Dual-mode detection platform for detecting specific protein glycosylation of small extracellular vesicles as well as preparation method and application of detection platform

Abstract

The invention discloses a dual-mode detection platform for detecting specific protein glycosylation of small extracellular vesicles as well as a preparation method and application of the detection platform. The detection platform comprises an aptamer probe PTK7-PRP, a lectin probe GRP, a hairpin DNAH1, a hairpin DNAH2 and a gold electrode or a gold-modified electrode. The invention provides a dual-mode detection platform with high sensitivity and wide linear detection range for the first time, the platform is simple in preparation process and has good selectivity, and specific detection of the glycosylated PTK7 protein in the small extracellular vesicles is realized. The electrochemical detection limit of the platform is as low as 826 parts / mL, and the detection limit of a colorimetric method is 856 parts / mL. Through the fusion of electrochemical and colorimetric dual-mode signals, the sensitivity and accuracy of detection are remarkably improved, and the risk of false positive and false negative results is remarkably reduced.

Description

Technical Field

[0001] The present invention relates to the technical field of bioanalysis and detection, and in particular to a detection platform for dual-mode detection of small extracellular vesicle-specific protein glycosylation, and a preparation method and application thereof. Background Art

[0002] Glycoproteins are proteins modified by glycosylation. Glycosylation is one of the most common and functionally diverse post-translational modifications, and is widely involved in important biological processes such as cell-to-cell recognition, immune response, and cell communication. Abnormal glycosylation patterns are closely related to the occurrence and development of many diseases, especially in cancer, where glycosylation has an important impact on tumor growth, metastasis, and immune escape. Therefore, glycoproteins have become key biomarkers for the early diagnosis and treatment of diseases such as cancer.

[0003] Small extracellular vesicles (sEVs) are nano-sized vesicles with a diameter of less than 200 nm that are secreted by cells. SEVs can carry a variety of bioactive molecules such as proteins, lipids and nucleic acids, reflect the physiological or pathological state of the parent cells, transmit signals between cells, and participate in processes such as immune regulation and tumor metastasis. Compared with sEVs of normal cells, sEVs secreted by cancer cells contain more specific biomarkers, making them a powerful tool for early diagnosis of cancer.

[0004] The surface of SEVs is rich in glycoproteins, and the glycosylation pattern is closely related to the glycosylation status of the parent cells. In cancer, the glycosylation pattern on the surface of sEVs often changes, affecting tumor growth, metastasis and immune escape. Glycoproteins such as carcinoembryonic antigen (CEA), fusin-1 (CD133), mucin-1 (MUC1), epithelial cell adhesion molecule (EpCAM) and protein tyrosine kinase 7 (PTK7) are closely related to cancer. PTK7 is a receptor protein on the surface of tumor cells, and its glycosylation changes affect the proliferation and metastasis of tumor cells. By detecting the glycosylation status of glycoproteins on the surface of sEVs, it can provide important basis for early diagnosis, disease monitoring and treatment of cancer.

[0005] Although traditional glycoprotein detection methods such as mass spectrometry (MS) and liquid chromatography (LC) have high sensitivity and specificity, they require complex sample preparation, expensive equipment and cumbersome data analysis, which limits their application in clinical high-throughput detection. In addition, metabolic glycosyl labeling (MGL) technology labels glycosyls in sEVs by introducing modified sugar analogs, but its labeling efficiency is unstable and it cannot fully capture glycosylation information. Another technology, lectin array (LA), can efficiently detect glycosylation structures, but there may be non-specific binding, affecting the accuracy of detection. Existing technologies generally rely on a single signal mode (such as fluorescence or colorimetric signals), which may be interfered by the environment in complex biological samples, resulting in false positive or false negative results. Therefore, there is an urgent need for a detection platform that can provide multiple signal outputs and improve detection sensitivity and accuracy. Summary of the invention

[0006] Purpose of the invention: In order to solve the above technical problems, the present invention aims to provide a dual-mode detection platform for sEVs-specific protein glycosylation, which is used for dual-mode detection of sEVs concentration and the glycosylation state of its related specific glycoprotein (PTK7). The detection platform of the present invention analyzes the concentration of sEVs, indirectly reflects the glycosylation modification level of its surface glycoprotein, greatly improves the sensitivity and accuracy of glycoprotein detection, and effectively reduces the risk of false positive and false negative results, providing strong support for the high-precision detection of glycoprotein-related biomarkers.

[0007] The present invention also provides a preparation method and application of a dual-mode detection platform for sEVs-specific protein glycosylation, which performs dual-mode analysis and detection on sEVs-specific protein glycosylation secreted by different cells, and also provides reliable technical support for the early diagnosis and research of cancer-related diseases.

[0008] Technical solution: In order to achieve the above-mentioned purpose, the present invention discloses a dual-mode detection platform for detecting sEVs-specific protein glycosylation, which comprises an aptamer probe PTK7-PRP, a lectin probe GRP, a hairpin DNAH1, a hairpin DNAH2, a gold electrode or a modified gold electrode; the gold electrode or the modified gold electrode is loaded with sEVs for detection; the aptamer probe PTK7-PRP can specifically recognize the PTK7 protein, the lectin probe GRP recognizes the sugar group of sEVs and triggers the configuration change of PTK7-PRP, and the subsequent hybridization chain reaction (HCR) is triggered after the configuration change, which triggers the HCR amplification reaction through hairpin DNAH1 and hairpin DNAH2.

[0009] The sequence of the aptamer probe PTK7-PRP is 5'-AGTCTAGGATTCGGCGTGGGT TAAACCCGAATCCTAGACTACAGCAGATCTAACTGCTGCGCCGCCGGGAAA ATACTGTACGGTTAGA-3', the sequence of the lectin probe GRP is ConA-CTGCTGTAGTCTAG GATTCGG-3', the sequence of the hairpin DNA H1 is 5'-TTAACCCACGCCGAATCCTAGACTCAAAGTAGTCTAGGATTCGGCGTG-3', and the sequence of the hairpin DNA H2 is 5'-AGTCTAGGATTC GGCGTGGGTTAACACGCCGAATCCTAGACTACTTTG-3'.

[0010] Furthermore, the loaded sEVs are sEVs of CCRF-CEM cells, MCF-7 cells, Ramos cells or HeLa cells, and the loading concentration is 6.5×10 3 -6.5×10 7 particles / mL.

[0011] The method for preparing the dual-mode detection platform for sEVs-specific protein glycosylation of the present invention comprises the following steps:

[0012] (1) sEVs were added to the pretreated gold electrode surface for incubation, and then a solution containing the aptamer probe PTK7-PRP and the lectin probe GRP was added for co-incubation to expose the promoter that can trigger the HCR amplification reaction;

[0013] (2) placing the gold electrode treated in step (1) in an AuNPs solution containing hairpin DNA H1 and hairpin DNA H2, and triggering the HCR amplification reaction after incubation to obtain a functionalized electrode, which is the detection platform.

[0014] Furthermore, the concentration of sEVs is 6.5×10 3 -6.5×10 7 particles / mL, the concentration of aptamer probe PTK7-PRP was 0.3-1.25 μM, the concentration of probe GRP was 0.25-1.5 μM, the concentration of hairpin DNAH1 was 0.5-2.0 μM, and the concentration of hairpin DNAH2 was 0.5-2.0 μM.

[0015] Furthermore, the pre-treated gold electrode in step (1) is specifically as follows: first, the aptamer probe CD63, tri(2-carboxyethyl)phosphine (TCEP) and buffer are co-incubated, the mixed solution is dropped on the surface of the gold electrode for incubation, and finally, the incubated gold electrode is immersed in methyl methacrylate (MCH) to block the unbound specific sites; the aptamer probe CD63 is 5'-SH-TTTTTCACCCCACCTCGCTCCCGT GACACTAATGCTA-3', and the concentration is 0.1-1.0 μM.

[0016] Preferably, the concentration of the aptamer probe CD63 is 0.5 μM.

[0017] Furthermore, the CCRF-CEM sEVs in step (1) are prepared by culturing CCRF-CEM cells in RPMI-1640 medium containing 10% fetal bovine serum and 1% penicillin / streptomycin, collecting the culture fluid and centrifuging it to obtain a CCRF-CEM sEVs precipitate, which is then resuspended in sterile PBS buffer (10 mM K2HPO4 and 0.1 M NaCl, PH = 7.4) to form a sEVs suspension and stored at -80°C for use (all centrifugation steps are performed at 4°C).

[0018] Furthermore, the incubation time of step (1) is 0.5-3h; and the incubation time of step (2) is 0.5-3h.

[0019] Furthermore, in step (2), the concentration of AuNPs is 2.6-3.4 nM.

[0020] Preferably, the concentration of AuNPs in step (2) is 3.0 nM.

[0021] The dual-mode detection platform for sEVs-specific protein glycosylation of the present invention is used in the dual-mode detection of sEVs-specific protein glycosylation.

[0022] Furthermore, the dual-mode detection platform for sEVs-specific protein glycosylation is used in the preparation of a reagent for dual-mode detection of sEVs-specific protein glycosylation.

[0023] Furthermore, the application process is: electrochemical analysis and detection are performed on the prepared CCRF-CEM sEVs gold electrodes with different concentrations. As the concentration of CCRF-CEM sEVs increases, the current response on the electrode surface gradually increases, thereby realizing the electrochemical detection of glycosylated proteins.

[0024] Furthermore, with the increase in the concentration of CCRF-CEM sEVs, the color of the AuNPs solution gradually changed from red to blue, realizing the colorimetric detection of glycosylated proteins.

[0025] The dual-mode detection platform for sEVs-specific protein glycosylation of the present invention is used in the detection of tumor cell sEVs.

[0026] Furthermore, the application of the detection platform in detecting tumor cell sEVs specifically includes the following steps:

[0027] (1) Using a functionalized electrode as the working electrode, a three-electrode system is used for electrochemical analysis and detection; by comparing the signal difference obtained from measuring sEVs of different concentrations, sEVs are quantitatively analyzed and detected;

[0028] (2) Alternatively, after the functionalized electrode is obtained and the HCR amplification reaction is triggered, an electrolyte salt is added to the post-reaction solution to induce AuNPs aggregation for colorimetric detection.

[0029] Wherein, the electrolyte salt is a sodium salt, and the sodium salt is preferably sodium chloride.

[0030] Furthermore, in step (2) of the detection method, the NaCl concentration is 20-60 mM.

[0031] The dual-mode detection platform for sEVs-specific protein glycosylation of the present invention is used in the preparation of reagents for detecting tumor cells or biomarker screening.

[0032] The dual-mode detection platform provided by the present invention can combine electrochemical and colorimetric signals to sensitively detect sEVs-specific glycoproteins, solving the problems of complex sample processing for detecting sEVs glycosylated proteins, incomplete glycosylation recognition, insufficient sensitivity and specificity, and complex implementation of dual-labeling strategies.

[0033] Among them, the aptamer probe PTK7-PRP and the lectin probe GRP can specifically recognize the membrane protein (PTK7) and sugar groups overexpressed in CCRF-CEM tumor cells. After the PTK7-PRP probe and the GRP probe bind to the glycosylated PTK7 protein, the configuration of PTK7-PRP changes, exposing the promoter that can trigger the HCR amplification reaction. In the AuNPs solution containing the hairpin DNA (H1 and H2), the HCR reaction is triggered. H1 and H2 form a long double-stranded DNA structure through hybridization amplification reaction. This reaction significantly enhances the signal and provides more binding sites for subsequent detection.

[0034] The dual detection of the present invention combines two detection methods and conducts differential pulse voltammetry (DPV) electrochemical detection of target molecules through different signal output forms: the long DNA double strand triggered by HCR is the electroactive substance hexaammineruthenium ([Ru(NH3)6] 3+, RuHex) molecules provide multiple binding sites, which can adsorb more RuHex, generate higher peak current, significantly enhance the electrochemical signal, record the changes in current signals through DPV, and quantitatively analyze the presence and concentration of glycosylated PTK7, thereby achieving quantitative analysis of sEVs, which has the advantages of high sensitivity and precise quantification.

[0035] Colorimetric detection: The HCR process consumes a large amount of hairpin DNA in the reaction solution, resulting in insufficient residual hairpin DNA to protect AuNPs. As a result, AuNPs undergo NaCl-induced aggregation, and the solution color changes from red to blue, which can be qualitatively or semi-quantitatively analyzed by visual observation or absorbance ratio (A650 / A520). This enables colorimetric detection of sEVs-specific protein glycosylation, which has the advantages of rapid and convenient qualitative or semi-quantitative screening.

[0036] The working principle of the present invention is: first, a CD63 capture probe is modified on the surface of a gold electrode to achieve effective capture of target sEVs. Then, the target sEVs are dripped on the surface of the gold electrode and incubated to allow the sEVs to bind to the capture probe. Next, the incubated gold electrode is immersed in a mixed solution of PTK7-PRP and GRP, and the promoter of HCR is exposed through target-induced close hybridization. Subsequently, the gold electrode is immersed in an AuNPs solution containing H1 / H2 to trigger the HCR amplification reaction. The self-assembled DNA formed by amplification can adsorb more RuHex, thereby generating a higher peak current, and the sensitive electrochemical signal transduction of the sensor and the construction of its quantitative relationship are realized through analysis.

[0037] The present invention proposes an electrochemical and colorimetric dual-mode detection platform, which combines a dual-labeling strategy and HCR amplification technology to achieve sensitive detection of specific glycoproteins (such as PTK7) in sEVs. The platform of the present invention detects the concentration of sEVs and combines the recognition of its surface specific glycoprotein (PTK7) to indirectly reflect its glycosylation state, and uses aptamers and lectin probes to specifically identify the protein part and glycosylation of PTK7 protein, thereby accurately monitoring the glycosylation state. In this platform, aptamer probes are used to selectively identify PTK7 protein, and lectin probes target glycosylation structures. When the two are combined, the HCR amplification reaction is triggered to produce long double-stranded DNA, which significantly enhances the electrochemical signal. At the same time, the colorimetric mode induces the aggregation of AuNPs through salt, resulting in color changes, thereby achieving visual detection. This method not only improves the detection sensitivity, but also reduces false positive and false negative results, and improves the accuracy of detection.

[0038] The HCR reaction process of the present invention is as follows: when two metastable auxiliary DNA hairpins (H1 and H2) coexist in an aqueous solution, they do not hybridize with each other. Instead, they begin to bind to each other and assemble to form a long DNA double helix structure after the initiator is added. This process occurs when the initiator opens and activates the first hairpin H1, which immediately opens the second hairpin H2 and hybridizes with it, forming a nicked double-stranded DNA with single-stranded DNA adhesion, which causes the opening of another H1 and triggers the occurrence of the HCR process. As a result, a long DNA double helix structure is assembled using hairpins as monomers, and the double helix structure has dozens or even hundreds of repeating units until the hairpins are exhausted.

[0039] HCR triggers the formation of double-stranded DNA, which is the core amplification mechanism of the dual detection of the present invention. The HCR reaction is initiated after the sugar and protein recognition of the target glycosylated PTK7 protein is completed, generating long double-stranded DNA, which provides a signal source for the two detection modes (electrochemical and colorimetric).

[0040] Beneficial effects: Compared with the existing methods, the present invention has the following advantages:

[0041] (1) High sensitivity and low detection limit. The detection platform of the present invention can adopt a dual-mode detection method, showing extremely high sensitivity in both electrochemical and colorimetric modes. In the electrochemical mode, the detection limit of sEVs is 826 particles / mL; the detection limit of sEVs in the colorimetric mode is 856 particles / mL. The low detection limits of these two modes demonstrate high sensitivity to sEVs, which can more accurately reflect the presence of glycosylated PTK7 protein, and have the potential in early cancer diagnosis and biomarker screening, which helps to achieve effective identification and intervention in the early stages of the disease.

[0042] (2) Wide linear detection range. The detection platform of the present invention has a detection method within 6.5×10 3 It shows a good linear relationship in the sEVs concentration range of 6.5×107particles / mL. The correlation coefficient of the electrochemical mode is R2=0.9938, and the correlation coefficient of the colorimetric mode is R2=0.9996. This wide linear detection range not only enables the platform to provide accurate quantitative analysis in sEVs samples of different concentrations, but also can sensitively detect the glycosylation modification level of specific glycoproteins (such as PTK7) on the surface of sEVs. By capturing and analyzing target glycoproteins in low-concentration sEVs, this platform ensures the reliability and accuracy of the detection results on the basis of high sensitivity, and can achieve accurate monitoring of glycoproteins regardless of the sample concentration.

[0043] (3) Dual-mode signal enhances accuracy and reliability. The detection platform of the present invention combines two detection modes, electrochemical signal and colorimetric signal, which greatly enhances the accuracy and reliability of the analysis results. The electrochemical mode provides high-precision quantitative analysis, which can reflect the concentration changes of glycosylated PTK7 on the surface of sEVs; while the colorimetric mode provides the experimenter with intuitive visual results, which facilitates rapid identification and confirmation of the results. This fusion of dual-mode signals not only ensures the accuracy of the detection, but also effectively reduces the occurrence of false positive and false negative results, and improves the overall reliability of the detection.

[0044] (4) Simple and efficient operation process. The dual labeling strategy and HCR amplification technology adopted in the present invention not only improve the sensitivity of detection, but also simplify the operation process, and propose a dual-mode detection method for the first time. Compared with the traditional antibody labeling method, the use of aptamers greatly reduces the complexity of labeling and sample processing, making the method easier and faster to operate, and accurate results can be obtained in a shorter time. This efficient operation process improves the efficiency of the experiment.

[0045] (5) Lower cost and broad application prospects. The detection platform and detection method of the present invention have lower cost compared with traditional technologies, do not rely on expensive instruments and equipment, and do not require complicated sample pretreatment. The low-cost synthesis of aptamers further reduces the experimental cost, making this method suitable for high-throughput screening and early disease diagnosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 It is the result of electrochemical and colorimetric detection of sEVs content;

[0047] Figure 2 Various key factors were systematically evaluated: CD63 aptamer concentration, PTK7-PRP probe concentration, GRP concentration, H1 / H2 concentration, HCR reaction time, incubation time, AuNPs concentration, and NaCl concentration;

[0048] Figure 3 The present invention is the detection and analysis of glycosylated PTK7 on the surface protein of sEVs from different cell sources;

[0049] Figure 4 It is a schematic diagram of the detection principle of the electrochemical / colorimetric dual-mode detection of sEVs-specific protein glycosylation mediated by the double-labeling strategy triggered by the hybridization chain reaction proposed in the present invention. DETAILED DESCRIPTION

[0050] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments.

[0051] The abbreviations of technical terms in the present invention are as follows: FBS: fetal bovine serum; RCF: centrifugal force generated by a centrifuge.

[0052] HeLa cells: American type culture collection; (ATCC No. CCL-2)

[0053] CCRF-CEM cells: American type culture collection; (ATCC No. CCL-119)

[0054] Ramos cells: American type culture collection; (ATCC No. CRL-1596)

[0055] The electrochemically active substance is RuHex, the detection solution is 10 mM tris-HCl (pH=7.4) buffer, the electrochemical signal recording method is DPV, and the colorimetric signal recording method is ultraviolet-visible absorption spectroscopy (UV-Vis).

[0056] In the embodiment of the present invention, the working electrode is gold, the reference electrode is saturated calomel, and the auxiliary electrode is platinum.

[0057] Each sequence in the present invention is directly synthesized by a biological company.

[0058] Example 1

[0059] The CD63 aptamer DNA sequence (SEQ ID NO. 1) is: 5'-SH-TTTTTCACCCCACCTCGCTCCCGTGACACTAATGCTA-3'

[0060] The specific sequence of the aptamer probe PTK7-PRP is (SEQ ID NO.2):

[0061] Lectin probe GRP sequence (SEQ ID NO.3): ConA-CTGCTGT AGTCTAGGAT TCGG -3', the underlined region is complementary to the spacer domain of PTK7-PRP.

[0062] The sequence of hairpin DNA H1 is (SEQ ID NO.4): 5'-TTAACC CACGCCGAATCCT AGACT CAAAG TAGTCTAGGATTCGGCGTG -3', complementary to the PTK7-PRP priming domain.

[0063] The sequence of hairpin DNA H2 is (SEQ ID NO.5): 5'- AGTCTAGGATTCGGCGTG GGTTA CACGCCGAATCCTAGACTACTTTG-3'. The underlined sequence indicates the complementary region of the probe for forming a hairpin structure.

[0064] Example 2

[0065] (1) Prepare the solutions required for the experimental system

[0066] PBS buffer (10 mM, pH = 7.4; used for resuspension of CCRF-CEM sEVs and electrode elution); TCEP solution (10 mM; used to break the disulfide bond of CD63 aptamer); NaCl solution (20 mM-60 mM) (50 mM was selected after optimization; used to induce AuNPs aggregation in colorimetric detection.)

[0067] AuNPs solution was synthesized by citrate reduction method: 100 mL HAuCl4 was heated to boiling, and 10 mL 38.8 mM trisodium citrate was quickly added. After a few minutes, the color of the solution was observed to change to wine red, and it was refluxed for 15 min and then allowed to cool to room temperature and stored at 4 °C for further use.

[0068] (2) Preparation of CCRF-CEM sEVs

[0069] CCRF-CEM cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin at 37°C and 5% CO2. When the cell density reached 80%-90%, it was replaced with serum-free RPMI-1640 medium and starved for 48 hours at 37°C to promote the release of sEVs. Culture medium treatment steps: Preliminary centrifugation at 300g RCF for 10 minutes at 4°C, and then centrifugation at 2000g RCF for 20 minutes to remove cells and debris. The supernatant was centrifuged at 11000g RCF for 30 minutes and filtered with a 0.22μm filter membrane to further remove large particle impurities. Ultracentrifugation was performed at 110000g RCF for 120 minutes, and the supernatant was removed to obtain CCRF-CEM sEVs precipitate.

[0070] The resulting precipitate was resuspended in PBS buffer and stored at -20°C. The suspension was then diluted with sterile PBS, and the concentration of sEVs was quantitatively detected by nanoparticle tracking analysis (NTA). The results showed that the concentration of CCRF-CEM sEVs was 6.5×10 8 particles / mL, diluted to 6.5×10 3 -6.5×10 7 particles / mL were used for subsequent experiments.

[0071] (3) Preparation of pretreated gold electrodes

[0072] In this experiment, gold electrodes were selected as the aptamer sensor platform, and the gold electrodes were pretreated. The specific process is: 10μL 5μM CD63 aptamer, 10μL 10mM TCEP and 180μL PBS buffer (pH=7.4) were incubated together at room temperature for 2h to break the disulfide bond. After the above incubation, 10μL of 0.5μM CD63 aptamer was dropped on the surface of the gold electrode (diameter 2mm), incubated at 4°C for 13h, and connected to the surface of the gold electrode in the form of gold-sulfur bonds. Then, the gold electrode was immersed in 100μL 1mM MCH to block the unbound specific sites, reacted at room temperature for 2h, and the electrode was washed with 10mM PBS (pH=7.4) buffer solution to elute the nonspecifically adsorbed substances to obtain the pretreated gold electrode.

[0073] (4) Preparation of CCRF-CEM sEVs gold electrode and triggering of HCR reaction

[0074] 10 μL of different concentrations (6.5×10 3 -6.5×10 7 The CCRF-CEM sEVs were captured at 50 μL of 5% aptamer probe PTK7-PRP and 1.0 μM lectin probe GRP and incubated at 37°C for 1 h for target-induced close-range hybridization, thereby changing the conformation of PTK7-PRP and exposing the promoter that can trigger the HCR amplification reaction.

[0075] After the incubation, the CCRF-CEM sEVs gold electrode was placed in 50 μL of AuNPs solution (concentration of 3 nM) containing hairpin probes H1 and H2 (concentration of 1.5 μM each) and incubated at 37 ° C for 2 h to trigger the HCR amplification reaction. After the HCR reaction was completed, the gold electrode was washed with 10 mM PBS (pH = 7.4) buffer solution to elute the nonspecifically adsorbed substances to obtain the functionalized CCRF-CEMsEVs gold electrode. HCR amplification is triggered by the promoter exposed by the PTK7-PRP probe, and the promoter sequence sequentially opens the hairpin structure H1 and H2 to form a long double-stranded DNA. This long double-stranded DNA not only significantly amplifies the detection signal, but also provides more binding sites for adsorbing the electrochemical signal molecule RuHex to enhance the electrochemical detection signal.

[0076] The electrochemical signals were recorded on a CHI 760C electrochemical workstation (Shanghai, China) using a three-electrode system, and the prepared functionalized CCRF-CEM sEVs gold electrodes were respectively subjected to DPV. (sEVs concentration was 6.5 × 103 -6.5×10 7 particles / mL) for electrochemical analysis and detection. The three-electrode system specifically includes: the working electrode is the CCRF-CEM sEVs gold electrode prepared by the present invention, the counter electrode is a platinum electrode, and the reference electrode is a saturated calomel electrode. The experimental parameters of DPV are set as follows: the voltage scan range is -0.5V–+0.1V; the amplitude is 0.5V; the pulse width is 0.01s; and the pulse period is 0.2s. The electrochemical detection is carried out in a 10mM Tris-HCl (pH=7.4) detection solution containing 5μM RuHex. CCRF-CEM sEVs are quantitatively analyzed and detected by comparing the signal difference measured in the presence or absence of target CCRF-CEM sEVs and in the presence of different concentrations of CCRF-CEM sEVs.

[0077] like Figure 1 A, 1B experimental results show that at a sEVs concentration of 6.5×10 3 In the range of 6.5×107particles / mL, as the concentration of CCRF-CEM sEVs increases, the current response on the electrode surface gradually increases, and the DPV signal increases significantly with the increase of CCRF-CEM sEVs concentration. The regression equation is: ΔI = 0.24252lgC sEVs -0.28386, the correlation coefficient is R2 = 0.9938, where C is the CCRF-CEM sEVs concentration, ΔI is the current change, and the detection limit is 826 particles / mL, which indicates that the sensor has high sensitivity to low-concentration sEVs.

[0078] If colorimetric detection is performed, after triggering the HCR amplification reaction, add 2.5 μL of a final concentration of 50 mM NaCl solution to the reaction solution to induce AuNPs aggregation for colorimetric detection. The colorimetric signal is recorded using UV-Vis on an EVOLUTION 201PC UV spectrophotometer (Thermo Fisher Scientific). The degree of change in the color of the solution is quantitatively evaluated by measuring the absorbance ratio (A650 / A520) at 650 nm and 520 nm. The experimental results show that with the increase in the concentration of CCRF-CEM sEVs, the A650 / A520 ratio increases significantly, indicating that AuNPs aggregate in the presence of high concentrations of the target, resulting in changes in the optical properties of the solution, while achieving highly sensitive detection of glycosylated PTK7 protein. Figure 1 C and 1D show that at a sEVs concentration of 6.5×10 3In the concentration range of 6.5×107particles / mL, as the concentration of CCRF-CEM sEVs increased, the color of the AuNPs solution gradually changed from red to blue, thus realizing the colorimetric detection of glycosylated PTK7 protein. There was a good linear relationship between the colorimetric signal and the concentration of CCRF-CEM sEVs, and the trend of significantly increasing with the increase of CCRF-CEM sEVs concentration was the regression equation: A650 / A520=0.07871lgC sEVs +0.19445, the correlation coefficient was R2=0.9996, and the detection limit was 856particles / mL, which showed that the colorimetric method was highly accurate and reliable in the detection of CCRF-CEM sEVs.

[0079] In addition, the HCR reaction was effectively triggered in the AuNPs solution containing hairpin DNA (H1 and H2). H1 and H2 formed a long double-stranded DNA structure through hybridization amplification reaction, which significantly enhanced the detection signal and provided more binding sites for subsequent detection.

[0080] DPV signal ( Figure 1 B) and colorimetric signal ( Figure 1 D) showed a trend of significant enhancement with the increase of CCRF-CEM sEVs concentration. The DPV signal quantitatively reflects the current difference caused by the HCR reaction through ΔI, showing a high linear correlation and sensitivity; at the same time, the A650 / A520 ratio of the colorimetric signal also showed an excellent linear relationship and low detection limit, which further demonstrated the accuracy, sensitivity and reliability of the dual-mode detection platform of the present invention in the detection of CCRF-CEM sEVs.

[0081] Example 2

[0082] The present invention adopts the control variable method and follows the two-step strategy of "first determine the range, then gradually optimize" to systematically screen and optimize the key parameters of the dual-mode detection system, including CD63 aptamer concentration, PTK7-PRP probe concentration, GRP probe concentration, H1 / H2 concentration, HCR reaction time, incubation time, AuNPs concentration and NaCl concentration. First, through preliminary experiments, single variables are adjusted one by one within a large range, while the intermediate values ​​of other variables are fixed to observe their effects on the detection signal, thereby determining the effective working range of each parameter. The results showed that the effective range of CD63 aptamer concentration was 0.1μM to 1.0μM; PTK7-PRP probe concentration was 0.3μM to 1.25μM; GRP concentration was 0.25μM to 1.5μM; H1 / H2 concentration was 0.5μM to 2μM; HCR reaction time was 0.5h to 3h; incubation time of PTK7-PRP and GRP mixed solution with gold electrode was 0.5h to 3h; AuNPs concentration was 2.6nM to 4nM; NaCl concentration was 20mM to 60mM.

[0083] On this basis, the method of Example 1 was used to fix the CCRF-CEM sEVs concentration to 6.5×10 7 particles / mL and other variables, only the value of the target parameter is adjusted, and each parameter is optimized one by one using the control variable method to further accurately determine the optimal experimental conditions. The optimization results are as follows:

[0084] like Figure 2 A, Under the conditions of PTK7-PRP and GRP probe concentrations of 1μM, HCR reaction time of 2h, NaCl concentration of 50mM and AuNPs concentration of 3nM, the concentration of aptamer CD63 was adjusted to 0.1μM, 0.25μM, 0.5μM, 0.75μM and 1μM, and the intensity of the electrochemical signal (ΔI) was measured. The results showed that when the concentration of aptamer CD63 was 0.5μM, the signal intensity was the largest, and further increasing the concentration of aptamer CD63 would lead to a decrease in binding efficiency due to the steric hindrance effect. Therefore, the optimal concentration of aptamer CD63 was determined to be 0.5μM.

[0085] like Figure 2 B. Under the conditions of CD63 aptamer concentration of 0.5μM, GRP probe concentration of 1μM, HCR reaction time of 2h, NaCl concentration of 50mM and AuNPs concentration of 3nM, the PTK7-PRP probe concentration was adjusted to 0.3μM, 0.5μM, 0.7μM, 1μM and 1.25μM. The results showed that the signal intensity was the highest when the PTK7-PRP concentration was 1μM, and then remained stable. Therefore, the optimal value of PTK7-PRP concentration was 1μM.

[0086] like Figure 2C, Under the conditions of CD63 aptamer concentration of 0.5μM, PTK7-PRP probe concentration of 1μM, HCR reaction time of 2h, NaCl concentration of 50mM and AuNPs concentration of 3nM, the GRP concentration was adjusted to 0.25μM, 0.5μM, 0.75μM, 1μM and 1.5μM. The results showed that when the GRP concentration was 1μM, the signal intensity reached the maximum and remained stable. Therefore, the optimal value of GRP concentration was 1μM.

[0087] like Figure 2 D, Under the conditions of CD63 aptamer concentration of 0.5μM, HCR reaction time of 2h, NaCl concentration of 50mM and AuNPs concentration of 3nM, the H1 / H2 concentration was adjusted to 0.5μM, 0.75μM, 1μM, 1.5μM and 2μM. The results showed that when the H1 / H2 concentration was 1.5μM, the signal intensity reached the maximum value and remained stable. Therefore, the optimal value of H1 / H2 concentration was 1.5μM.

[0088] like Figure 2 E, under the conditions of CD63 aptamer concentration of 0.5μM, PTK7-PRP and GRP probe concentrations of 1μM, NaCl concentration of 50mM and AuNPs concentration of 3nM, the HCR reaction time was adjusted to 0.5h, 1h, 1.5h, 2h and 3h. The experimental results showed that when the HCR reaction time was 2h, the signal amplification efficiency was the best, and extending the reaction time (>2h) did not significantly improve the signal intensity, while shortening the reaction time (<1.5h) resulted in insufficient signal amplification. Therefore, the optimal value of the HCR reaction time is 2h.

[0089] like Figure 2 F, Under the conditions of CD63 aptamer concentration of 0.5 μM, PTK7-PRP and GRP probe concentrations of 1 μM, NaCl concentration of 50 mM and AuNPs concentration of 3 nM, the incubation time of the mixed solution of PTK7-PRP and GRP with the pretreated gold electrode was adjusted to 0.5 h, 1 h, 1.5 h, 2 h and 3 h. The results showed that when the incubation time was 1 h, the electrochemical signal reached the maximum and remained stable. Therefore, the optimal value of the incubation time was 1 h.

[0090] like Figure 2G, Under the conditions of CD63 aptamer concentration 0.5μM; PTK7-PRP probe concentration 1μM; GRP concentration 1μM; H1 / H2 concentration 1.5μM; HCR reaction time 2h; incubation time 1h; AuNPs concentration 3nM; NaCl concentration 50mM, the AuNPs concentration was adjusted to 2.6nM, 2.8nM, 3nM, 3.2nM and 3.4nM, and the colorimetric signal (A650 / A520) was measured. The results showed that the colorimetric signal intensity was optimal when the AuNPs concentration was 3nM in colorimetric detection; the signal was insufficient at low concentrations (<3nM), and the background noise increased at high concentrations (>3nM). Therefore, the optimal value of the AuNPs concentration is 3nM.

[0091] like Figure 2 H, under the conditions of CD63 aptamer concentration 0.5μM; PTK7-PRP probe concentration 1μM; GRP concentration 1μM; H1 / H2 concentration 1.5μM; HCR reaction time 2h; incubation time 1h; AuNPs concentration 3nM; NaCl concentration 50mM, the NaCl concentration was adjusted to 20mM, 30mM, 40mM, 50mM and 60mM, and the colorimetric signal (A650 / A520) was measured. The results showed that when the NaCl concentration was 50mM, the colorimetric signal reached the maximum value and the background noise was low; lower concentrations could not induce effective aggregation of AuNPs, and higher concentrations would destroy the protective effect of hairpin DNA on AuNPs. Therefore, the optimal value of NaCl concentration in colorimetric detection is 50mM.

[0092] According to the above optimization process, the optimal parameter combination of the dual-mode detection system is determined as follows: CD63 aptamer concentration: 0.5μM; PTK7-PRP probe concentration: 1μM; GRP concentration: 1μM; H1 / H2 concentration: 1.5μM; HCR reaction time: 2h; incubation time: 1h; AuNPs concentration: 3nM; NaCl concentration: 50mM. The optimized conditions can not only improve the sensitivity of the signal, but also significantly reduce the background noise, ensuring the stability and repeatability of the experimental results.

[0093] Example 3

[0094] Analysis and detection of sEVs from different cells

[0095] In order to evaluate the selectivity of the proposed dual-mode sensor CCRF-CEM sEVs gold electrode in detecting sEVs-specific glycoproteins, the same preparation and detection methods as in Example 1 were used, but the CCRF-CEM cells were replaced with MCF-7, Ramos, and HeLa tumor cells in the same concentration range (sEVs concentration was 6.5×10 3 -6.5×10 7particles / mL), and other processes remained unchanged. The sEVs prepared from different cells and PBS buffer were compared and tested. Six electrodes were used in parallel for each sample. DPV and UV-Vis were used for signal analysis, such as Figure 3 As shown in A, the content of glycosylated PTK7 protein in CCRF-CEM sEVs was significantly higher than that in sEVs of other tumor cell lines (MCF-7, Ramos, Hela), indicating its potential as a specific marker. The electrochemical detection results showed that CCRF-CEM sEVs produced a higher DPV signal compared with sEVs of other tumor cell lines, demonstrating the specific detection ability of glycosylated PTK7 protein. In contrast, due to the lack of glycosylated PTK7 protein in PBS buffer, electrochemical detection showed a very low DPV signal. Figure 3 As shown in B, the A650 / A520 ratio results of the colorimetric detection were consistent with those of the electrochemical detection. The A650 / A520 ratio of the CCRF-CEM sEVs sample was significantly higher than that of the sEVs of other tumor cell lines and PBS buffer, further verifying the sensitivity and specificity of the detection system for glycosylated PTK7 protein. The colorimetric signal in PBS buffer remained at a low level, which was consistent with its DPV signal results.

[0096] The obtained results are consistent with those reported in the literature (Liu, X.; Zhang, H.; Ma, C.; Zhao, Y.; Sun, C. Dual-Recognition Triggered Proximity Ligation Combined with a Rolling Circle Amplification Strategy for Analysis of Exosomal Protein-Specific Glycosylation. Analytical Chemistry 2023, 95 (42), 15745–15754.). The present invention shows a lower detection limit of 826 / 856 particles / mL, which is much lower than the 2.759×10 3particles / mL. This shows that the platform of the present invention has significant advantages in sensitivity and detection performance. In combination with the above, the dual-mode detection platform of the present invention can not only sensitively and specifically detect glycosylated PTK7 protein, but also reflect its application potential in distinguishing sEVs from different tumor cell sources through comparative analysis of sEVs from different tumor cell lines. At the same time, the platform can accurately detect surface glycosylated PTK7 protein under low concentration conditions of sEVs, and combined with its wide linear range and low background noise, it proves its practical application value in later tumor cell detection and biomarker screening.

[0097] In summary, if Figure 4 As shown, the present invention adopts a dual-label strategy and a dual detection method of HCR amplification to detect CCRF-CEM sEVs-specific glycosylated PTK-7 protein. Since CCRF-CEM sEVs express abundant CD63 protein on their surface, these vesicles can be effectively captured on the electrode. PTK7-PRP consists of three regions: an aptamer region (blue), a spacer region (green), and a start region (red) for recognizing PTK7. In addition, a glycosyl recognition probe (GRP, green) is introduced to specifically recognize glycosylated proteins on the surface of sEVs. When the two probes recognize the PTK7 protein at the same time, the aptamer probe undergoes a conformational change, exposing the HCR initiation domain, thereby triggering the HCR amplification reaction, and the electrochemical signal is generated by RuHex as an indicator, while the colorimetric signal is generated by gold nanoparticles (AuNPs). The aptamer region specifically binds to the PTK7 protein, while the start region is initially protected by the hairpin structure formed by the spacer region and is released after the GRP binds to the glycoprotein on the surface of sEVs. PTK7-PRP then undergoes a conformational change, triggering the release of the HCR initiation domain. The presence of the hairpin DNA (H1 and H2) triggers the HCR reaction at the glycan site of the target protein, forming a long double-stranded DNA. This amplified structure provides numerous binding sites for the electroactive molecule RuHex, significantly enhancing the electrochemical signal (mode I).

[0098] At the same time, the HCR process consumes a large amount of hairpin DNA in the reaction solution, leaving insufficient residual hairpin DNA to protect AuNPs. Therefore, salt-induced aggregation of AuNPs causes the solution to change from red to blue, thereby achieving colorimetric detection of glycosylated PTK-7 protein (mode II). The degree of solution color change can be quantitatively evaluated by measuring the absorbance ratio at 650nm and 520nm (A650 / A520).

[0099] In the absence of target glycosylated protein, the promoter domain remains hidden, preventing HCR from being triggered, and thus no enhancement of the electrochemical signal is observed. Meanwhile, the unconsumed hairpin DNA remains in the solution, effectively preventing the aggregation of AuNPs and maintaining the original red color of the solution.

Claims

1. A dual-mode detection platform for small extracellular vesicle-specific protein glycosylation, characterized in that: The detection platform includes an aptamer probe PTK7-PRP, a lectin probe GRP, a hairpin DNAH1, a hairpin DNAH2, a gold electrode or a modified gold electrode; the aptamer probe PTK7-PRP can specifically identify the PTK7 protein, the lectin probe GRP recognizes the sugar group of the small extracellular vesicle and triggers the configuration change of PTK7-PRP, and the subsequent hybridization chain reaction is triggered after the configuration change, and the hybridization chain reaction amplification reaction is triggered by the hairpin DNAH1 and the hairpin DNAH2.

2. The dual-mode detection platform for small extracellular vesicle-specific protein glycosylation according to claim 1, characterized in that: The aptamer probe PTK7-PRP sequence is 5'-AGTCTAGGATTCGG CGTGGGTTAAACCCGAATCCTAGACTACAGCAGATCTAACTGCTGCGCCGC CGGGAAAATACTGTACGGTTAGA-3', the lectin probe GRP sequence is ConA-CTGCTGT AGTCTAGGATTCGG-3', the hairpin DNA H1 sequence is 5'-TTAACCCACGCCGAATCCTAGACTCAAAGTAGTCTAGGATTCGGCGTG-3', and the hairpin DNA H2 sequence is 5'-AGT CTAGGATTCGGCGTGGGTTAACACGCCGAATCCTAGACTACTTTG-3'.

3. The dual-mode detection platform for small extracellular vesicle-specific protein glycosylation according to claim 1, characterized in that: The loaded small extracellular vesicles are small extracellular vesicles of CCRF-CEM cells, MCF-7 cells, Ramos cells or HeLa cells, and the loading concentration is 6.5×103-6.5×10 7 particles / mL.

4. A method for preparing the dual-mode detection platform for small extracellular vesicle-specific protein glycosylation according to claim 1, characterized in that: The steps include: (1) small extracellular vesicles were added to the pretreated electrode surface for incubation, and then a solution containing the aptamer probe PTK7-PRP and the lectin probe GRP was added for co-incubation to expose the promoter that can trigger the hybridization chain reaction amplification reaction; (2) placing the electrode treated in step (1) in an AuNPs solution containing hairpin DNA H1 and hairpin DNA H2, and triggering a hybridization chain reaction amplification reaction after incubation to obtain a functionalized electrode, which is the detection platform.

5. The method for preparing the dual-mode detection platform for small extracellular vesicle-specific protein glycosylation according to claim 4, characterized in that: The concentration of the small extracellular vesicles is 6.5×103-6.5×10 7 particles / mL, the concentration of probe PTK7-PRP was 0.3-1.25 μM, the concentration of probe GRP was 0.25-1.5 μM, the concentration of hairpin DNAH1 was 0.5-2.0 μM, and the concentration of hairpin DNAH2 was 0.5-2.0 μM.

6. The method for preparing the dual-mode detection platform for small extracellular vesicle-specific protein glycosylation according to claim 4, characterized in that: The electrode pretreated in step (1) is specifically as follows: first, the aptamer probe CD63, tri(2-carboxyethyl)phosphine (TCEP) and buffer are co-incubated, then the mixed solution is dropped on the electrode surface for incubation, and finally the incubated electrode is immersed in methyl methacrylate (MCH) to block the unbound specific sites; the aptamer probe CD63 is 5'-SH-TTTTTCACCCCACCTCGC TCCCGTGACACTAATGCTA-3', and the concentration is 0.1-1.0 μM.

7. The method for preparing the dual-mode detection platform for small extracellular vesicle-specific protein glycosylation according to claim 4, characterized in that: The incubation time of step (1) is 0.5-3h; the incubation time of step (2) is 0.5-3h; the concentration of AuNPs in step (2) is 2.6-3.4nM.

8. Use of the dual-mode detection platform for small extracellular vesicle-specific protein glycosylation according to claim 1 in dual-mode detection of small extracellular vesicle-specific protein glycosylation.

9. The use according to claim 8, characterized in that: The application of the detection platform in detecting tumor cell sEVs specifically includes the following steps: (1) Using the functionalized electrode as the working electrode, a three-electrode system is used for electrochemical analysis and detection; by comparing the signal difference obtained from the measurement of small extracellular vesicles with different concentrations, small extracellular vesicles are quantitatively analyzed and detected; (2) Alternatively, after the functionalized electrode is obtained and the hybridization chain reaction amplification reaction is triggered, an electrolyte salt is added to the post-reaction solution to induce the aggregation of the AuNPs solution for colorimetric detection.

10. Use of the dual-mode detection platform for small extracellular vesicle-specific protein glycosylation according to claim 1 in the preparation of a reagent for detecting tumor cells or biomarker screening.

Images