MiRNA marker for sperm quality improvement after varicocele resection and application of miRNA marker

Abstract

The invention provides a miRNA marker for sperm quality improvement after varicocele resection and application of the miRNA marker. The invention provides application of miRNA in preparation of a chip, a detection reagent or a detection kit for sperm quality improvement judgment after varicocele resection. Wherein the miRNA comprises a miRNA of which the sequence is as shown in SEQ ID NO: 1, or a miRNA of which the sequence is complementary with the sequence as shown in SEQ ID NO: 1. The sperm quality improvement condition after varicocele resection can be effectively judged by detecting the miRNA in sperms.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and in particular, relates to miRNA markers for improving sperm quality after varicocele treatment and applications thereof. Background Art

[0002] Varicocele is a pathological enlargement of the Pampinus plexus (testicular veins) in the scrotal part. It is one of the most common causes of male infertility and can affect 15-20% of adult men, with up to 40% of men with primary infertility and up to 80% of men with secondary infertility having varicocele. Varicocele may cause damage to spermatozoa, leading to altered semen parameters and abnormal development and growth of the affected testicle. Surgical correction is considered a possible treatment option to reduce damage to sperm and improve male fertility.

[0003] After varicocelectomy, semen parameters such as concentration, survival rate and morphology are improved, and many cases of varicocele have achieved natural pregnancy. Many research efforts have focused on investigating the potential genetic factors that lead to male infertility, however, these studies can only elucidate 15% of the total cases. Epigenetic changes should also be considered as important determinants related to male reproductive capacity. Therefore, a lot of information is still needed to better explain the pathogenic mechanism of the disease. In order to achieve pathological improvement by regulating related substances.

[0004] An important area in epigenetics is small noncoding RNAs (sncRNAs), which have provided valuable insights into the complex origins of various diseases and deepened the understanding of varicocele. Sperm is rich in sncRNAs, among which microRNAs (miRNAs) are the most widely studied sncRNAs. miRNAs regulate various physiological and developmental processes, including cell differentiation, proliferation, and fertility.

[0005] Therefore, it is of great significance to this field to develop highly specific and sensitive miRNA markers for improved sperm quality after varicocele treatment to assist in determining the recovery of male fertility. Summary of the invention

[0006] The present invention provides a highly specific and sensitive miRNA marker for improving sperm quality after varicocele treatment.

[0007] In a first aspect of the present invention, there is provided a use of a miRNA in preparing a chip, a detection reagent or a detection kit for judging the improvement of sperm quality after varicocelectomy; Wherein, the miRNA includes: a miRNA whose sequence is shown in SEQ ID NO: 1, or a miRNA complementary to the sequence shown in SEQ ID NO: 1.

[0008] In another preferred embodiment, the miRNA further comprises a miRNA selected from the following group: (b1) a miRNA having a sequence as shown in SEQ ID NO: 2, a miRNA having a sequence as shown in SEQ ID NO: 3, or a combination thereof; or (b2) a miRNA complementary to the miRNA sequence described in (b1).

[0009] In another preferred embodiment, the miRNA further comprises a miRNA selected from the following group: (c1) a miRNA having a sequence as shown in SEQ ID NO: 4, a miRNA having a sequence as shown in SEQ ID NO: 5, a miRNA having a sequence as shown in SEQ ID NO: 6, a miRNA having a sequence as shown in SEQ ID NO: 7, a miRNA having a sequence as shown in SEQ ID NO: 8, a miRNA having a sequence as shown in SEQ ID NO: 9, a miRNA having a sequence as shown in SEQ ID NO: 10, or a combination thereof; or (c2) a miRNA complementary to the miRNA sequence described in (c1).

[0010] In another preferred embodiment, the miRNA is miRNA isolated from sperm.

[0011] In another preferred embodiment, the chip, detection reagent or detection kit is used to detect the expression level (or level) of the miRNA.

[0012] In another preferred example, when the miRNA is an upregulated marker (in Table A), when the level of the miRNA is significantly increased compared to before the operation, it indicates that the sperm quality of the subject to be tested is improved after varicocele surgery; when the miRNA is a downregulated marker (in Table A), when the miRNA is significantly decreased, it indicates that the sperm quality of the subject to be tested is improved after varicocele surgery; otherwise, there is no improvement.

[0013] In a second aspect of the present invention, a miRNA chip is provided, the miRNA chip comprising: a solid support; and Oligonucleotide probes are sequentially fixed on the solid phase carrier, and the oligonucleotide probes specifically bind to miRNA; Wherein, the miRNA includes: a miRNA whose sequence is shown in SEQ ID NO: 1, or a miRNA complementary to the sequence shown in SEQ ID NO: 1.

[0014] In another preferred embodiment, the miRNA further comprises a miRNA selected from the following group: (b1) a miRNA having a sequence as shown in SEQ ID NO: 2, a miRNA having a sequence as shown in SEQ ID NO: 3, or a combination thereof; or (b2) a miRNA complementary to the miRNA sequence described in (b1).

[0015] In another preferred embodiment, the miRNA further comprises a miRNA selected from the following group: (c1) a miRNA having a sequence as shown in SEQ ID NO: 4, a miRNA having a sequence as shown in SEQ ID NO: 5, a miRNA having a sequence as shown in SEQ ID NO: 6, a miRNA having a sequence as shown in SEQ ID NO: 7, a miRNA having a sequence as shown in SEQ ID NO: 8, a miRNA having a sequence as shown in SEQ ID NO: 9, a miRNA having a sequence as shown in SEQ ID NO: 10, or a combination thereof; or (c2) a miRNA complementary to the miRNA sequence described in (c1).

[0016] In another preferred embodiment, the oligonucleotide probe contains: complementary binding region; and / or A linker region connected to a solid support.

[0017] In another preferred embodiment, the miRNA chip is used to detect the level of the miRNA.

[0018] In another preferred embodiment, the miRNA chip is used to judge the improvement of sperm quality after varicocelectomy.

[0019] In another preferred embodiment, the miRNA is miRNA isolated from human sperm.

[0020] In the third aspect of the present invention, there is provided a use of the miRNA chip as described in the second aspect of the present invention for preparing a detection kit for judging the improvement of sperm quality after varicocelectomy.

[0021] In a fourth aspect of the present invention, a detection kit is provided, wherein the detection kit contains a detection reagent for detecting miRNA; Wherein, the miRNA includes: a miRNA having a sequence as shown in SEQ ID NO: 1, or a miRNA complementary to the sequence shown in SEQ ID NO: 1; or The detection kit is equipped with the miRNA chip described in the second aspect of the present invention.

[0022] In another preferred embodiment, the miRNA further comprises a miRNA selected from the following group: (b1) a miRNA having a sequence as shown in SEQ ID NO: 2, a miRNA having a sequence as shown in SEQ ID NO: 3, or a combination thereof; or (b2) a miRNA complementary to the miRNA sequence described in (b1).

[0023] In another preferred embodiment, the miRNA further comprises a miRNA selected from the following group: (c1) a miRNA having a sequence as shown in SEQ ID NO: 4, a miRNA having a sequence as shown in SEQ ID NO: 5, a miRNA having a sequence as shown in SEQ ID NO: 6, a miRNA having a sequence as shown in SEQ ID NO: 7, a miRNA having a sequence as shown in SEQ ID NO: 8, a miRNA having a sequence as shown in SEQ ID NO: 9, a miRNA having a sequence as shown in SEQ ID NO: 10, or a combination thereof; or (c2) a miRNA complementary to the miRNA sequence described in (c1).

[0024] In another preferred embodiment, the kit further comprises an instruction manual.

[0025] In another preferred embodiment, the instructions state that the kit is used to determine (a) whether sperm quality is improved after varicocelectomy; and / or (b) whether the fertility of the subject to be tested is improved.

[0026] In another preferred embodiment, the kit or detection reagent is used to detect the level of the miRNA.

[0027] In another preferred embodiment, the subject to be tested is a male.

[0028] In another preferred embodiment, the subject to be tested is a subject who has undergone varicocelectomy.

[0029] In another preferred embodiment, the miRNA is isolated from human sperm miRNA.

[0030] In a fifth aspect of the present invention, there is provided a miRNA isolated from sperm for use in judging the improvement of sperm quality after varicocelectomy; Wherein, the miRNA is selected from the following group: (A) a miRNA having a sequence as shown in SEQ ID NO: 1, or a miRNA complementary to the sequence shown in SEQ ID NO: 1; (B) miRNA selected from the group consisting of: (b1) a miRNA having a sequence as shown in SEQ ID NO: 2, a miRNA having a sequence as shown in SEQ ID NO: 3, or a combination thereof; or (b2) a miRNA complementary to the miRNA sequence described in (b1); and (C) a miRNA selected from the group consisting of: (c1) a miRNA having a sequence as shown in SEQ ID NO: 4, a miRNA having a sequence as shown in SEQ ID NO: 5, a miRNA having a sequence as shown in SEQ ID NO: 6, a miRNA having a sequence as shown in SEQ ID NO: 7, a miRNA having a sequence as shown in SEQ ID NO: 8, a miRNA having a sequence as shown in SEQ ID NO: 9, a miRNA having a sequence as shown in SEQ ID NO: 10, or a combination thereof; or (c2) a miRNA complementary to the miRNA sequence described in (c1).

[0031] In the sixth aspect of the present invention, an isolated or artificially constructed precursor miRNA is provided, wherein the precursor miRNA can be cleaved and expressed in human cells to become the miRNA described in the fifth aspect of the present invention.

[0032] In the seventh aspect of the present invention, an isolated polynucleotide is provided, wherein the polynucleotide can be transcribed into a precursor miRNA by a human cell, and the precursor miRNA can be cleaved and expressed into the miRNA described in the fifth aspect of the present invention in a human cell.

[0033] In another preferred embodiment, the polynucleotide has a structure shown in Formula I: Seq 正向 -X-Seq 反向 Formula I In Formula I, Seq 正向 A nucleotide sequence that can be expressed as the miRNA in human cells; Seq 反向 is a nucleotide sequence that is substantially complementary or completely complementary to Seq in the forward direction; X is located in Seq 正向 and Seq 反向and the spacer sequence is 正向 and Seq 反向 Not complementary; After the structure shown in Formula I is transferred into human cells, a secondary structure shown in Formula II is formed: Formula II, In Formula II, Seq 正向 , Seq 反向 and X is defined as above, || means in Seq 正向 and Seq 反向 The base pairing relationship formed between them.

[0034] In the eighth aspect of the present invention, a vector is provided, wherein the vector contains the miRNA described in the fifth aspect of the present invention or the polynucleotide described in the seventh aspect of the present invention.

[0035] In a ninth aspect of the present invention, a method for judging the improvement of sperm quality after varicocelectomy is provided, comprising the steps of: (a) detecting the expression level C1 of miRNA in a sample of a test subject; (b) comparing the expression level of the miRNA obtained in step (a) with a control reference value C0; Wherein, the miRNA includes: a miRNA whose sequence is shown in SEQ ID NO: 1, or a miRNA complementary to the sequence shown in SEQ ID NO: 1; If the test result of the subject meets the following conditions, it indicates that (a) the sperm quality of the subject is improved after varicocelectomy; and / or (b) the fertility of the subject is improved; (1) When a certain miRNA is an up-regulated miRNA in Table A in the test subject, and the expression level of the miRNA is significantly higher than the control reference value C0; or (2) When a certain miRNA is a down-regulated miRNA in Table A in the test subject, and the expression level of the miRNA is significantly lower than the control reference value C0.

[0036] In another preferred embodiment, the control reference value C0 is the miRNA expression level in patients with varicocele.

[0037] In another preferred embodiment, the table A is as follows: Table A

[0038] In another preferred embodiment, the up-regulation or down-regulation in Table A refers to the up-regulation or down-regulation after varicocelectomy relative to the up-regulation or down-regulation before varicocelectomy.

[0039] In another preferred embodiment, the up-regulation refers to that the expression level X1 of the miRNA after varicocelectomy is significantly higher than the expression level X0 of the miRNA before varicocelectomy.

[0040] In another preferred embodiment, the significantly higher refers to X1 / X0≥1.5, preferably ≥3, more preferably ≥3.

[0041] In another preferred embodiment, the down-regulation refers to that the expression level X1 of the miRNA after varicocelectomy is significantly lower than the expression level X0 of the miRNA before varicocelectomy.

[0042] In another preferred embodiment, the significantly lower than refers to X0 / X1≥1.5, preferably ≥3, more preferably ≥3.

[0043] In the tenth aspect of the present invention, a miRNA set for judging the improvement of sperm quality after varicocele surgery is provided, the set comprising: A miRNA having a sequence as shown in SEQ ID NO: 1, or a miRNA complementary to the sequence shown in SEQ ID NO: 1; and miRNA selected from the group consisting of: (b1) a miRNA having a sequence as shown in SEQ ID NO: 2, a miRNA having a sequence as shown in SEQ ID NO: 3, or a combination thereof; or (b2) a miRNA complementary to the miRNA sequence described in (b1).

[0044] In another preferred embodiment, the set further comprises: miRNA selected from the following group: (c1) a miRNA having a sequence as shown in SEQ ID NO: 4, a miRNA having a sequence as shown in SEQ ID NO: 5, a miRNA having a sequence as shown in SEQ ID NO: 6, a miRNA having a sequence as shown in SEQ ID NO: 7, a miRNA having a sequence as shown in SEQ ID NO: 8, a miRNA having a sequence as shown in SEQ ID NO: 9, a miRNA having a sequence as shown in SEQ ID NO: 10, or a combination thereof; or (c2) a miRNA complementary to the miRNA sequence described in (c1).

[0045] In an eleventh aspect of the present invention, there is provided a device for evaluating sperm quality improvement after varicocelectomy, the device comprising: (a) an input module, wherein the input module is configured to input the miRNA level of a subject to be tested; Wherein, the miRNA includes: a miRNA whose sequence is shown in SEQ ID NO: 1, or a miRNA complementary to the sequence shown in SEQ ID NO: 1; (b) an evaluation module, wherein the evaluation module is configured to compare the input miRNA level with a control reference value, and when the miRNA is an up-regulated miRNA in Table A and the miRNA level is significantly higher than the control reference value, it indicates that the sperm quality of the subject to be tested is improved; or when the miRNA is a down-regulated miRNA in Table A and the miRNA level is significantly lower than the control reference value, it indicates that the sperm quality of the subject to be tested is improved; otherwise, it indicates that the sperm quality of the subject to be tested is not improved; and (c) an output module, wherein the output module is configured to output the evaluation result.

[0046] In another preferred example, the control reference value is the miRNA expression level in patients with varicocele.

[0047] In another preferred embodiment, the miRNA is derived from sperm miRNA of the subject to be tested.

[0048] In another preferred embodiment, the device further comprises (d) a storage module, wherein the storage module is configured to store the following data: miRNA level, control reference value of miRNA, and evaluation result (ie, whether sperm quality is improved).

[0049] In another preferred example, the device further comprises (e) a control module, wherein the control module is configured to control the operation of each module.

[0050] In another preferred embodiment, the device further comprises (a0) a detection module, wherein the detection module is configured to detect the sperm miRNA level of the subject to be tested.

[0051] In another preferred embodiment, the miRNA further comprises a miRNA selected from the following group: (b1) a miRNA having a sequence as shown in SEQ ID NO: 2, a miRNA having a sequence as shown in SEQ ID NO: 3, or a combination thereof; or (b2) a miRNA complementary to the miRNA sequence described in (b1).

[0052] In another preferred embodiment, the miRNA further comprises a miRNA selected from the following group: (c1) a miRNA having a sequence as shown in SEQ ID NO: 4, a miRNA having a sequence as shown in SEQ ID NO: 5, a miRNA having a sequence as shown in SEQ ID NO: 6, a miRNA having a sequence as shown in SEQ ID NO: 7, a miRNA having a sequence as shown in SEQ ID NO: 8, a miRNA having a sequence as shown in SEQ ID NO: 9, a miRNA having a sequence as shown in SEQ ID NO: 10, or a combination thereof; or (c2) a miRNA complementary to the miRNA sequence described in (c1).

[0053] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 Shows the improvement of sperm quality after varicocelectomy in patients with varicocele. a: Changes (log2) in sperm quality indices in 63 patients with varicocele. The indices after varicocelectomy were compared with those before surgery. There were three main indices: sperm density (Con, left, orange), sperm survival (Via, center, yellow), and normal sperm morphology (NM, right, blue); b: Sperm quality indices improved after varicocelectomy. A change factor of up to 1.5 indicates improvement, a change factor of -1.5 indicates deterioration, and a change factor between 1.5 and -1.5 indicates no effect. Of the 65 indices, 43 patients improved (Con 22, Via 19, and NM 24); c: Differences in sperm quality indices between the BE (before varicocelectomy) and AF (after varicocelectomy) groups in the 43 patients who improved. Improvement was defined as improvement in any of the three sperm quality indices. Con group P<0.05, Via group P<0.05, NM group P<0.0001.

[0055] Figure 2 The expression profiles of sncRNAs in spermatozoa of 63 patients are shown. a: Composition of sncRNA categories in spermatozoa of 63 patients before and after varicocelectomy; b: The percentages of different sncRNAs changed after varicocelectomy; miRNA changes were significant, P < 0.05; c: Venn diagram showing the number of shared or uniquely expressed miRNAs before (232) and after varicocelectomy (189).

[0056] Figure 3Differentially expressed miRNAs among patients are shown. a: Heat map of the top 50 miRNAs expressed in 63 patients. Color saturation from light to dark indicates miRNA expression levels from low (blue) to high (red). According to the improvement of sperm quality, the 63 patients were subdivided into FC: 43 of 63 patients with improved sperm quality (fold change up to 1.5 in any of the three sperm quality indicators); UNFC: 20 of 63 patients with no improvement in sperm quality; b: Differentially expressed miRNAs in 43 patients with improved sperm quality after varicocelectomy; threshold was abs fold change ≥ 2, P value < 0.05; c: GO term enrichment analysis of miRNA target genes. BP: biological process, CC: cellular component, MF: molecular function; d: KEGG pathway enrichment analysis of miRNA target genes. Count: indicates the number of genes enriched in the pathway.

[0057] Figure 4 It shows that abnormally expressed miRNA affects early embryonic development. a: The results of early embryonic development after injection of synthetic miRNA in fertilized eggs. Normal control: no injection, negative control: injection of random synthetic fragments; b: The development of early embryos from fertilized eggs to blastocysts after injection. Day 1 is the zygote stage, Day 2 is the 2-cell stage, Day 3 is the 4 to 8-cell stage, Day 4 is the morula (or mulberry) embryo stage, and Day 5 is the blastocyst stage. Bar: 100 μm.

[0058] Figure 5 The heat map of the top 50 tsRNAs expressed in 63 patients is shown; AF-FC: sperm quality improved after surgery, AF-UNFC: sperm quality did not improve after surgery, BE-FC: sperm quality improved before surgery, BE-UNFC: sperm quality did not improve before surgery.

[0059] Figure 6 Heatmap of the top 50 expressed rsRNAs in 63 patients is shown; AF-FC: sperm quality improved after surgery, AF-UNFC: sperm quality did not improve after surgery, BE-FC: sperm quality improved before surgery, BE-UNFC: sperm quality did not improve before surgery.

[0060] Figure 7 The heat map of the top 50 piRNAs expressed in 63 patients is shown; AF-FC: sperm quality improved after surgery, AF-UNFC: sperm quality did not improve after surgery, BE-FC: sperm quality improved before surgery, BE-UNFC: sperm quality did not improve before surgery.

[0061] Figure 8Volcano plots of differentially expressed miRNAs in 43 patients with improved sperm quality after varicocelectomy are shown; threshold was fold change ≥±2, P < 0.05. DETAILED DESCRIPTION

[0062] After extensive and in-depth research and a large number of screenings, the inventors unexpectedly developed a simple, effective and accurate method and device for judging the improvement of sperm quality after varicocelectomy based on sperm miRNA. Specifically, the inventors found miRNAs with significant difference values ​​by comparing the sncRNAs of varicocele patients before and after surgery, and compared the expression levels and conditional screening of the miRNAs of subjects whose sperm quality was significantly improved before and after surgery, and obtained 10 miRNAs with significant differences (hsa-miR-132-3p, hsa-miR-34c-5p, hsa-miR-202-3p, hsa-miR-874-3p, hsa-miR-486-5p, hsa-miR-486-3p, hsa-miR-499a-5p, hsa-miR-499b-3p, hsa-miR-92b-3p and hsa-miR-520a-3p). It was also verified that its abnormal expression would have a negative impact on early embryonic development related to sperm quality. On this basis, the present invention was completed.

[0063] the term In order to more easily understand the present disclosure, some terms are first defined. As used in this application, unless otherwise expressly provided herein, each of the following terms should have the meaning given below. Other definitions are set forth throughout the application.

[0064] As used herein, the term "comprising" or "including (comprising)" may be open, semi-closed and closed. In other words, the term also includes "consisting essentially of" or "consisting of".

[0065] As used herein, unless otherwise indicated, any concentration range, percentage range, ratio range or integer range should be understood to include any integer value within the range and fractional values ​​thereof (e.g., one tenth and one hundredth of an integer) where appropriate.

[0066] As used herein, the term "and / or" refers to and encompasses any and all possible combinations of one or more of the associated listed items.

[0067] As used herein, the term "sample" or "specimen" refers to material specifically associated with a subject from which specific information about the subject can be determined, calculated, or inferred. A sample may consist in whole or in part of biological material from a subject.

[0068] As used herein, the term "expression" includes the production of mRNA or miRNA from a gene or gene portion, and includes the production of proteins encoded by RNA or gene portions, and also includes the appearance of detection substances associated with expression. For example, cDNA, the binding of binding ligands (such as antibodies) to genes or other oligonucleotides, proteins or protein fragments, and the chromogenic portion of the binding ligands are all included within the scope of the term "expression". Therefore, the increase in half-point density on immunoblots such as Western blots is also within the scope of the term "expression" based on biological molecules.

[0069] As used herein, the term "reference value" or "control reference value" refers to a value that is statistically correlated with a particular result when compared to the results of an analysis. In a preferred embodiment, the reference value is the miRNA expression level of patients with varicocele who have not undergone surgery and is determined by statistical analysis. Some such studies are shown in the Examples section of this article. However, studies from the literature and user experience of the methods disclosed herein can also be used to produce or adjust reference values. Reference values ​​can also be determined by considering circumstances and results that are particularly relevant to the patient's ethnic group, medical history, genetics, age and other factors.

[0070] Varicocele Varicocele refers to the abnormal expansion and tortuosity of the venous plexus (mainly the internal spermatic vein) in the spermatic cord due to poor blood return or venous valve insufficiency. Varicocele is associated with reduced male fertility, and the decline in sperm quality caused by varicocele is a common cause of male infertility. Many studies have reported that semen parameters have improved after varicocelectomy.

[0071] The miRNA markers for improving sperm quality after varicocelectomy of the present invention miRNAs are approximately 19-23 nucleotides in length and regulate gene expression by inhibiting translation and reducing the stability of their target mRNAs. miRNAs regulate various physiological and developmental processes, including cell differentiation, proliferation, and fertility. Studies have shown that the expression of miRNAs such as miR-210-3p, miR-21, miR-34a, miR-122a, miR-181a, miR-34c, and miR-192a was evaluated in semen samples obtained from patients with varicocele and compared with samples obtained from healthy men with normal semen parameters. The existing study found that the expression of hsa-miR-145 was reduced in sperm of infertile men with varicocele. Compared with men with sperm, the expression level of hsa-miR-192a was higher in seminal plasma and testicular tissue of men without sperm after surgery. miRNAs play an important role not only in sperm fertility, but also in the development of fertilized eggs. Previous studies have found that different miRNAs expressed in human sperm (hsa-miR-101-3p, hsa-miR-132-3p, hsa-miR-191-5p, hsa-miR-29a-3p and hsa-miR-520a-3p) are associated with embryo quality after in vitro fertilization. This suggests that miRNAs can be used as specific biomarkers for restoring human male fertility after varicocelectomy.

[0072] The present invention shows that varicocele treatment for patients with abnormal semen parameters can help some of them improve their semen parameters. The present invention analyzes the sncRNA expression profile of sperm in men after varicocelectomy. It was found that the miRNA expression level of sperm changed significantly, among which 10 miRNAs (hsa-miR-132-3p, hsa-miR-202-3p, hsa-miR-34c-3p, hsa-miR-486-3p, hsa-miR-48-65p, hsa-miR-499a-5p, hsa-miR-499b-3p, HSSa-miR-520a-3p, hsa-miR-874-3p and hsa-miR-92b-3p) were differentially expressed in sperm. Their functional genes indicate that the sperm epigenome is related to the transcriptional regulation of RNA polymerase II and signaling pathways such as the PI3K-Akt pathway. Furthermore, it was observed that altered sperm miRNAs (miR-132-3p, miR-34c-3p, and miR-520a-3p) may affect early embryo quality, suggesting that these miRNAs may play a role in the early stages of embryonic development. The above miRNAs can serve as non-invasive markers of sperm quality, and identifying biomarkers of defective sperm may help in appropriate treatment through varicocelectomy for better outcomes.

[0073] The present invention screened 63 pairs of varicocele patients before and after varicocele surgery and found that semen parameters, including sperm density, survival rate and morphology, were significantly improved. Through high-throughput deep sequencing of sperm sncRNA, it was found that the expression levels of 10 miRNAs (3 up-regulated, hsa-miR-486-3p, hsa-miR-486-5p and hsa-miR-874-3p; 7 down-regulated, hsa-miR-132-3p, hsa-miR-202-3p, hsa-miR-34c-5p, hsa-miR-499a-5p, hsa-miR-499b-3p, hsa-miR-520a-5p and hsa-miR-92b-3p) changed dynamically, and the abnormal expression of these miRNAs was related to early embryonic development. The up-regulation refers to that the expression level of the miRNA is significantly increased after varicocele surgery compared with that before varicocele surgery (fold change ≥1.5, preferably ≥2, more preferably ≥3); the down-regulation refers to that the expression level of the miRNA is significantly downregulated after varicocele surgery compared with that before varicocele surgery (fold change ≤2 / 3, preferably ≤1 / 2, more preferably ≤1 / 3).

[0074] Specifically, the present invention provides miRNA markers that can be used to determine whether sperm quality is improved after varicocele surgery, specifically including: hsa-miR-486-3p, hsa-miR-486-5p and hsa-miR-874-3p; 7 down-regulated, hsa-miR-132-3p, hsa-miR-202-3p, hsa-miR-34c-5p, hsa-miR-499a-5p, hsa-miR-499b-3p, hsa-miR-520a-5p and hsa-miR-92b-3p. Whether sperm quality is improved or male fertility is improved can be determined by comparing the multiple changes of the above one or more miRNA levels before and after varicocele surgery of the subject to be tested.

[0075] The main advantages of the present invention include: (a) The miRNA of the present invention can be used to distinguish whether the sperm quality is improved after varicocele surgery or whether the fertility of the subject is improved.

[0076] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0077] Materials and methods Study population Before the start of this study, institutional review board approval was obtained, and informed consent was obtained from each participant. Male patients with varicocele who required surgery at the Shanghai Family Planning Institute Hospital between August 2022 and February 2024 were included in this study. Exclusion criteria for patients were: any type of genetic disease, or a diagnosis of cancer. All patients were followed up for at least R1 month.

[0078] Sample collection The samples were obtained after 3 days of abstinence from sex, liquefied at 37°C for 30 min, and then processed immediately. All semen samples were analyzed for key semen parameters such as volume, motility, viability, sperm density, and morphology according to the World Health Organization guidelines (5th edition).

[0079] Isolation of total RNA from sperm samples Isolation of total RNA was performed as described previously. Briefly, total RNA was purified from supernatant sperm and pelleted sperm were mixed in 700 mL Qiazol lysis reagent (Qiagen) with DTT (80 mmol / L) (Sigma) for 2 h to ensure complete sperm lysis. Thereafter, the procedure was completed according to the manufacturer's recommendations (Qiagen miRNeasy Mini Kit). The quantity and quality of RNA were assessed using a Nanodrop 2000 spectrophotometer (Thermo Scientific).

[0080] Construction and analysis of small RNA libraries Small RNA libraries were constructed as described previously. In brief, all libraries were sent to Illumina HiSeq X Ten platform or NovaSeq 6000 for sequencing. Adapter sequences were removed from the 3' end of sequencing reads using fastp (version 0.20.1). After quality filtering, sequencing reads were mapped to the genome by bowtie (hg38, bowtie version 1.2.1.1). Bowtie aligned these read sequences to known miRNA, tRNA, rRNA, snoRNA, and snRNA sequences without allowing any mismatches, and reads that aligned to pre-miRNAs were identified as miRNAs. The remaining reads of the specified length were extracted and used to identify piRNAs according to the previously described method.

[0081] Target gene prediction and enrichment analysis The miRWalk database (http: / / mirwalk.umm.uni-heidelberg.de / ) was used to predict miRNA target genes. Gene Ontology (GO) term and KEGG pathway enrichment analysis were performed using the DAVID online tool to explore the biological functions of target genes.

[0082] Mouse fertilized egg collection and embryo culture in vitro Mouse fertilized eggs were collected as described previously. Briefly, female ICR mice (6–8 weeks old) were purchased from Beijing Vita River Laboratory Animal Technology Co., Ltd. To obtain fertilized eggs, female mice (8–10 weeks old) were intraperitoneally injected with 10 IU PMSG. After 48 h, mice were injected with 10 IU hCG. After another 13 h, fertilized eggs / cumulus masses were surgically separated from the oviduct. Fertilized eggs were cultured in drops of K-modified simplex optimized medium (Nanjing Aibei Biotechnology Co., Ltd.) at 37 °C under oil with 5% CO2, and embryonic development was monitored regularly. All mouse experiments were reviewed and approved by the Shanghai Institute of Biomedical and Pharmaceutical Technology.

[0083] Microinjection of miRNAs Mouse fertilized eggs were microinjected with 3 to 5 pl of miRNA using an inverted microscope (Eppendorf) with a micromanipulator. The working concentration of miRNA was 100 nM. The two pronuclei and polar bodies of the fertilized eggs were examined to assess fertilization. 2-cell examination was performed 24 hours after injection (day 2), 4-8-cell observation was performed 48 hours after injection (day 3), morula-stage cells were observed at 72 hours (day 3), and blastocysts were examined at day 4.

[0084] The sequences of miRNAs are: miR-34c-5p, 5'-3': AGGCAGUGUAGUUAGCUGAUUGC (SEQ ID NO: 2); miR-132-3p, 5'-3': UAACAGUCUACAGCCAUGGUCG(SEQ ID NO: 1); miR-520a-3p, 5'-3': AAAGUGCUUCCCUUUGGACUGU (SEQ ID NO: 10).

[0085] Statistical analysis In this study, the present invention analyzed the differences in miRNA expression between the test groups using the freely available R software. DESeq2 uses read count data for differential sncRNAs expression analysis.

[0086] Example 1 1.1 Research subjects This study included 63 male patients with varicocele who underwent varicocelectomy for infertility. The mean age of the men was 31.76 ± 3.88 years, and the mean BMI was 23.98 ± 3.29. The baseline sperm quality index of semen parameters, including sperm density, survival rate, and normal sperm morphology, are shown in Table 1. Referring to the World Health Organization guidelines (5th edition), all sperm characteristics were normal except for normal sperm morphology (2.45 ± 2.01%) which was below the standard (4%).

[0087] Table 1 Clinical characteristics of patients (n=63)

[0088] 1.2 Evaluating the effect of varicocelectomy on improving sperm quality To investigate the effect of varicocelectomy on improving sperm quality, the differences in all sperm quality indices were evaluated in 63 patients between two groups (Before vs After). Notably, the fold change (log2) of most sperm quality indices was greater than zero ( Figure 1 a in Figure ), which means that these parameters were improved, especially sperm density (Con) and normal sperm morphology (NM).

[0089] Subsequently, the present invention analyzed the fold changes of these indicators, set the threshold as a fold change of 1.5, and defined a fold change greater than 1.5 as an improvement. The results showed that among the 63 patients, 22 patients had improved sperm density (Con), 19 patients had improved sperm survival rate (Via), and 24 patients had improved normal sperm morphology rate (NM). Figure 1 b). According to the improvement of sperm quality indicators, 43 out of 63 patients had improved sperm quality after varicocelectomy. In addition, among the 43 improved patients, there were significant differences in sperm density (P<0.05) and sperm survival rate (P<0.05) between the Before group and the After group, especially the normal sperm morphology rate (P<0.0001) was significantly improved ( Figure 1 c) in.

[0090] 1.3 Sperm sncRNA composition Next, we explored the epigenetic effects of varicocelectomy on the improvement of sperm quality. Small RNA libraries of sperm from 63 patients before and after surgery were sequenced. Approximately 14,418,149 and 8,641,890 raw reads were generated in the Before and After groups, respectively. In addition, 12,720,369 and 7,480,375 useful reads (15-30 nt) were obtained from the small RNA libraries, respectively. A total of 8,920,511 and 5,522,580 unique reads were aligned to the reference genome (Table 2), which was greater than 70%, indicating that the reliability and quality of the reads were sufficient for further analysis.

[0091] Table 2 Overview of sperm small RNA sequencing in 63 cases before and after varicocelectomy

[0092] The expression of identified sncRNAs is shown in Figure 2 As shown. Figure 2 As shown in a, the sperm sncRNA contents of the two groups changed slightly, but their main components were consistent ( Figure 2a in the figure). There are four main types of sncRNAs in sperm, namely tsRNA (73.99%), rsRNA (10.86%), piRNA (5.51%) and miRNA (4.11%) (Table 3). The sncRNA content is consistent with the presence of sncRNAs in normal sperm. Except for miRNA, the expression ratios of sncRNAs in the two groups were similar. The expression ratio of miRNA was significantly reduced after surgical treatment, from 4.11% to 3.15% (P value = 0.03469, Figure 2 Annotation analysis showed that 189 of the 232 known miRNAs were co-expressed in both groups, and 43 miRNAs were uniquely expressed in the Before group but not in the After varicocelectomy group ( Figure 2 c) in.

[0093] Table 3 Ratio of sncRNAs before and after varicocelectomy

[0094] 1.4 Comparison of sperm miRNA expression profiles To further analyze the effect of varicocelectomy on sperm quality, the expression of miRNA was analyzed. According to the fold change of sperm quality (fold change ≥ 1.5), each group (before surgery (BE), after surgery (AF)) was divided into two subgroups, namely, unchanged fold change (fold change ≤ 1.5, UNFC) and fold change (fold change ≥ 1.5, FC).

[0095] The expression of the top 50 miRNAs is as follows Figure 3 As shown in a in Figure 2. Analysis showed that among the four subgroups, the AF-FC group had the lowest miRNA expression level, indicating that the expression level of miRNA decreased after surgery, and this part of the changed miRNA may be related to sperm quality. However, there was no similar difference in the other three sncRNAs ( Figure 5-7 ).

[0096] Next, the present invention used fold change ≥ ± 2 and P value < 0.05 as screening criteria to analyze the differential expression of miRNAs between the BE-FC group and the AF-FC group. The analysis of differentially expressed miRNAs showed that in the AF-FC group, 10 miRNAs were significantly changed ( Figure 3 b in Figure 8, Table 4 ), of which three miRNAs were upregulated (hsa-miR-486-3p, hsa-miR-486-5p, and hsa-miR-874-3p), while seven miRNAs were downregulated (hsa-miR-132-3p, hsa-miR-202-3p, hsa-miR-134c-5p, hsa-miR-499a-5p, hsa-miR-499b-3p, hsa-miR-520a-3p, and hsa-miR-92b-3p).

[0097] Table 4

[0098] 1.5 Functional annotation of predicted miRNA targets For the above 10 differentially expressed miRNAs, the miRWalk online database predicted 97 target genes. GO term enrichment analysis of predicted target genes was performed in three major GO categories: biological process, cellular component, and molecular function (BP, CC, and MF, Figure 3 c) in.

[0099] In the biological process category, regulation of transcription by RNA polymerase II was the most important and common term, followed by positive regulation of transcription by RNA polymerase II, apoptotic process, and other essential cellular processes. Meanwhile, in the cellular component category, most transcripts were associated with the cytoplasm, followed by nucleus, cytoplasm, and nucleoplasm. In the molecular function category, protein binding was the most important enriched term identified, followed by metal ion binding, ATP binding, and sequence-specific DNA binding in the cis-regulatory region of RNA polymerase II. The detailed results of the KEGG pathway enrichment analysis are shown in Figure 2. Figure 3 Further analysis showed that these genes were enriched in several important pathways related to PI3K-Akt signaling, cell cycle and cell senescence.

[0100] Example 2 Verification of miRNAs on sperm quality To investigate the potential role of sperm miRNAs in improving sperm quality from the perspective of early embryonic development, three highly and significantly expressed miRNAs, namely miR-132-3p, miR-520a-3p, and miR-34c-5p, were selected from the 10 differentially expressed miRNAs for validation.

[0101] The present invention synthesized three miRNA mimics and injected them (100 nM) into normal mouse fertilized eggs, injected random sequences as negative controls (Random), and a normal control (Control) without injection.

[0102] After injection, the fertilized eggs were cultured normally in vitro. With the early stage of embryonic development, compared with the normal control group and the negative control group, the miRNA injection had an adverse effect on embryonic development (Table 5), especially miR-34c-5p. The effect of abnormal expression of miRNA began as early as the 2-cell stage, with 34.36% developing to 2-cell (100% in the normal control group and 100% in the negative control group), and only 9.34% of the fertilized eggs developed into blastocysts, while the control group was 94.71% and the negative control group was 92.20% ( Figure 4 a) in the figure.

[0103] Table 5 Results of early embryonic development after injection of synthetic miRNA into fertilized eggs

[0104] For the other two miRNAs (miR-132-3p and miR-520a-3p), the most significant effects were observed in blastocysts (89.81% and 73.08%). Microinjection affected the development of early embryos, and the embryo quality of the miR-34c-5p group was significantly reduced. The quality of early embryos in the miR-132-3p and miR-520-5p groups also decreased, but the embryo quality of the randomized group and the control group was not affected ( Figure 4 b). The changes in the expression levels of the three miRNAs were consistent with the sequencing results ( Figure 3 ).

[0105] These results suggest that aberrantly expressed miRNAs are detrimental to early embryonic development.

[0106] discuss Varicocele is associated with reduced male fertility, and surgical treatment is by far the most common and effective clinical option based on clinical presentation. Many studies have reported improvements in semen parameters after varicocelectomy. Unlike most previous studies that compared healthy groups with patients with varicocele, in this study, we recruited the same group of patients and compared the changes in sperm quality before and after varicocele surgery. We observed that varicocele affects semen parameters, and semen parameters improved 1 month after varicocele surgery, but not all indicators improved in every man. It is noteworthy that about 68% (43 / 63) of men with varicocele who underwent varicocelectomy had at least one improvement in indicators such as sperm density, survival rate, and normal sperm morphology. This suggests that varicocelectomy helps improve semen parameters in patients with varicocele.

[0107] Abundant sncRNAs, including miRNAs, can be detected in sperm. Sperm fertilization largely depends on post-transcriptional regulatory processes. MiRNAs have emerged as key regulators of these processes. Therefore, changes in miRNA expression may contribute to male infertility. miRNAs are abundant in sperm and are expected to advance the diagnosis of male reproductive system diseases. This study aimed to analyze the miRNA expression profile in spermatozoa of patients after varicocelectomy and investigate potential molecular biomarkers of sperm quality. Differential expression analysis showed that a total of 10 miRNAs (3 upregulated and 7 downregulated) were differentially expressed in the AF-FC group compared with the BE-FC group, which was associated with improved sperm quality indicators. Some of them have been previously reported to be associated with spermatogenesis and male infertility, such as miR-202 and miR-34c.

[0108] The expression levels of hsa-miR-21, hsa-miR-34a, and hsa-miR-122a were significantly reduced in spermatozoa of patients with varicocele compared to fertile groups without varicocele. Similarly, the mean levels of hsa-miR-122, hsa-miR-181a, and hsa-miR-34c were lower in the semen of infertile men with varicocele compared to fertile men with or without varicocele. In another study, the expression of hsa-miR-34c-5p was downregulated in men with hypoasthenozoospermia. The expression of miR-132-5p, miR-202-3p, miR-34c-5p, and miR-520a-3p were altered in the seminal plasma of patients with spermatogenic arrest compared to normal fertile controls. The expression of miR-202-3p, miR-34c and miR-520a-5p in azoospermia samples was significantly lower than that in normozoospermia samples. In the present study, hsa-miR-202-3p and hsa-miR-34c-5p were significantly decreased and semen parameters were improved in patients after varicocelectomy compared with those before surgical treatment.

[0109] In the study of the present invention, 97 genes were predicted to be targets of 10 differentially expressed miRNAs. Further functional analysis of the target genes showed that they were involved in biological processes such as RNA / DNA transcription, gene expression regulation, and cell fate determination. In addition, it was found that they were mainly related to pathways such as the PI3K-Akt signaling pathway. Determined pathways are often mentioned in reports on semen motility. It is reported that inhibiting the expression of PI3K in semen can enhance sperm motility. In the study of the present invention, PI3K-Akt is a signaling pathway with a large number of enriched genes. The results of the present invention show that target genes such as PHLPP2, BCL2L11, CDK6, ITGAV, SGK3, GNB5, and PIK3R play a role downstream of PI3K-Akt signaling.

[0110] Maternal miRNAs appear to be required for early embryonic development. At the same time, paternal miRNAs may also play an important role in early embryonic development. More and more studies have found that sperm can deliver a unique set of RNAs to oocytes after fertilization. These sperm RNAs are involved in many processes, including genome recognition, early embryonic development, and epigenetic inheritance. The most abundant miRNA in human sperm is miR-34c, which plays a contradictory role in preimplantation embryonic development. Existing studies provide evidence that sperm-carried miR-34c is essential for the first cleavage division of mouse fertilized eggs. However, another study showed that its presence in sperm is essential for mouse fertilization and embryonic development. Previous studies of the present invention have shown that miRNAs in sperm are related to embryo quality after in vitro fertilization. Here, the present invention uses early cleavage rates to evaluate the effects of miR-34c-5p, miR-132-3p, and miR-520a-5p on early embryonic development. The present invention found that there is a correlation between abnormal expression of miRNA and early cleavage rate. Starting from the 2-cell stage, the lowest high-quality embryo rate was observed in the miR-34c group, and the miR-132-3p and miR-520a-5p groups also showed lower rates, especially in blastocysts, indicating that abnormally expressed miRNAs may affect early embryonic development related to sperm quality.

[0111] The sequence information of the present invention is shown in Table 6 below.

[0112] Table 6

[0113] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A use of miRNA in the preparation of a chip, a detection reagent or a detection kit for judging the improvement of sperm quality after varicocelectomy; characterized in that: The miRNA includes: a miRNA whose sequence is shown in SEQ ID NO: 1, or a miRNA complementary to the sequence shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that The miRNA also includes a miRNA selected from the group consisting of: (b1) a miRNA having a sequence as shown in SEQ ID NO: 2, a miRNA having a sequence as shown in SEQ ID NO: 3, or a combination thereof; or (b2) a miRNA complementary to the miRNA sequence described in (b1).

3. The use according to claim 1, characterized in that The miRNA also includes a miRNA selected from the group consisting of: (c1) a miRNA having a sequence as shown in SEQ ID NO: 4, a miRNA having a sequence as shown in SEQ ID NO: 5, a miRNA having a sequence as shown in SEQ ID NO: 6, a miRNA having a sequence as shown in SEQ ID NO: 7, a miRNA having a sequence as shown in SEQ ID NO: 8, a miRNA having a sequence as shown in SEQ ID NO: 9, a miRNA having a sequence as shown in SEQ ID NO: 10, or a combination thereof; or (c2) a miRNA complementary to the miRNA sequence described in (c1).

4. The use according to claim 1, characterized in that The miRNA is miRNA isolated from sperm.

5. A miRNA chip for judging sperm quality improvement after varicocelectomy, characterized in that: The miRNA chip comprises: a solid support; and Oligonucleotide probes are sequentially fixed on the solid phase carrier, and the oligonucleotide probes specifically bind to miRNA; Wherein, the miRNA includes: a miRNA whose sequence is shown in SEQ ID NO: 1, or a miRNA complementary to the sequence shown in SEQ ID NO:

1.

6. The miRNA chip according to claim 5, characterized in that The miRNA chip is used for judging the improvement of sperm quality after varicocelectomy.

7. The use of the miRNA chip according to claim 5, characterized in that: Used to prepare a detection kit for judging the improvement of sperm quality after varicocelectomy.

8. A detection kit for judging the improvement of sperm quality after varicocelectomy, characterized in that: The detection kit is equipped with a detection reagent for detecting miRNA; Wherein, the miRNA includes: a miRNA having a sequence as shown in SEQ ID NO: 1, or a miRNA complementary to the sequence shown in SEQ ID NO: 1; or The detection kit is equipped with the miRNA chip according to claim 5.

9. A miRNA set for judging sperm quality improvement after varicocele surgery, characterized in that: The collection includes: A miRNA having a sequence as shown in SEQ ID NO: 1, or a miRNA complementary to the sequence shown in SEQ ID NO: 1; and miRNA selected from the group consisting of: (b1) a miRNA having a sequence as shown in SEQ ID NO: 2, a miRNA having a sequence as shown in SEQ ID NO: 3, or a combination thereof; or (b2) a miRNA complementary to the miRNA sequence described in (b1).

10. An evaluation device for sperm quality improvement after varicocelectomy, characterized in that: The device comprises: (a) an input module, wherein the input module is configured to input the miRNA level of a subject to be tested; Wherein, the miRNA includes: a miRNA whose sequence is shown in SEQ ID NO: 1, or a miRNA complementary to the sequence shown in SEQ ID NO: 1; (b) an evaluation module, wherein the evaluation module is configured to compare the input miRNA level with a control reference value, and when the miRNA is an up-regulated miRNA and the miRNA level is significantly higher than the control reference value, it indicates that the sperm quality of the subject to be tested is improved; or when the miRNA is a down-regulated miRNA and the miRNA level is significantly lower than the control reference value, it indicates that the sperm quality of the subject to be tested is improved; otherwise, it indicates that the sperm quality of the subject to be tested is not improved; and (c) An output module, wherein the output module is configured to output the evaluation result.

Images