Methods of using extracellular vesicles-ASO targeting STAT6

Abstract

The present disclosure relates to methods of administering an antisense oligonucleotide (ASO) comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length, which contiguous nucleotide sequence is complementary to a nucleic acid sequence within the STAT6 transcript. In some aspects, the ASO is associated with an extracellular vesicle, such as an exosome.

Description

Technical Field

[0001] The present disclosure relates to a method for treating a disease or condition in a subject in need thereof, the method comprising administering a dose of one or more antisense oligonucleotides (ASOs) targeting a STAT6 transcript (SEQ ID NO: 1 or SEQ ID NO: 3), wherein each of the one or more ASOs comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length, the contiguous nucleotide sequence being complementary to a nucleic acid sequence within the STAT6 transcript; and wherein the amount of the one or more ASOs in the dose is at least about 0.01 mg to at least about 240 mg. In some aspects, the ASO is connected to the surface of the EV. In some aspects, the ASO is connected to the outer surface of the EV. In certain aspects of the present disclosure, the extracellular vesicle further comprises a scaffold protein. Background Art

[0002] Exosomes are small extracellular vesicles naturally produced by each eukaryotic cell. Exosomes contain a membrane that encapsulates the internal space (i.e., the lumen). As a drug delivery vehicle, EVs (e.g., exosomes) provide many advantages over traditional drug delivery methods as a new treatment modality in many therapeutic areas. Specifically, exosomes have inherently low immunogenicity, even when administered to different species.

[0003] Antisense oligonucleotides have become a powerful means to regulate target gene expression in vitro or in vivo. However, there is still a need to improve the stability and targeting of ASOs in vivo. Therefore, in order to better realize the therapeutic uses and other applications of EV-based technologies, new and more effective engineered EVs (e.g., exosomes) are needed, specifically engineered EVs that can be used to deliver therapeutic agents that can reduce the expression of genes associated with diseases (e.g., N of cancer). Summary of the invention

[0004] Some aspects of the present disclosure relate to a method of preventing or treating a disease or condition in a subject in need thereof, the method comprising administering to the subject a dose of one or more antisense oligonucleotides (ASOs) targeting a STAT6 transcript (SEQ ID NO: 1 or SEQ ID NO: 3), wherein each of the one or more ASOs comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within the STAT6 transcript; and wherein the amount of the one or more ASOs in the dose is at least about 0.01 mg to at least about 240 mg.

[0005] Some aspects of the present disclosure relate to a method of increasing or enhancing an immune response in a subject in need thereof, the method comprising administering to the subject a dose of one or more antisense oligonucleotides (ASOs) targeting a STAT6 transcript (SEQ ID NO: 1 or SEQ ID NO: 3), wherein each of the one or more ASOs comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within the STAT6 transcript; and wherein the amount of the one or more ASOs in the dose is at least about 0.01 mg to at least about 240 mg.

[0006] In some aspects, the ASO is delivered via one or more extracellular vesicles (EVs). In some aspects, the one or more ASOs are associated with the one or more EVs.

[0007] In some aspects, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, or at least about 90% of the one or more ASOs are associated with the one or more EVs.

[0008] In some aspects, the dose is at least about 0.01 mg, at least about 0.05 mg, at least about 0.1 mg, at least about 0.5 mg, at least about 1 mg, at least about 2 mg, at least about 3 mg, at least about 4 mg, at least about 5 mg, at least about 6 mg, at least about 7 mg, at least about 8 mg, at least about 9 mg, at least about 10 mg, at least about 11 mg, at least about 12 mg, at least about 13 mg, at least about 14 mg, at least about 15 mg, at least about 16 mg, at least about 17 mg, at least about 18 mg, at least about 19 mg, at least about 20 mg, at least about 21 mg, at least about 22 mg, at least about 23 mg, at least about 24 mg, at least about 25 mg, at least about 26 mg, at least about 27 mg, at least about 28 mg, at least about 29 mg, at least about 30 mg, at least about 31 mg, at least about 32 mg, at least about 33 mg, at least about 34 mg, at least about 35 mg, at least about 36 mg, at least about 37 mg, at least about 38 mg, at least about 39 mg, at least about 40 mg, at least about 41 mg, at least about 42 mg, at least about 43 mg, at least about 44 mg In some aspects, the dosage is at least about 5 mg of the one or more ASOs. In some aspects, the dosage is at least about 15 mg of the one or more ASOs. In some aspects, the dosage is at least about 20 mg of the one or more ASOs. In some aspects, the dosage is at least about 10 mg of the one or more ASOs. In some aspects, the dosage is at least about 30 mg of the one or more ASOs. In some aspects, the dosage is at least about 60 mg of the one or more ASOs.

[0009] In some aspects, the dose is administered about once a week, about once every two weeks, about once every three weeks, or about once every four weeks. In some aspects, the dose is administered on about day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered on about day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered on about day 1 of the third 28-day cycle. In some aspects, the dose is administered about every 56 days after the third 28-day cycle.

[0010] In some aspects, the contiguous nucleotide sequence is complementary to a nucleic acid sequence within nucleotides 1 to 2056 of the STAT6 transcript corresponding to the nucleotide sequence shown in SEQ ID NO:3 or nucleotides 2059 to 3963 of the STAT6 transcript corresponding to the nucleotide sequence shown in SEQ ID NO:3.

[0011] In some aspects, the ASO is a gapmer, a mixmer or a totalmer. In some aspects, the ASO comprises one or more nucleoside analogs. In some aspects, one or more nucleoside analogs in the nucleoside analogs comprise 2'-O-alkyl-RNA; 2'-O-methyl RNA (2'-OMe); 2'-alkoxy-RNA; 2'-O-methoxyethyl-RNA (2'-MOE); 2'-amino-DNA; 2'-fluoro-RNA; 2'-fluoro-DNA; arabinose nucleic acid (ANA); 2'-fluoro-ANA; or bicyclic nucleoside analogs. In some aspects, one or more nucleoside analogs in the nucleoside analogs are sugar-modified nucleosides. In some aspects, the sugar-modified nucleosides are 2' sugar-modified nucleosides with enhanced affinity. In some aspects, one or more nucleoside analogs in the nucleoside analogs comprise nucleosides including bicyclic sugars. In some aspects, one or more nucleoside analogs in the nucleoside analogs comprise LNA. In some aspects, one or more nucleoside analogs in the nucleotide analogs are selected from the group consisting of: constrained ethyl nucleosides (cEt), 2',4'-constrained 2'-O-methoxyethyl (cMOE), α-L-LNA, β-D-LNA, 2'-O,4'-C-ethylene bridged nucleic acids (ENA), amino-LNA, oxy-LNA, thio-LNA, and any combination thereof. In some aspects, the ASO comprises one or more 5'-methyl-cytosine nucleobases.

[0012] In some aspects, the contiguous nucleotide sequence is complementary to a nucleic acid sequence within: (i) a 5' untranslated region (UTR); (ii) a coding region; or (iii) a 3' UTR of a target transcript. In some aspects, the contiguous nucleotide sequence is complementary to a nucleic acid sequence comprising: (i) nucleotides 1-700 of SEQ ID NO:3; (ii) nucleotides 1000-1500 of SEQ ID NO:3; (iii) nucleotides 1500-2000 of SEQ ID NO:3; (iv) nucleotides 2000-2500 of SEQ ID NO:3; (v) nucleotides 2500-3000 of SEQ ID NO:3; (vi) nucleotides 3000-3700 of SEQ ID NO:3, (vii) nucleotides 413-803 of SEQ ID NO:3; (viii) nucleotides 952-1688 of SEQ ID NO:3; (ix) nucleotides 1726-2489 of SEQ ID NO:3; (x) nucleotides 2682-2912 of SEQ ID NO:3; (xi) nucleotides 2970-3203 of SEQ ID NO:3; (xii) nucleotides 3000-3700 of SEQ ID NO:3 NO:3; (xiii) nucleotides 463-753 of SEQ ID NO:3; (xiv) nucleotides 1002-1638 of SEQ ID NO:3; (xv) nucleotides 1776-2439 of SEQ ID NO:3; (xvi) nucleotides 2682-2862 of SEQ ID NO:3; (xvii) nucleotides 3020-3153 of SEQ ID NO:3; (xviii) nucleotides 3381-3511 of SEQ ID NO:3; (xix) nucleotides 503-713 of SEQ ID NO:3; (xx) nucleotides 1042-1598 of SEQ ID NO:3; (xxi) nucleotides 1816-2399 of SEQ ID NO:3; (xxii) nucleotides 2722-2822 of SEQ ID NO:3; (xxiii) nucleotides 3060-3113 of SEQ ID NO:3; or (xxiv) nucleotides 3060-3113 of SEQ ID NO:3 NO:3421-3471.

[0013] In some aspects, the contiguous nucleotide sequence is complementary to a nucleic acid sequence within: (i) nucleotides 513-703 of SEQ ID NO:3; (ii) nucleotides 1052-1588 of SEQ ID NO:3; (iii) nucleotides 1826-2389 of SEQ ID NO:3; (iv) nucleotides 2732-2812 of SEQ ID NO:3; (v) 3070-3103 of SEQ ID NO:3; or (vi) 3431-3461 of SEQ ID NO:3.

[0014] In some aspects, the ASO comprises a nucleic acid sequence selected from the group consisting of GAAAGGTTCCGTCGGGC (SEQ ID NO: 144), CTGAGTCGCTGAAGCGG (SEQ ID NO: 145), GCCCTTGTACTTTTGC ATAG (SEQ ID NO: 193), GCAAGATCCCGGATTCGGTC (SEQ ID NO: 185), and any combination thereof.

[0015] In some aspects, the contiguous nucleotide sequence comprises Figure 1 A-1B is a nucleotide sequence complementary to a sequence in the target transcript. In some aspects, the contiguous nucleotide sequence is completely complementary to a nucleotide sequence within the target transcript. In some aspects, the ASO comprises a nucleotide sequence selected from SEQ ID NO: 91-193, with one or two mismatches. In some aspects, the ASO has a nucleotide sequence selected from Figure 1 The designs in A-1B consist of a group of designs where uppercase letters are sugar-modified nucleosides and lowercase letters are DNA.

[0016] In some aspects, the ASO is 14 to 20 nucleotides in length.

[0017] In some aspects, the continuous nucleotide sequence comprises one or more modified internucleoside bonds. In some aspects, the one or more modified internucleoside bonds are phosphorothioate bonds. In some aspects, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% of the internucleoside bonds are modified. In some aspects, each internucleoside bond in the internucleoside bond in the ASO is a phosphorothioate bond.

[0018] In some aspects, the ASO is connected to an anchoring moiety. In some aspects, the anchoring moiety comprises a sterol, GM1, a lipid, a vitamin, a small molecule, a peptide, or a combination thereof. In some aspects, the anchoring moiety comprises cholesterol. In some aspects, the anchoring moiety comprises a phospholipid, a lysophospholipid, a fatty acid, a vitamin (e.g., vitamin D and / or vitamin E) or any combination thereof. In some aspects, the anchoring moiety is associated with the EV. In some aspects, the EV comprises a lipid bilayer, wherein the anchoring moiety is associated with the lipid bilayer of the EV. In some aspects, the ASO is connected to the anchoring moiety on the outer surface of the EV. In some aspects, the ASO is connected to the anchoring moiety on the luminal surface of the EV. In some aspects, the ASO is connected to the anchoring moiety. In some aspects, the anchoring moiety comprises a scaffolding moiety.

[0019] In some aspects, the ASO is connected to the EV via a linker. In some aspects, the linker is a polypeptide. In some aspects, the linker is a non-polypeptide moiety. In some aspects, the linker comprises ethylene glycol. In some aspects, the linker comprises HEG, TEG, PEG, or any combination thereof. In some aspects, the linker comprises acrylic acid phosphoramidite (e.g., ACRYDITE TM ), adenylation, azide (NHS ester), digoxin (NHS ester), cholesterol-TEG, I-LINKER TM , amino modifiers (e.g., amino modifier C6, amino modifier C12, amino modifier C6 dT or Uni-Link TM In some aspects, the linker comprises (i) a maleimide moiety and (ii) a valine-alanine-p-aminobenzylcarbamate or a valine-citrulline-p-aminobenzylcarbamate. In some aspects, the linker comprises (i) a maleimide moiety and (ii) a valine-alanine-p-aminobenzylcarbamate or a valine-citrulline-p-aminobenzylcarbamate.

[0020] In some aspects, the extracellular vesicle further comprises an exogenous targeting moiety. In some aspects, the exogenous targeting moiety comprises a peptide, an antibody or an antigen-binding fragment thereof, a chemical compound, an RNA aptamer, or any combination thereof.

[0021] In some aspects, the exogenous targeting moiety comprises a peptide. In some aspects, the exogenous targeting moiety comprises a microprotein, a designed ankyrin repeat protein (darpin), anticalin, adnectin, an aptamer, a peptide mimetic molecule, a natural ligand of a receptor, a camelid nanobody, or any combination thereof. In some aspects, the exogenous targeting moiety comprises a full-length antibody, a single domain antibody, a heavy chain antibody only (VHH), a single-chain antibody, a shark heavy chain antibody only (VNAR), scFv, Fv, Fab, Fab', F(ab')2, or any combination thereof. In some aspects, the antibody is a single-chain antibody.

[0022] In some aspects, the exogenous targeting moiety targets exosomes to the liver, heart, lung, brain, kidney, central nervous system, peripheral nervous system, muscle, bone, joint, skin, intestine, bladder, pancreas, lymph node, spleen, blood, bone marrow, or any combination thereof. In some aspects, the exogenous targeting moiety targets the extracellular vesicles to tumor cells, dendritic cells, T cells, B cells, macrophages, neurons, hepatocytes, Kupffer cells, myeloid cells (e.g., neutrophils, monocytes, macrophages, hematopoietic stem cells, MDSCs (e.g., monocytic MDSCs or granulocytic MDSCs)) or any combination thereof.

[0023] In some aspects, the extracellular vesicle comprises a scaffold portion that connects the exogenous targeting moiety to the extracellular vesicle. In some aspects, the scaffold portion is scaffold X. In some aspects, the scaffold portion is scaffold Y. In some aspects, the extracellular vesicle is an exosome.

[0024] In some aspects, the ASO or the ASO and the extracellular vesicles are administered by a route selected from the group consisting of parenteral administration, topical administration, intravenous administration, oral administration, subcutaneous administration, intraarterial administration, intradermal administration, transdermal administration, rectal administration, intracranial administration, intraperitoneal administration, intrathecal administration, intranasal administration, intratumoral administration, intramuscular administration, inhalation, and any combination thereof.

[0025] In some aspects, the method further comprises administering a PD-1 antagonist to the subject. In some aspects, the PD-1 antagonist comprises an antibody or an antigen-binding portion thereof ("anti-PD-1 antibody") that specifically binds to human PD-1 and blocks or inhibits the interaction between PD-1 and PD-L1. In some aspects, the anti-PD-1 antibody is selected from the group consisting of: nivolumab, pembrolizumab, PDR001, MEDI-0680, cemiplimab, JS001, BGB-A317, INCSHR1210, TSR-042, GLS-010, AM-0001, STI-1110, AGEN2034, MGA012, IBI308, and any combination thereof. In some aspects, the PD-1 antagonist comprises an antibody or antigen-binding portion thereof that specifically binds to human PD-L1 and blocks or inhibits the interaction between PD-1 and PD-L1 ("anti-PD-L1 antibody"). In some aspects, the anti-PD-L1 antibody is selected from the group consisting of atezolizumab, durvalumab, avelumab, STI-1014, CX-072, KN035, LY3300054, CK-301, BMS-936559, and any combination thereof.

[0026] In some aspects, (i) the ASO or the ASO and the extracellular vesicle and (ii) the PD-1 antagonist are administered simultaneously. In some aspects, (i) the ASO or the ASO and the extracellular vesicle and (ii) the PD-1 antagonist are administered sequentially. In some aspects, (i) the ASO or the ASO and the extracellular vesicle and (i) the PD-1 antagonist are administered on different days.

[0027] In some aspects, the PD-1 antagonist is linked to or associated with the extracellular vesicle.

[0028] In some aspects, the subject has cancer. In some aspects, the cancer is selected from the group consisting of fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, head and neck cancer squamous cell carcinoma, colorectal cancer, lymphoma, leukemia, liver cancer, gastric cancer, glioblastoma, melanoma, myeloma basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, non-seminoma, embryonal carcinoma, Wilms' In some aspects, the cancer comprises hepatocellular carcinoma (HCC). In some aspects, the cancer comprises advanced HCC. In some aspects, the cancer comprises gastric cancer. In some aspects, the cancer comprises colorectal cancer. In some aspects, the cancer has metastasized to the liver. In some aspects, the cancer is refractory to previous therapy.

[0029] In some aspects, the method further comprises administering an additional anticancer agent. In some aspects, the additional anticancer agent comprises a standard of care therapy.

[0030] In some aspects, the amount of the one or more ASOs in the dose is measured using anion exchange chromatography (AEX). In some aspects, the AEX comprises AEX ultrapure liquid chromatography (UPLC).

[0031] In some aspects, the amount of the one or more ASOs in the dose is measured using hydrophilic chromatography.

[0032] In some aspects, the amount of the one or more ASOs in the dose is measured using a ribogreen assay. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 List the targets of STAT6 ( Figure 1) transcript. The table includes the following information (from left to right): (i) description of the ASO; (ii) sequence of the ASO without any specific design or chemical structure; (iii) SEQ ID number assigned to the ASO sequence only; (iv) length of the ASO; (v) sequence of the ASO with chemical structure; and (vi) target start and end positions on the target transcript sequence (SEQ ID NO: 3). The ASOs are in 5' to 3' order. The symbols in the chemical structure are as follows: Nb means LNA; dN means DNA; 5MdC means 5-methyl-dC; Nm means MOE; and s means phosphorothioate.

[0034] Figure 2 is a schematic diagram of PTGFRN-overexpressing exosomes loaded with STAT6-targeting ASO.

[0035] Figure 3A-3B is a representative chromatogram of exo-ASO-STAT6 obtained by anion exchange chromatography ultrapure liquid chromatography (AEX-UPLC). DETAILED DESCRIPTION

[0036] Some aspects of the present disclosure relate to a method for preventing or treating a disease or condition in a subject in need thereof, the method comprising administering to the subject a dose of one or more antisense oligonucleotides (ASOs) targeting a STAT6 transcript (SEQ ID NO: 1 or SEQ ID NO: 3), wherein each of the one or more ASOs comprises a continuous nucleotide sequence of 10 to 30 nucleotides in length, the continuous nucleotide sequence being complementary to a nucleic acid sequence within the STAT6 transcript; and wherein the amount of the one or more ASOs in the dose is at least about 0.01 mg to at least about 240 mg. In some aspects, the ASOs are delivered by one or more EVs. In some aspects, the one or more ASOs are associated with the one or more EVs. In some aspects, the ASOs are connected to the surface of the EVs. In some aspects, the ASOs are connected to the outer surface of the EVs. In some aspects, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, or at least about 90% of the one or more ASOs are associated with the one or more EVs.

[0037] I. Definitions

[0038] In order that this description may be more readily understood, certain terms are first defined. Additional definitions are set forth throughout the detailed description.

[0039] It should be noted that the term "a / an" entity refers to one or more entities in the entity; for example, "nucleotide sequence" is understood to mean one or more nucleotide sequences. Thus, the terms "a / a" (or "an"), "one or more", and "at least one" are used interchangeably herein.

[0040] Furthermore, the use of "and / or" herein should be considered as explicitly disclosing each of the two specified features or components with or without the other. Thus, the term "and / or" as used herein in phrases such as "A and / or B" is intended to include "A and B," "A or B," "A" (alone), and "B" (alone). Likewise, the term "and / or" as used in phrases such as "A, B, and / or C" is intended to cover each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0041] It should be understood that wherever herein aspects are described with the language "comprising," otherwise similar aspects described according to "consisting of" and / or "consisting essentially of" are also provided.

[0042] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art in the relevant field of the present disclosure. For example, the following provides a common dictionary of many terms used in the present disclosure for technical personnel: Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd edition, 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd edition, 1999, Academic Press; and Oxford Dictionary of Biochemistry and Molecular Biology, revised edition, 2000, Oxford University Press.

[0043] Units, prefixes and symbols are expressed in the form accepted by the International System of Units (SI). Numerical ranges include the numbers that define the range. Unless otherwise indicated, nucleotide sequences are written from left to right in a 5' to 3' orientation. Amino acid sequences are written from left to right in an amino to carboxyl orientation. The titles provided herein are not limitations on the various aspects of the present disclosure, which can be obtained by reference to the entire specification. Therefore, the terms defined immediately below are more fully defined by reference to the specification as a whole.

[0044] As used herein, the term "about" means approximately, roughly, about, or in the region thereof. When the term "about" is used in conjunction with a numerical range, the term modifies the range by extending the limits above and below the numerical values ​​set forth. Typically, the term "about" can modify the numerical value to be above and below the value set forth by a change of, for example, 10% up or down (higher or lower). For example, if it is stated that "ASO reduces the expression of STAT6 protein in cells after administration of ASO by at least about 60%", it implies a range of 50% to 70% reduction in STAT6 levels.

[0045] The term "antisense oligonucleotide" (ASO) refers to an oligomer or polymer of nucleosides, such as naturally occurring nucleosides or modified forms thereof, which are covalently linked to each other by internucleotide bonds. ASOs for use in the present disclosure include at least one non-naturally occurring nucleoside. The ASO is at least partially complementary to a target nucleic acid, such that the ASO hybridizes to the target nucleic acid sequence.

[0046] The term "nucleic acid" or "nucleotide" is intended to encompass a plurality of nucleic acids. In some aspects, the term "nucleic acid" or "nucleotide" refers to a target sequence in vivo or in vitro, for example, a pre-mRNA, mRNA or DNA. When the term refers to a nucleic acid or nucleotide in a target sequence, the nucleic acid or nucleotide may be a sequence naturally occurring in a cell. In other aspects, "nucleic acid" or "nucleotide" refers to a sequence in an ASO of the present disclosure. When the term refers to a sequence in an ASO, the nucleic acid or nucleotide may be non-naturally occurring, i.e., chemically synthesized, enzymatically produced, recombinantly produced, or any combination thereof. In some aspects, the nucleic acid or nucleotide in an ASO is synthetically or recombinantly produced, but is not a naturally occurring sequence or fragment thereof. In some aspects, the nucleic acid or nucleotide in an ASO is not naturally occurring because the nucleic acid or nucleotide contains at least one nucleoside analog that is not naturally occurring in nature.

[0047] The term "nucleotide" as used herein refers to a glycoside comprising a sugar moiety, a base moiety and a covalent linking group (bond group), such as a phosphate or phosphorothioate internucleotide bond group, and encompasses naturally occurring nucleotides (such as DNA or RNA) and non-naturally occurring nucleotides comprising modified sugar and / or base moieties, which are also referred to herein as "nucleotide analogs". In this article, a single nucleotide may be referred to as a monomer or unit. In certain aspects, the term "nucleotide analog" refers to a nucleotide with a modified sugar moiety. Non-limiting examples of nucleotides (e.g., LNA) with modified sugar moieties are disclosed elsewhere herein. In other aspects, the term "nucleotide analog" refers to a nucleotide with a modified nucleobase moiety. Nucleotides with modified nucleobase moieties include, but are not limited to, 5-methyl-cytosine, isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 6-aminopurine, 2-aminopurine, inosine, diaminopurine, and 2-chloro-6-aminopurine. In some aspects, the terms "nucleotide," "unit," and "monomer" are used interchangeably. It should be recognized that when referring to a sequence of nucleotides or monomers, reference is made to the sequence of bases (such as A, T, G, C or U and their analogs).

[0048] As used herein, term " nucleoside " refers to the glycoside comprising sugar moiety and base moiety, and therefore can be used to refer to the nucleotide unit that is covalently connected by the internucleotide bond between the nucleotide of ASO.In the field of biotechnology, term " nucleotide " is generally used to refer to nucleic acid monomer or unit.In the context of ASO, term " nucleotide " can refer to single base, that is, the core base sequence comprising cytosine (DNA and RNA), guanine (DNA and RNA), adenine (DNA and RNA), thymine (DNA) and uracil (RNA), wherein the existence of sugar backbone and internucleotide bond is implicit.Equally, specifically in the case of the oligonucleotide that one or more internucleotide bond groups in the internucleotide bond group are modified, term " nucleotide " can refer to " nucleoside " for example, term " nucleotide " can be used, even when specifying the existence of the bond between nucleoside or the property, described term can be used.

[0049] As used herein, the term "nucleotide length" refers to the total number of nucleotides (monomers) in a given sequence. For example, the sequence of ASO-STAT6-1053 (SEQ ID NO: 91) has 15 nucleotides; therefore, the nucleotide length of the sequence is 15. Therefore, the term "nucleotide length" is used interchangeably with "nucleotide number" herein.

[0050] As one of ordinary skill in the art will recognize, the 5' terminal nucleotide of an oligonucleotide does not contain a 5' internucleotide linkage group, although it may contain a 5' terminal group.

[0051] The compounds described herein may contain several asymmetric centers and may exist as optically pure enantiomers, mixtures of enantiomers (e.g., racemates), mixtures of diastereomers, diastereomeric racemates, or mixtures of diastereomeric racemates. In some aspects, the asymmetric center may be an asymmetric carbon atom. The term "asymmetric carbon atom" means a carbon atom with four different substituents. According to the Cahn-Ingold-Prelog convention, an asymmetric carbon atom may be in the "R" or "S" configuration.

[0052] As used herein, the term "bicyclic sugar" refers to a modified sugar moiety comprising a 4 to 7 ring, wherein the ring comprises two atoms connecting the 4 to 7 rings to form a bridge of the second ring, thereby forming a bicyclic structure. In some aspects, the bridge connects the C2' and C4' (i.e., the 2'-4' bridge) of the ribose ring of the nucleoside, as observed in LNA nucleosides.

[0053] The term "region" when used in the context of a nucleotide sequence refers to a segment of the sequence. For example, the phrase "region within a nucleotide sequence" or "region within the complement of a nucleotide sequence" refers to a sequence that is shorter than a nucleotide sequence, but longer than at least 10 nucleotides located within a particular nucleotide sequence or the complement of a nucleotide sequence, respectively. The term "sub-sequence" or "subsequence" may also refer to a region of a nucleotide sequence.

[0054] The term "transcript" as used herein may refer to a primary transcript synthesized by transcription of DNA and processed to become a messenger RNA (mRNA), i.e., a precursor messenger RNA (pre-mRNA) and the processed mRNA itself. The term "transcript" may be used interchangeably with "pre-mRNA" and "mRNA". After the DNA chain is transcribed into a primary transcript, the newly synthesized primary transcript is modified in several ways to be converted into its mature, functional form, thereby producing different proteins and RNAs, such as mRNA, tRNA, rRNA, lncRNA, miRNA, etc. Therefore, the term "transcript" may include exons, introns, 5'UTRs, and 3'UTRs.

[0055] As used herein, the term "expression" refers to the process by which a polynucleotide produces a gene product, such as an RNA or a polypeptide. It includes, but is not limited to, the transcription of a polynucleotide into a messenger RNA (mRNA) and the translation of the mRNA into a polypeptide. Expression produces a "gene product" as used herein, and a gene product can be a nucleic acid (e.g., a messenger RNA produced by gene transcription), or a polypeptide translated from a transcript. The gene products described herein further include nucleic acids with post-transcriptional modifications (e.g., polyadenylation or splicing), or polypeptides with post-translational modifications (e.g., methylation, glycosylation, addition of lipids, association with other protein subunits, or proteolytic cleavage).

[0056] In the context of two or more nucleic acids, the term "identical" or "percent identity" means that two or more sequences are identical or have a specified percentage of identical nucleotides or amino acid residues when compared and aligned (if necessary, introducing gaps) for maximum correspondence, without considering any conservative amino acid substitutions as part of the sequence identity. Percent identity can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software that can be used to obtain alignments of amino acid or nucleotide sequences are known in the art.

[0057] One such non-limiting example of a sequence alignment algorithm is the algorithm described in Karlin et al., 1990, Proc. Natl. Acad. Sci., 87:2264-2268, as modified in Karlin et al., 1993, Proc. Natl. Acad. Sci., 90:5873-5877, and incorporated into the NBLAST and XBLAST programs (Altschul et al., 1991, Nucleic Acids Res., 25:3389-3402). In certain aspects, gapped BLAST may be used as described in Altschul et al., 1997, Nucleic Acids Res., 25:3389-3402. BLAST-2, WU-BLAST-2 (Altschul et al., 1996, Methods in Enzymology, 266:460-480), ALIGN, ALIGN-2 (Genentech, South San Francisco, California), or Megalign (DNASTAR) are other publicly available software programs that can be used to align sequences. In certain aspects, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (e.g., using the NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 90 and a length weight of 1, 2, 3, 4, 5, or 6). In certain alternative aspects, the GAP program in the GCG software package incorporates the algorithm of Needleman and Wunsch (J. Mol. Biol. (48): 444-453 (1970)) can be used to determine the percent identity between two amino acid sequences (e.g., using a BLOSUM 62 matrix or a PAM250 matrix, and gap weights of 16, 14, 12, 10, 8, 6 or 4 and length weights of 1, 2, 3, 4, 5). Alternatively, in certain aspects, the percent identity between nucleotide or amino acid sequences is determined using the algorithm of Myers and Miller (Computers in Biosciences (CABIOS), 4: 11-17 (1989). For example, the ALIGN program (version 2.0) can be used and PAM120 with a residue table, a gap length penalty of 12, and a gap penalty of 4 can be used to determine the percent identity. One skilled in the art can determine appropriate parameters for maximum alignment by specific alignment software. In certain aspects, the default parameters of the alignment software are used.

[0058] In certain aspects, the percent identity "X" of a first nucleotide sequence to a second nucleotide sequence is calculated as 100 x (Y / Z), where Y is the number of amino acid residues scored as identical matches in an alignment of the first sequence to the second sequence (as aligned by visual inspection or a specific sequence alignment program) and Z is the total number of residues in the second sequence. If the first sequence is longer than the second sequence, the percent identity of the first sequence to the second sequence will be higher than the percent identity of the second sequence to the first sequence.

[0059] Different regions within a single polynucleotide target sequence aligned to a polynucleotide reference sequence can each have their own percent sequence identity. It should be noted that percent sequence identity values ​​are rounded to the nearest tenth. For example, 80.11, 80.12, 80.13, and 80.14 are rounded down to 80.1, while 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2. It should also be noted that length values ​​will always be integers.

[0060] As used herein, the terms "homologous" and "homology" are interchangeable with the terms "identity" and "identical."

[0061] The term "naturally occurring variant thereof" refers to a variant of a STAT6 polypeptide sequence or a STAT6 nucleic acid sequence (e.g., transcript), which is naturally present in a defined classification group, such as in mammals (e.g., mice, monkeys, and humans). Typically, when referring to a "naturally occurring variant" of a polynucleotide, the term may also encompass any allelic variant of the genomic DNA encoding STAT6 produced by chromosomal translocation or replication (found at 247,416,156-247,449,108 at chromosome position 1q44 (i.e., nucleotides 247,416,156-247,449,108 of GenBank accession number NC_000001.11), and RNA, such as mRNA derived therefrom."naturally occurring variant" may also include variants derived from alternative splicing of STAT6 mRNA. When referring to a specific polypeptide sequence, for example, the term also includes a naturally occurring form of a protein, which may be processed, for example, by co-translation or post-translational modification, such as signal peptide cleavage, proteolytic cleavage, glycosylation, etc.

[0062] When determining the degree of "complementarity" between the ASO (or region thereof) of the present disclosure and the target region (e.g., the target region disclosed herein) of the nucleic acid encoding mammalian STAT6 (e.g., STAT6 gene), the degree of "complementarity" (also referred to as "homology" or "identity") is expressed as the percentage of identity (or homology percentage) between the sequence of the ASO (or region thereof) and the sequence of the target region (or the reverse complement of the target region) that is optimally aligned therewith. The percentage is calculated by calculating the number of aligned bases that are identical between the two sequences, dividing by the total number of consecutive monomers in the ASO, and multiplying by 100. In such comparisons, if there are gaps, it is preferred that such gaps are simply mismatches, rather than areas where the number of monomers differs within the gap between the ASO of the present disclosure and the target region.

[0063] As used herein, the term "complement" indicates a sequence complementary to a reference sequence. As is well known, complementarity is the fundamental principle of DNA replication and transcription, because the complementarity is a property shared between two DNA or RNA sequences, so when the two DNA or RNA sequences are aligned antiparallel to each other, the nucleotide bases at each position in the sequence will be complementary, just like looking in a mirror and seeing the opposite. Therefore, for example, the complement of the sequence of 5' "ATGC" 3' can be written as 3' "TACG" 5' or 5' "GCAT" 3'. As used herein, the terms "reverse complement", "reverse complement" and "reverse complementarity" can be interchanged with the terms "complement", "complementary" and "complementarity". In some aspects, the term "complementary" refers to 100% matching or complementarity (i.e., complete complementation) with a continuous nucleic acid sequence within a STAT6 transcript. In some aspects, the term "complementary" refers to at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% match or complementarity to a contiguous nucleic acid sequence within a STAT6 transcript.

[0064] When referring to two separate nucleic acid or nucleotide sequences, the terms "corresponding to" and "corresponds to" can be used to illustrate regions of sequences that correspond or are similar to each other based on homology and / or functionality, although the nucleotides of a particular sequence may be numbered differently. For example, different isoforms of a gene transcript may have similar or conserved nucleotide sequence portions, and the numbering of the nucleotide sequences may differ in corresponding isoforms based on alternative splicing and / or other modifications. In addition, it is recognized that different numbering systems may be used when characterizing nucleic acid or nucleotide sequences (e.g., gene transcripts and whether the sequence is numbered starting from the translation start codon or including the 5'UTR). Further, it is recognized that the nucleic acid or nucleotide sequences of different variants of a gene or gene transcript may be different. However, as used herein, regions of variants that share nucleic acid or nucleotide sequence homology and / or functionality are considered to "correspond" to each other. For example, a nucleotide sequence of a STAT6 transcript corresponding to nucleotides X to Y of SEQ ID NO: 1 ("reference sequence") refers to a STAT6 transcript sequence (e.g., STAT6 pre-mRNA or mRNA) having the same sequence or a similar sequence as nucleotides X to Y of SEQ ID NO: 1, wherein X is a start site and Y is a stop site (e.g., Figure 1 By aligning the STAT6 transcript sequence with SEQ ID NO: 1, one of ordinary skill in the art can identify the corresponding X and Y residues in the STAT6 transcript sequence.

[0065] The terms "corresponding nucleotide analogs" and "corresponding nucleotides" are intended to mean that a nucleotide analog has the same pairing or hybridization ability as a nucleobase in a naturally occurring nucleotide. For example, when the 2-deoxyribose unit of a nucleotide is linked to adenine, a "corresponding nucleotide analog" contains a pentose unit (different from 2-deoxyribose) linked to adenine.

[0066] ASO chemistry is annotated as follows: β-D-oxy-LNA nucleotides are represented by OxyB, where B represents a nucleotide base such as thymine (T), uridine (U), cytosine (C), 5-methylcytosine (MC), adenine (a), or guanine (G), and thus include OxyA, OxyT, OxyMC, OxyC, and OxyG. DNA nucleotides are represented by DNAb, where lowercase b represents a nucleotide base such as thymine (T), uridine (U), cytosine (C), 5-methylcytosine (Mc), adenine (A), or guanine (G), and thus include DNAa, DNAt, DNA, and DNAg. The letter M before C or c indicates 5-methylcytosine. The letter "s" indicates a phosphorothioate internucleotide bond.

[0067] As used herein, the term "ASO Number" or "ASO No." refers to a unique number assigned to a nucleotide sequence having a detailed chemical structure of components such as nucleosides (e.g., DNA), nucleoside analogs (e.g., β-D-oxy-LNA), nucleobases (e.g., A, T, G, C, U or MC), and backbone structures (e.g., phosphorothioate or phosphodiester). For example, ASO-STAT6-1053 may refer to STAT6-1053 (SEQ ID NO: 91).

[0068] "Potency" is usually expressed as IC 50 or EC 50 Values, unless otherwise stated, are in μM, nM, or pM units. Potency can also be expressed as percent inhibition. IC 50 is the median inhibitory concentration of the therapeutic molecule. EC 50 is the median effective concentration of the therapeutic molecule relative to vehicle or control (e.g., saline). In functional assays, IC 50 EC is the concentration of a therapeutic molecule that reduces a biological response (e.g., mRNA transcription or protein expression) by 50% of the biological response achieved by the therapeutic molecule. 50 IC is the concentration of the therapeutic molecule that produces 50% of the biological response (e.g., mRNA transcription or protein expression). 50 or EC 50 It can be calculated by many methods known in the art.

[0069] As used herein, the term "inhibition", for example, the expression of STAT6 gene transcripts and / or STAT6 proteins refers to that ASO reduces the expression of STAT6 gene transcripts and / or STAT6 proteins in cells or tissues. In some aspects, the term "inhibition" refers to the complete inhibition (100% inhibition or undetectable level) of STAT6 gene transcripts or STAT6 proteins. In other aspects, the term "inhibition" refers to at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 99% inhibition of STAT6 gene transcripts and / or STAT6 protein expression in cells or tissues.

[0070] As used herein, the term "extracellular vesicle" or "EV" refers to a cell-derived vesicle comprising a membrane that wraps an internal space. Extracellular vesicles include all membrane-bound vesicles (e.g., exosomes, nanovesicles) whose diameter is less than the diameter of the cell from which it is derived. In some aspects, the diameter of the extracellular vesicle is in the range of 20nm to 1000nm, and may include being in the internal space (i.e., lumen), displayed on the outer surface of the extracellular vesicle, and / or various macromolecular payloads across the membrane. In some aspects, the payload may include nucleic acids, proteins, carbohydrates, lipids, small molecules and / or combinations thereof. In some aspects, the extracellular medium includes a scaffold portion. For example, and not limitation, extracellular vesicles include apoptotic bodies, cell fragments, vesicles derived from cells by direct or indirect manipulation (e.g., by continuous extrusion or treatment with alkaline solution), vesicles, vesicle organelles, and vesicles produced by living cells (e.g., by direct plasma membrane budding or late endosomes and plasma membrane fusion). Extracellular vesicles can be derived from living or dead organisms, explanted tissues or organs, prokaryotic or eukaryotic cells, and / or cultured cells. In some aspects, extracellular vesicles are produced by cells expressing one or more transgenic products.

[0071] As used herein, the term "exosome" refers to an extracellular vesicle with a diameter between 20-300nm (e.g., between 40-200nm). Exosomes include a membrane that encloses an internal space (i.e., an inner cavity), and in some aspects, can be produced from cells (e.g., producer cells) by direct plasma membrane budding or by fusing late endosomes with plasma membranes. In some aspects, exosomes include a scaffold portion. As described below, exosomes can be derived from producer cells and can be separated from producer cells based on their size, density, biochemical parameters, or a combination thereof. In some aspects, EVs (e.g., exosomes) disclosed herein are produced by cells expressing one or more transgenic products.

[0072] As used herein, the term "nanovesicle" refers to an extracellular vesicle with a diameter between 20-250nm (e.g., between 30-150nm), and is produced from a cell (e.g., a producer cell) by direct or indirect manipulation so that the cell does not produce nanovesicles without manipulation. Suitable manipulation of cells to produce nanovesicles includes but is not limited to continuous extrusion, alkaline solution treatment, ultrasonic treatment, or a combination thereof. In some aspects, the generation of nanovesicles may cause the destruction of producer cells. In some aspects, the nanovesicle colony described herein is substantially free of vesicles derived from producer cells by direct budding from plasma membrane or late endosome fusion with plasma membrane. In some aspects, the nanovesicle comprises a scaffold portion. Once nanovesicles are obtained from producer cells, they can be separated from producer cells based on their size, density, biochemical parameters, or a combination thereof.

[0073] As used herein, the term "surface engineered EV (e.g., exosome)" (e.g., Scaffold X engineered EV (e.g., exosome)) refers to an EV (e.g., exosome) having a membrane or surface of an EV (e.g., exosome) modified in its composition such that the surface of the engineered EV (e.g., exosome) is different from the surface of the EV (e.g., exosome) before modification or a naturally occurring EV (e.g., exosome). The engineering can be performed on the surface of the EV (e.g., exosome) or in the membrane of the EV (e.g., exosome) such that the surface of the EV (e.g., exosome) is altered. For example, the membrane is modified in its composition of proteins, lipids, small molecules, carbohydrates, etc. The composition can be altered by chemical, physical or biological methods, or by being produced by cells that have been previously or simultaneously modified by chemical, physical or biological methods. Specifically, the composition can be altered by genetic engineering or by being produced by cells that have been previously modified by genetic engineering. In some aspects, the surface engineered EV (e.g., exosome) comprises an exogenous protein (i.e., a protein that is not naturally expressed by the EV (e.g., exosome)) or a fragment or variant thereof, which can be exposed on the surface of the EV (e.g., exosome) or can be an anchor point (attachment) for a portion exposed on the surface of the EV (e.g., exosome). In other aspects, the surface engineered EV (e.g., exosome) comprises a higher expressed (e.g., higher amount) natural exosomal protein (e.g., Scaffold X) or a fragment or variant thereof, which can be exposed on the surface of the EV (e.g., exosome) or can be an anchor point (attachment) for a portion exposed on the surface of the EV (e.g., exosome).

[0074] As used herein, the term "luminal engineered exosomes" (e.g., Scaffold Y engineered exosomes) refers to EVs (e.g., exosomes) having a membrane or lumen modified in its composition such that the lumen of the engineered EV (e.g., exosome) is different from the lumen of the EV (e.g., exosome) before modification or a naturally occurring EV (e.g., exosome). The engineering can be performed directly in the lumen of the EV (e.g., exosome) or in the membrane such that the lumen of the EV (e.g., exosome) is altered. For example, the membrane is modified in its composition of proteins, lipids, small molecules, carbohydrates, etc. such that the lumen of the EV (e.g., exosome) is modified. The composition can be altered by chemical, physical, or biological methods, or by being produced by cells previously modified by chemical, physical, or biological methods. Specifically, the composition can be altered by genetic engineering or by being produced by cells previously modified by genetic engineering. In some aspects, the lumen-engineered exosomes comprise exogenous proteins (i.e., proteins not naturally expressed by EVs (e.g., exosomes)) or fragments or variants thereof, which may be exposed in the lumen of EVs (e.g., exosomes) or may be anchor points (attachments) of portions exposed on the inner layer of EVs (e.g., exosomes). In other aspects, lumen-engineered EVs (e.g., exosomes) comprise more highly expressed natural exosomal proteins (e.g., Scaffold X or Scaffold Y) or fragments or variants thereof, which may be exposed in the lumen of exosomes or may be anchor points (attachments) of portions exposed in the lumen of exosomes.

[0075] The term "modified", when used in the context of EVs (e.g., exosomes described herein), refers to changes or engineering of EVs (e.g., exosomes and / or their producer cells) such that the modified EVs (e.g., exosomes) are different from naturally occurring EVs (e.g., exosomes). In some aspects, the modified EVs (e.g., exosomes) described herein contain a membrane that is different from the membrane of a naturally occurring EV (e.g., exosome) in terms of the composition of proteins, lipids, small molecules, carbohydrates, etc. (e.g., the membrane contains a higher density or amount of native exosomal proteins and / or the membrane contains proteins that do not naturally occur in exosomes (e.g., ASOs)). In some aspects, such modifications to the membrane change the outer surface of the EVs (e.g., exosomes) (e.g., surface engineered EVs (e.g., exosomes) described herein). In some aspects, such modifications to the membrane change the lumen of the EVs (e.g., exosomes) (e.g., lumen engineered EVs (e.g., exosomes) described herein).

[0076] As used herein, the term "scaffold moiety" refers to a molecule on the luminal surface or the outer surface of an EV (e.g., an exosome) that can be used to anchor a payload or any other compound of interest (e.g., an ASO) to an EV (e.g., an exosome). In certain aspects, the scaffold moiety comprises a synthetic molecule. In certain aspects, the scaffold moiety comprises a non-polypeptide moiety. In other aspects, the scaffold moiety comprises a lipid, carbohydrate, or protein that is naturally present in an EV (e.g., an exosome). In certain aspects, the scaffold moiety comprises a lipid, carbohydrate, or protein that is not naturally present in an EV (e.g., an exosome). In certain aspects, the scaffold moiety is Scaffold X. In certain aspects, the scaffold moiety is Scaffold Y. In other aspects, the scaffold moiety comprises both Scaffold X and Scaffold Y. Non-limiting examples of other scaffold moieties that can be used in the present disclosure include: aminopeptidase N (CD13); neprilysin, also known as membrane metalloendopeptidase (MME); ectonucleotide pyrophosphatase / phosphodiesterase family member 1 (ENPP1); neuropilin-1 (NRP1); CD9, CD63, CD81, PDGFR, GPI-anchored protein, lactadherin (MFGE8), LAMP2, and LAMP2B.

[0077] As used herein, the term "Scaffold X" refers to an exosomal protein recently identified on the surface of exosomes. See, e.g., U.S. Pat. No. 10,195,290, which is incorporated herein by reference in its entirety. Non-limiting examples of Scaffold X proteins include: prostaglandin F2 receptor negative regulator ("PTGFRN protein"); basic glycoprotein ("BSG protein"); immunoglobulin superfamily member 2 ("IGSF2 protein"); immunoglobulin superfamily member 3 ("IGSF3 protein"); immunoglobulin superfamily member 8 ("IGSF8 protein"); integrin beta-1 ("ITGB1 protein"); integrin alpha-4 ("ITGA4 protein"); 4F2 cell surface antigen heavy chain ("SLC3A2 protein"); a class of ATP transporters ("ATP1A1 protein", "ATP1A2 protein", "ATP1A3 protein", "ATP1A4 protein", "ATP1B3 protein", "ATP2B1 protein", "ATP2B2 protein", "ATP2B3 protein", "ATP2B protein") and functional fragments thereof. In some aspects, the scaffold X protein can be a whole protein or a fragment thereof (e.g., a functional fragment, e.g., a minimal fragment capable of anchoring another moiety to the outer surface or the luminal surface of an EV (e.g., an exosome). In some aspects, the scaffold X can anchor a moiety (e.g., an ASO) to the outer surface or the luminal surface of an exosome.

[0078] As used herein, the term "scaffold Y" refers to an exosomal protein recently identified within the lumen of an exosome. Non-limiting examples of scaffold Y proteins that can be used in the compositions and methods disclosed herein include, for example, those disclosed in International Publication No. WO / 2019 / 099942 or WO 2020 / 101740, each of which is incorporated herein by reference in its entirety. Additional examples of scaffold Y proteins include: protein kinase C substrate rich in myristoylated alanine ("MARCKS protein"); protein kinase C substrate-like 1 rich in myristoylated alanine ("MARCKSL1 protein"); and brain acid soluble protein 1 ("BASP1 protein"). In some aspects, the scaffold Y protein can be a whole protein or a fragment thereof (e.g., a functional fragment, e.g., a minimal fragment capable of anchoring a portion to the lumenal surface of an exosome). In some aspects, scaffold Y can anchor a portion (e.g., an ASO) to the lumenal surface of an EV (e.g., an exosome). In some aspects, scaffold Y can anchor a moiety (e.g., an ASO) to the outer surface of an EV (e.g., an exosome).

[0079] As used herein, the term "fragment" of a protein (e.g., a therapeutic protein, scaffold X, or scaffold Y) refers to an amino acid sequence of a protein that is shorter than the naturally occurring sequence of the protein, the portion of the N-terminus and / or the C-terminus that is missing, or any portion thereof, compared to the naturally occurring protein. As used herein, the term "functional fragment" refers to a protein fragment that retains the function of the protein. Thus, in some aspects, a functional fragment of a scaffold X protein retains the ability to anchor a portion to the luminal surface or the outer surface of an EV (e.g., an exosome). Similarly, in some aspects, a functional fragment of a scaffold Y protein retains the ability to anchor a portion to the luminal surface or the outer surface of an EV (e.g., an exosome). Whether a fragment is a functional fragment can be assessed by any known method for determining the protein content of an EV (e.g., an exosome), including Western blot, FACS analysis, and fusion of a fragment with an autofluorescent protein, such as GFP. In certain aspects, a functional fragment of a Scaffold X protein retains the ability of a naturally occurring Scaffold X protein, e.g., at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100% of the ability to anchor a moiety. In some aspects, a functional fragment of a Scaffold Y protein retains the ability of a naturally occurring Scaffold Y protein, e.g., at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100% of the ability to anchor another molecule.

[0080] As used herein, the term "variant" of a molecule (e.g., a functional molecule, an antigen, a scaffold X and / or a scaffold Y) refers to a molecule that shares certain structural and functional identities with another molecule after comparison by methods known in the art. For example, a variant of a protein may include a substitution, insertion, deletion, frameshift or rearrangement in another protein.

[0081] In some aspects, the variant of Scaffold X comprises a variant with at least about 70% identity to a full-length, mature PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2 or ATP transporter or a fragment (e.g., a functional fragment) of PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2 or ATP transporter. In some aspects, the variant of PTGFRN or the variant of the fragment shares at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity with the PTGFRN according to SEQ ID NO: 301 or with its functional fragment. In some aspects, the variant of the Scaffold X protein disclosed herein or the variant of the fragment retains the ability to specifically target to EVs (e.g., exosomes). In some aspects, Scaffold X includes one or more mutations, e.g., conservative amino acid substitutions.

[0082] "Conservative amino acid substitution" is a substitution in which an amino acid residue is replaced by an amino acid residue with a similar side chain. Families of amino acid residues with similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Therefore, if an amino acid in a polypeptide is replaced by another amino acid from the same side chain family, the substitution is considered to be conservative. On the other hand, a string of amino acids can be conservatively replaced by a structurally similar string that differs in the order and / or composition of the side chain family members.

[0083] The term "percentage of sequence identity" or "percentage of identity" between two polynucleotide or polypeptide sequences refers to the number of identical matching positions shared by the sequences within the comparison window, taking into account additions or deletions (i.e., gaps) that must be introduced for optimal alignment of the two sequences. A matching position is any position where the same nucleotide or amino acid is present in both the target sequence and the reference sequence. Gaps present in the target sequence are not counted because gaps are not nucleotides or amino acids. Likewise, gaps present in the reference sequence are not counted because the target sequence nucleotides or amino acids are counted, not the nucleotides or amino acids from the reference sequence.

[0084] The percentage of sequence identity is calculated by determining the number of positions where the same amino acid residue or nucleic acid base occurs in the two sequences, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The comparison of the sequence and the determination of the percentage of sequence identity between the two sequences can be completed using readily available software that can be used and downloaded online. Suitable software programs can be obtained from various sources, and can be used for the comparison of protein sequences and nucleotide sequences. A suitable program for determining the percentage of sequence identity is bl2seq, which is a part of the BLAST program suite that can be obtained from the National Center for Biotechnology Information (National Center for Biotechnology Information) BLAST website (blast.ncbi.nlm.nih.gov) of the U.S. government. Bl2seq uses BLASTN or BLASTP algorithms to compare between two sequences. BLASTN is used to compare nucleic acid sequences, and BLASTP is used to compare amino acid sequences. Other suitable programs are for example Needle, Stretcher, Water or Matcher, which are part of the EMBOSS suite of bioinformatics programs and are also available from the European Bioinformatics Institute (EBI) at www.ebi.ac.uk / Tools / psa.

[0085] Different regions within a single polynucleotide or polypeptide target sequence aligned to a polynucleotide or polypeptide reference sequence can each have their own percent sequence identity. It should be noted that percent sequence identity values ​​are rounded to the nearest tenth. For example, 80.11, 80.12, 80.13, and 80.14 are rounded down to 80.1, while 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2. It should also be noted that length values ​​will always be integers.

[0086] Those skilled in the art will appreciate that the generation of sequence alignments for calculating sequence identity percentages is not limited to binary sequence-sequence comparisons driven completely by primary sequence data. Sequence alignments can be derived from multiple sequence alignments. A suitable program for generating multiple sequence alignments is ClustalW2, which can be obtained from www.clustal.org. Another suitable program is MUSCLE, which can be obtained from www.drive5.com / muscle / . ClustalW2 and MUSCLE can alternatively be obtained from, for example, EBI.

[0087] It should also be understood that sequence alignments can be generated by integrating sequence data with data from heterogeneous sources, such as structural data (e.g., crystal protein structures), functional data (e.g., the location of mutations), or phylogenetic data. A suitable program for integrating heterogeneous data to generate multiple sequence alignments is T-Coffee, which is available at www.tcoffee.org and alternatively available from, for example, EBI. It should also be understood that the final alignment for calculating percent sequence identity can be automatically or manually curated.

[0088] Polynucleotide variants can contain changes in coding region, noncoding region or both.On the one hand, polynucleotide variants contain silent substitutions, additions or deletions that do not change the characteristics or active changes of the encoded polypeptide.On the other hand, due to the degeneracy of the genetic code, nucleotide variants are produced by silent substitutions.In other aspects, wherein 5-10, 1-5 or 1-2 amino acids are substituted, lacked or added variants in any combination.Polynucleotide variants can be produced for a variety of reasons, for example, for optimizing the codon expression of a specific host (codons in human mRNA are changed to other codons, for example bacterial hosts, such as Escherichia coli (E.coli)).

[0089] Naturally occurring variants are called "allelic variants" and refer to one of several alternative forms of a gene occupying a given locus on a chromosome of an organism (Genes II, Lewin, B., ed., John Wiley & Sons, New York (1985)). These allelic variants may vary at the polynucleotide and / or polypeptide level and are included in the present disclosure. Alternatively, non-naturally occurring variants may be produced by mutagenesis techniques or direct synthesis.

[0090] Using known methods of protein engineering and recombinant DNA technology, variants can be produced to improve or change the properties of a polypeptide. For example, one or more amino acids can be deleted from the N-terminus or C-terminus of a secreted protein without significantly losing biological function. Ron et al., J. Biol. Chem. 268: 2984-2988 (1993), which is incorporated herein by reference in its entirety, reports variant KGF proteins with heparin binding activity even after the deletion of 3, 8 or 27 amino terminal amino acid residues. Similarly, interferon gamma exhibits up to ten times higher activity after the deletion of 8-10 amino acid residues from the carboxyl terminus of this protein. (Dobeli et al., J. Biotechnology 7: 199-216 (1988), which is incorporated herein by reference in its entirety.)

[0091] In addition, there is sufficient evidence to show that variants generally retain biological activities similar to those of naturally occurring proteins. For example, Gayle and colleagues (Journal of Biological Chemistry 268:22105-22111 (1993), the document is incorporated herein by reference in its entirety) have been subjected to extensive mutation analysis of human cytokine IL-1a. It uses random mutagenesis to produce more than 3,500 individual IL-1a mutants with an average of 2.5 amino acid changes per variant over the entire length of the molecule. Multiple mutations are examined at each possible amino acid position. The researchers found that "[most of] the molecule can be changed, with little effect on [combination or biological activity]. "(See Abstract.) In fact, in the more than 3,500 nucleotide sequences examined, only 23 unique amino acid sequences produced proteins significantly different in activity from the wild type.

[0092] As described above, polypeptide variants include, for example, modified polypeptides. Modifications include, for example, acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphatidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, pegylation (Mei et al., Blood 116:270-79 (2010), which is incorporated herein by reference in its entirety), proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination. In some aspects, Scaffold X and / or Scaffold Y are modified at any convenient location.

[0093] As used herein, the terms "linked to" or "conjugated to" are used interchangeably and refer to a covalent or non-covalent bond formed between a first moiety and a second moiety, e.g., a scaffold X and an ASO, e.g., a scaffold portion expressed in or on an extracellular vesicle and an ASO, e.g., a scaffold X (e.g., a PTGFRN protein) located in the luminal surface or on the outer surface of an extracellular vesicle, respectively.

[0094] The term "encapsulated" or grammatically different forms of the term (e.g., encapsulation or encapsulating) refers to the state or process of having a first part (e.g., ASO) located inside a second part (e.g., EV, e.g., exosome) without chemically or physically connecting the two parts. In some aspects, the term "encapsulated" can be used interchangeably with "in the lumen of..." Non-limiting examples of encapsulating a first part (e.g., ASO) into a second part (e.g., EV, e.g., exosome) are disclosed elsewhere herein.

[0095] As used herein, the term "producer cell" refers to a cell used to produce EVs (e.g., exosomes). Producer cells can be cells cultured in vitro or cells cultured in vivo. Producer cells include, but are not limited to, cells known to be effective in producing EVs (e.g., exosomes), for example, HEK293 cells, Chinese hamster ovary (CHO) cells, mesenchymal stem cells (MSCs), BJ human foreskin fibroblasts, fHDF fibroblasts, Neuronal precursor cells, Amniotic cells, adipose mesenchymal stem cells, RPTEC / TERT1 cells. In some aspects, producer cells are not antigen presenting cells. In some aspects, producer cells are not dendritic cells, B cells, mast cells, macrophages, neutrophils, Kupffer-Browicz cells, cells derived from any of these cells, or any combination thereof. In some aspects, EVs (e.g., exosomes) useful in the present disclosure do not carry antigens exposed to MHC class I or class II molecules on the surface of EVs (e.g., exosomes), but can carry antigens in the lumen of EVs (e.g., exosomes) or carry antigens on the surface of EVs (e.g., exosomes) by attaching to scaffolds X and / or scaffolds Y.

[0096] As used herein, the terms "isolate," "isolated," and "isolating," or "purify," "purified," and "purifying," and "extracted," and "extracting," are used interchangeably and refer to the state (e.g., multiple known or unknown amounts and / or concentrations) of a desired preparation of EVs that have been subjected to one or more purification processes, e.g., selection or enrichment of a desired EV preparation. In some aspects, as used herein, isolation or purification is the process of removing, partially removing (e.g., fractionating) EVs from a sample containing producer cells. In some aspects, the isolated EV composition has no detectable undesirable activity, or alternatively, the level or amount of the undesirable activity is at or below an acceptable level or amount. In other aspects, the isolated EV composition has an amount and / or concentration of the desired EVs that is at or above an acceptable amount and / or concentration. In other aspects, the isolated EV composition is enriched compared to the starting material (e.g., producer cell preparation) from which the composition is obtained. Compared to the starting material, this enrichment can be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99%, 99.999%, 99.9999% or greater than 99.9999%. In some aspects, the isolated EV preparation is substantially free of residual biological products. In some aspects, the isolated EV preparation is 100% free, 99% free, 98% free, 97% free, 96% free, 95% free, 94% free, 93% free, 92% free, 91% free or 90% free of any contaminating biological substances. Residual biological products may include non-biological materials (including chemicals) or undesirable nucleic acids, proteins, lipids, or metabolites. Substantially free of residual biological products may also mean that the EV composition contains no detectable producer cells, and only EVs are detectable.

[0097] As used herein, the term "payload" refers to an agent that acts on a target (e.g., a target cell) in contact with an EV. A non-limiting example of a payload that can be included in an EV (e.g., an exosome) is an ASO. Payloads that can be introduced into EVs (e.g., exosomes) and / or producer cells include therapeutic agents such as nucleotides (e.g., nucleotides containing a detectable portion or toxin or disrupting transcription), nucleic acids (e.g., DNA or mRNA molecules encoding polypeptides such as enzymes, or RNA molecules with regulatory functions such as miRNA, dsDNA, lncRNA, and siRNA), amino acids (e.g., amino acids containing a detectable portion or toxin or disrupting translation), polypeptides (e.g., enzymes), lipids, carbohydrates, and small molecules (e.g., small molecule drugs and toxins). In some aspects, the payload comprises an ASO.

[0098] As used herein, the term "antibody" encompasses immunoglobulins and fragments thereof that are produced naturally or partially or completely synthetically. The term also encompasses any protein having a binding domain homologous to an immunoglobulin binding domain. "Antibodies" further include polypeptides that specifically bind to and recognize antigens and contain framework regions from immunoglobulin genes or fragments thereof. As used herein, the term "antigen" refers to any agent that, when introduced into a subject, triggers an immune response (cellular or fluid) against itself. The use of the term antibody is intended to include complete antibodies, polyclonal antibodies, monoclonal antibodies and recombinant antibodies, fragments thereof, and further includes single-chain antibodies, humanized antibodies, murine antibodies, chimeric antibodies, mouse-human antibodies, mouse-primate antibodies, primate-human monoclonal antibodies, anti-idiotypic antibodies, antibody fragments, such as scFv, (scFv) 2 , Fab, Fab' and F(ab') 2 、F(ab1) 2 , Fv, dAb and Fd fragments, bifunctional antibodies and antibody-related polypeptides. Antibodies include bispecific antibodies and multispecific antibodies, as long as they exhibit the desired biological activity or function.

[0099] For example, the term "antibody" includes both naturally occurring and non-naturally occurring antibodies; monoclonal and polyclonal antibodies; chimeric and humanized Abs; human or non-human Abs; fully synthetic Abs; and single-chain Abs. Non-human antibodies can be humanized by recombinant methods to reduce their immunogenicity in humans. In the absence of explicit instructions, and unless the context indicates otherwise, the term "antibody" also includes an antigen-binding fragment or antigen-binding portion of any of the above-mentioned immunoglobulins, and includes monovalent and divalent fragments or portions, as well as single-chain Abs.

[0100] As used herein, the term "antagonist", such as a PD-1 antagonist, refers to any substance that limits, reduces, inhibits, blocks, or reduces the activity of a target. For example, a PD antagonist limits, reduces, inhibits, blocks, or otherwise reduces the activity of PD-1. Examples of antagonists include, but are not limited to, small molecules, polypeptides (e.g., ligands, receptors, antibodies, and fragments thereof), nucleic acid molecules, and any combination thereof. In certain aspects, the antagonist comprises an antibody or an antigen-binding portion thereof.

[0101] As used herein, "programmed death-1" or "PD-1" refers to an immunosuppressive receptor in the CD28 family. PD-1 is expressed primarily on previously activated T cells in vivo. PD-1 binds to two ligands, PD-L1 and PD-L2. As used herein, the term "PD-1" includes human PD-1 (hPD-1), variants, isoforms and species homologs of hPD-1, and analogs having at least one common epitope with hPD-1. The complete hPD-1 sequence can be found under GenBank accession number U64863. "PD-1" and "PD-1 receptor" are used interchangeably herein. As used herein, the term "PD-1 activity" or "PD-1 signaling" refers to, but is not limited to, the interaction between PD-1 and PD-L1 and / or PD-L1. Therefore, in some aspects, a PD-1 antagonist inhibits or blocks the interaction between PD-1 and PD-L1 (and / or PD-L2). Thus, in some aspects, a "PD-1 antagonist" comprises an anti-PD-1 antibody, an anti-PD-L1 antibody, an anti-PD-L2 antibody, or any combination thereof.

[0102] Any anti-PD-1 antibody or anti-PD-L1 antibody known in the art can be used in the methods disclosed herein. Non-limiting examples of anti-PD-1 antibodies include nivolumab (see US 8,008,449), pembrolizumab, PDR001 (see WO 2015 / 112900), MEDI-0680 (see WO 2012 / 145493), cemiplimab (see WO 2015 / 112800), JS001 (see Si-Yang Liu et al., Journal of Hematology and Oncology (J. Hematol. Oncol.) 10:136 (2017)), BGB-A317 (see WO 2015 / 35606 and US 2015 / 0079109), INCSHR1210 (see WO 2015 / 085847; ... Liu et al., Journal of Hematology and Oncology 10: 136 (2017)), TSR-042 (see WO 2014 / 179664), GLS-010 (see Si-Yang Liu et al., Journal of Hematology and Oncology 10: 136 (2017)), AM-0001, STI-1110 (see WO 2014 / 194302) AGEN2034 (see WO 2017 / 040790), MGA012 (see WO 2017 / 19846) and IBI308 (see WO 2017 / 024465, WO 2017 / 025016, WO 2017 / 132825 and WO 2017 / 133540) (each of which is incorporated herein by reference in its entirety). Non-limiting examples of anti-PD-L1 antibodies include, but are not limited to, BMS-936559 (see, e.g., US 7,943,743 and WO 2013 / 173223), atezolizumab (see, e.g., US 8,217,149), durvalumab (see WO 2011 / 066389), avelumab (see WO 2013 / 079174), STI-1014 (see WO 2013 / 181634), CX-072 (see WO 2016 / 149201), KN035 (see Zhang et al., Cell Discov. 7:3 (March 2017)), LY3300054 (see, e.g., WO 2017 / 034916) and CK-301 (see Gorelik et al., AACR: Abstract 4606 (April 2016)) (each of which is incorporated herein by reference in its entirety).

[0103] The terms "individual", "subject", "host" and "patient" are used interchangeably herein and refer to any mammalian subject, particularly a human, for whom diagnosis, treatment or therapy is desired. The compositions and methods described herein are suitable for both human therapy and veterinary applications. In some aspects, the subject is a mammal, and in other aspects, the subject is a human. As used herein, "mammalian subject" includes all mammals, including but not limited to humans, livestock (e.g., dogs, cats, etc.), farm animals (e.g., cattle, sheep, pigs, horses, etc.), and laboratory animals (e.g., monkeys, rats, mice, rabbits, guinea pigs, etc.).

[0104] The term "pharmaceutical composition" refers to a preparation that is in such form as to permit the biological activity of the active ingredient to be effective, and contains no additional components that are unacceptably toxic to a subject to which the composition would be administered. Such compositions may be sterile.

[0105] As used herein, the term "substantially free" means that a sample containing EVs (e.g., exosomes) contains less than 10% macromolecules by mass / volume (m / v) percentage concentration. Some fractions may contain less than 0.001%, less than 0.01%, less than 0.05%, less than 0.1%, less than 0.2%, less than 0.3%, less than 0.4%, less than 0.5%, less than 0.6%, less than 0.7%, less than 0.8%, less than 0.9%, less than 1%, less than 2%, less than 3%, less than 4%, less than 5%, less than 6%, less than 7%, less than 8%, less than 9%, or less than 10% (m / v) macromolecules.

[0106] As used herein, the term "macromolecule" means nucleic acids, contaminant proteins, lipids, carbohydrates, metabolites, or a combination thereof.

[0107] As used herein, the term "conventional exosomal proteins" means proteins previously known to be enriched in exosomes, including but not limited to CD9, CD63, CD81, PDGFR, GPI-anchored proteins, lactadherin (MFGE8), LAMP2 and LAMP2B, fragments thereof, or peptides bound thereto.

[0108] As used herein, "administering" refers to administering a composition comprising EVs (e.g., exosomes) disclosed herein to a subject by a pharmaceutically acceptable route. The route of administration can be intravenous administration, e.g., intravenous injection and intravenous infusion. Other routes of administration include, e.g., subcutaneous, intramuscular, oral, nasal, and pulmonary administration. EVs (e.g., exosomes) can be administered as part of a pharmaceutical composition comprising at least one excipient.

[0109] For example, an "effective amount" of an ASO or extracellular vesicle as disclosed herein is an amount sufficient to achieve a clearly stated purpose. An "effective amount" can be determined empirically and in a routine manner depending on the stated purpose.

[0110] As used herein, "treat," "treatment," or "treating" refers to, for example, reducing the severity of a disease or condition; reducing the duration of a disease process; ameliorating or eliminating one or more symptoms associated with a disease or condition; providing a beneficial effect to a subject suffering from a disease or condition, but not necessarily curing the disease or condition. The term also includes preventing or preventing a disease or condition or its symptoms. In one aspect, "treating" includes inducing hematopoiesis in a subject in need thereof. In some aspects, the disease or condition is associated with hematopoiesis or its lack. In certain aspects, the disease or condition is cancer. In some aspects, treatment enhances hematopoiesis in a subject suffering from cancer, wherein the enhanced hematopoiesis comprises increased proliferation and / or differentiation of one or more immune cells in the subject.

[0111] As used herein, "prevent" or "preventing" refers to reducing or lowering the incidence or severity of a particular outcome. In some aspects, the outcome is prevented by preventive treatment. In some aspects, the EV (e.g., exosome) comprising an ASO described herein is administered to the subject prophylactically. In some aspects, the subject is at risk of cancer. In some aspects, the subject is at risk of a hematopoietic disorder.

[0112] II. Methods of the Disclosure

[0113] Certain aspects of the present disclosure relate to methods for preventing and / or treating a disease or condition in a subject in need thereof, the methods comprising administering a dose of one or more antisense oligonucleotides (ASOs) targeted to a STAT6 transcript (SEQ ID NO: 1 or SEQ ID NO: 3), wherein each of the one or more ASOs comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within the STAT6 transcript; and wherein the amount of the one or more ASOs in the dose is at least about 0.01 mg to at least about 240 mg.

[0114] II.A. Administration

[0115] In some aspects, the dose is at least about 0.01 mg, at least about 0.05 mg, at least about 0.1 mg, at least about 0.5 mg, at least about 1 mg, at least about 2 mg, at least about 3 mg, at least about 4 mg, at least about 5 mg, at least about 6 mg, at least about 7 mg, at least about 8 mg, at least about 9 mg, at least about 10 mg, at least about 11 mg, at least about 12 mg, at least about 13 mg, at least about 14 mg, at least about 15 mg, at least about 16 mg, at least about 17 mg, at least about 18 mg, at least about 19 mg, at least about 20 mg, at least about 21 mg, at least about 22 mg, at least about 23 mg, at least about 24 mg, at least about 25 mg, at least about 26 mg, at least about 27 mg, at least about 28 mg, at least about 29 mg, at least about 30 mg, at least about 31 mg, at least about 32 mg, at least about 33 mg, at least about 34 mg, at least about 35 mg, at least about 36 mg, at least about 37 mg, at least about 38 mg, at least about 39 mg, at least about 40 mg, at least about 41 mg, at least about 42 mg, at least about 43 mg, at least about 44 mg At least about 150 mg, at least about 160 mg, at least about 170 mg, at least about 180 mg, at least about 190 mg, at least about 200 mg, at least about 220 mg, or at least about 240 mg of the one or more ASOs.

[0116] In some aspects, the dose is at least about 1 mg of the one or more ASOs. In some aspects, the dose is at least about 2 mg of the one or more ASOs. In some aspects, the dose is at least about 3 mg of the one or more ASOs. In some aspects, the dose is at least about 4 mg of the one or more ASOs. In some aspects, the dose is at least about 5 mg of the one or more ASOs. In some aspects, the dose is at least about 6 mg of the one or more ASOs. In some aspects, the dose is at least about 7 mg of the one or more ASOs. In some aspects, the dose is at least about 8 mg of the one or more ASOs. In some aspects, the dose is at least about 9 mg of the one or more ASOs. In some aspects, the dose is at least about 10 mg of the one or more ASOs.

[0117] In some aspects, the dose is at least about 11 mg of the one or more ASOs. In some aspects, the dose is at least about 12 mg of the one or more ASOs. In some aspects, the dose is at least about 13 mg of the one or more ASOs. In some aspects, the dose is at least about 14 mg of the one or more ASOs. In some aspects, the dose is at least about 15 mg of the one or more ASOs. In some aspects, the dose is at least about 16 mg of the one or more ASOs. In some aspects, the dose is at least about 17 mg of the one or more ASOs. In some aspects, the dose is at least about 18 mg of the one or more ASOs. In some aspects, the dose is at least about 19 mg of the one or more ASOs. In some aspects, the dose is at least about 20 mg of the one or more ASOs.

[0118] In some aspects, the dose is at least about 21 mg of the one or more ASOs. In some aspects, the dose is at least about 22 mg of the one or more ASOs. In some aspects, the dose is at least about 23 mg of the one or more ASOs. In some aspects, the dose is at least about 24 mg of the one or more ASOs. In some aspects, the dose is at least about 25 mg of the one or more ASOs. In some aspects, the dose is at least about 26 mg of the one or more ASOs. In some aspects, the dose is at least about 27 mg of the one or more ASOs. In some aspects, the dose is at least about 28 mg of the one or more ASOs. In some aspects, the dose is at least about 29 mg of the one or more ASOs. In some aspects, the dose is at least about 30 mg of the one or more ASOs.

[0119] In some aspects, the dose is at least about 31 mg of the one or more ASOs. In some aspects, the dose is at least about 32 mg of the one or more ASOs. In some aspects, the dose is at least about 33 mg of the one or more ASOs. In some aspects, the dose is at least about 34 mg of the one or more ASOs. In some aspects, the dose is at least about 35 mg of the one or more ASOs. In some aspects, the dose is at least about 36 mg of the one or more ASOs. In some aspects, the dose is at least about 37 mg of the one or more ASOs. In some aspects, the dose is at least about 38 mg of the one or more ASOs. In some aspects, the dose is at least about 39 mg of the one or more ASOs. In some aspects, the dose is at least about 40 mg of the one or more ASOs.

[0120] In some aspects, the dose is at least about 41 mg of the one or more ASOs. In some aspects, the dose is at least about 42 mg of the one or more ASOs. In some aspects, the dose is at least about 43 mg of the one or more ASOs. In some aspects, the dose is at least about 44 mg of the one or more ASOs. In some aspects, the dose is at least about 45 mg of the one or more ASOs. In some aspects, the dose is at least about 46 mg of the one or more ASOs. In some aspects, the dose is at least about 47 mg of the one or more ASOs. In some aspects, the dose is at least about 48 mg of the one or more ASOs. In some aspects, the dose is at least about 49 mg of the one or more ASOs. In some aspects, the dose is at least about 50 mg of the one or more ASOs.

[0121] In some aspects, the dose is at least about 51 mg of the one or more ASOs. In some aspects, the dose is at least about 52 mg of the one or more ASOs. In some aspects, the dose is at least about 53 mg of the one or more ASOs. In some aspects, the dose is at least about 54 mg of the one or more ASOs. In some aspects, the dose is at least about 55 mg of the one or more ASOs. In some aspects, the dose is at least about 56 mg of the one or more ASOs. In some aspects, the dose is at least about 57 mg of the one or more ASOs. In some aspects, the dose is at least about 58 mg of the one or more ASOs. In some aspects, the dose is at least about 59 mg of the one or more ASOs. In some aspects, the dose is at least about 60 mg of the one or more ASOs.

[0122] In some aspects, the dose is administered every day, every two days, every three days, every four days, or every five days. In some aspects, during a 1-week cycle, the dose is administered once a week, twice a week, three times a week, four times a week, or five times a week. In some aspects, during the first 1-week cycle, the dose is administered twice a week. In some aspects, during the first 1-week cycle, the dose is administered three times a week. In some aspects, during the first 1-week cycle, the dose is administered four times a week.

[0123] In some aspects, the dose is administered about once a week, about once every two weeks, about once every three weeks, or about once every four weeks. In some aspects, the dose is administered twice a week. In some aspects, the dose is administered three times a week. In some aspects, the dose is administered three times a week in the first week of a 28-day cycle. In some aspects, the dose is administered twice a week in the first week of a 28-day cycle.

[0124] In some aspects, the dosage is administered on about the 1st and 15th day of the first 28-day cycle. In some aspects, the dosage is administered on about the 1st and 15th day of the second 28-day cycle. In some aspects, the dosage is administered on about the 1st day of the third 28-day cycle. In some aspects, the dosage is administered once every 56 days after the third 28-day cycle. In some aspects, the dosage is administered (i) on about the 1st and 15th day of the first 28-day cycle, and (ii) on about the 1st and 15th day of the second 28-day cycle. In some aspects, the dosage is administered (i) on about the 1st and 15th day of the first 28-day cycle, (ii) on about the 1st and 15th day of the second 28-day cycle, and (iii) on about the 1st day of the third 28-day cycle. In certain aspects, the dose is administered (i) on about days 1 and 15 of a first 28-day cycle, (ii) on about days 1 and 15 of a second 28-day cycle, (iii) on about day 1 of a third 28-day cycle, and (iii) about every 56 days after the third 28-day cycle.

[0125] In some aspects, the dose is administered (i) three times per week in Week 1 of the first 28-day cycle, (ii) twice per week in Week 2 of the first 28-day cycle, and (iii) once per week in Week 4 of the first 28-day cycle. In some aspects, the dose is administered (i) three times per week in Week 1 of the first 28-day cycle, (ii) twice per week in Week 2 of the first 28-day cycle, (iii) once per week in Week 4 of the first 28-day cycle, and (iv) twice per month during each subsequent 28-day cycle, e.g., during the subsequent six 28-day cycles.

[0126] In some aspects, the dose is administered at a dose of about 5 mg of the ASO on about day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered at a dose of about 5 mg of the ASO (i) on about day 1 and day 15 of the first 28-day cycle, and (ii) on about day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered at a dose of about 5 mg of the ASO (i) on about day 1 and day 15 of the first 28-day cycle, (ii) on about day 1 and day 15 of the second 28-day cycle, and (iii) on about day 1 of the third 28-day cycle. In certain aspects, the dose is administered at a dose of about 5 mg (i) on about days 1 and 15 of the first 28-day cycle, (ii) on about days 1 and 15 of the second 28-day cycle, (iii) on about day 1 of the third 28-day cycle, and (iii) once about every 56 days after the third 28-day cycle.

[0127] In some aspects, the dose is administered at a dose of about 10 mg of the ASO on about day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered at a dose of about 10 mg of the ASO (i) on about day 1 and day 15 of the first 28-day cycle, and (ii) on about day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered at a dose of about 10 mg of the ASO (i) on about day 1 and day 15 of the first 28-day cycle, (ii) on about day 1 and day 15 of the second 28-day cycle, and (iii) on about day 1 of the third 28-day cycle. In certain aspects, the dose is administered at a dose of about 10 mg (i) on about days 1 and 15 of the first 28-day cycle, (ii) on about days 1 and 15 of the second 28-day cycle, (iii) on about day 1 of the third 28-day cycle, and (iii) about every 56 days after the third 28-day cycle.

[0128] In some aspects, the dose is administered at a dose of about 15 mg of the ASO on about day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered at a dose of about 15 mg of the ASO (i) on about day 1 and day 15 of the first 28-day cycle, and (ii) on about day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered at a dose of about 15 mg of the ASO (i) on about day 1 and day 15 of the first 28-day cycle, (ii) on about day 1 and day 15 of the second 28-day cycle, and (iii) on about day 1 of the third 28-day cycle. In certain aspects, the dose is administered at a dose of about 15 mg (i) on about days 1 and 15 of the first 28-day cycle, (ii) on about days 1 and 15 of the second 28-day cycle, (iii) on about day 1 of the third 28-day cycle, and (iii) once every 56 days after the third 28-day cycle.

[0129] In some aspects, the dose is administered at a dose of about 20 mg of the ASO on about day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered at a dose of about 20 mg of the ASO (i) on about day 1 and day 15 of the first 28-day cycle, and (ii) on about day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered at a dose of about 20 mg of the ASO (i) on about day 1 and day 15 of the first 28-day cycle, (ii) on about day 1 and day 15 of the second 28-day cycle, and (iii) on about day 1 of the third 28-day cycle. In certain aspects, the dose is administered at a dose of about 20 mg (i) on about days 1 and 15 of the first 28-day cycle, (ii) on about days 1 and 15 of the second 28-day cycle, (iii) on about day 1 of the third 28-day cycle, and (iii) once about every 56 days after the third 28-day cycle.

[0130] In some aspects, the dose is administered at a dose of about 25 mg of the ASO on about day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered at a dose of about 25 mg of the ASO (i) on about day 1 and day 15 of the first 28-day cycle, and (ii) on about day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered at a dose of about 25 mg of the ASO (i) on about day 1 and day 15 of the first 28-day cycle, (ii) on about day 1 and day 15 of the second 28-day cycle, and (iii) on about day 1 of the third 28-day cycle. In certain aspects, the dose is administered at a dose of about 25 mg (i) on about days 1 and 15 of the first 28-day cycle, (ii) on about days 1 and 15 of the second 28-day cycle, (iii) on about day 1 of the third 28-day cycle, and (iii) about every 56 days after the third 28-day cycle.

[0131] In some aspects, the dose is administered at a dose of about 30 mg of the ASO on about day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered at a dose of about 30 mg of the ASO (i) on about day 1 and day 15 of the first 28-day cycle, and (ii) on about day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered at a dose of about 30 mg of the ASO (i) on about day 1 and day 15 of the first 28-day cycle, (ii) on about day 1 and day 15 of the second 28-day cycle, and (iii) on about day 1 of the third 28-day cycle. In certain aspects, the dose is administered at a dose of about 30 mg (i) on about days 1 and 15 of the first 28-day cycle, (ii) on about days 1 and 15 of the second 28-day cycle, (iii) on about day 1 of the third 28-day cycle, and (iii) once about every 56 days after the third 28-day cycle.

[0132] In some aspects, the dose is administered at a dose of about 35 mg of the ASO on about day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered at a dose of about 35 mg of the ASO (i) on about day 1 and day 15 of the first 28-day cycle, and (ii) on about day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered at a dose of about 35 mg of the ASO (i) on about day 1 and day 15 of the first 28-day cycle, (ii) on about day 1 and day 15 of the second 28-day cycle, and (iii) on about day 1 of the third 28-day cycle. In certain aspects, the dose is administered at a dose of about 35 mg (i) on about days 1 and 15 of the first 28-day cycle, (ii) on about days 1 and 15 of the second 28-day cycle, (iii) on about day 1 of the third 28-day cycle, and (iii) about every 56 days after the third 28-day cycle.

[0133] In some aspects, the dose is administered at a dose of about 40 mg of the ASO on about day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered at a dose of about 40 mg of the ASO (i) on about day 1 and day 15 of the first 28-day cycle, and (ii) on about day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered at a dose of about 40 mg of the ASO (i) on about day 1 and day 15 of the first 28-day cycle, (ii) on about day 1 and day 15 of the second 28-day cycle, and (iii) on about day 1 of the third 28-day cycle. In certain aspects, the dose is administered at a dose of about 40 mg (i) on about days 1 and 15 of the first 28-day cycle, (ii) on about days 1 and 15 of the second 28-day cycle, (iii) on about day 1 of the third 28-day cycle, and (iii) about every 56 days after the third 28-day cycle.

[0134] In some aspects, the dose is administered at a dose of about 45 mg of the ASO on about day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered at a dose of about 45 mg of the ASO (i) on about day 1 and day 15 of the first 28-day cycle, and (ii) on about day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered at a dose of about 45 mg of the ASO (i) on about day 1 and day 15 of the first 28-day cycle, (ii) on about day 1 and day 15 of the second 28-day cycle, and (iii) on about day 1 of the third 28-day cycle. In certain aspects, the dose is administered at a dose of about 45 mg (i) on about days 1 and 15 of the first 28-day cycle, (ii) on about days 1 and 15 of the second 28-day cycle, (iii) on about day 1 of the third 28-day cycle, and (iii) once about every 56 days after the third 28-day cycle.

[0135] In some aspects, the dose is administered at a dose of about 50 mg of the ASO on about day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered at a dose of about 50 mg of the ASO (i) on about day 1 and day 15 of the first 28-day cycle, and (ii) on about day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered at a dose of about 50 mg of the ASO (i) on about day 1 and day 15 of the first 28-day cycle, (ii) on about day 1 and day 15 of the second 28-day cycle, and (iii) on about day 1 of the third 28-day cycle. In certain aspects, the dose is administered at a dose of about 50 mg (i) on about days 1 and 15 of the first 28-day cycle, (ii) on about days 1 and 15 of the second 28-day cycle, (iii) on about day 1 of the third 28-day cycle, and (iii) once about every 56 days after the third 28-day cycle.

[0136] In some aspects, the dose is administered at a dose of about 55 mg of the ASO on about day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered at a dose of about 55 mg of the ASO (i) on about day 1 and day 15 of the first 28-day cycle, and (ii) on about day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered at a dose of about 55 mg of the ASO (i) on about day 1 and day 15 of the first 28-day cycle, (ii) on about day 1 and day 15 of the second 28-day cycle, and (iii) on about day 1 of the third 28-day cycle. In certain aspects, the dose is administered at a dose of about 55 mg (i) on about days 1 and 15 of the first 28-day cycle, (ii) on about days 1 and 15 of the second 28-day cycle, (iii) on about day 1 of the third 28-day cycle, and (iii) once about every 56 days after the third 28-day cycle.

[0137] In some aspects, the dose is administered at a dose of about 60 mg of the ASO on about day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered at a dose of about 60 mg of the ASO (i) on about day 1 and day 15 of the first 28-day cycle, and (ii) on about day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered at a dose of about 60 mg of the ASO (i) on about day 1 and day 15 of the first 28-day cycle, (ii) on about day 1 and day 15 of the second 28-day cycle, and (iii) on about day 1 of the third 28-day cycle. In certain aspects, the dose is administered at a dose of about 60 mg (i) on about days 1 and 15 of the first 28-day cycle, (ii) on about days 1 and 15 of the second 28-day cycle, (iii) on about day 1 of the third 28-day cycle, and (iii) once about every 56 days after the third 28-day cycle.

[0138] In some aspects, the amount of the one or more ASOs in the dosage is measured using anion exchange chromatography (AEX). In some aspects, the AEX comprises AEX ultrapure liquid chromatography (UPLC). In some aspects, the amount of the one or more ASOs in the dosage is measured using hydrophilic chromatography. In some aspects, the amount of the one or more ASOs in the dosage is measured using ribogreen assay.

[0139] As described herein, ASOs useful in the present disclosure can specifically hybridize with one or more regions of STAT6 transcripts (e.g., pre-mRNA or mRNA), thereby reducing and / or inhibiting STAT6 protein expression in cells. Therefore, EVs (e.g., exosomes) (e.g., EVs disclosed herein) containing such ASOs can be used to prevent and / or treat any disease or condition associated with increased STAT6 protein expression.

[0140] In some aspects, the disease or illness that can be treated with the methods of the present invention comprises cancer. In some aspects, cancer is associated with increased expression of STAT6 protein. Non-limiting examples of cancers that can be treated with the present disclosure include: colorectal cancer, lung cancer (e.g., non-small cell lung cancer (NSCLC)), pancreatic cancer (e.g., pancreatic ductal adenocarcinoma (PDAC)), leukemia, uterine cancer, ovarian cancer, breast cancer, bladder cancer, bile duct cancer, gastric cancer, or any combination thereof. In some aspects, the cancer is selected from colon adenocarcinoma, rectal adenocarcinoma, pancreatic cancer, pancreatic ductal adenocarcinoma (PDAC), ovarian serous cystadenocarcinoma, acute myeloid leukemia, testicular germ cell tumor, lung adenocarcinoma, brain low-grade glioma, glioblastoma multiforme, uveal melanoma, thyroid cancer, uterine endometrial cancer, uterine carcinosarcoma, pheochromocytoma, paraganglioma, renal papillary cell carcinoma, gastric adenocarcinoma, renal clear cell carcinoma, thymoma, sarcoma, lung squamous cell carcinoma, esophageal adenocarcinoma, esophageal squamous cell carcinoma and any combination thereof. In some aspects, cancer is bone marrow-rich cancer. In some aspects, cancer comprises liver cancer. In some aspects, cancer comprises hepatocellular carcinoma (HCC). In some aspects, cancer comprises pancreatic ductal adenocarcinoma (PDAC). In some aspects, cancer comprises gastric cancer. In some aspects, cancer comprises gastric cancer metastasized to the liver. In some aspects, cancer comprises colorectal cancer (CRC). In some aspects, cancer comprises CRC metastasized to the liver. In some aspects, cancer comprises ovarian cancer. In some aspects, cancer comprises leptomeningeal cancer. In some aspects, the methods disclosed herein increase the infiltration of immune cells, e.g., macrophages, of a tumor. In some aspects, cancer is a bone marrow-rich cancer. In some aspects, cancer comprises a cancer rich in M2. In some aspects, cancer comprises liver cancer. In some aspects, cancer comprises hepatocellular carcinoma (HCC). In some aspects, cancer comprises pancreatic ductal adenocarcinoma (PDAC), and in some aspects, cancer comprises colorectal cancer (CRC). In some aspects, cancer comprises ovarian cancer. In some aspects, cancer comprises leptomeningeal cancer. In some aspects, cancer comprises refractory tumors of the central nervous system.

[0141] In some aspects, the methods disclosed herein treat tumors of the central nervous system of a subject. In some aspects, the method treats a brain tumor of a subject. In some aspects, the method treats a glioblastoma of a subject. In some aspects, a glioblastoma is a glioblastoma multiforme (GBM). In some aspects, the method treats a leptomeningeal cancer disease of a subject. In some aspects, EVs (e.g., exosomes) comprising ASOs activate macrophages in the central nervous system. In some aspects, EVs (e.g., exosomes) comprising ASOs induce M1 polarization of macrophages in the central nervous system. In some aspects, EVs (e.g., exosomes) comprising ASOs activate meningeal macrophages. In some aspects, EVs (e.g., exosomes) comprising ASOs induce M1 polarization of meningeal macrophages. In some aspects, EVs (e.g., exosomes) comprising ASOs induce tumor infiltration of meningeal macrophages.

[0142] When applied to a subject with cancer, in some aspects, the EV (e.g., exosome) disclosed herein can upregulate immune response and enhance the tumor targeting of the subject's immune system. In some aspects, the cancer being treated is characterized by leukocytes (T cells, B cells, macrophages, dendritic cells, monocytes) infiltrating into the tumor microenvironment, or so-called "hot tumors" or "inflammatory tumors". In some aspects, the cancer being treated is characterized by leukocytes infiltrating into the tumor microenvironment, or low or undetectable levels in the so-called "cold tumors" or "non-inflammatory tumors". In some aspects, the amount and time of EV administration are sufficient to convert "cold tumors" into "hot tumors", that is, the administration causes leukocytes (such as T cells) to infiltrate into the tumor microenvironment. In some aspects, cancer includes bladder cancer, cervical cancer (e.g., cervical squamous cell carcinoma), renal cell carcinoma, testicular cancer, colorectal cancer, lung cancer, head and neck cancer and ovarian, lymphoma, liver cancer, glioblastoma, melanoma, myeloma, leukemia, pancreatic cancer or a combination thereof. In some aspects, the cancer comprises hepatocellular carcinoma (HCC). In some aspects, the cancer comprises advanced HCC. In some aspects, the cancer comprises gastric cancer. In some aspects, the cancer comprises colorectal cancer. In some aspects, the cancer has metastasized to the liver.

[0143] As used herein, the term "distant tumor" or "distant tumor" refers to a tumor that has spread from the original (or primary) tumor to a distant organ or distant tissue (e.g., lymph node). In some aspects, the EVs disclosed herein treat tumors after metastatic spread. In some aspects, administration of the EVs disclosed herein (e.g., exosomes) induces immune memory.

[0144] In some aspects, EVs (e.g., exosomes) comprising ASOs activate tumor-associated macrophages (TAMs). In some aspects, EVs (e.g., exosomes) comprising ASOs induce M1 polarization of TAMs. In some aspects, EVs (e.g., exosomes) comprising ASOs induce expression of M1 markers in TAMs. In some aspects, EVs (e.g., exosomes) comprising ASOs reduce expression of M2 markers in TAMs. Therefore, certain aspects of the present disclosure relate to methods for inducing M1 polarization of TAMs, the methods comprising administering to a subject an EV (e.g., exosome) comprising an ASO disclosed herein.

[0145] In some aspects, EVs (e.g., exosomes) treat fibrosis in a subject in need thereof. Excessive M2 macrophage activation causes sustained production of TGFβ and growth factors, thereby promoting proliferation of myofibroblasts, activation of EMT / EndoMT, and extracellular matrix deposition. M2 macrophages represent a breaking point between wound healing and the exacerbation of the pro-fibrotic process. In some aspects, fibrosis is selected from liver fibrosis (NASH), cirrhosis, pulmonary fibrosis, cystic fibrosis, chronic ulcerative colitis / IBD, bladder fibrosis, renal fibrosis, CAPS (Muckle-Wells syndrome), atrial fibrosis, endomyocardial fibrosis, old myocardial infarction, glial scar, arteriosclerosis, arthrofibrosis, Crohn's disease, Dupuytren's contracture, keloid fibrosis, mediastinal fibrosis, myelofibrosis, Peyronie's disease, nephrogenic systemic fibrosis, progressive massive fibrosis, retroperitoneal fibrosis, scleroderma / systemic sclerosis, adhesive capsulitis, and any combination thereof. In some aspects, EVs (e.g., exosomes) treat liver fibrosis (NASH). In some aspects, EVs (e.g., exosomes) treat CAPS (Muckle-Wells syndrome).

[0146] In some aspects, EVs (e.g., exosomes) treat neurodegenerative diseases. In some aspects, the neurodegenerative disease is selected from Alzheimer's disease, Parkinson's disease, prion disease, motor neuron disease, Huntington's disease, spinocerebellar ataxia, spinal muscular atrophy, and any combination thereof.

[0147] In some aspects, EVs (e.g., exosomes) treat metabolic disorders / CVD. In some aspects, metabolic disorders / CVD are selected from acid-base imbalance, metabolic encephalopathy, calcium metabolism disorders, DNA repair defect disorders, glucose metabolism disorders, hyperlactatemia, iron metabolism disorders, lipid metabolism disorders, malabsorption syndrome, metabolic syndrome X, inborn errors of metabolism, mitochondrial diseases, phosphorus metabolism disorders, porphyria, proteostasis deficiency, metabolic skin diseases, wasting syndrome, water electrolyte imbalance, and any combination thereof.

[0148] In some aspects, EV (e.g., exosomes) promote anti-tumor immunity in subjects. In some aspects, EV (e.g., exosomes) are administered to induce nitric oxide synthase (NOS2) expression in subjects. In some aspects, EV (e.g., exosomes) are administered to promote the remodeling of the tumor microenvironment (TME) in subjects. In some aspects, EV (e.g., exosomes) are administered to induce activation of tumor-infiltrating lymphocytes (e.g., tumor-infiltrating CD8 T cells) in subjects. In some aspects, EV (e.g., exosomes) are administered to increase expression of effector / activator genes in tumor-infiltrating lymphocytes (e.g., tumor-infiltrating CD8 T cells) in subjects. In some aspects, after EV (e.g., exosomes) are administered, expression of effector / activator genes Gzmb and Id2 in tumor-infiltrating lymphocytes (e.g., tumor-infiltrating CD8 T cells) increases. In some aspects, the administration of EVs (e.g., exosomes) reduces the depletion of tumor-infiltrating lymphocytes (e.g., tumor-infiltrating CD8 T cells) in the subject. In some aspects, the administration of EVs (e.g., exosomes) reduces the expression of exhaustion markers in tumor-infiltrating lymphocytes (e.g., tumor-infiltrating CD8 T cells). In some aspects, the administration of EVs (e.g., exosomes) reduces the expression of Lag3 in tumor-infiltrating lymphocytes (e.g., tumor-infiltrating CD8 T cells). In some aspects, the administration of EVs (e.g., exosomes) increases the number of tumor-infiltrating lymphocytes (e.g., tumor-infiltrating CD8 T cells). In some aspects, the administration of EVs (e.g., exosomes) reduces the number of Foxp3+ regulatory T cells in, for example, TME.

[0149] In some aspects, EVs (e.g., exosomes) and / or PD-1 antagonists are administered intravenously to the subject's circulatory system. In some aspects, EVs and / or PD-1 antagonists are infused into a suitable fluid and administered into a vein of the subject.

[0150] In some aspects, EVs (e.g., exosomes) and / or PD-1 antagonists are administered intra-arterially to the subject's circulatory system. In some aspects, EVs and / or PD-1 antagonists are infused into a suitable fluid and administered into an artery of the subject.

[0151] In some aspects, EV (e.g., exosomes) and / or PD-1 antagonists are administered to a subject by intrathecal administration. In some aspects, EV (e.g., exosomes) and / or PD-1 antagonists are administered by intrathecal administration, followed by mechanical convection forces to the trunk. See, for example, Verma et al., Alzheimer's Disease and Dementia (Alzheimer's Dement.) 12: e12030 (2020); the document is incorporated herein by reference in its entirety). In some aspects, mechanical convection forces (e.g., oscillating vests) promote the further diffusion of intrathecally administered EV (e.g., exosomes) down the nerve, thereby allowing EV (e.g., exosomes) to be better delivered to the nerve.

[0152] In some aspects, the intra- and inter-compartmental biodistribution of exosomes can be manipulated by exogenous external forces acting on a subject after compartmental delivery of the exosomes. This includes the application of mechanical convection, such as by applying shock, vibration, shaking, or massage to body compartments or the entire body. For example, after intrathecal administration, the application of chest wall vibration by several means including an oscillating mechanical jacket can spread the biodistribution of exosomes along the neural axis or along cranial and spinal nerves, which is helpful for the treatment of neurological diseases by drug-carrying exosomes.

[0153] In some aspects, applying external mechanical convective forces by means of an oscillating jacket or other similar means can be used to remove exosomes and other materials from the cerebrospinal fluid in the intrathecal space and discharge them into the peripheral circulation. This aspect helps remove endogenous toxic exosomes and other harmful macromolecules such as beta-amyloid, tau, alpha-synuclein, TDP43, neurofilaments, and excess cerebrospinal fluid from the intrathecal space to the periphery for clearance.

[0154] In some aspects, exosomes delivered via the intraventricular route can be translocated throughout the neuraxis by simultaneously incorporating a lumbar puncture and allowing ventriculo-lumbar perfusion, where additional fluid is infused into the ventricles following exosome administration while allowing the existing CSF neuraxial column to drain via the lumbar puncture. Ventriculo-lumbar perfusion can allow ICV-administered exosomes to diffuse along the entire neuraxis and completely cover the subarachnoid space to treat leptomeningeal cancer and other diseases.

[0155] In some aspects, external extracorporeal focused ultrasound, thermal energy (heat), or cold can be used to manipulate the compartmental pharmacokinetics and drug release properties of exosomes engineered to be sensitive to these phenomena.

[0156] In some aspects, the intercompartmental behavior and biodistribution of exosomes engineered to contain paramagnetic materials can be manipulated by externally applying magnets or magnetic fields.

[0157] In some aspects, EVs are administered by injection into the spinal canal or into the subarachnoid space so that they reach the cerebrospinal fluid (CSF).

[0158] In some aspects, EVs (eg, exosomes) are administered intratumorally to one or more tumors of a subject.

[0159] In some aspects, EVs (e.g., exosomes) are administered to a subject via intranasal administration. In some aspects, EVs can be insufflated through the nose in the form of topical or systemic administration. In some aspects, EVs are administered in the form of a nasal spray.

[0160] In some aspects, EV (e.g., exosomes) are administered to a subject by intraperitoneal administration. In some aspects, EV is infused into a suitable liquid and injected into the peritoneum of the subject. In some aspects, intraperitoneal administration causes EV to be distributed to the lymph. In some aspects, intraperitoneal administration causes EV to be distributed to the thymus, spleen, and / or bone marrow. In some aspects, intraperitoneal administration causes EV to be distributed to one or more lymph nodes. In some aspects, intraperitoneal administration causes EV to be distributed to one or more of the cervical lymph nodes, inguinal lymph nodes, mediastinal lymph nodes, or sternal lymph nodes. In some aspects, intraperitoneal administration causes EV to be distributed to the pancreas.

[0161] In some aspects, EVs (e.g., exosomes) are administered to a subject via periocular administration. In some aspects, s are injected into periocular tissue. Periocular drug administration includes subconjunctival, anterior sub-Tenon's, posterior sub-Tenon's, and retrobulbar administration.

[0162] In some aspects, the method further comprises administering a PD-1 antagonist. In some aspects, the PD-1 antagonist blocks, inhibits and / or reduces the interaction between PD-1 and PD-L1. In some aspects, the PD-1 antagonist comprises an antibody or antigen binding portion thereof that specifically binds to PD-1 ("anti-PD-1 antibody"). In some aspects, the PD-1 antagonist comprises an antibody or antigen binding portion thereof that specifically binds to PD-L1 ("anti-PD-L1 antibody"). In some aspects, the extracellular vesicles comprising ASO and the PD-1 antagonist are administered simultaneously. In some aspects, the extracellular vesicles comprising ASO and the PD-1 antagonist are administered sequentially. In some aspects, the extracellular vesicles comprising ASO and the PD-1 antagonist are administered on the same day. In some aspects, the extracellular vesicles comprising ASO are administered before the PD-1 antagonist.

[0163] II.B. Combination Therapy

[0164] Some aspects of the present disclosure relate to administering the following methods to a subject in need, (i) a dose of one or more antisense oligonucleotides (ASOs) targeting a STAT6 transcript (SEQ ID NO: 1 or SEQ ID NO: 3), wherein each of the one or more ASOs comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length, the contiguous nucleotide sequence being complementary to a nucleic acid sequence within the STAT6 transcript; and wherein the amount of the one or more ASOs in the dose is at least about 0.01 mg to at least about 240 mg, and (ii) additional therapy. In some aspects, additional therapy is an additional anticancer agent and / or immunomodulator. Such agents may include, for example, chemotherapeutic drugs, small molecule drugs, or antibodies that stimulate an immune response to a given cancer. In some aspects, the methods described herein are used in combination with standard of care treatments (e.g., surgery, radiation, and chemotherapy).

[0165] In some aspects, the EVs (e.g., exosomes) disclosed herein can be used in combination with one or more additional therapeutic agents (e.g., immuno-oncology agents) so that multiple elements of the immune pathway can be targeted. Non-limiting examples of such combinations include: therapies that enhance tumor antigen presentation (e.g., dendritic cell vaccines, cellular vaccines that secrete GM-CSF, CpG oligonucleotides, imiquimod); therapies that inhibit negative immunoregulation, for example, by inhibiting CTLA-4 and / or PD1 / PD-L1 / PD-L2 pathways and / or depleting or blocking Tregs or other immunosuppressive cells (e.g., myeloid-derived suppressor cells); therapies that stimulate positive immunoregulation, for example, using agonists that stimulate CD-137, OX-40 and / or CD40 or GITR pathways and / or stimulate T cell effector function; therapies that systemically increase the frequency of anti-tumor T cells; therapies that deplete or inhibit Tregs (e.g., Tre in tumors) g), for example, using antagonists of CD25 (e.g., daclizumab) or by ex vivo anti-CD25 bead depletion; therapies that affect suppressive myeloid cell function in the tumor; therapies that enhance the immunogenicity of tumor cells (e.g., anthracyclines); adoptive T-cell or NK-cell transfer comprising genetically modified cells, e.g., cells modified by chimeric antigen receptors (CAR-T therapy); therapies that inhibit metabolic enzymes such as indoleamine dioxygenase (IDO), dioxygenases, arginase, or nitric oxide synthase; therapies that reverse / prevent T-cell anergy or exhaustion; therapies that trigger innate immune activation and / or inflammation at the tumor site; administration of immunostimulatory cytokines; or blockade of immunosuppressive cytokines.

[0166] In some aspects, additional anticancer agents include immune checkpoint inhibitors (i.e., blocking signal transduction through specific immune checkpoint pathways). Non-limiting examples of immune checkpoint inhibitors that can be used for the methods of the present invention include CTLA-4 antagonists (e.g., anti-CTLA-4 antibodies), PD-1 antagonists (e.g., anti-PD-1 antibodies, anti-PD-L1 antibodies), TIM-3 antagonists (e.g., anti-TIM-3 antibodies) or combinations thereof.

[0167] In some aspects, the immuno-oncology agent comprises an immune checkpoint activator (ie, promoting signal transduction through a specific immune checkpoint pathway). In certain aspects, the immune checkpoint activator comprises an OX40 agonist (eg, an anti-OX40 antibody), a LAG-3 agonist (eg, an anti-LAG-3 antibody), a 4-1BB (CD137) agonist (eg, an anti-CD137 antibody), a GITR agonist (eg, an anti-GITR antibody), or any combination thereof.

[0168] In some aspects, the additional anticancer agent comprises a standard of care chemotherapy. In some aspects, the standard of care chemotherapy comprises a platinum-based chemotherapy. In some aspects, the standard of care chemotherapy comprises a platinum-based dual chemotherapy.

[0169] In some aspects, other anticancer agents are standard of care therapies for the treatment of colorectal cancer. In some aspects, other anticancer agents include 5-fluorouracil (FU), leucovorin (LV), oxaliplatin (oxaliplatin), irinotecan (irinotecan), anti-vascular endothelial growth factor (VEGF) antibodies, anti-epidermal growth factor receptor (EGFR) antibodies or any combination thereof. In some aspects, other anticancer agents include FU, LV and oxaliplatin (FOLFOX). In some aspects, other anticancer agents include FU, LV and irinotecan (FOLFIRI). In some aspects, the subject suffers from colorectal cancer with high MSI. In some aspects, the subject suffers from colorectal cancer presenting one or more, for example, at position Gly12, Gly13, Glu61 or any combination thereof KRAS mutations. In some aspects, the subject suffers from colorectal cancer presenting one or more BRAF mutations (e.g., BRAFV600E).

[0170] In some aspects, other anticancer agents are standard of care therapies for treating HCC. In some aspects, other anticancer agents include sorafenib. In some aspects, other anticancer agents include lenvatinib. In some aspects, other anticancer agents include atezolizumab and bevacizumab. In some aspects, other anticancer agents include pembrolizumab, nivolumab, ipilimumab or a combination thereof. In some aspects, other anticancer agents include FU, LV and oxaliplatin (FOLFOX). In some aspects, other anticancer agents include regorafenib, cabozantinib, ramucirumab or any combination thereof.

[0171] In some aspects, other anticancer agents are standard of care therapies for treating colorectal cancer. In some aspects, other anticancer agents include (i) epirubicin, cisplatin and 5-FU ("ECF"); (ii) or epirubicin, cisplatin and capecitabine (capecitabine) ("ECX"); or (iii) docetaxel, oxaliplatin and 5-FU / folinic acid ("FLOT"). In some aspects, other anticancer agents include HER2 targeting agents.

[0172] In some aspects, the combination of EVs (e.g., exosomes) disclosed herein and a second agent (e.g., an immune checkpoint inhibitor) discussed herein can be administered simultaneously as a single composition in a pharmaceutically acceptable carrier. In other aspects, the combination of EVs (e.g., exosomes) and a second agent (e.g., an immune checkpoint inhibitor) discussed herein can be administered simultaneously as a separate composition. In other aspects, the combination of EVs (e.g., exosomes) and a second agent (e.g., an immune checkpoint inhibitor) discussed herein can be administered sequentially. In some aspects, EVs (e.g., exosomes) are administered prior to administering a second agent (e.g., an immune checkpoint inhibitor).

[0173] III. Antisense Oligonucleotides (ASO)

[0174] The present disclosure uses antisense oligonucleotides (ASOs) for regulating the function of nucleic acid molecules encoding mammalian STAT6, such as STAT6 nucleic acids, such as STAT6 transcripts, nucleic acid molecules including STAT6 pre-mRNA and STAT6 mRNA, or naturally occurring variants of such nucleic acid molecules encoding mammalian STAT6. In the context of the present disclosure, the term "ASO" refers to a molecule formed by a covalent bond of two or more nucleotides (i.e., oligonucleotides).

[0175] In some aspects, EV (e.g., exosomes) comprises at least one ASO. In some aspects, EV (e.g., exosomes) comprises at least two ASOs, for example, a first ASO comprising a first nucleotide sequence and a second ASO comprising a second nucleotide sequence. In some aspects, EV (e.g., exosomes) comprises at least three ASOs, at least four ASOs, at least five ASOs, at least six ASOs, or more than six ASOs. In some aspects, the first ASO, the second ASO, the third ASO, the fourth ASO, the fifth ASO, the sixth ASO, and / or the ninth ASO are different.

[0176] In some aspects, EV (eg, exosomes) comprises a first ASO and a second ASO, wherein the first ASO comprises a first nucleotide sequence complementary to a first target sequence in a first transcript, and wherein the second ASO comprises a second nucleotide sequence complementary to a second target sequence in the first transcript. In some aspects, the first target sequence does not overlap with the second target sequence. In some aspects, the first target sequence comprises at least one nucleotide within the 5'UTR of the transcript, and the second target sequence does not comprise nucleotides within the 5'UTR. In some aspects, the first target sequence comprises at least one nucleotide within the 3'UTR of the transcript, and the second target sequence does not comprise nucleotides within the 3'UTR. In some aspects, the first target sequence comprises at least one nucleotide within the 5'UTR of the transcript, and the second target sequence comprises at least one nucleotide within the 3'UTR.

[0177] In some aspects, the first ASO targets a sequence within an exon-intron junction, and the second ASO targets a sequence within an exon-intron junction. In some aspects, the first ASO targets a sequence within an exon-intron junction, and the second ASO targets a sequence within an exon. In some aspects, the first ASO targets a sequence within an exon-intron junction, and the second ASO targets a sequence within an intron. In some aspects, the first ASO targets a sequence within an exon, and the second ASO targets a sequence within an exon. In some aspects, the first ASO targets a sequence within an intron, and the second ASO targets a sequence within an exon. In some aspects, the first ASO targets a sequence within an intron, and the second ASO targets a sequence within an exon. In some aspects, the first ASO targets a sequence within an intron, and the second ASO targets a sequence within an intron.

[0178] In some aspects, an EV (e.g., an exosome) comprises a first ASO and a second ASO, wherein the first ASO comprises a first nucleotide sequence complementary to a first target sequence in a first transcript, and wherein the second ASO comprises a second nucleotide sequence complementary to a second target sequence in a second transcript, wherein the first transcript is not the product of the same gene as the second transcript.

[0179] The ASO comprises a continuous nucleotide sequence of about 10 to about 30, such as 10-20, 14-20, 16-20 or 15-25 nucleotides in length. In some aspects, the length of the ASO is 20 nucleotides. In some aspects, the length of the ASO is 18 nucleotides. In some aspects, the length of the ASO is 19 nucleotides. In some aspects, the length of the ASO is 17 nucleotides. In some aspects, the length of the ASO is 16 nucleotides. In some aspects, the length of the ASO is 15 nucleotides. In some aspects, the length of the ASO is 14 nucleotides. In some aspects, the length of the ASO is 13 nucleotides. In some aspects, the length of the ASO is 12 nucleotides. In some aspects, the length of the ASO is 11 nucleotides. In some aspects, the length of the ASO is 10 nucleotides.

[0180] In some aspects, the ASO comprises a continuous nucleotide sequence of about 10 to about 50 nucleotides in length, for example, about 10 to about 45, about 10 to about 40, about 10 or about 35 or about 10 to about 30 nucleotides. In some aspects, the length of the ASO is 21 nucleotides. In some aspects, the length of the ASO is 22 nucleotides. In some aspects, the length of the ASO is 23 nucleotides. In some aspects, the length of the ASO is 24 nucleotides. In some aspects, the length of the ASO is 25 nucleotides. In some aspects, the length of the ASO is 26 nucleotides. In some aspects, the length of the ASO is 27 nucleotides. In some aspects, the length of the ASO is 28 nucleotides. In some aspects, the length of the ASO is 29 nucleotides. In some aspects, the length of the ASO is 30 nucleotides. In some aspects, the length of the ASO is 31 nucleotides. In some aspects, the length of the ASO is 32 nucleotides. In some aspects, the length of the ASO is 33 nucleotides. In some aspects, the length of the ASO is 34 nucleotides. In some aspects, the ASO is 35 nucleotides in length. In some aspects, the ASO is 36 nucleotides in length. In some aspects, the ASO is 37 nucleotides in length. In some aspects, the ASO is 38 nucleotides in length. In some aspects, the ASO is 39 nucleotides in length. In some aspects, the ASO is 40 nucleotides in length. In some aspects, the ASO is 41 nucleotides in length. In some aspects, the ASO is 42 nucleotides in length. In some aspects, the ASO is 43 nucleotides in length. In some aspects, the ASO is 44 nucleotides in length. In some aspects, the ASO is 45 nucleotides in length. In some aspects, the ASO is 46 nucleotides in length. In some aspects, the ASO is 47 nucleotides in length. In some aspects, the ASO is 48 nucleotides in length. In some aspects, the ASO is 49 nucleotides in length. In some aspects, the ASO is 50 nucleotides in length.

[0181] As used herein, the terms "antisense ASO," "antisense oligonucleotide," and "oligomer" are interchangeable with the term "ASO."

[0182] References to SEQ ID numbers include specific nucleobase sequences, but do not include any design or complete chemical structure. In addition, unless otherwise indicated, the ASOs disclosed in the figures herein show representative designs, but are not limited to the specific designs shown in the figures. For example, when a claim (or this specification) refers to SEQ ID NO: 101, it only includes the nucleotide sequence of SEQ ID NO: 101. The design of any ASO disclosed herein can be written as SEQ ID NO: XX, wherein each of the first nucleotide, the second nucleotide, the third nucleotide, the first nucleotide, the second nucleotide, and the Nth nucleotide from the 5' end is a modified nucleotide, e.g., LNA, and each of the other nucleotides is an unmodified nucleotide (e.g., DNA).

[0183] In various aspects, the ASO of the present disclosure does not comprise RNA (unit). In some aspects, the ASO comprises one or more DNA units. On the one hand, the ASO according to the present disclosure is a linear molecule or is synthesized as a linear molecule. In some aspects, the ASO is a single-stranded molecule and does not comprise a short region of, for example, at least 3, 4 or 5 continuous nucleotides, which are complementary to the equivalent region (i.e., duplex) in the same ASO-in this respect, the ASO is not (substantially) double-stranded. In some aspects, the ASO is not substantially double-stranded. In some aspects, the ASO is not siRNA. In various aspects, the ASO of the present disclosure can be completely composed of a continuous nucleotide region. Therefore, in some aspects, the ASO is not substantially self-complementary.

[0184] In other aspects, the disclosure includes fragments of ASOs. For example, the disclosure includes at least one nucleotide, at least two consecutive nucleotides, at least three consecutive nucleotides, at least four consecutive nucleotides, at least five consecutive nucleotides, at least six consecutive nucleotides, at least seven consecutive nucleotides, at least eight consecutive nucleotides, or at least nine consecutive nucleotides of an ASO disclosed herein. Fragments of any sequence disclosed herein are contemplated as part of the disclosure.

[0185] In some aspects, ASOs for use in the present disclosure include phosphorodiamidate morpholino oligomers (PMOs) or peptide-conjugated phosphorodiamidate morpholino oligomers (PPMOs).

[0186] In some aspects, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, or at least about 90% of one or more ASOs are associated with one or more EVs. In some aspects, at least about 20% of one or more ASOs are associated with one or more EVs. In some aspects, at least about 25% of one or more ASOs are associated with one or more EVs. In some aspects, at least about 30% of one or more ASOs are associated with one or more EVs. In some aspects, at least about 35% of one or more ASOs are associated with one or more EVs. In some aspects, at least about 40% of one or more ASOs are associated with one or more EVs. In some aspects, at least about 45% of one or more ASOs are associated with one or more EVs. In some aspects, at least about 50% of one or more ASOs are associated with one or more EVs. In some aspects, at least about 55% of one or more ASOs are associated with one or more EVs. In some aspects, at least about 60% of one or more ASOs are associated with one or more EVs. In some aspects, at least about 65% of one or more ASOs are associated with one or more EVs. In some aspects, at least about 70% of one or more ASOs are associated with one or more EVs. In some aspects, at least about 75% of one or more ASOs are associated with one or more EVs. In some aspects, at least about 80% of one or more ASOs are associated with one or more EVs. In some aspects, at least about 85% of one or more ASOs are associated with one or more EVs. In some aspects, at least about 90% of one or more ASOs are associated with one or more EVs.

[0187] III.A. ASOs targeting STAT6

[0188] Suitably, the ASO of the present disclosure can downregulate (e.g., reduce or remove) the expression of STAT6 mRNA or STAT6 protein. In this regard, the ASO of the present disclosure can promote the differentiation of M2 macrophages and / or reduce the differentiation of M1 macrophages. Specifically, the present disclosure relates to ASOs targeting one or more regions (e.g., intron regions, exon regions and / or exon-intron junction regions) of STAT6 pre-mRNA.

[0189] Unless otherwise indicated, the term "STAT6" as used herein may refer to STAT6 from one or more species (e.g., humans, non-human primates, dogs, cats, guinea pigs, rabbits, rats, mice, horses, cows, and bears).

[0190] STAT6 (STAT6) is also known as signal transducer and activator of transcription 6. Synonyms for STAT6 / STAT6 are known and include IL-4STAT; STAT, interleukin 4-induced; transcription factor IL-4STAT; STAT6B; STAT6C; and D12S1644. The sequence of the human STAT6 gene can be found under the publicly available GenBank accession number NC_000012.12:c57111413-57095404. The human STAT6 gene is found at 57111413-57095404, complement, at chromosome position 12q13.3.

[0191] The sequence of the human STAT6 pre-mRNA transcript (SEQ ID NO: 1) corresponds to the reverse complement of residue 57111413-57095404 of chromosome 12q13.3. The STAT6 mRNA sequence (GenBank accession number NM_001178078.1) is provided in SEQ ID NO: 3 (Table 1), except that the nucleotide "t" in SEQ ID NO: 3 is shown as "u" in the mRNA. The sequence of the human STAT6 protein can be found in the following publicly available accession numbers: P42226-1, (typical sequence, SEQ ID NO: 2; Table 1), P42226-2 (SEQ ID NO: 4) and P42226-3 (SEQ ID NO: 5), each of which is incorporated herein by reference in its entirety.

[0192] Table 1. STAT6 mRNA and protein sequences

[0193]

[0194]

[0195]

[0196]

[0197] Natural variants of human STAT6 gene products are known. For example, natural variants of human STAT6 protein may contain one or more amino acid substitutions selected from the group consisting of: M118R, D419N, and any combination thereof. Additional variants of human STAT6 protein produced by alternative splicing are also known in the art. STAT6 isoform 2 (identifier: P42226-2 at UniProt) differs from the canonical sequence (SEQ ID NO: 3) as follows: Relative to SEQ ID NO: 3, residues 1-174 are deleted and replaced with 175 MEQ 177 replace 175 PSE177 The sequence of STAT6 isoform 3 (identifier: P42226-3) differs from the canonical sequence (SEQ ID NO: 3) as follows: Residues 1-110 are missing relative to SEQ ID NO: 3. Thus, the ASOs of the present disclosure can be designed to reduce or inhibit the expression of natural variants of STAT6 proteins.

[0198] An example of a target nucleic acid sequence of an ASO is STAT6 precursor mRNA. SEQ ID NO: 1 represents a human STAT6 genomic sequence (i.e., the complement of chromosome 12q13.3, the reverse complement of nucleotides 57111413-57095404). SEQ ID NO: 1 is identical to the STAT6 precursor mRNA sequence, except that the nucleotide "t" in SEQ ID NO: 1 is shown as "u" in the precursor mRNA. In certain aspects, "target nucleic acid" includes an intron of a STAT6 protein encoding a nucleic acid or a naturally occurring variant thereof, and an RNA nucleic acid derived therefrom, e.g., a precursor mRNA. In other aspects, the target nucleic acid includes an exon region of a STAT6 protein encoding a nucleic acid or a naturally occurring variant thereof, and an RNA nucleic acid derived therefrom, e.g., a precursor mRNA. In yet other aspects, the target nucleic acid includes an exon-intron connection of a STAT6 protein encoding a nucleic acid or a naturally occurring variant thereof, and an RNA nucleic acid derived therefrom, e.g., a precursor mRNA. In some aspects, for example, when used in research or diagnosis, a "target nucleic acid" can be a cDNA or synthetic oligonucleotide derived from the above-mentioned DNA or RNA nucleic acid target. The sequence of human STAT6 protein encoded by STAT6 precursor mRNA is shown in SEQ ID NO: 3. In other aspects, the target nucleic acid comprises an untranslated region of a STAT6 protein encoding nucleic acid or a naturally occurring variant thereof, for example, 5'UTR, 3'UTR or both.

[0199] In some aspects, the ASOs of the present disclosure hybridize to a region within an intron of a STAT6 transcript, e.g., SEQ ID NO: 1. In certain aspects, the ASOs of the present disclosure hybridize to a region within an exon of a STAT6 transcript, e.g., SEQ ID NO: 1. In other aspects, the ASOs of the present disclosure hybridize to a region within an exon-intron junction of a STAT6 transcript, e.g., SEQ ID NO: 1. In some aspects, the ASOs of the present disclosure hybridize to a region within a STAT6 transcript (e.g., an intron, an exon, or an exon-intron junction), e.g., SEQ ID NO: 1, wherein the ASO has a design according to the formula: 5'ABC 3' as described elsewhere herein.

[0200] In some aspects, ASO targets mRNA encoding a specific isoform of STAT6 protein (e.g., isoform 1). In some aspects, ASO targets all isoforms of STAT6 protein. In other aspects, ASO targets two isoforms of STAT6 protein (e.g., isoform 1 and isoform 2, isoform 1 and isoform 3, or isoform 2 and isoform 3).

[0201] In some aspects, the ASO comprises a contiguous nucleotide sequence (e.g., 10 to 30 nucleotides in length, e.g., 20 nucleotides in length) that is complementary to a nucleic acid sequence within a STAT6 transcript, e.g., a region corresponding to SEQ ID NO: 1 or SEQ ID NO: 3. In some aspects, the ASO comprises a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence of a STAT6 transcript or a region within the sequence (a "target region"), wherein the nucleic acid sequence corresponds to (i) nucleotides 1-700 of SEQ ID NO: 3; (ii) nucleotides 1000-1500 of SEQ ID NO: 3; (iii) nucleotides 1500-2000 of SEQ ID NO: 3; (iv) nucleotides 2000-2500 of SEQ ID NO: 3; (v) nucleotides 2500-3000 of SEQ ID NO: 3; or (vi) 3000-3700 of SEQ ID NO: 3, and wherein, optionally, the ASO has one of the designs described herein or a chemical structure shown elsewhere herein.

[0202] In some aspects, the ASO comprises a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence of a STAT6 transcript, or a region within the sequence (a "target region"), wherein the nucleic acid sequence corresponds to (i) nucleotides 413-803 of SEQ ID NO: 3; (ii) nucleotides 952-1688 of SEQ ID NO: 3; (iii) nucleotides 1726-2489 of SEQ ID NO: 3; (iv) nucleotides 2682-2912 of SEQ ID NO: 3; (v) nucleotides 2970-3203 of SEQ ID NO: 3; or (vi) 3331-3561 of SEQ ID NO: 3, and wherein, optionally, the ASO has one of the designs described herein or a chemical structure shown elsewhere herein.

[0203] In some aspects, the ASO comprises a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence of a STAT6 transcript, or a region within the sequence (a "target region"), wherein the nucleic acid sequence corresponds to (i) nucleotides 463-753 of SEQ ID NO: 3; (ii) nucleotides 1002-1638 of SEQ ID NO: 3; (iii) nucleotides 1776-2439 of SEQ ID NO: 3; (iv) nucleotides 2682-2862 of SEQ ID NO: 3; (v) nucleotides 3020-3153 of SEQ ID NO: 3; or (vi) 3381-3511 of SEQ ID NO: 3, and wherein, optionally, the ASO has one of the designs described herein or a chemical structure shown elsewhere herein.

[0204] In some aspects, the ASO comprises a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence of a STAT6 transcript, or a region within the sequence (a "target region"), wherein the nucleic acid sequence corresponds to (i) nucleotides 503-713 of SEQ ID NO: 3; (ii) nucleotides 1042-1598 of SEQ ID NO: 3; (iii) nucleotides 1816-2399 of SEQ ID NO: 3; (iv) nucleotides 2722-2822 of SEQ ID NO: 3; (v) nucleotides 3060-3113 of SEQ ID NO: 3; or (vi) 3421-3471 of SEQ ID NO: 3, and wherein, optionally, the ASO has one of the designs described herein or a chemical structure shown elsewhere herein.

[0205] In some aspects, the target region corresponds to nucleotides 1053-1067 of SEQ ID NO:3 (e.g., ASO-STAT6-1053; SEQ ID NO:91). In some aspects, the target region corresponds to nucleotides 1359-1373 of SEQ ID NO:3 (e.g., ASO-STAT6-1359; SEQ ID NO:92). In some aspects, the target region corresponds to nucleotides 1890-1904 of SEQ ID NO:3 (e.g., ASO-STAT6-1890; SEQ ID NO:93). In some aspects, the target region corresponds to nucleotides 1892-1906 of SEQ ID NO:3 (e.g., ASO-STAT6-1892; SEQ ID NO:94). In some aspects, the target region corresponds to nucleotides 1915-1929 of SEQ ID NO:3 (e.g., ASO-STAT6-1915; SEQ ID NO:95). In some aspects, the target region corresponds to nucleotides 1916-1930 of SEQ ID NO: 3 (e.g., ASO-STAT6-1916; SEQ ID NO: 96). In some aspects, the target region corresponds to nucleotides 1917-1931 of SEQ ID NO: 3 (e.g., ASO-STAT6-1917; SEQ ID NO: 97). In some aspects, the target region corresponds to nucleotides 1918-1932 of SEQ ID NO: 3 (e.g., ASO-STAT6-1918; SEQ ID NO: 98). In some aspects, the target region corresponds to nucleotides 1919-1933 of SEQ ID NO: 3 (e.g., ASO-STAT6-1919; SEQ ID NO: 99). In some aspects, the target region corresponds to nucleotides 1920-1934 of SEQ ID NO: 3 (e.g., ASO-STAT6-1920; SEQ ID NO: 100). In some aspects, the target region corresponds to nucleotides 1937-1951 of SEQ ID NO:3 (e.g., ASO-STAT6-1937; SEQ ID NO: 101). In some aspects, the target region corresponds to nucleotides 1938-1952 of SEQ ID NO:3 (e.g., ASO-STAT6-1938; SEQ ID NO: 102). In some aspects, the target region corresponds to nucleotides 2061-2075 of SEQ ID NO:3 (e.g., ASO-STAT6-2061; SEQ ID NO: 103). In some aspects, the target region corresponds to nucleotides 2062-2076 of SEQ ID NO:3 (e.g., ASO-STAT6-2062; SEQ ID NO: 104).In some aspects, the target region corresponds to nucleotides 2063-2077 of SEQ ID NO:3 (e.g., ASO-STAT6-2063; SEQ ID NO: 105). In some aspects, the target region corresponds to nucleotides 2064-2078 of SEQ ID NO:3 (e.g., ASO-STAT6-2064; SEQ ID NO: 106). In some aspects, the target region corresponds to nucleotides 2066-2080 of SEQ ID NO:3 (e.g., ASO-STAT6-2066; SEQ ID NO: 107). In some aspects, the target region corresponds to nucleotides 2067-2081 of SEQ ID NO:3 (e.g., ASO-STAT6-2067; SEQ ID NO: 108). In some aspects, the target region corresponds to nucleotides 2068-2082 of SEQ ID NO:3 (e.g., ASO-STAT6-2068; SEQ ID NO: 109). In some aspects, the target region corresponds to nucleotides 2352-2366 of SEQ ID NO:3 (e.g., ASO-STAT6-2352; SEQ ID NO: 110). In some aspects, the target region corresponds to nucleotides 3073-3087 of SEQ ID NO:3 (e.g., ASO-STAT6-3073; SEQ ID NO: 111). In some aspects, the target region corresponds to nucleotides 1053-1068 of SEQ ID NO:3 (e.g., ASO-STAT6-1053; SEQ ID NO: 112). In some aspects, the target region corresponds to nucleotides 1054-1069 of SEQ ID NO:3 (e.g., ASO-STAT6-1054; SEQ ID NO: 113). In some aspects, the target region corresponds to nucleotides 1356-1371 of SEQ ID NO:3 (e.g., ASO-STAT6-1356; SEQ ID NO: 114). In some aspects, the target region corresponds to nucleotides 1847-1862 of SEQ ID NO:3 (e.g., ASO-STAT6-1847; SEQ ID NO: 115). In some aspects, the target region corresponds to nucleotides 1886-1901 of SEQ ID NO:3 (e.g., ASO-STAT6-1886; SEQ ID NO: 116). In some aspects, the target region corresponds to nucleotides 1887-1902 of SEQ ID NO:3 (e.g., ASO-STAT6-1887; SEQ ID NO: 117). In some aspects, the target region corresponds to nucleotides 1888-1903 of SEQ ID NO:3 (e.g., ASO-STAT6-1888; SEQ ID NO: 118).In some aspects, the target region corresponds to nucleotides 1889-1904 of SEQ ID NO:3 (e.g., ASO-STAT6-1889; SEQ ID NO: 119). In some aspects, the target region corresponds to nucleotides 1890-1905 of SEQ ID NO:3 (e.g., ASO-STAT6-1890; SEQ ID NO: 120). In some aspects, the target region corresponds to nucleotides 1893-1908 of SEQ ID NO:3 (e.g., ASO-STAT6-1893; SEQ ID NO: 121). In some aspects, the target region corresponds to nucleotides 1917-1932 of SEQ ID NO:3 (e.g., ASO-STAT6-1917; SEQ ID NO: 122). In some aspects, the target region corresponds to nucleotides 1919-1934 of SEQ ID NO:3 (e.g., ASO-STAT6-1919; SEQ ID NO: 123). In some aspects, the target region corresponds to nucleotides 2056-2071 of SEQ ID NO:3 (e.g., ASO-STAT6-2056; SEQ ID NO: 124). In some aspects, the target region corresponds to nucleotides 2060-2075 of SEQ ID NO:3 (e.g., ASO-STAT6-2060; SEQ ID NO: 125). In some aspects, the target region corresponds to nucleotides 2066-2081 of SEQ ID NO:3 (e.g., ASO-STAT6-2066; SEQ ID NO: 126). In some aspects, the target region corresponds to nucleotides 2070-2085 of SEQ ID NO:3 (e.g., ASO-STAT6-2070; SEQ ID NO: 127). In some aspects, the target region corresponds to nucleotides 2351-2366 of SEQ ID NO:3 (e.g., ASO-STAT6-2351; SEQ ID NO: 128). In some aspects, the target region corresponds to nucleotides 2352-2367 of SEQ ID NO:3 (e.g., ASO-STAT6-2352; SEQ ID NO: 129). In some aspects, the target region corresponds to nucleotides 2359-2374 of SEQ ID NO:3 (e.g., ASO-STAT6-2359; SEQ ID NO: 130). In some aspects, the target region corresponds to nucleotides 3633-3648 of SEQ ID NO:3 (e.g., ASO-STAT6-3633; SEQ ID NO: 131). In some aspects, the target region corresponds to nucleotides 673-689 of SEQ ID NO:3 (e.g., ASO-STAT6-673; SEQ ID NO: 132).In some aspects, the target region corresponds to nucleotides 1052-1068 of SEQ ID NO:3 (e.g., ASO-STAT6-1052; SEQ ID NO: 133). In some aspects, the target region corresponds to nucleotides 1356-1372 of SEQ ID NO:3 (e.g., ASO-STAT6-1356; SEQ ID NO: 134). In some aspects, the target region corresponds to nucleotides 1357-1373 of SEQ ID NO:3 (e.g., ASO-STAT6-1357; SEQ ID NO: 135). In some aspects, the target region corresponds to nucleotides 1359-1375 of SEQ ID NO:3 (e.g., ASO-STAT6-1359; SEQ ID NO: 136). In some aspects, the target region corresponds to nucleotides 1360-1376 of SEQ ID NO:3 (e.g., ASO-STAT6-1360; SEQ ID NO: 137). In some aspects, the target region corresponds to nucleotides 1839-1855 of SEQ ID NO:3 (e.g., ASO-STAT6-1839; SEQ ID NO: 138). In some aspects, the target region corresponds to nucleotides 1848-1864 of SEQ ID NO:3 (e.g., ASO-STAT6-1848; SEQ ID NO: 139). In some aspects, the target region corresponds to nucleotides 1849-1865 of SEQ ID NO:3 (e.g., ASO-STAT6-1849; SEQ ID NO: 140). In some aspects, the target region corresponds to nucleotides 1891-1907 of SEQ ID NO:3 (e.g., ASO-STAT6-1891; SEQ ID NO: 141). In some aspects, the target region corresponds to nucleotides 1915-1931 of SEQ ID NO:3 (e.g., ASO-STAT6-1915; SEQ ID NO: 142). In some aspects, the target region corresponds to nucleotides 1916-1932 of SEQ ID NO:3 (e.g., ASO-STAT6-1916; SEQ ID NO:143). In some aspects, the target region corresponds to nucleotides 1917-1933 of SEQ ID NO:3 (e.g., ASO-STAT6-1917; SEQ ID NO:144). In some aspects, the target region corresponds to nucleotides 1938-1954 of SEQ ID NO:3 (e.g., ASO-STAT6-1938; SEQ ID NO:145). In some aspects, the target region corresponds to nucleotides 1939-1955 of SEQ ID NO:3 (e.g., ASO-STAT6-1939; SEQ ID NO:146).In some aspects, the target region corresponds to nucleotides 2063-2079 of SEQ ID NO:3 (e.g., ASO-STAT6-2063; SEQ ID NO: 147). In some aspects, the target region corresponds to nucleotides 2064-2080 of SEQ ID NO:3 (e.g., ASO-STAT6-2064; SEQ ID NO: 148). In some aspects, the target region corresponds to nucleotides 2065-2081 of SEQ ID NO:3 (e.g., ASO-STAT6-2065; SEQ ID NO: 149). In some aspects, the target region corresponds to nucleotides 2066-2082 of SEQ ID NO:3 (e.g., ASO-STAT6-2066; SEQ ID NO: 150). In some aspects, the target region corresponds to nucleotides 2068-2084 of SEQ ID NO:3 (e.g., ASO-STAT6-2068; SEQ ID NO: 151). In some aspects, the target region corresponds to nucleotides 2187-2203 of SEQ ID NO:3 (e.g., ASO-STAT6-2187; SEQ ID NO: 152). In some aspects, the target region corresponds to nucleotides 2350-2366 of SEQ ID NO:3 (e.g., ASO-STAT6-2350; SEQ ID NO: 153). In some aspects, the target region corresponds to nucleotides 2351-2367 of SEQ ID NO:3 (e.g., ASO-STAT6-2351; SEQ ID NO: 154). In some aspects, the target region corresponds to nucleotides 2352-2368 of SEQ ID NO:3 (e.g., ASO-STAT6-2352; SEQ ID NO: 155). In some aspects, the target region corresponds to nucleotides 2357-2373 of SEQ ID NO:3 (e.g., ASO-STAT6-2357; SEQ ID NO: 156). In some aspects, the target region corresponds to nucleotides 513-532 of SEQ ID NO:3 (e.g., ASO-STAT6-513; SEQ ID NO: 157). In some aspects, the target region corresponds to nucleotides 671-690 of SEQ ID NO:3 (e.g., ASO-STAT6-671; SEQ ID NO: 158). In some aspects, the target region corresponds to nucleotides 1131-1150 of SEQ ID NO:3 (e.g., ASO-STAT6-1131; SEQ ID NO: 159). In some aspects, the target region corresponds to nucleotides 1354-1373 of SEQ ID NO:3 (e.g., ASO-STAT6-1354; SEQ ID NO: 160).In some aspects, the target region corresponds to nucleotides 1355-1374 of SEQ ID NO:3 (e.g., ASO-STAT6-1355; SEQ ID NO:161). In some aspects, the target region corresponds to nucleotides 1356-1375 of SEQ ID NO:3 (e.g., ASO-STAT6-1356; SEQ ID NO:162). In some aspects, the target region corresponds to nucleotides 1432-1451 of SEQ ID NO:3 (e.g., ASO-STAT6-1432; SEQ ID NO:163). In some aspects, the target region corresponds to nucleotides 1555-1574 of SEQ ID NO:3 (e.g., ASO-STAT6-1555; SEQ ID NO:164). In some aspects, the target region corresponds to nucleotides 1556-1575 of SEQ ID NO:3 (e.g., ASO-STAT6-1556; SEQ ID NO:165). In some aspects, the target region corresponds to nucleotides 1557-1576 of SEQ ID NO:3 (e.g., ASO-STAT6-1557; SEQ ID NO:166). In some aspects, the target region corresponds to nucleotides 1558-1577 of SEQ ID NO:3 (e.g., ASO-STAT6-1558; SEQ ID NO:167). In some aspects, the target region corresponds to nucleotides 1826-1845 of SEQ ID NO:3 (e.g., ASO-STAT6-1826; SEQ ID NO:168). In some aspects, the target region corresponds to nucleotides 1827-1846 of SEQ ID NO:3 (e.g., ASO-STAT6-1827; SEQ ID NO:169). In some aspects, the target region corresponds to nucleotides 1833-1852 of SEQ ID NO:3 (e.g., ASO-STAT6-1833; SEQ ID NO:170). In some aspects, the target region corresponds to nucleotides 1843-1862 of SEQ ID NO:3 (e.g., ASO-STAT6-1843; SEQ ID NO:171). In some aspects, the target region corresponds to nucleotides 1846-1865 of SEQ ID NO:3 (e.g., ASO-STAT6-1846; SEQ ID NO:172). In some aspects, the target region corresponds to nucleotides 1847-1866 of SEQ ID NO:3 (e.g., ASO-STAT6-1847; SEQ ID NO:173). In some aspects, the target region corresponds to nucleotides 1883-1902 of SEQ ID NO:3 (e.g., ASO-STAT6-1883; SEQ ID NO:174).In some aspects, the target region corresponds to nucleotides 1889-1908 of SEQ ID NO:3 (e.g., ASO-STAT6-1889; SEQ ID NO:175). In some aspects, the target region corresponds to nucleotides 1890-1909 of SEQ ID NO:3 (e.g., ASO-STAT6-1890; SEQ ID NO:176). In some aspects, the target region corresponds to nucleotides 1891-1910 of SEQ ID NO:3 (e.g., ASO-STAT6-1891; SEQ ID NO:177). In some aspects, the target region corresponds to nucleotides 1916-1935 of SEQ ID NO:3 (e.g., ASO-STAT6-1916; SEQ ID NO:178). In some aspects, the target region corresponds to nucleotides 1917-1936 of SEQ ID NO:3 (e.g., ASO-STAT6-1917; SEQ ID NO:179). In some aspects, the target region corresponds to nucleotides 2056-2075 of SEQ ID NO:3 (e.g., ASO-STAT6-2056; SEQ ID NO: 180). In some aspects, the target region corresponds to nucleotides 2057-2076 of SEQ ID NO:3 (e.g., ASO-STAT6-2057; SEQ ID NO: 181). In some aspects, the target region corresponds to nucleotides 2060-2079 of SEQ ID NO:3 (e.g., ASO-STAT6-2060; SEQ ID NO: 182). In some aspects, the target region corresponds to nucleotides 2062-2081 of SEQ ID NO:3 (e.g., ASO-STAT6-2062; SEQ ID NO: 183). In some aspects, the target region corresponds to nucleotides 2063-2082 of SEQ ID NO:3 (e.g., ASO-STAT6-2063; SEQ ID NO: 184). In some aspects, the target region corresponds to nucleotides 2065-2084 of SEQ ID NO:3 (e.g., ASO-STAT6-2065; SEQ ID NO: 185). In some aspects, the target region corresponds to nucleotides 2068-2087 of SEQ ID NO:3 (e.g., ASO-STAT6-2068; SEQ ID NO: 186). In some aspects, the target region corresponds to nucleotides 2347-2366 of SEQ ID NO:3 (e.g., ASO-STAT6-2347; SEQ ID NO: 187). In some aspects, the target region corresponds to nucleotides 2348-2367 of SEQ ID NO:3 (e.g., ASO-STAT6-2348; SEQ ID NO: 188).In some aspects, the target region corresponds to nucleotides 2358-2377 of SEQ ID NO:3 (e.g., ASO-STAT6-2358; SEQ ID NO: 189). In some aspects, the target region corresponds to nucleotides 2782-2801 of SEQ ID NO:3 (e.g., ASO-STAT6-2782; SEQ ID NO: 190). In some aspects, the target region corresponds to nucleotides 3070-3089 of SEQ ID NO:3 (e.g., ASO-STAT6-3070; SEQ ID NO: 191). In some aspects, the target region corresponds to nucleotides 3071-3090 of SEQ ID NO:3 (e.g., ASO-STAT6-3071; SEQ ID NO: 192). In some aspects, the target region corresponds to nucleotides 3431-3450 of SEQ ID NO:3 (e.g., ASO-STAT6-3431; SEQ ID NO: 193).

[0206] In some aspects, the target region corresponds to nucleotides 1053-1067 of SEQ ID NO: 3 (e.g., ASO-STAT6-1053; SEQ ID NO: 91), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1359-1373 of SEQ ID NO: 3 (e.g., ASO-STAT6-1359; SEQ ID NO: 92), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1890-1904 of SEQ ID NO: 3 (e.g., ASO-STAT6-1890; SEQ ID NO: 93), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1892-1906 of SEQ ID NO: 3 (e.g., ASO-STAT6-1892; SEQ ID NO: 94), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1915-1929 of SEQ ID NO: 3 (e.g., ASO-STAT6-1915; SEQ ID NO: 95), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1916-1930 of SEQ ID NO: 3 (e.g., ASO-STAT6-1916; SEQ ID NO: 96), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1917-1931 of SEQ ID NO:3 (e.g., ASO-STAT6-1917; SEQ ID NO:97), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end.In some aspects, the target region corresponds to nucleotides 1918-1932 of SEQ ID NO: 3 (e.g., ASO-STAT6-1918; SEQ ID NO: 98), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1919-1933 of SEQ ID NO: 3 (e.g., ASO-STAT6-1919; SEQ ID NO: 99), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1920-1934 of SEQ ID NO: 3 (e.g., ASO-STAT6-1920; SEQ ID NO: 100), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1937-1951 of SEQ ID NO: 3 (e.g., ASO-STAT6-1937; SEQ ID NO: 101), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1938-1952 of SEQ ID NO: 3 (e.g., ASO-STAT6-1938; SEQ ID NO: 102), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2061-2075 of SEQ ID NO: 3 (e.g., ASO-STAT6-2061; SEQ ID NO: 103), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2062-2076 of SEQ ID NO:3 (e.g., ASO-STAT6-2062; SEQ ID NO: 104), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end.In some aspects, the target region corresponds to nucleotides 2063-2077 of SEQ ID NO: 3 (e.g., ASO-STAT6-2063; SEQ ID NO: 105), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2064-2078 of SEQ ID NO: 3 (e.g., ASO-STAT6-2064; SEQ ID NO: 106), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2066-2080 of SEQ ID NO: 3 (e.g., ASO-STAT6-2066; SEQ ID NO: 107), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2067-2081 of SEQ ID NO: 3 (e.g., ASO-STAT6-2067; SEQ ID NO: 108), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2068-2082 of SEQ ID NO: 3 (e.g., ASO-STAT6-2068; SEQ ID NO: 109), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2352-2366 of SEQ ID NO: 3 (e.g., ASO-STAT6-2352; SEQ ID NO: 110), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 3073-3087 of SEQ ID NO: 3 (e.g., ASO-STAT6-3073; SEQ ID NO: 111), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end.In some aspects, the target region corresponds to nucleotides 1053-1068 of SEQ ID NO: 3 (e.g., ASO-STAT6-1053; SEQ ID NO: 112), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1054-1069 of SEQ ID NO: 3 (e.g., ASO-STAT6-1054; SEQ ID NO: 113), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1356-1371 of SEQ ID NO: 3 (e.g., ASO-STAT6-1356; SEQ ID NO: 114), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1847-1862 of SEQ ID NO: 3 (e.g., ASO-STAT6-1847; SEQ ID NO: 115), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1886-1901 of SEQ ID NO: 3 (e.g., ASO-STAT6-1886; SEQ ID NO: 116), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1887-1902 of SEQ ID NO: 3 (e.g., ASO-STAT6-1887; SEQ ID NO: 117), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1888-1903 of SEQ ID NO:3 (e.g., ASO-STAT6-1888; SEQ ID NO: 118), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end.In some aspects, the target region corresponds to nucleotides 1889-1904 of SEQ ID NO: 3 (e.g., ASO-STAT6-1889; SEQ ID NO: 119), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1890-1905 of SEQ ID NO: 3 (e.g., ASO-STAT6-1890; SEQ ID NO: 120), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1893-1908 of SEQ ID NO: 3 (e.g., ASO-STAT6-1893; SEQ ID NO: 121), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1917-1932 of SEQ ID NO: 3 (e.g., ASO-STAT6-1917; SEQ ID NO: 122), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1919-1934 of SEQ ID NO: 3 (e.g., ASO-STAT6-1919; SEQ ID NO: 123), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2056-2071 of SEQ ID NO: 3 (e.g., ASO-STAT6-2056; SEQ ID NO: 124), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2060-2075 of SEQ ID NO:3 (e.g., ASO-STAT6-2060; SEQ ID NO: 125), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end.In some aspects, the target region corresponds to nucleotides 2066-2081 of SEQ ID NO: 3 (e.g., ASO-STAT6-2066; SEQ ID NO: 126), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2070-2085 of SEQ ID NO: 3 (e.g., ASO-STAT6-2070; SEQ ID NO: 127), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2351-2366 of SEQ ID NO: 3 (e.g., ASO-STAT6-2351; SEQ ID NO: 128), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2352-2367 of SEQ ID NO: 3 (e.g., ASO-STAT6-2352; SEQ ID NO: 129), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2359-2374 of SEQ ID NO: 3 (e.g., ASO-STAT6-2359; SEQ ID NO: 130), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 3633-3648 of SEQ ID NO: 3 (e.g., ASO-STAT6-3633; SEQ ID NO: 131), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 673-689 of SEQ ID NO: 3 (e.g., ASO-STAT6-673; SEQ ID NO: 132), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end.In some aspects, the target region corresponds to nucleotides 1052-1068 of SEQ ID NO: 3 (e.g., ASO-STAT6-1052; SEQ ID NO: 133), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1356-1372 of SEQ ID NO: 3 (e.g., ASO-STAT6-1356; SEQ ID NO: 134), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1357-1373 of SEQ ID NO: 3 (e.g., ASO-STAT6-1357; SEQ ID NO: 135), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1359-1375 of SEQ ID NO: 3 (e.g., ASO-STAT6-1359; SEQ ID NO: 136), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1360-1376 of SEQ ID NO: 3 (e.g., ASO-STAT6-1360; SEQ ID NO: 137), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1839-1855 of SEQ ID NO: 3 (e.g., ASO-STAT6-1839; SEQ ID NO: 138), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1848-1864 of SEQ ID NO:3 (e.g., ASO-STAT6-1848; SEQ ID NO: 139), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end.In some aspects, the target region corresponds to nucleotides 1849-1865 of SEQ ID NO: 3 (e.g., ASO-STAT6-1849; SEQ ID NO: 140), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1891-1907 of SEQ ID NO: 3 (e.g., ASO-STAT6-1891; SEQ ID NO: 141), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1915-1931 of SEQ ID NO: 3 (e.g., ASO-STAT6-1915; SEQ ID NO: 142), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1916-1932 of SEQ ID NO: 3 (e.g., ASO-STAT6-1916; SEQ ID NO: 143), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1917-1933 of SEQ ID NO: 3 (e.g., ASO-STAT6-1917; SEQ ID NO: 144), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1938-1954 of SEQ ID NO: 3 (e.g., ASO-STAT6-1938; SEQ ID NO: 145), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1939-1955 of SEQ ID NO:3 (e.g., ASO-STAT6-1939; SEQ ID NO: 146), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end.In some aspects, the target region corresponds to nucleotides 2063-2079 of SEQ ID NO: 3 (e.g., ASO-STAT6-2063; SEQ ID NO: 147), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2064-2080 of SEQ ID NO: 3 (e.g., ASO-STAT6-2064; SEQ ID NO: 148), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2065-2081 of SEQ ID NO: 3 (e.g., ASO-STAT6-2065; SEQ ID NO: 149), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2066-2082 of SEQ ID NO: 3 (e.g., ASO-STAT6-2066; SEQ ID NO: 150), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2068-2084 of SEQ ID NO: 3 (e.g., ASO-STAT6-2068; SEQ ID NO: 151), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2187-2203 of SEQ ID NO: 3 (e.g., ASO-STAT6-2187; SEQ ID NO: 152), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2350-2366 of SEQ ID NO:3 (e.g., ASO-STAT6-2350; SEQ ID NO: 153), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end.In some aspects, the target region corresponds to nucleotides 2351-2367 of SEQ ID NO: 3 (e.g., ASO-STAT6-2351; SEQ ID NO: 154), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2352-2368 of SEQ ID NO: 3 (e.g., ASO-STAT6-2352; SEQ ID NO: 155), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2357-2373 of SEQ ID NO: 3 (e.g., ASO-STAT6-2357; SEQ ID NO: 156), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 513-532 of SEQ ID NO: 3 (e.g., ASO-STAT6-513; SEQ ID NO: 157), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 671-690 of SEQ ID NO: 3 (e.g., ASO-STAT6-671; SEQ ID NO: 158), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1131-1150 of SEQ ID NO: 3 (e.g., ASO-STAT6-1131; SEQ ID NO: 159), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1354-1373 of SEQ ID NO:3 (e.g., ASO-STAT6-1354; SEQ ID NO: 160), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end.In some aspects, the target region corresponds to nucleotides 1355-1374 of SEQ ID NO: 3 (e.g., ASO-STAT6-1355; SEQ ID NO: 161), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1356-1375 of SEQ ID NO: 3 (e.g., ASO-STAT6-1356; SEQ ID NO: 162), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1432-1451 of SEQ ID NO: 3 (e.g., ASO-STAT6-1432; SEQ ID NO: 163), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1555-1574 of SEQ ID NO: 3 (e.g., ASO-STAT6-1555; SEQ ID NO: 164), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1556-1575 of SEQ ID NO: 3 (e.g., ASO-STAT6-1556; SEQ ID NO: 165), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1557-1576 of SEQ ID NO: 3 (e.g., ASO-STAT6-1557; SEQ ID NO: 166), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1558-1577 of SEQ ID NO:3 (e.g., ASO-STAT6-1558; SEQ ID NO: 167), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end.In some aspects, the target region corresponds to nucleotides 1826-1845 of SEQ ID NO: 3 (e.g., ASO-STAT6-1826; SEQ ID NO: 168), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1827-1846 of SEQ ID NO: 3 (e.g., ASO-STAT6-1827; SEQ ID NO: 169), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1833-1852 of SEQ ID NO: 3 (e.g., ASO-STAT6-1833; SEQ ID NO: 170), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1843-1862 of SEQ ID NO: 3 (e.g., ASO-STAT6-1843; SEQ ID NO: 171), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1846-1865 of SEQ ID NO: 3 (e.g., ASO-STAT6-1846; SEQ ID NO: 172), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1847-1866 of SEQ ID NO: 3 (e.g., ASO-STAT6-1847; SEQ ID NO: 173), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1883-1902 of SEQ ID NO:3 (e.g., ASO-STAT6-1883; SEQ ID NO: 174), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end.In some aspects, the target region corresponds to nucleotides 1889-1908 of SEQ ID NO: 3 (e.g., ASO-STAT6-1889; SEQ ID NO: 175), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1890-1909 of SEQ ID NO: 3 (e.g., ASO-STAT6-1890; SEQ ID NO: 176), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1891-1910 of SEQ ID NO: 3 (e.g., ASO-STAT6-1891; SEQ ID NO: 177), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1916-1935 of SEQ ID NO: 3 (e.g., ASO-STAT6-1916; SEQ ID NO: 178), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 1917-1936 of SEQ ID NO: 3 (e.g., ASO-STAT6-1917; SEQ ID NO: 179), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2056-2075 of SEQ ID NO: 3 (e.g., ASO-STAT6-2056; SEQ ID NO: 180), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2057-2076 of SEQ ID NO:3 (e.g., ASO-STAT6-2057; SEQ ID NO: 181), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end.In some aspects, the target region corresponds to nucleotides 2060-2079 of SEQ ID NO: 3 (e.g., ASO-STAT6-2060; SEQ ID NO: 182), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2062-2081 of SEQ ID NO: 3 (e.g., ASO-STAT6-2062; SEQ ID NO: 183), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2063-2082 of SEQ ID NO: 3 (e.g., ASO-STAT6-2063; SEQ ID NO: 184), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2065-2084 of SEQ ID NO: 3 (e.g., ASO-STAT6-2065; SEQ ID NO: 185), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2068-2087 of SEQ ID NO: 3 (e.g., ASO-STAT6-2068; SEQ ID NO: 186), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2347-2366 of SEQ ID NO: 3 (e.g., ASO-STAT6-2347; SEQ ID NO: 187), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2348-2367 of SEQ ID NO:3 (e.g., ASO-STAT6-2348; SEQ ID NO: 188), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end.In some aspects, the target region corresponds to nucleotides 2358-2377 of SEQ ID NO: 3 (e.g., ASO-STAT6-2358; SEQ ID NO: 189), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 2782-2801 of SEQ ID NO: 3 (e.g., ASO-STAT6-2782; SEQ ID NO: 190), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 3070-3089 of SEQ ID NO: 3 (e.g., ASO-STAT6-3070; SEQ ID NO: 191), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 3071-3090 of SEQ ID NO: 3 (e.g., ASO-STAT6-3071; SEQ ID NO: 192), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or the 5' end. In some aspects, the target region corresponds to nucleotides 3431-3450 of SEQ ID NO:3 (e.g., ASO-STAT6-3431; SEQ ID NO: 193), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' and / or 5' end).

[0207] In some aspects, the ASO is not TGAGCGAATGGACAGGTCTT (SEQ ID NO: 89). In some aspects, the target region corresponds to a continuous nucleotide sequence of 10 to 30 nucleotides in length, which is complementary to a nucleic acid sequence within nucleotides 1-2056 of SEQ ID NO: 3. In some aspects, the target region corresponds to a continuous nucleotide sequence of 10 to 30 nucleotides in length, which is complementary to a nucleic acid sequence within nucleotides 1-2055 of SEQ ID NO: 3. In some aspects, the target region corresponds to a continuous nucleotide sequence of 10 to 30 nucleotides in length, which is complementary to a nucleic acid sequence within nucleotides 1-2054 of SEQ ID NO: 3. In some aspects, the target region corresponds to a continuous nucleotide sequence of 10 to 30 nucleotides in length, which is complementary to a nucleic acid sequence within nucleotides 1-2053 of SEQ ID NO: 3. In some aspects, the target region corresponds to a continuous nucleotide sequence of 10 to 30 nucleotides in length, which is complementary to a nucleic acid sequence within nucleotides 1-2052 of SEQ ID NO: 3. In some aspects, the target region corresponds to a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within nucleotides 1-2051 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within nucleotides 1-2050 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within nucleotides 1-2049 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within nucleotides 1-2048 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within nucleotides 1-2047 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within nucleotides 1-2046 of SEQ ID NO: 3. In some aspects, the target region corresponds to a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within nucleotides 1-2045 of SEQ ID NO: 3. In some aspects, the target region corresponds to a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within nucleotides 1-2044 of SEQ ID NO: 3.In some aspects, the target region corresponds to a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within nucleotides 1-2043 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within nucleotides 1-2042 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within nucleotides 1-2041 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within nucleotides 1-2040 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within nucleotides 1-2039 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within nucleotides 1-2038 of SEQ ID NO:3.

[0208] In some aspects, the target region corresponds to a continuous nucleotide sequence of 10 to 30 nucleotides in length, which is complementary to a nucleic acid sequence within nucleotides 2041-3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a continuous nucleotide sequence of 10 to 30 nucleotides in length, which is complementary to a nucleic acid sequence within nucleotides 2042-3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a continuous nucleotide sequence of 10 to 30 nucleotides in length, which is complementary to a nucleic acid sequence within nucleotides 2043-3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a continuous nucleotide sequence of 10 to 30 nucleotides in length, which is complementary to a nucleic acid sequence within nucleotides 2044-3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a continuous nucleotide sequence of 10 to 30 nucleotides in length, which is complementary to a nucleic acid sequence within nucleotides 2045-3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a continuous nucleotide sequence of 10 to 30 nucleotides in length, which is complementary to a nucleic acid sequence within nucleotides 2046-3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a continuous nucleotide sequence of 10 to 30 nucleotides in length, which is complementary to a nucleic acid sequence within nucleotides 2047-3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a continuous nucleotide sequence of 10 to 30 nucleotides in length, which is complementary to a nucleic acid sequence within nucleotides 2048-3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a continuous nucleotide sequence of 10 to 30 nucleotides in length, which is complementary to a nucleic acid sequence within nucleotides 2049-3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a continuous nucleotide sequence of 10 to 30 nucleotides in length, which is complementary to a nucleic acid sequence within nucleotides 2050-3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within nucleotides 2051-3963 of SEQ ID NO: 3. In some aspects, the target region corresponds to a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within nucleotides 2052-3963 of SEQ ID NO: 3. In some aspects, the target region corresponds to a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within nucleotides 2053-3963 of SEQ ID NO: 3.In some aspects, the target region corresponds to a continuous nucleotide sequence of 10 to 30 nucleotides in length, which is complementary to a nucleic acid sequence within nucleotides 2054-3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a continuous nucleotide sequence of 10 to 30 nucleotides in length, which is complementary to a nucleic acid sequence within nucleotides 2055-3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a continuous nucleotide sequence of 10 to 30 nucleotides in length, which is complementary to a nucleic acid sequence within nucleotides 2056-3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a continuous nucleotide sequence of 10 to 30 nucleotides in length, which is complementary to a nucleic acid sequence within nucleotides 2057-3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a continuous nucleotide sequence of 10 to 30 nucleotides in length, which is complementary to a nucleic acid sequence within nucleotides 2058-3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within nucleotides 2059-3963 of SEQ ID NO:3.

[0209] In some aspects, the ASO of the present disclosure hybridizes with multiple target regions (e.g., genomic sequence, SEQ ID NO: 1) within the STAT6 transcript. In some aspects, the ASO hybridizes with two different target regions within the STAT6 transcript. In some aspects, the ASO hybridizes with three different target regions within the STAT6 transcript. Figure 1 Sequences of exemplary ASOs that hybridize to multiple target regions and the start / stop sites of the different target regions are provided in A. In some aspects, an ASO that hybridizes to multiple regions within a STAT6 transcript (e.g., a genomic sequence, SEQ ID NO: 1) is more potent (e.g., has a lower EC50) in reducing STAT6 expression compared to an ASO that hybridizes to a single region within a STAT6 transcript (e.g., a genomic sequence, SEQ ID NO: 1).

[0210] III.B. ASO STAT6 sequence

[0211] In some aspects, the ASOs of the present disclosure comprise a contiguous nucleotide sequence corresponding to the complement of a region of a STAT6 transcript, eg, a nucleotide sequence corresponding to SEQ ID NO: 1 or SEQ ID NO:3.

[0212] In certain aspects, the disclosure provides an ASO that is 10-30, e.g., 10-15 nucleotides, 10-20 nucleotides, 10-25 nucleotides, or about 20 nucleotides in length, wherein the contiguous nucleotide sequence has at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to a region within the complement of a STAT6 transcript, such as SEQ ID NO: 1 or SEQ ID NO: 3, or a naturally occurring variant thereof. Thus, for example, the ASO hybridizes to a single-stranded nucleic acid molecule having a sequence of SEQ ID NO: 1 or SEQ ID NO: 3, or a portion thereof.

[0213] The ASO may comprise a contiguous nucleotide sequence that is fully complementary (fully complementary) to an equivalent region of a nucleic acid encoding a mammalian STAT6 protein (e.g., SEQ ID NO: 1 or SEQ ID NO: 3). The ASO may comprise a contiguous nucleotide sequence that is fully complementary (fully complementary) to a nucleic acid sequence or a region within a sequence, corresponding to nucleotides XY of SEQ ID NO: 1 or SEQ ID NO: 3, wherein X and Y are the start site and the stop site, respectively, such as Figure 1 As shown in A.

[0214] ASO can include a continuous nucleotide sequence that is completely complementary (completely complementary) to an equivalent region of an mRNA (e.g., SEQ ID NO: 3) encoding a mammalian STAT6 protein. ASO can include a continuous nucleotide sequence that is completely complementary (completely complementary) to an mRNA sequence or a region within a sequence, corresponding to nucleotides XY of SEQ ID NO: 3, wherein X and Y are start sites and stop sites, respectively.

[0215] In some aspects, the nucleotide sequence or contiguous nucleotide sequence of the ASO of the present disclosure is identical to a sequence selected from SEQ ID NOs: 91 to 193 (ie, Figure 1 A) has at least about 80% sequence identity, such as at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96% sequence identity, at least about 97% sequence identity, at least about 98% sequence identity, at least about 99% sequence identity, such as about 100% sequence identity (homologous). In some aspects, the ASO has a design described elsewhere herein or a chemical structure shown elsewhere herein (e.g., Figure 1 A).

[0216] In some aspects, the ASO (or a contiguous nucleotide portion thereof) is selected from or comprises one of the sequences selected from the group consisting of SEQ ID NOs: 91-193, or a region of at least 10 contiguous nucleotides thereof, wherein the ASO (or a contiguous nucleotide portion thereof) may optionally comprise one, two, three or four mismatches when compared to the corresponding STAT6 transcript.

[0217] In some aspects, the ASO comprises a sequence selected from the group consisting of: 91 (e.g., ASO-STAT6-1053), 92 (e.g., ASO-STAT6-1359), 93 (e.g., ASO-STAT6-1890), 94 (e.g., ASO-STAT6-1892), 95 (e.g., ASO-STAT6-1915), 96 (e.g., ASO-STAT6-1916), 97 (e.g., ASO-STAT6-1917), 98 (e.g., ASO-STAT6-1918), 99 (e.g., ASO-STAT6-1919), 100 (e.g., ASO-STAT6-1920), 101 (e.g., ASO-STAT6-1921), 102 (e.g., ASO-STAT6-1923), 103 (e.g., ASO-STAT6-1924), 104 (e.g., ASO-STAT6-1925), 105 (e.g., ASO-STAT6-1926), 106 (e.g., ASO-STAT6-1927), 01 (e.g., ASO-STAT6-1937), 102 (e.g., ASO-STAT6-1938), 103 (e.g., ASO-STAT6-2061), 104 (e.g., ASO-STAT6-2062), 105 (e.g., ASO-STAT6-2063), 106 (e.g., ASO-STAT6-2064), 107 (e.g., ASO-STAT6-2066), 108 (e.g., ASO-STAT6-2067), 109 (e.g., ASO-STAT6-2068), 110 (e.g., ASO-STAT6-2352), 111 (e.g., ASO-STAT6-3 073), 112 (e.g., ASO-STAT6-1053), 113 (e.g., ASO-STAT6-1054), 114 (e.g., ASO-STAT6-1356), 115 (e.g., ASO-STAT6-1847), 116 (e.g., ASO-STAT6-1886), 117 (e.g., ASO-STAT6-1887), 118 (e.g., ASO-STAT6-1888), 119 (e.g., ASO-STAT6-1889), 120 (e.g., ASO-STAT6-1890), 121 (e.g., ASO-STAT6-1893), 122 (e.g., ASO-STAT6-1894), 123 (e.g., ASO-STAT6-1895), 124 (e.g., ASO-STAT6-1896), 125 (e.g., ASO-STAT6-1897), 126 (e.g., ASO-STAT6-1898), 127 (e.g., ASO-STAT6-1899), 128 (e.g., ASO-STAT6-1891), 129 (e.g., ASO-STAT6-1893), 130 (e.g., ASO-STAT6-1894), 131 (e.g., ASO-STAT6-1895), 132 (e.g., ASO-STAT6-1897), 133 (e.g., ASO-STAT6-1898), 134 (e.g., ASO-STAT6-1899), 135 128 (e.g., ASO-STAT6-2351), 129 (e.g., ASO-STAT6-2352), 130 (e.g., ASO-STAT6-2359), 131 (e.g., ASO-STAT6-3633), 132 (e.g., ASO-STAT6-673), 133 (e.g., ASO-STAT6-734), 134 (e.g., ASO-STAT6-735), 135 (e.g., ASO-STAT6-736), 136 (e.g., ASO-STAT6-737), 137 (e.g., ASO-STAT6-738), 138 (e.g., ASO-STAT6-739), 139 (e.g., ASO-STAT6-740), 140 (e.g., ASO-STAT6-741), 141 (e.g., ASO-STAT6-742), 142 (e.g., ASO-STAT6-743), 143 (e.g., ASO-STAT6-744), 144 (e.g., ASO-STAT6-745), 145 (e.g., ASO-STAT6-746), 146 (e.g., ASO-STAT6-747), 147 (e.g., ASO-STAT6-748), 148 (e.g., ASO-STAT6-749), 149 (e.g., ASO-STAT6-750), 150 (e.g., ASO-STAT6-751134 (e.g., ASO-STAT6-1356), 135 (e.g., ASO-STAT6-1357), 136 (e.g., ASO-STAT6-1359), 137 (e.g., ASO-STAT6-1360), 138 (e.g., ASO-STAT6-1839), 139 (e.g., ASO-STAT6-1848), 140 (e.g., ASO-STAT6-1849), 141 (e.g., ASO-STAT6-1891), 142 (e.g., ASO-STAT6-1915), 143 (e.g., ASO-STAT6-1916), 144 (e.g., ASO-STAT6-1917), 145 (e.g., ASO-STAT6-1938), 146 (e.g., ASO-STAT6-1939), 147 (e.g., ASO-STAT6-2063), 148 (e.g., ASO-STAT6-2064), 149 (e.g., ASO-STAT6-2065), 150 (e.g., ASO-STAT6-2066), 151 (e.g., ASO-STAT6-2068), 152 (e.g., ASO-STAT6-2187), 153 (e.g., ASO-STAT6-2350), 154 (e.g., ASO-STAT6- 2351), 155 (e.g., ASO-STAT6-2352), 156 (e.g., ASO-STAT6-2357), 157 (e.g., ASO-STAT6-513), 158 (e.g., ASO-STAT6-671), 159 (e.g., ASO-STAT6-1131), 160 (e.g., ASO-STAT6-1354), 161 (e.g., ASO-STAT6-1355), 162 (e.g., ASO-STAT6-1356), 163 (e.g., ASO-STAT6-1432), 164 (e.g., ASO-STAT6-1555), 165 (e.g., ASO-STAT6-1556), AT6-1556), 166 (e.g., ASO-STAT6-1557), 167 (e.g., ASO-STAT6-1558), 168 (e.g., ASO-STAT6-1826), 169 (e.g., ASO-STAT6-1827), 170 (e.g., ASO-STAT6-1833), 171 (e.g., ASO-STAT6-1843), 172 (e.g., ASO-STAT6-1846), 173 (e.g., ASO-STAT6-1847), 174 (e.g., ASO-STAT6-1883), 175 (e.g., ASO-STAT6-1889), 176 (e.g.,177 (e.g., ASO-STAT6-1891), 178 (e.g., ASO-STAT6-1916), 179 (e.g., ASO-STAT6-1917), 180 (e.g., ASO-STAT6-2056), 181 (e.g., ASO-STAT6-2057), 182 (e.g., ASO-STAT6-2060), 183 (e.g., ASO-STAT6-2062), 184 (e.g., ASO-STAT6-2063), 185 (e.g., ASO-STAT6-2065), 186 (e.g., ASO-STAT6-2068), 187 (e.g., ASO-STAT6-2347), 188 (e.g., ASO-STAT6-2348), 189 (e.g., ASO-STAT6-2358), 190 (e.g., ASO-STAT6-2782), 191 (e.g., ASO-STAT6-3070), 192 (e.g., ASO-STAT6-3071), and 193 (e.g., ASO-STAT6-3431). ,

[0218] In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO:91 (e.g., ASO-STAT6-1053). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO:92 (e.g., ASO-STAT6-1359). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO:93 (e.g., ASO-STAT6-1890). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO:94 (e.g., ASO-STAT6-1892). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO:95 (e.g., ASO-STAT6-1915). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO:96 (e.g., ASO-STAT6-1916). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO:97 (e.g.,

[0219] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 98 (e.g.,

[0220] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 99 (e.g.,

[0221] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 100 (e.g.,

[0222] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 101 (e.g.,

[0223] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 102 (e.g.,

[0224] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 103 (e.g.,

[0225] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 104 (e.g.,

[0226] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 105 (e.g.,

[0227] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 106 (e.g.,

[0228] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 107 (e.g.,

[0229] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 108 (e.g.,

[0230] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 109 (e.g.,

[0231] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 110 (e.g.,

[0232] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 111 (e.g.,

[0233] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 112 (e.g.,

[0234] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 113 (e.g.,

[0235] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 114 (e.g.,

[0236] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 115 (e.g.,

[0237] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 116 (e.g.,

[0238] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 117 (e.g.,

[0239] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 118 (e.g.,

[0240] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 119 (e.g.,

[0241] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 120 (e.g.,

[0242] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 121 (e.g.,

[0243] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 122 (e.g.,

[0244] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 123 (e.g.,

[0245] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 124 (e.g.,

[0246] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 125 (e.g.,

[0247] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 126 (e.g.,

[0248] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 127 (e.g.,

[0249] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 128 (e.g.,

[0250] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 129 (e.g.,

[0251] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 130 (e.g.,

[0252] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 131 (e.g.,

[0253] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 132 (e.g.,

[0254] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 133 (e.g.,

[0255] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 134 (e.g.,

[0256] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 135 (e.g.,

[0257] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 136 (e.g.,

[0258] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 137 (e.g.,

[0259] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 138 (e.g.,

[0260] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 139 (e.g.,

[0261] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 140 (e.g.,

[0262] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 141 (e.g.,

[0263] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 142 (e.g.,

[0264] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 143 (e.g.,

[0265] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 144 (e.g.,

[0266] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 145 (e.g.,

[0267] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 146 (e.g.,

[0268] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 147 (e.g.,

[0269] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 148 (e.g.,

[0270] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 149 (e.g.,

[0271] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 150 (e.g.,

[0272] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 151 (e.g.,

[0273] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 152 (e.g.,

[0274] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 153 (e.g.,

[0275] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 154 (e.g.,

[0276] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 155 (e.g.,

[0277] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 156 (e.g.,

[0278] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 157 (e.g.,

[0279] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 158 (e.g.,

[0280] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 159 (e.g.,

[0281] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 160 (e.g.,

[0282] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 161 (e.g.,

[0283] In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 162 (e.g.,

[0284] In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 163 (e.g., ASO-STAT6-1432). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 164 (e.g., ASO-STAT6-1555). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 165 (e.g., ASO-STAT6-1556). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 166 (e.g., ASO-STAT6-1557). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 167 (e.g., ASO-STAT6-1558). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 168 (e.g., ASO-STAT6-1826). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 169 (e.g., ASO-STAT6-1827). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 170 (e.g., ASO-STAT6-1833). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 171 (e.g., ASO-STAT6-1843). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 172 (e.g., ASO-STAT6-1846). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 173 (e.g., ASO-STAT6-1847). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 174 (e.g., ASO-STAT6-1883). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 175 (e.g., ASO-STAT6-1889). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 176 (e.g., ASO-STAT6-1890). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 177 (e.g., ASO-STAT6-1891). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 178 (e.g., ASO-STAT6-1916). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 179 (e.g., ASO-STAT6-1917). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 180 (e.g., ASO-STAT6-2056). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 181 (e.g., ASO-STAT6-2057).In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 182 (e.g., ASO-STAT6-2060). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 183 (e.g., ASO-STAT6-2062). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 184 (e.g., ASO-STAT6-2063). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 185 (e.g., ASO-STAT6-2065). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 186 (e.g., ASO-STAT6-2068). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 187 (e.g., ASO-STAT6-2347). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 188 (e.g., ASO-STAT6-2348). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 189 (e.g., ASO-STAT6-2358). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 190 (e.g., ASO-STAT6-2782). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 191 (e.g., ASO-STAT6-3070). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 192 (e.g., ASO-STAT6-3071). In some aspects, the ASO comprises a sequence as shown in SEQ ID NO: 193 (e.g., ASO-STAT6-3431).

[0285] In some aspects, the ASOs of the present disclosure bind to a target nucleic acid sequence (e.g., a STAT6 transcript) and are capable of inhibiting or reducing the expression of a STAT6 transcript by at least 10% or 20% compared to normal (i.e., control) expression levels in a cell, for example, by at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% compared to normal expression levels (expression levels in cells not exposed to the ASO).

[0286] In some aspects, the ASOs of the present disclosure are capable of reducing the in vitro expression of STAT6 mRNA in target cells by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% when the cells are contacted with the ASO, compared to cells not contacted with the ASO (e.g., contacted with saline).

[0287] III.C. ASO length

[0288] The ASO may comprise a contiguous nucleotide sequence that is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 contiguous nucleotides in length. It will be understood that when a range of ASO or contiguous nucleotide sequence length is given, the range includes the lower and upper lengths provided in the range, e.g., from (or between) 10 to 30, inclusive.

[0289] In some aspects, the ASO comprises a continuous nucleotide sequence having a length totaling about 14-20, 14, 15, 16, 17, 18, 19 or 20 continuous nucleotides. In some aspects, the ASO comprises a continuous nucleotide sequence having a length totaling about 20 continuous nucleotides. In some aspects, the length of the ASO of the present disclosure is 14 nucleotides. In some aspects, the length of the ASO of the present disclosure is 15 nucleotides. In some aspects, the length of the ASO of the present disclosure is 16 nucleotides. In some aspects, the length of the ASO of the present disclosure is 17 nucleotides. In some aspects, the length of the ASO of the present disclosure is 18 nucleotides. In some aspects, the length of the ASO of the present disclosure is 19 nucleotides.

[0290] III.D. Nucleosides and Nucleoside Analogs

[0291] In one aspect of the present disclosure, ASO comprises one or more non-naturally occurring nucleoside analogs. As used herein, "nucleoside analogs" are variants of natural nucleosides, such as DNA or RNA nucleosides, through the modification of sugar and / or base moieties. In the context of oligonucleotides, analogs can in principle be simply the "silence" or "equivalence" of natural nucleosides, that is, there is no functional effect on the way in which oligonucleotides inhibit target gene expression. However, if such "equivalent" analogs are easier or cheaper to prepare, or more stable under storage or manufacturing conditions, or represent labels or markers, then the equivalent analogs may be useful. However, in some aspects, analogs will have a functional effect on the way in which ASOs inhibit expression; for example, by generating an increased binding affinity to the target and / or increased resistance to intracellular nucleases and / or the ease of transport to the increase in the cell. Specific examples of nucleoside analogs are described by, for example, Freier and Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3 (2), 293-213, and in Scheme 1. The ASOs disclosed herein may contain more than one, more than two, more than three, more than four, more than five, more than six, more than seven, more than eight, more than nine, more than 10, more than 11, more than 12, more than 13, more than 14, more than 15, more than 16, more than 18, more than 19 or more than 20 nucleoside analogs. In some aspects, the nucleoside analogs in the ASO are identical. In other aspects, the nucleoside analogs in the ASO are different. The nucleotide analog in the ASO can be any one or a combination of the following nucleoside analogs.

[0292] In some aspects, the nucleoside analog comprises 2'-O-alkyl-RNA; 2'-O-methyl RNA (2'-OMe); 2'-alkoxy-RNA; 2'-O-methoxyethyl-RNA (2'-MOE); 2'-amino-DNA; 2'-fluoro-RNA; 2'-fluoro-DNA; arabinose nucleic acid (ANA); 2'-fluoro-ANA or bicyclic nucleoside analogs; or any combination thereof. In some aspects, the nucleoside analog comprises a sugar-modified nucleoside. In some aspects, the nucleoside analog comprises a nucleoside comprising a bicyclic sugar. In some aspects, the nucleoside analog comprises LNA.

[0293] In some aspects, the nucleoside analog is selected from the group consisting of: constrained ethyl nucleosides (cEt), 2',4'-constrained 2'-O-methoxyethyl (cMOE), α-L-LNA, β-D-LNA, 2'-O,4'-C-ethylene bridged nucleic acid (ENA), amino-LNA, oxy-LNA, thio-LNA, and any combination thereof. In some aspects, the ASO comprises one or more 5'-methyl-cytosine nucleobases.

[0294] III.D.1. Nucleobases

[0295] The term core base includes purine (e.g., adenine and guanine) and pyrimidine (e.g., uracil, thymine and cytosine) moieties present in nucleosides and nucleotides, which form hydrogen bonds in nucleic acid hybridization. In the context of the present disclosure, the term core base also encompasses modified core bases that are different from naturally occurring core bases but have functionality during nucleic acid hybridization. In some aspects, the core base moiety is modified by modifying or replacing the core base. In this context, "core base" refers to naturally occurring core bases such as adenine, guanine, cytosine, thymine, uracil, xanthine and hypoxanthine, and non-naturally occurring variants. Such variants are, for example, those described in Hirao et al. (2012) Accounts of Chemical Research, Vol. 45, p. 2055 and in Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry, Suppl. 37 1.4.1.

[0296] In some aspects, the nucleobase moiety is modified by changing a purine or pyrimidine to a modified purine or pyrimidine, such as a substituted purine or substituted pyrimidine, such as a nucleobase selected from the group consisting of isocytosine, pseudoisocytosine, 5-methyl-cytosine, 5-thiazolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil, 5-thiazolo-uracil, 2-thio-uracil, 2'thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.

[0297] The nucleobase moiety can be indicated by the letter code for each corresponding nucleobase, for example, A, T, G, C or U, wherein each letter can optionally include a functionally equivalent modified nucleobase. For example, in the exemplary oligonucleotide, the nucleobase moiety is selected from A, T, G, C and 5-methyl-cytosine. Optionally, for LNA gap bodies, 5-methyl-cytosine LNA nucleosides can be used.

[0298] III.D.2. Sugar modifications

[0299] The ASOs of the present disclosure may comprise one or more nucleosides with modified sugar moieties, i.e., modifications to the sugar moiety when compared to the ribose sugar moiety found in DNA and RNA. Many nucleosides with modifications to the ribose sugar moiety have been prepared, primarily with the goal of improving certain properties of the oligonucleotide, such as affinity and / or nuclease resistance.

[0300] Such modifications include modifications to the ribose ring structure, such as by replacing a hexose ring (HNA), or a bicyclic (LNA) with a diradical bridge between C2' and C4' carbons on the ribose ring, or a non-connected ribose ring (e.g., UNA) lacking a key between C2' and C3' carbons. Other sugar-modified nucleosides include, for example, bicyclohexose nucleic acids (WO2011 / 017521) or tricyclic nucleic acids (WO2013 / 154798). Modified nucleosides also include nucleosides in which sugar moieties are substituted for non-sugar moieties, such as in the case of peptide nucleic acids (PNA) or morpholino nucleic acids.

[0301] Sugar modification also includes the modification by changing the substituent on the ribose ring to a group other than the naturally occurring 2'-OH group in the dehydrogenation or RNA nucleoside. The substituent can be introduced, for example, at the 2', 3', 4' or 5' position. Nucleosides with modified sugar moieties also include 2' modified nucleosides, such as 2' substituted nucleosides. In fact, a lot of effort has been spent on developing 2' substituted nucleosides, and it has been found that many 2' substituted nucleosides have useful properties when incorporated into oligonucleotides, such as enhanced nucleoside resistance and enhanced affinity.

[0302] III.D.2.a 2'-modified nucleosides

[0303] Nucleosides modified through 2' sugars are nucleosides having a substituent (nucleosides substituted through 2') or a diradical nucleosides connected with 2' at the 2' position except H or -OH, and include nucleosides substituted through 2' and LNA (2'-4' diradical bridged) nucleosides. For example, sugars modified through 2' can provide enhanced binding affinity with oligonucleotides (e.g., 2' sugar-modified nucleosides with enhanced affinity) and / or increased nuclease resistance to oligonucleotides. Examples of nucleosides modified through 2' substitutions are 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-RNA, arabinose nucleic acid (ANA) and 2'-fluoro-ANA nucleosides. For additional examples, see, e.g., Freier and Altmann; Nucleic Acids Research, 1997, 25, 4429-4443; Uhlmann; Current Opinion in Drug Development, 2000, 3(2), 293-213; and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. Below are schematic diagrams of some 2'-substituted modified nucleosides.

[0304]

[0305] III.D.2.b Locked Nucleic Acid (LNA).

[0306] LNA nucleosides are modified nucleosides that contain a linker group (called a diradical or bridge) between the C2' and C4' of the ribose ring of the nucleoside (i.e., a 2'-4' bridge) that restricts or locks the conformation of the ribose ring. These nucleosides are also referred to in the literature as bridged nucleic acids or bicyclic nucleic acids (BNA). When LNA is incorporated into an oligonucleotide of a complementary RNA or DNA molecule, the locking of the conformation of the ribose is associated with an enhanced affinity for hybridization (duplex stabilization). This can be routinely determined by measuring the melting temperature of the oligonucleotide / complement duplex.

[0307] Non-limiting exemplary LNA nucleosides are disclosed in WO 99 / 014226, WO 00 / 66604, WO 98 / 039352, WO 2004 / 046160, WO 00 / 047599, WO 2007 / 134181, WO 2010 / 077578, WO 2010 / 036698, WO 2007 / 090071, WO 2009 / 006478, WO 2011 / 156202, WO 2008 / 154401, WO 2009 / 067647, WO2008 / 150729, Morita et al., Bioorganic & Med. Chem. Lett. 12, 73-76, Seth et al., Journal of Organic Chemistry (J. Org. Chem.) 2010, Vol. 75(5), pp. 1569-81, and Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238.

[0308] In some aspects, the modified nucleosides or LNA nucleosides of the ASOs of the present disclosure have the general structure of Formula I or II:

[0309]

[0310] in

[0311] W is selected from -O-, -S-, -N(R a )-、-C(R a R b )-, specifically -O-;

[0312] B is a nucleobase or a modified nucleobase moiety;

[0313] Z is an internucleoside bond to an adjacent nucleoside or to the 5'-terminal group;

[0314] Z* is an internucleoside bond to an adjacent nucleoside or to the 3′-terminal group;

[0315] R 1 , R 2 , R 3 , R 5 and R 5* are each independently selected from hydrogen, halogen, alkyl, alkenyl, alkynyl, hydroxy, alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, formyl, azide, heterocycle, and aryl; and

[0316] X, Y, R a and R b As defined herein.

[0317] In some aspects, -XY-, R a is hydrogen or alkyl, specifically hydrogen or methyl. In some aspects of -XY-, R b is hydrogen or alkyl, specifically hydrogen or methyl. In some aspects of -XY-, R a and R b One or both are hydrogen. In another aspect of -XY-, only R a and R b One of them is hydrogen. In some aspects of -XY-, R a and R b One of the -XY- is methyl, and the other is hydrogen. In some aspects of -XY-, R a and R b Both are methyl groups.

[0318] In some aspects, -X-, R a is hydrogen or alkyl, specifically hydrogen or methyl. In some aspects of -X-, R b is hydrogen or alkyl, specifically hydrogen or methyl. In other aspects of -X-, R a and R b One or both are hydrogen. In certain aspects of -X-, only R a and R b One of them is hydrogen. In some aspects of -X-, R a and R b In other aspects of -X-, R a and R b Both are methyl groups.

[0319] In some aspects, -Y-, R a is hydrogen or alkyl, specifically hydrogen or methyl. In certain aspects of -Y-, R b is hydrogen or alkyl, specifically hydrogen or methyl. In other aspects of -Y-, R a and R b One or both are hydrogen. In some aspects of -Y-, only R a and R b One of them is hydrogen. In other aspects of -Y-, R a and R b One of the -Y- is methyl, and the other is hydrogen. In some aspects of -Y-, R a and R b Both are methyl groups.

[0320] In some respects, R 1 , R 2 , R 3 , R 5 and R 5* Each is independently selected from hydrogen and alkyl, specifically hydrogen and methyl.

[0321] In some respects, R 1 , R 2 , R 3 , R 5 and R 5* Both are hydrogen.

[0322] In some respects, R 1 , R 2 , R 3 At the same time, both are hydrogen, R 5 and R 5* One of the is hydrogen and the other is as defined above, specifically alkyl, more specifically methyl.

[0323] In some respects, R 1 , R 2 , R 3 At the same time, both are hydrogen, R 5 and R 5* One of them is hydrogen and the other is azide.

[0324] In some aspects, -XY- is -O-CH 2 -, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* Such LNA nucleosides are disclosed in WO 99 / 014226, WO 00 / 66604, WO 98 / 039352 and WO 2004 / 046160, all of which are hereby incorporated by reference, and include LNA nucleosides generally known in the art such as β-D-oxy LNA and α-L-oxy LNA nucleosides.

[0325] In some aspects, -XY- is -S-CH 2 -, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* Such thio-LNA nucleosides are disclosed in WO 99 / 014226 and WO 2004 / 046160, which are hereby incorporated by reference.

[0326] In some aspects, -XY- is -NH-CH 2 -, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5*Such amino LNA nucleosides are disclosed in WO 99 / 014226 and WO 2004 / 046160, which are hereby incorporated by reference.

[0327] In some aspects, -XY- is -O-CH 2 CH 2 -or-OCH 2 CH 2 CH 2 -, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* Such LNA nucleosides are disclosed in WO 00 / 047599 and Morita et al., Bioorganic and Medical Chemistry Communications 12, 73-76, which are hereby incorporated by reference, and include LNA nucleosides generally known in the art such as 2'-0-4'-ethylene bridged nucleic acids (ENA).

[0328] In some aspects, -XY- is -O-CH 2 -, W is oxygen, R 1 , R 2 , R 3 At the same time, both are hydrogen, R 5 and R 5* One of the 5'-substituted LNA nucleosides is hydrogen and the other is not hydrogen, such as an alkyl group, for example a methyl group. Such 5'-substituted LNA nucleosides are disclosed in WO 2007 / 134181, which is hereby incorporated by reference.

[0329] In some aspects, -XY- is -O-CR a R b -, where R a and R b One or both of them are not hydrogen, specifically alkyl such as methyl, W is oxygen, R 1 , R 2 , R 3 At the same time, both are hydrogen, R 5 and R 5* One of the is hydrogen and the other is not hydrogen, in particular an alkyl group, such as a methyl group. Such double-modified LNA nucleosides are disclosed in WO 2010 / 077578, which is hereby incorporated by reference.

[0330] In some aspects, -XY- is -O-CH(CH 2 -O-CH 3 )-("2'O-methoxyethyl bicyclic nucleic acids", Seth et al., Journal of Organic Chemistry, 2010, Vol. 75(5), pp. 1569-81).

[0331] In some aspects, -XY- is -O-CHR a -, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* and are both hydrogen. Such 6'-substituted LNA nucleosides are disclosed in WO 2010 / 036698 and WO 2007 / 090071, which are hereby incorporated by reference. In such 6'-substituted LNA nucleosides, R a Specifically, it is a C1-C6 alkyl group, such as a methyl group.

[0332] In some aspects, -XY- is -O-CH(CH 2 -O-CH 3 )-, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* Such LNA nucleosides are also known in the art as cyclic MOE (cMOE) and are disclosed in WO 2007 / 090071.

[0333] In some aspects, -XY- is -O-CH(CH 3 )-.

[0334] In some aspects, -XY- is -O-CH 2- O-CH 2 -(Seth et al., J. Org. Chem. 2010 supra).

[0335] In some aspects, -XY- is -O-CH(CH 3 )-, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* Such 6'-methyl LNA nucleosides are also known in the art as cET nucleosides and may be (S)-cET or (R)-cET diastereomers as disclosed in WO 2007 / 090071 (β-D) and WO 2010 / 036698 (α-L), both of which are hereby incorporated by reference.

[0336] In some aspects, -XY- is -O-CR a R b -, where R a and R b None of them are hydrogen, W is oxygen, and R1 , R 2 , R 3 , R 5 and R 5* At the same time, they are both hydrogen. In some respects, R a and R b Both are alkyl at the same time, in particular both are methyl at the same time. Such 6' disubstituted LNA nucleosides are disclosed in WO 2009 / 006478, which is hereby incorporated by reference.

[0337] In some aspects, -XY- is -S-CHR a -, W is oxygen, and R 1 , R 2 , R 3 , R 5 and R 5* Such 6'-substituted thio-LNA nucleosides are disclosed in WO 2011 / 156202, which is hereby incorporated by reference. In certain aspects of such 6'-substituted thio-LNAs, R a is an alkyl group, specifically a methyl group.

[0338] In some aspects, -XY- is -C(=CH 2 )C(R a R b )-, if W is oxygen, and R 1 , R 2 , R 3 , R 5 and R 5* Such vinyl carbon LNA nucleosides are disclosed in WO 2008 / 154401 and WO 2009 / 067647, both of which are hereby incorporated by reference.

[0339] In some aspects, -XY- is -N(OR a )-CH 2 -, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* are both hydrogen. In some aspects, R a is an alkyl group, such as methyl. Such LNA nucleosides are also known as N-substituted LNAs and are disclosed in WO 2008 / 150729, which is hereby incorporated by reference.

[0340] In some aspects, -XY- is -O-NCH 3 -(Seth et al., J. Org. Chem. 2010 supra).

[0341] In some aspects, -XY- is ON (R a )--N(R a )-O-、-NR a -CR a R b -CR a R b -or-NR a -CR a R b -, W is oxygen, and R 1 , R 2 , R 3 , R 5 and R 5* At the same time, they are both hydrogen. In some respects, R a is an alkyl group, such as a methyl group. (Seth et al., Journal of Organic Chemistry, 2010 supra).

[0342] In some respects, R 5 and R 5* Both are hydrogen. In other respects, R 5 and R 5* One of is hydrogen and the other is alkyl, such as methyl. In such aspects, R 1 , R 2 and R 3 may be specifically hydrogen, and -XY- may be specifically -O-CH 2 -or-O-CHC(R a ) 3 -, such as -O-CH(CH 3 )-.

[0343] In some aspects, -XY- is -CR a R b -O-CR a R b -, such as -CH 2 -O-CH 2 -, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* At the same time, they are both hydrogen. In this respect, R a It may be in particular an alkyl group, such as a methyl group. Such LNA nucleosides are also known as conformationally restricted nucleotides (CRNs) and are disclosed in WO 2013 / 036868, which is hereby incorporated by reference.

[0344] In some aspects, -XY- is -O-CR a R b -O-CR a Rb -, such as -O-CH 2 -O-CH 2 -, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* At the same time, they are both hydrogen. In some respects, R a It may be in particular an alkyl group, such as a methyl group. Such LNA nucleosides are also known as COC nucleotides LNA and are disclosed in Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238, which is hereby incorporated by reference.

[0345] Unless otherwise stated, it will be appreciated that LNA nucleosides may be either the β-D or α-L stereoisomer.

[0346] Some examples of LNA nucleosides are presented in Scheme 1.

[0347] Solution 1

[0348]

[0349] As presented elsewhere, in some aspects of the disclosure, the LNA nucleosides in the oligonucleotides are β-D-oxy-LNA nucleosides.

[0350] III.E. Nuclease-mediated degradation

[0351] Nuclease-mediated degradation refers to oligonucleotides that, when duplexed with complementary nucleotide sequences, are capable of mediating the degradation of such sequences.

[0352] In some aspects, the oligonucleotides can function by nuclease-mediated degradation of the target nucleic acid, wherein the oligonucleotides of the disclosure are capable of recruiting nucleases, particularly endonucleases, preferably endoribonucleases (RNases), such as RNase H. Examples of oligonucleotide designs that function by a nuclease-mediated mechanism are oligonucleotides that typically comprise a region of at least 5 or 6 DNA nucleosides and are flanked on one or both sides by affinity-enhancing nucleosides, such as gapmers.

[0353] III.F. RNase H activity and recruitment

[0354] The RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H and induce degradation of complementary RNA molecules when forming a duplex with a complementary RNA molecule. WO01 / 23613 provides an in vitro method for determining RNase H activity, which can be used to determine the ability to recruit RNase H. Generally, an oligonucleotide is considered to be able to recruit RNase H if, when a complementary target nucleic acid sequence is provided, the initial rate (measured in pmoles / liter / minute) of the complementary target nucleic acid sequence is at least 5%, such as at least 10% or greater than 20% of the initial rate determined when an oligonucleotide having the same base sequence as the modified oligonucleotide being tested is used, but contains only DNA monomers, wherein all monomers in the oligonucleotide have phosphorothioate bonds between them, and the method provided in Examples 91-95 of WO01 / 23613 is used.

[0355] In some aspects, an oligonucleotide is considered to be substantially incapable of recruiting RNase H if, when provided with a complementary target nucleic acid, the initial rate of RNase H (measured in pmoles / L / minute) is less than 20%, such as less than 10%, such as less than 5%, of the initial rate determined when using an oligonucleotide having the same base sequence as the oligonucleotide being tested, but contains only DNA monomers, no 2' substitutions, wherein all monomers in the oligonucleotide have phosphorothioate bonds between them, and the methods provided in Examples 91-95 of WO01 / 23613 are used.

[0356] III.G.ASO Design

[0357] The ASOs of the present disclosure may comprise a nucleotide sequence comprising both nucleosides and nucleoside analogs, and may be in the form of a gapmer. Examples of configurations of gapmers that may be used with the ASOs of the present disclosure are described in U.S. Patent Application Publication No. 2012 / 0322851.

[0358] As used herein, the term "gapmer" refers to an antisense oligonucleotide comprising a region of an RNase H recruiting oligonucleotide (gap), the region being flanked by one or more affinity-enhanced modified nucleosides (flanks) at 5' and 3'. The term "LNA gapmer" is a gapmer oligonucleotide, wherein at least one affinity-enhanced modified nucleoside of the affinity-enhanced modified nucleoside is an LNA nucleoside. The term "mixed wing gapmer" refers to an LNA gapmer, wherein the flank region comprises at least one LNA nucleoside and at least one DNA nucleoside or non-LNA modified nucleoside, such as at least one 2'-substituted modified nucleoside, for example, 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-DNA, arabinose nucleic acid (ANA) and 2'-fluoro-ANA nucleosides.

[0359] In some aspects, the ASO of the present disclosure may be in the form of a mixed polymer. In some aspects, the ASO of the present disclosure may be in the form of a full polymer. In some aspects, in addition to enhancing the affinity of the ASO to the target region, some nucleoside analogs also mediate RNA enzyme (e.g., RNA enzyme H) binding and cleavage. Since the α-L-LNA monomer recruits RNA enzyme H activity to a certain extent, in some aspects, the gap region (e.g., region B referred to herein) of the ASO containing the α-L-LNA monomer is composed of fewer monomers that can be recognized and cleaved by RNA enzyme H, and greater flexibility is introduced in the construction of the mixed polymer.

[0360] In some aspects, the ASO of the present disclosure is a gap body and comprises a continuous stretch of nucleotides (e.g., one or more DNAs) capable of recruiting an RNase (e.g., RNase H), referred to herein as region B (B), wherein region B is flanked at both 5' and 3' by regions 5' and 3' of nucleoside analogs to a continuous stretch of nucleotides of region B - these regions are referred to as region A (A) and region C (C), respectively. In some aspects, the nucleoside analogs are sugar-modified nucleosides (e.g., high-affinity sugar-modified nucleosides). In certain aspects, the sugar-modified nucleosides of regions A and C enhance the affinity of the ASO to the target nucleic acid (i.e., affinity-enhanced 2' sugar-modified nucleosides). In some aspects, the sugar-modified nucleosides are 2' sugar-modified nucleotides, such as high-affinity 2' sugar modifications, such as LNA and / or 2'-MOE.

[0361] In the gapmer, the 5' and 3' most proximal nucleosides of region B are DNA nucleosides and are positioned adjacent to nucleoside analogs (e.g., high affinity sugar-modified nucleosides) of regions A and C, respectively. In some aspects, regions A and C can be further defined by having nucleoside analogs at the ends furthest from region B (i.e., at the 5' end of region A and the 3' end of region C).

[0362] In some aspects, the ASO of the present disclosure comprises a nucleotide sequence of formula (5' to 3') ABC, wherein: (A) (the 5' region or the first wing sequence) comprises at least one nucleoside analog (e.g., 3-5 LNA units); (B) comprises at least four consecutive nucleosides (e.g., 4-24 DNA units) that are capable of recruiting RNases when forming a duplex with a complementary RNA molecule (such as a pre-mRNA or an mRNA target); and (C) (the 3' region or the second wing sequence) comprises at least one nucleoside analog (e.g., 3-5 LNA units).

[0363] In some aspects, region A comprises 3-5 nucleoside analogs, such as LNA, region B consists of 6-24 (e.g., 6, 7, 8, 9, 10, 11, 12, 13 or 14) DNA units, and region C consists of 3 or 4 nucleoside analogs, such as LNA. Such designs include (ABC) 3-14-3, 3-11-3, 3-12-3, 3-13-3, 4-9-4, 4-10-4, 4-11-4, 4-12-4, and 5-10-5. In some aspects, the ASO has LLLD n LLL, LLLLD n LLLL or LLLLLD n In some aspects, the ASO has a design of LLLMMDnMMLLL, LLLMDnMLLL, LLLMMMDnMMLLLL, LLLLMDnMLLLL, LLLLLLMMMDnMMLLLLL, or LLLLLLMDnMLLLLL, wherein D is DNA, n can be any integer between 3 and 15, L is LNA, and M is 2'MOE.

[0364] Additional interstitial body designs are disclosed in WO 2004 / 046160, WO 2007 / 146511 and WO 2008 / 113832, each of which is hereby incorporated by reference in its entirety.

[0365] III.H. Internucleotide bonds

[0366] The monomers of the ASOs described herein are coupled together via a linkage group. Suitably, each monomer is linked to the 3' adjacent monomer via a linkage group.

[0367] One of ordinary skill in the art will appreciate that in the context of the present disclosure, the 5' monomer at the end of an ASO does not include a 5' linkage group, although it may or may not include a 5' terminal group.

[0368] In some aspects, the continuous nucleotide sequence comprises one or more modified internucleoside bonds. The term "linking group" or "internucleoside bond" is intended to mean a group that can covalently couple two nucleosides together. Non-limiting examples include phosphate groups and thiophosphate groups.

[0369] The nucleosides of the ASO of the present disclosure or a sequence of consecutive nucleosides thereof are coupled together by a bond group. Suitably, each nucleoside is linked to the 3' adjacent nucleoside by a bond group.

[0370] In some aspects, the internucleoside linkage is modified from its normal phosphodiester to a linkage that is more resistant to nuclease attack (such as phosphorothioate that can be cleaved by RNase H), also allowing the antisense inhibition approach to reduce the expression of the target gene. In some aspects, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the internucleoside linkages are modified.

[0371] IV. Extracellular vesicles, e.g., exosomes

[0372] Disclosed herein are EVs (e.g., exosomes) comprising ASOs. The ASOs may be any ASO described herein or a functional fragment thereof. In some aspects, the ASOs reduce the level of STAT6 mRNA or STAT6 protein in target cells.

[0373] In some aspects, EV (e.g., exosomes) target tumor cells, dendritic cells, T cells, B cells, macrophages, monocytes, neurons, hepatocytes, Kupffer cells, myeloid cells (e.g., neutrophils, myeloid-derived suppressor cells (MDSC, e.g., monocytic MDSC or granulocytic MDSC), monocytes, macrophages, hematopoietic stem cells, basophils, neutrophils or eosinophils) or any combination thereof. In some aspects, EV (e.g., exosomes) target myeloid cells. In some aspects, EV (e.g., exosomes) target macrophages. In certain aspects, EV (e.g., exosomes) target liver, heart, lung, brain, kidney, central nervous system, peripheral nervous system, muscle, bone, joint, skin, intestine, bladder, pancreas, lymph nodes, spleen, blood, bone marrow or any combination thereof.

[0374] In some aspects, EVs (e.g., exosomes) reduce the expression of one or more genes upregulated by STAT6. In some aspects, EVs (e.g., exosomes) promote the differentiation of M2 macrophages. In some aspects, EVs (e.g., exosomes) reduce the differentiation of M1 macrophages.

[0375] As described above, the EVs described herein (e.g., exosomes) are extracellular vesicles with a diameter between about 20-300 nm (e.g., between 40-200 nm). The size of the EVs described herein (e.g., exosomes) can be measured according to the methods described below.

[0376] In some aspects, the EV (e.g., exosome) of the present disclosure comprises a bilipid membrane ("EV, e.g., exosome membrane") comprising an inner (luminal) surface and an outer surface. In some aspects, the inner (luminal) surface faces the inner core (i.e., lumen) of the EV (e.g., exosome). In some aspects, the outer surface can be in contact with an endosome, a multivesicular body, or a membrane / cytoplasm of a producer cell or a target cell.

[0377] In some aspects, the EV (e.g., exosome) membrane comprises lipids and fatty acids. In some aspects, the EV (e.g., exosome) membrane comprises phospholipids, glycolipids, fatty acids, sphingolipids, phosphoglycerides, sterols, cholesterol, and phosphatidylserine.

[0378] In some aspects, the EV (e.g., exosome) membrane comprises an inner leaflet and an outer leaflet. The composition of the inner leaflet and the outer leaflet can be determined by a cross-bilayer distribution assay known in the art, see, for example, Kuypers et al., Biochim Biophys Acta 1985 819: 170. In some aspects, the composition of the outer leaflet is a choline phospholipid between about 70%-90%, an acidic phospholipid between about 0%-15%, and a phosphatidylethanolamine between about 5%-30%. In some aspects, the composition of the inner leaflet is a choline phospholipid between about 15%-40%, an acidic phospholipid between about 10%-50%, and a phosphatidylethanolamine between about 30%-60%.

[0379] In some aspects, the EV (eg, exosome) membrane comprises one or more polysaccharides, such as glycans.

[0380] In some aspects, the EVs (eg, exosomes) of the present disclosure comprise an ASO, wherein the ASO is attached to the EV via a scaffold moiety on the outer surface of the EV or on the luminal surface of the EV.

[0381] In some aspects, the EV (eg, exosome) comprising the ASO comprises an anchoring moiety between the ASO and the exosome membrane, the anchoring moiety optionally comprising a linker. Non-limiting examples of linkers are disclosed elsewhere herein.

[0382] IV.A. Anchoring

[0383] One or more anchoring moieties (AM) can be used to anchor the ASO to the EV of the present disclosure. In some aspects, the ASO is directly linked to the anchoring moiety or is linked through a linker. In some aspects, the ASO can be attached to the anchoring moiety or linker combination through a reaction between a "reactive group" (RG; e.g., amine, thiol, hydroxyl, carboxylic acid, or azide) and a "reactive moiety" (RM; e.g., maleimide, succinate, NHS). Several potential synthetic pathways are envisioned, for example:

[0384] [AM]- / Reactive moiety / + / Reactive group / -[ASO]

[0385] [AM]-[Linker]n- / Reactive moiety / + / Reactive group / -[ASO]

[0386] [AM]- / Reactive moiety / + / Reactive group / -[Linker]n-[ASO]

[0387] [AM]-[Linker]n- / Reactive moiety / + / Reactive group / -[Linker]n-[ASO]

[0388] The anchoring moiety can be inserted into the lipid bilayer of EVs (e.g., exosomes), thereby allowing the exosomes to be loaded with the ASO. Currently, the main obstacle to the commercialization of exosomes as delivery vehicles for polar ASOs is the very inefficient loading. This obstacle can be overcome by modifying the polar ASO before loading it into the exosomes. Therefore, as described herein, the modification of the ASO facilitates its loading into the exosomes.

[0389] The methods described herein for loading exosomes with modified polar ASOs significantly improve loading efficiency compared to previously reported loading efficiencies of unmodified ASOs introduced into exosomes by, for example, electroporation or cationic lipid transfection.

[0390] In some aspects, the modification increases the hydrophobicity of the ASO by at least about 1 fold, at least about 2 fold, at least about 3 fold, at least about 4 fold, at least about 5 fold, at least about 6 fold, at least about 7 fold, at least about 8 fold, at least about 9 fold, or at least about 10 fold relative to the native (unmodified) ASO. In some aspects, the modification increases the hydrophobicity of the ASO by at least about 1 order of magnitude, at least about 2 orders of magnitude, at least about 3 orders of magnitude, at least about 4 orders of magnitude, at least about 5 orders of magnitude, at least about 6 orders of magnitude, at least about 7 orders of magnitude, at least about 8 orders of magnitude, at least about 9 orders of magnitude, or at least about 10 orders of magnitude relative to the native (unmodified) ASO.

[0391] In some aspects, the modification increases the hydrophobicity of the ASO by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 125%, at least about 150%, at least about 175%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 450%, at least about 500%, at least about 600%, at least about 700%, at least about 800%, at least about 900%, or at least about 1000% relative to a native (unmodified) ASO, e.g., a corresponding unmodified ASO. The increase in hydrophobicity can be assessed using any suitable method. For example, hydrophobicity can be determined by measuring the percent solubility in an organic solvent such as octanol as compared to the solubility in an aqueous solvent such as water.

[0392] In some aspects, the anchoring moiety can be chemically conjugated with the ASO to enhance its hydrophobic characteristics. In exemplary aspects, the anchoring moiety is a sterol (e.g., cholesterol), GM1, a lipid, a vitamin, a small molecule, a peptide, or a combination thereof. In some aspects, part is a lipid. In some aspects, the anchoring moiety is a sterol (e.g., cholesterol). Other hydrophobic moieties include, for example, phospholipids, lysophospholipids, fatty acids, or vitamins (e.g., vitamin D or vitamin E).

[0393] In some aspects, the anchoring moiety is conjugated directly or through one or more linkers at a terminus of the ASO (ie, a "terminal modification"). In other aspects, the anchoring moiety is conjugated to other portions of the ASO.

[0394] In some aspects, the ASO may include a detectable label. Exemplary labels include fluorescent labels and / or radioactive labels. In some aspects, when the ASO is fluorescently labeled, the detectable label may be, for example, Cy3. Adding a detectable label to the ASO may be used as a method of labeling exosomes and tracking their biodistribution. In other aspects, the detectable label may be directly attached to the exosomes, for example, by labeling exosomal lipids and / or exosomal peptides.

[0395] The different components of the ASO (i.e., the anchoring moiety, linker and linker combination, and the ASO) can be linked by amide, ester, ether, thioether, disulfide, phosphoramidate, phosphotriester, phosphorodithioate, methylphosphonate, phosphodiester, or phosphorothioate bonds, or alternatively any or other bonds.

[0396] In some aspects, the different components of the ASO can be linked using a bifunctional linker (i.e., a linker containing two functional groups), such as N-succinimidyl-3-(2-pyridyldithio) propionate, N-4-maleimidobutyric acid, S-(2-pyridyldithio)cysteamine, iodoacetoxysuccinimide, N-(4-maleimidobutoxy)succinimide, N-[5-(3'-maleimidopropionamide)-1-carboxypentyl]iminodiacetic acid, N-(5-aminopentyl)-iminodiacetic acid, and the like.

[0397] Suitable anchoring moieties capable of anchoring the ASO to the surface of an EV (eg, exosome) include, for example, sterols (eg, cholesterol), lipids, lysophospholipids, fatty acids, or fat-soluble vitamins, as described in detail below.

[0398] In some aspects, the anchoring moiety can be a lipid. The lipid anchoring moiety can be any lipid known in the art, for example, palmitic acid or glycosylphosphatidylinositol. In some aspects, the lipid is a fatty acid, a phospholipid, a phospholipid (for example, phosphatidylcholine, phosphatidylserine or phosphatidylethanolamine) or its analog (for example, phosphatidylcholine, lecithin, phosphatidylethanolamine, cephalin or phosphatidylserine or its analog or part, such as its partially hydrolyzed part).

[0399] Typically, the anchoring moiety is chemically attached. However, the anchoring moiety can be enzymatically attached to the ASO. In some aspects, the anchoring moiety may be attached to the ASO by changing the cell culture conditions. For example, by using a culture medium in which myristic acid is restrictive, some other fatty acids (including shorter chain fatty acids and unsaturated fatty acids) can be attached to the N-terminal glycine. For example, in the BK channel, myristate has been reported to be attached post-translationally to internal serine / threonine or tyrosine residues via a hydroxy ester bond.

[0400] The anchoring moiety can be conjugated to the ASO directly or indirectly via a combination of linkers at any chemically feasible position (e.g., at the 5' and / or 3' end of the ASO). In one aspect, the anchoring moiety is conjugated only to the 3' end of the ASO. In one aspect, the anchoring moiety is conjugated only to the 5' end of the ASO. In one aspect, the anchoring moiety is conjugated at a position that is not the 3' end or the 5' end of the ASO.

[0401] Some types of membrane anchors that can be used to practice the methods of the present disclosure are presented in the following table:

[0402]

[0403] In some aspects, the anchoring moiety of the present disclosure can comprise two or more types of anchoring moieties disclosed herein. For example, in some aspects, the anchoring moiety can comprise two lipids (e.g., a phospholipid and a fatty acid), or two phospholipids, or two fatty acids, or a lipid and a vitamin, or cholesterol and a vitamin, etc., which together have 6-80 carbon atoms (i.e., an equivalent carbon number (ECN) of 6-80).

[0404] IV.A.1. Cholesterol and other sterols

[0405] In some aspects, the anchoring portion comprises a sterol, steroid, hopane, hydroxysteroid, secosteroid or its analogue with lipophilic properties. In some aspects, the anchoring portion comprises a sterol, such as a phytosterol, a fungus sterol or an animal sterol. Exemplary animal sterols include cholesterol and 24S-hydroxycholesterol; Exemplary phytosterols include ergosterol (fungosterol), campesterol, sitosterol and stigmasterol. In some aspects, the sterol is selected from ergosterol, 7-dehydrocholesterol, cholesterol, 24S-hydroxycholesterol, lanosterol, cycloartenol, fucosterol, algin sterol, campesterol, β-sitosterol, dihydrositosterol, fecal alcohol, avenasterol or stigmasterol. Sterol can be free sterol, acylated (sterol ester), alkylated (steryl alkyl ether), sulfated (sterol sulfate) or connected to a glycoside moiety (steryl glycoside), which itself can be acylated (acylated sterol glycoside).

[0406] In some aspects, the anchoring moiety comprises a steroid. In some aspects, the steroid is selected from dihydrotestosterone, uvaol, hecigenin, diosgenin, progesterone or cortisol.

[0407] For example, sterols can be conjugated to ASOs directly or through a combination of linkers at available -OH groups of the sterol. Exemplary sterols have a general backbone as shown below:

[0408]

[0409] As a further example, ergosterol has the following structure:

[0410]

[0411] Cholesterol has the following structure:

[0412]

[0413] Thus, in some embodiments, the free -OH group of the sterol or steroid is used to conjugate the ASO to the sterol (eg, cholesterol) or steroid directly or through a linker combination.

[0414] IV.A.2. Fatty acids

[0415] In some aspects, the anchoring moiety is a fatty acid. In some aspects, the fatty acid is a short chain, medium chain or long chain fatty acid. In some aspects, the fatty acid is a saturated fatty acid. In some aspects, the fatty acid is an unsaturated fatty acid. In some aspects, the fatty acid is a monounsaturated fatty acid. In some aspects, the fatty acid is a polyunsaturated fatty acid, such as ω-3 or ω-6 fatty acid.

[0416] In some aspects, the anchoring moiety comprises two fatty acids, each of which is independently selected from fatty acids having a chain of any one of the aforementioned ranges or numbers of carbon atoms. In some aspects, one of the fatty acids is independently a fatty acid having a C6-C21 chain, and one fatty acid is independently a fatty acid having a C12-C36 chain. In some embodiments, each fatty acid independently has a chain of 11, 12, 13, 14, 15, 16, or 17 carbon atoms.

[0417] Suitable fatty acids include saturated straight chain fatty acids, saturated branched chain fatty acids, unsaturated fatty acids, hydroxy fatty acids and polycarboxylic acids. In some aspects, such fatty acids have up to 32 carbon atoms.

[0418] IV.A.3. Phospholipids

[0419] In some aspects, the anchoring moiety comprises a phospholipid. A phospholipid is a class of lipids that are a major component of all cell membranes. Because of their amphiphilic nature, the phospholipids can form lipid bilayers. The structure of a phospholipid molecule generally consists of two hydrophobic fatty acid "tails" and a hydrophilic "head" consisting of phosphate groups. For example, a phospholipid can be a lipid according to the formula:

[0420]

[0421] Where R p represents the phospholipid part, and R 1 and R 2It refers to fatty acid moieties with or without unsaturation which may be the same or different.

[0422] The phospholipid moiety may, for example, be selected from the non-limiting group consisting of phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylserine, phosphatidic acid, 2-lysophosphatidylcholine, and sphingomyelin.

[0423] IV.A.4. Lysolipids (e.g., lysophospholipids)

[0424] In some aspects, the anchoring moiety comprises a lysolipid (e.g., a lysophospholipid). A lysolipid is a derivative of a lipid in which one or two fatty acyl chains have been removed, typically by hydrolysis. A lysophospholipid is a derivative of a phospholipid in which one or two fatty acyl chains have been removed by hydrolysis.

[0425] In some aspects, the anchoring moiety comprises any of the phospholipids disclosed above, wherein one or both acyl chains have been removed by hydrolysis, and thus the resulting lysophospholipid comprises one or no fatty acid acyl chains.

[0426] In some aspects, the anchoring moiety comprises a lysoglycerophospholipid, a lysoglycosphingolipid, a lysophosphatidylcholine, a lysophosphatidylethanolamine, a lysophosphatidylinositol, or a lysophosphatidylserine.

[0427] IV.A.5. Vitamins

[0428] In some aspects, the anchoring moiety comprises a lipophilic vitamin, e.g., folic acid, vitamin A, vitamin E, or vitamin K.

[0429] In some aspects, the anchoring portion comprises vitamin A. Vitamin A is a group of unsaturated nutritional organic compounds including retinol, retinal, retinoic acid, and several provitamin A carotenoids (most notably beta-carotene). In some aspects, the anchoring portion comprises retinol. In some aspects, the anchoring portion comprises a retinoid. A retinoid is a class of vitamins or chemical compounds chemically related to vitamin A. In some aspects, the anchoring portion comprises a first generation retinoid (e.g., retinol, tretinoin, isotretinoin, or alitretinoin), a second generation retinoid (e.g., etretinate or vitamin A), a third generation retinoid (e.g., adapalene, bexarotene, or tazarotene), or any combination thereof.

[0430] IV.B. Joint assembly

[0431] In some aspects, the ASO is connected to the hydrophobic membrane anchoring moiety disclosed herein by a linker combination, which can include any combination of cleavable and / or non-cleavable linkers. The main function of the linker combination is to provide optimal spacing between the anchoring moiety and the BAM target. For example, in the case of an ASO, the linker combination should reduce steric hindrance and position the ASO so that it can interact with the target nucleic acid (e.g., mRNA or miRNA).

[0432] The joint may be susceptible to cleavage ("cleavable joint"), thereby promoting the release of the bioactive molecule. Therefore, in some aspects, the joint combination disclosed herein may include a cleavable joint. Under conditions where the bioactive molecule remains active, such cleavable joints may, for example, be susceptible to acid-induced cleavage, light-induced cleavage, peptidase-induced cleavage, esterase-induced cleavage, and disulfide bond cleavage. Alternatively, the joint may be substantially resistant to cleavage ("non-cleavable joint"). In some aspects, the cleavable joint includes a spacer. In some aspects, the spacer is PEG.

[0433] In some aspects, the joint combination comprises at least 2, at least 3, at least 4, at least 5 or at least 6 or more different joints disclosed herein. In some aspects, the joint in the joint combination can be connected by an ester bond (e.g., phosphodiester or thiophosphate).

[0434] In some aspects, the linker is a direct bond between the anchoring moiety and the BAM (eg, ASO).

[0435] IV.B.1. Non-cleavable linkers

[0436] In some aspects, the linker combination comprises a "non-cleavable linker". A non-cleavable linker is any chemical moiety that is capable of linking two or more components of the modified bioactive molecule of the present disclosure in a stable covalent manner (e.g., a bioactive molecule and an anchoring moiety; a bioactive molecule and a cleavable linker; an anchoring moiety and a cleavable linker) and does not fall into the categories of cleavable linkers listed above. Thus, a non-cleavable linker is substantially resistant to acid-induced cleavage, light-induced cleavage, peptidase-induced cleavage, esterase-induced cleavage, and disulfide bond cleavage.

[0437] In addition, non-cleavable refers to the ability of a chemical bond in or adjacent to a linker to withstand cleavage induced by an acid, a photolabile cleavage agent, a peptidase, an esterase, or a chemical or physiological compound that cleaves a disulfide bond, without the cyclic dinucleotide and / or antibody losing its activity. In some aspects, the bioactive molecule is attached to the linker via another linker (e.g., a self-immolative linker).

[0438] In some aspects, the linker combination comprises a non-cleavable linker, the non-cleavable linker comprising, for example, tetraethylene glycol (TEG), hexaethylene glycol (HEG), polyethylene glycol (PEG), succinimide, or any combination thereof. In some aspects, the non-cleavable linker comprises a spacer unit to connect the biologically active molecule to the non-cleavable linker.

[0439] In some aspects, one or more non-cleavable linkers comprise smaller units linked together (e.g., HEG, TEG, glycerol, C2 to C12 alkyl, etc.). In one aspect, the bond is an ester bond (e.g., phosphodiester or phosphorothioate) or other bond.

[0440] IV.B.1.a. Ethylene glycol (HEG, TEG, PEG)

[0441] In some aspects, the linker combination comprises a non-cleavable linker, wherein the non-cleavable linker comprises polyethylene glycol (PEG) characterized by the formula: R 3 -(O-CH 2 -CH 2 ) n - or R 3 -(0-CH 2 -CH 2 ) n -O-, where R 3 is hydrogen, methyl or ethyl, and the value of n is 2 to 200. In some aspects, the linker comprises a spacer, wherein the spacer is PEG.

[0442] In some aspects, the PEG linker is an oligoethylene glycol, for example, a diethylene glycol, triethylene glycol, tetraethylene glycol (TEG), pentaethylene glycol, or hexaethylene glycol (HEG) linker.

[0443] In some aspects, the value of n is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59 , 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113 3, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 1 57, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 189, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199 or 200.

[0444] In some aspects, n is between 2 and 10, between 10 and 20, between 20 and 30, between 30 and 40, between 40 and 50, between 50 and 60, between 60 and 70, between 70 and 80, between 80 and 90, between 90 and 100, between 100 and 110, between 110 and 120, between 120 and 130, between 130 and 140, between 140 and 150, between 150 and 160, between 160 and 170, between 170 and 180, between 180 and 190, or between 190 and 200.

[0445] In some specific aspects, the value of n is 3-200, 3-20, 10-30, or 9-45.

[0446] In some aspects, the PEG is a branched PEG. A branched PEG has PEG chains emanating from a central core group.

[0447] In certain embodiments, the PEG moiety is a monodisperse polyethylene glycol. In the context of the present disclosure, a monodisperse polyethylene glycol (mdPEG) is a PEG with a single, limited chain length and molecular weight. MdPEG is usually separated and produced from a polymerization mixture by chromatography. In some formulas, the monodisperse PEG moiety is designated as abbreviated mdPEG.

[0448] In some aspects, the PEG is a star PEG. A star PEG has 10 to 100 PEG chains emanating from a central core group.

[0449] In some aspects, the PEG is a comb PEG. A comb PEG has multiple PEG chains, typically grafted onto a polymer backbone.

[0450] In some aspects, the molar mass of PEG is between 100 g / mol and 3000 g / mol, specifically between 100 g / mol and 2500 g / mol, more specifically about 100 g / mol to 2000 g / mol. In some aspects, the molar mass of PEG is between 200 g / mol and 3000 g / mol, specifically between 300 g / mol and 2500 g / mol, more specifically about 400 g / mol to 2000 g / mol.

[0451] In some aspects PEG is PEG 100 PEG 200 PEG 300 PEG 400 PEG 500 PEG 600 PEG 700 PEG 800 PEG 900 PEG 1000 PEG 1100 PEG 1200 PEG 1300 PEG 1400 PEG 1500 PEG 1600 PEG 1700 PEG 1800 PEG 1900 PEG 2000 PEG 2100 PEG 2200 PEG2300 PEG 2400 PEG 2500 PEG 1600 PEG 1700 PEG 1800 PEG 1900 PEG 2000 PEG 2100 PEG 2200 PEG 2300 PEG 2400 PEG 2500 PEG 2600 PEG 2700 PEG 2800 PEG 2900 or PEG 3000 In one specific aspect, PEG is PEG 400 In another specific aspect, PEG is PEG 2000 .

[0452] In some aspects, the linker combinations of the present disclosure can comprise several PEG linkers, e.g., cleavable linkers flanking PEG, HEG, or TEG linkers.

[0453] In some aspects, the linker combination comprises (HEG)n and / or (TEG)n, wherein n is an integer between 1 and 50, and each unit is connected, for example, by a phosphate linker, a phosphorothioate bond, or a combination thereof.

[0454] IV.B.1.b. Glycerol and polyglycerol (PG)

[0455] In some aspects, the linker combination comprises a non-cleavable linker comprising a 3 —O—(CH 2 —CHOH—CH 2 O) n —) described glycerol units or polyglycerol (PG), wherein R3 is hydrogen, methyl or ethyl, and the value of n is 3 to 200. In some aspects, the value of n is 3 to 20. In some aspects, the value of n is 10 to 30.

[0456] In some aspects, the PG linker is a diglycerol, triglycerol, tetraglycerol (TG), pentaglycerol, or hexaglycerol (HG) linker.

[0457] In some aspects, the linker combination comprises (glycerol)n and / or (HG)n and / or (TG)n, wherein n is an integer between 1 and 50, and each unit is connected, for example, by a phosphate linker, a phosphorothioate bond, or a combination thereof.

[0458] In some aspects, the linker combination comprises at least one aliphatic (alkyl) linker, for example propyl, butyl, hexyl, or C2-C12 alkyl, such as C2-C10 alkyl or C2-C6 alkyl.

[0459] IV.B.2. Cleavable Linkers

[0460] In some aspects, the different components of the ASO disclosed herein can be joints through a cleavable joint. The term "cleavable joint" refers to a joint comprising at least one bond or chemical bond that can be broken or cut. As used herein, the term cutting refers to breaking one or more chemical bonds in a relatively large molecule in a manner that produces two or more relatively small molecules. Cutting can be mediated, for example, by nucleases, peptidases, proteases, phosphatases, oxidases or reductases, for example or by specific physicochemical conditions (e.g., redox environment, pH, the presence of reactive oxygen species or light of a specific wavelength).

[0461] In some aspects, the term "cleavable" as used herein refers to rapidly degradable linkers, e.g., phosphodiesters and disulfides, while the term "non-cleavable" refers to more stable bonds, e.g., nuclease-resistant phosphorothioates.

[0462] In some aspects, the cleavable linker is a dinucleotide or trinucleotide linker, a disulfide, an imine, a thioketal, a val-cit dipeptide, or any combination thereof.

[0463] In some aspects, the cleavable linker comprises valine-alanine-p-aminobenzylcarbamate or valine-citrulline-p-aminobenzylcarbamate.

[0464] IV.B.2.a. Redox-cleavable linkers

[0465] In some aspects, the linker combination comprises a redox cleavable linker. As a non-limiting example, one type of cleavable linker is a redox cleavable linking group that is cleaved upon reduction or oxidation.

[0466] In some aspects, the redox cleavable linker contains a disulfide bond, ie, the redox cleavable linker is a disulfide cleavable linker.

[0467] Redox-cleavable linkers can be reduced, for example, by intracellular thiols, oxidases, or reductases.

[0468] IV.B.2.b. Reactive Oxygen Species (ROS) Cleavable Linkers

[0469] In some aspects, the linker combination can include a cleavable linker that can be cleaved by, for example, reactive oxygen species (ROS) (such as superoxide (O) or hydrogen peroxide (H2O2)) produced by an inflammatory process (such as activated neutrophils). In some aspects, the ROS cleavable linker is a thioketal cleavable linker. See, for example, U.S. Patent No. 8,354,455B2, which is incorporated herein by reference in its entirety.

[0470] IV.B.2.c. pH-dependent cleavable linkers

[0471] In some aspects, the linker is an "acid-labile linker" comprising an acid-cleavable linking group, which is a linking group that is selectively cleaved under acidic conditions (pH < 7).

[0472] As non-limiting examples, acid cleavable linking groups are cut in acidic environments (e.g., about 6.0, 5.5, 5.0 or lower). In some respects, pH is about 6.5 or lower. In some respects, joints are cut by agents, such as enzymes that can serve as universal acids, such as peptidases (which can be substrate-specific) or phosphatases. In cells, some low pH organelles (such as endosomes and lysosomes) can provide cutting environments for acid cleavable linking groups. Although the pH of human serum is 7.4, the average pH in cells is slightly lower, in the range of about 7.1 to 7.3. Endosomes also have an acidic pH in the range of 5.5 to 6.0, and lysosomes are about 5.0 at more acidic pH. Therefore, in the art, pH-dependent cleavable joints are sometimes referred to as endosome unstable joints.

[0473] Additional examples can be found in U.S. Pat. Nos. 9,790,494 B2 and 8,137,695 B2, the contents of which are incorporated herein by reference in their entirety.

[0474] IV.B.2.d. Enzymatically cleavable linkers

[0475] In some aspects, the joint combination can include a joint that can be cut by intracellular or extracellular enzymes (e.g., proteases, esterases, nucleases, amidates). The range of enzymes that can cut a particular joint in the joint combination depends on the specific bond and chemical structure of the joint. Thus, a peptide joint can be cut, for example, by a peptidase, a joint containing an ester bond can be cut, for example, by an esterase; a joint containing an amide bond can be cut, for example, by an amidate; and the like.

[0476] IV.B.2.e. Protease-cleavable linkers

[0477] In some aspects, the joint combination comprises a protease cleavable joint, that is, a joint that can be cleaved by an endogenous protease. Only certain peptides are easily cleaved inside or outside the cell. See, for example, Trout et al., 79 "Proceedings of the National Academy of Sciences of the United States of America", 626-629 (1982) and Umemoto et al., 43 "International Journal of Cancer (Int.J.Cancer)", 677-684 (1989). The cleavable joint can contain a cleavable site comprising an α-amino acid unit and a peptide bond, and the peptide bond is chemically an amide bond between the carboxylate of an amino acid and the amino group of a second amino acid. Other amide bonds (such as the bond between the α-amino acid group of a carboxylate and lysine) are understood to be not peptide bonds and are considered to be non-cleavable.

[0478] IV.B.2.f. Esterase-cleavable linkers

[0479] Some linkers are cleaved by esterases ("esterase cleavable linkers"). Only certain esters can be cleaved by esterases and amidases present inside or outside the cell. Esters are formed by the condensation of carboxylic acids and alcohols. Simple esters are esters produced with simple alcohols (such as aliphatic alcohols, small cyclic and small aromatic alcohols). Examples of ester-based cleavable linking groups include, but are not limited to, esters of alkylene, alkenylene and alkynylene. Ester cleavable linking groups have the general formula -C(O)O- or -OC(O)-.

[0480] IV.B.2.g. Phosphatase-cleavable linkers

[0481] In some aspects, the linker combination can include a phosphate-based cleavable linking group that is cleaved by an agent that degrades or hydrolyzes the phosphate group. Examples of agents that cleave intracellular phosphate groups are enzymes, such as intracellular phosphatases. Examples of phosphate-based linking groups are —O—P(O)(OR k)—O—, —O—P(S)(OR k )—O—、—O—P(S)(SR k )—O-、-SP(O)(OR k )-O-、-OP(O)(OR k )-S-、-SP(O)(OR k )-S-、-OP(S)(OR k )-S-、-SP(S)(OR k )-O-、-OP(O)(R k )-O-、-OP(S)(R k )-O-、-SP(O)(R k )-O-、-SP(S)(R k )-O-、-SP(O)(R k )-S-or-OP(S)(R k)-S-.

[0482] In all aspects, R k Any of the following: NH 2 , BH 3 , CH 3 , C 1-6 Alkyl, C 6-10 Aryl, C 1-6 Alkoxy and C 6-10 In some aspects, C 1-6 Alkyl and C 6-10 Aryl is unsubstituted. Additional non-limiting examples are: -OP(O)(OH)-O-, -OP(S)(OH)-O-, -OP(S)(SH)-O-, -SP(O)(OH)-O-, -OP(O)(OH)-S-, -SP(O)(OH)-S-, -OP(S)(OH)-S-, -SP(S)(OH)-O-, -OP(O)(H)-O-, -OP(S)(H)-O-, -SP(O)(H)-O-, -SP(S)(H)-O-, -SP(O)(H)-S-, -OP(S)(H)-S-, or -OP(O)(OH)-O-.

[0483] IV.B.2.h. Photoactivatable cleavable linkers

[0484] In some aspects, the combined linker comprises a photoactivated cleavable linker, e.g., a nitrobenzyl linker or a linker comprising a nitrobenzyl reactive group.

[0485] IV.B.2.i. Self-dissolving joints

[0486] In some aspects, the linker combination comprises a self-immolative linker. In some aspects, the self-immolative linker in the EV (e.g., exosome) of the present disclosure undergoes 1,4 elimination after enzymatic cleavage of a protease-cleavable linker. In some aspects, the self-immolative linker in the EV (e.g., exosome) of the present disclosure undergoes 1,6 elimination after enzymatic cleavage of a protease-cleavable linker. In some aspects, the self-immolative linker is, for example, a p-aminobenzyl (pAB) derivative, such as p-aminobenzyl carbamate (pABC), p-aminobenzyl ether (PABE), p-aminobenzyl carbonate, or a combination thereof.

[0487] In some aspects, the cleavable linker is valine-alanine-p-aminobenzylcarbamate or valine-citrulline-p-aminobenzylcarbamate.

[0488] IV.B.3. Reactive moiety (RM)

[0489] The ASOs of the present disclosure are produced by chemical synthesis or by chemical reactions between their components. For example, in some aspects, an anchoring moiety comprising a reactive group (e.g., maleimide) can react with an ASO comprising a maleimide reactive group to produce a hydrophobic modified ASO of the present disclosure, wherein the anchoring moiety can be inserted into the lipid bilayer of the membrane of the exosome, thereby attaching the ASO to the surface of the exosome.

[0490] IV.C. Bracket

[0491] One or more scaffold parts can be expressed in EV. In some aspects, one or more scaffold parts are used to anchor ASO to EV of the present disclosure. In other aspects, in addition to ASO, one or more scaffold parts are used to anchor proteins or molecules to EV. Therefore, EV of the present disclosure comprises an anchoring part connecting ASO and a scaffold part connecting protein or molecule, such as a targeting part. In some aspects, ASO is connected to the scaffold part. In some aspects, EV comprises more than one scaffold part. In some aspects, the first ASO is connected to the first scaffold part, and the second ASO is connected to the second scaffold part. In some aspects, the first scaffold part and the second scaffold part are scaffold parts of the same type, for example, both the first scaffold part and the second scaffold part are scaffold parts of scaffold X protein. In some aspects, the first scaffold part and the second scaffold part are scaffold parts of different types, for example, the first scaffold part is scaffold Y protein, and the second scaffold part is scaffold X protein. In some aspects, the first scaffold part is scaffold Y disclosed herein. In some aspects, the first scaffold part is scaffold X disclosed herein. In some aspects, the second scaffold part is scaffold Y disclosed herein. In some aspects, the second scaffold portion is Scaffold X disclosed herein.

[0492] In some aspects, EV comprises one or more scaffold portions that are capable of anchoring the ASO to EV (e.g., exosomes) (e.g., on the lumen surface or on the outer surface). In some aspects, the scaffold portion is a polypeptide ("scaffold protein"). In some aspects, the scaffold protein comprises an exosomal protein or a fragment thereof. In other aspects, the scaffold portion is a non-polypeptide portion. In some aspects, the scaffold protein includes various membrane proteins enriched in the exosomal membrane, such as transmembrane proteins, integral proteins, and peripheral proteins. It may include various CD proteins, transporters, integrins, lectins, and cadherins. In some aspects, the scaffold portion (e.g., scaffold protein) comprises scaffold X. In other aspects, the scaffold portion (e.g., exosomal protein) comprises scaffold Y. In other aspects, the scaffold portion (e.g., exosomal protein) comprises both scaffold X and scaffold Y.

[0493] In some aspects, the EVs (e.g., exosomes) of the present disclosure comprise a membrane modified in its composition. For example, its membrane composition can be modified by changing the protein, lipid, or glycan content of the membrane.

[0494] In some aspects, surface engineered EVs (e.g., exosomes) are produced by chemical and / or physical methods, such as PEG-induced fusion and / or ultrasonic fusion. In other aspects, surface engineered EVs (e.g., exosomes) are produced by genetic engineering. EVs (e.g., exosomes) produced by genetically modified producer cells or progeny of genetically modified cells may contain modified membrane compositions. In some aspects, surface engineered EVs (e.g., exosomes) have a higher or lower density (e.g., a higher number) of scaffold portions (e.g., exosomal proteins, e.g., scaffold X), or include variants or fragments of scaffold portions.

[0495] For example, EVs engineered with a surface (e.g., Scaffold X) can be produced by cells (e.g., HEK293 cells) transformed with an exogenous sequence encoding a scaffold portion (e.g., an exosomal protein, e.g., Scaffold X) or a variant or fragment thereof. EVs comprising a scaffold portion expressed by an exogenous sequence can include a modified membrane composition.

[0496] Various modifications or fragments of the scaffold moieties can be used in various aspects of the present disclosure. For example, scaffold moieties modified to have enhanced affinity for a binding agent can be used to produce surface engineered EVs that can be purified using a binding agent. Scaffold moieties modified to more effectively target to EVs and / or membranes can be used. Scaffold moieties modified to contain the minimum fragments required for specific and effective targeting to exosome membranes can also be used.

[0497] The scaffold portion can be engineered to be expressed as a fusion molecule, such as a fusion molecule of scaffold X and an ASO. For example, a fusion molecule can comprise a scaffold portion disclosed herein (e.g., Scaffold X, e.g., PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2, ATP transporter, or a fragment or variant thereof) linked to an ASO.

[0498] In some aspects, scaffold X comprises prostaglandin F2 receptor negative regulator (PTGFRN polypeptide).PTGFRN albumen can also be referred to as CD9 partner 1 (CD9P-1), protein F (EWI-F) containing Glu-Trp-Ile EWI motif, prostaglandin F2-α receptor regulatory protein, prostaglandin F2-α receptor associated protein or CD315.The full length amino acid sequence of human PTGFRN albumen (Uniprot accession number Q9P2B2) is shown as SEQ ID NO:301 in Table 2.PTGFRN polypeptide contains signal peptide (SEQ ID NO:301 amino acid 1 to 25), extracellular domain (SEQ ID NO:301 amino acid 26 to 832), transmembrane domain (SEQ ID NO:301 amino acid 833 to 853) and cytoplasmic domain (SEQ ID NO:301 amino acid 854 to 879). The mature PTGFRN polypeptide consists of SEQ ID NO: 301 without the signal peptide, ie, amino acids 26 to 879 of SEQ ID NO: 301.

[0499] Table 2. Exemplary Scaffold X Protein Sequences

[0500]

[0501] IV.D. Targeting Moiety

[0502] In some aspects, EV (e.g., exosomes) include a targeting moiety, such as an exogenous targeting moiety. In some aspects, the exogenous targeting moiety includes a peptide, an antibody or its antigen-binding fragment, a chemical compound, an RNA aptamer, or any combination thereof. In some aspects, the targeting moiety includes a microprotein, a designed ankyrin repeat protein (darpin), anticalin, adnectin, an aptamer, a peptide mimetic molecule, a natural ligand of a receptor, a camelid nanobody, or any combination thereof. In some aspects, the exogenous targeting moiety includes a full-length antibody, a single domain antibody, a heavy chain antibody only (VHH), a single chain antibody, a shark heavy chain antibody only (VNAR), scFv, Fv, Fab, Fab', F(ab')2, or any combination thereof. In some aspects, the antibody is a single chain antibody.

[0503] In some aspects, the targeting moiety targets exosomes to the liver, heart, lung, brain, kidney, central nervous system, peripheral nervous system, muscle, bone, joint, skin, intestine, bladder, pancreas, lymph node, spleen, blood, bone marrow, or any combination thereof. In some aspects, the targeting moiety targets exosomes to tumor cells, dendritic cells, T cells, B cells, macrophages, neurons, hepatocytes, Kupffer cells, myeloid cells (e.g., neutrophils, monocytes, macrophages, or MDSCs (e.g., monocytic MDSCs or granulocytic MDSCs)), hematopoietic stem cells, or any combination thereof.

[0504] In some aspects, the targeting moiety is connected to the EV (e.g., exosome) via a scaffold protein. In some aspects, the scaffold protein is any scaffold protein disclosed herein. In some aspects, the scaffold protein is scaffold X. In some aspects, the scaffold protein is scaffold Y.

[0505] IV.E. Connector

[0506] As described above, the extracellular vesicles (EVs) (e.g., exosomes and nanovesicles) of the present disclosure may include one or more connectors that connect a molecule of interest (e.g., ASO) to the EV (e.g., to the outer surface or lumen surface). In some aspects, the ASO is connected to the EV directly or via a scaffold portion (e.g., scaffold X or scaffold Y). In some aspects, the ASO is connected to the scaffold portion via a connector. In some aspects, the ASO is connected to a second scaffold portion via a connector.

[0507] In certain aspects, the ASO is linked to the outer surface of the exosome via Scaffold X. In other aspects, the ASO is linked to the luminal surface of the exosome via Scaffold X or Scaffold Y. The linker can be any chemical moiety known in the art.

[0508] As used herein, the term "joint" refers to a peptide or polypeptide sequence (e.g., a synthetic peptide or polypeptide sequence) or to a non-polypeptide (e.g., an alkyl chain). In some aspects, two or more joints can be connected in series. When there are multiple joints, each joint in the joint can be the same or different. Generally, the joint provides flexibility or prevents / improves steric hindrance. The joint is usually not cut; however, in some aspects, such cutting can be desired. Therefore, in some aspects, the joint can include one or more protease cleavage sites, and the one or more protease cleavage sites can be located in the sequence of the joint or flanked by the joint at either end of the joint sequence.

[0509] In some aspects, the joint is a peptide joint. In some aspects, the peptide joint can include at least about two, at least about three, at least about four, at least about five, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95 or at least about 100 amino acids.

[0510] In some aspects, the peptide linker is synthetic, i.e., non-naturally occurring. In one aspect, the peptide linker comprises a peptide (or polypeptide) (e.g., a naturally or non-naturally occurring peptide) comprising an amino acid sequence that connects or genetically fuses a first linear sequence of amino acids to a second linear sequence of amino acids, the peptide not being naturally connected or genetically fused to the second linear sequence of amino acids in nature. For example, in one aspect, the peptide linker can comprise a non-naturally occurring polypeptide that is a modified form of a naturally occurring polypeptide (e.g., comprising a mutation, such as an addition, substitution, or deletion).

[0511] The linker may be susceptible to cleavage (a "cleavable linker"), thereby facilitating release of the biologically active molecule (eg, ASO).

[0512] In some aspects, the linker is a "reduction sensitive linker". In some aspects, the reduction sensitive linker contains a disulfide bond. In some aspects, the linker is an "acid labile linker". In some aspects, the acid labile linker contains a hydrazone. Suitable acid labile linkers also include, for example, cis-aconitine linkers, hydrazide linkers, thiocarbamoyl linkers, or any combination thereof.

[0513] In some aspects, the linker comprises a non-cleavable linker.

[0514] In some aspects, the linker comprises an acrylic acid phosphoramidite (e.g., ACRYDITE TM ), adenylation, azide (NHS ester), digoxin (NHS ester), cholesterol-TEG, I-LINKER TM , amino modifiers (e.g., amino modifier C6, amino modifier C12, amino modifier C6 dT or Uni-Link TM amino modification), alkyne, 5' hexynyl, 5-octadiynyl dU, biotinylation (e.g., biotin, biotin (azide), biotin dT, biotin-TEG, dual biotin, PC biotin, or desthiobiotin), thiol modification (thiol modification C3 SS, dithiol, or thiol modification C6 SS), or any combination thereof.

[0515] In some aspects, the linker comprises a terpene, such as nerolidol, farnesol, limonene, linalool, geraniol, carvone, fenchone, or menthol; a lipid, such as palmitic acid or myristic acid; cholesterol; oleyl; retinyl; a cholesteryl residue; cholic acid; adamantaneacetic acid; 1-pyrenebutyric acid; dihydrotestosterone; 1,3-bis-O(hexadecyl)glycerol; geranyloxyhexyl; hexadecylglycerol; borneol; 1,3-propanediol; heptadecyl; O3-(oleoyl)lithocholic acid; O3-(oleoyl)cholenic acid; dimethoxytrityl; phenoxazine, a maleimide moiety, a glucosidase type, a CL2A-SN38 type, folic acid; a carbohydrate; vitamin A; vitamin E; vitamin K, or any combination thereof.

[0516] IV.F. Modified EVs containing tropic moieties

[0517] In some aspects, the EVs (e.g., exosomes) disclosed herein can be surface engineered to modulate their properties, e.g., biodistribution, e.g., by incorporating immunoaffinity ligands or cognate receptor ligands. For example, the EVs (e.g., exosomes) disclosed herein can be surface engineered to direct them to specific cell types, such as Schwanncell cells, sensory neurons, motor neurons, meningeal macrophages, or tumor cells, or can be surface engineered to enhance their migration to specific compartments, such as migration to the CNS (to improve intrathecal compartment retention) or migration to the tumor microenvironment.

[0518] In some aspects, EV (e.g., exosomes) comprises (i) ASO disclosed herein and (ii) biodistribution modifier or targeting moiety. In some aspects, biodistribution modifier or targeting moiety comprises a single domain antigen binding portion, e.g., VHH and / or vNAR. As used herein, the terms "biodistribution modifier" and "targeting moiety" are used interchangeably and refer to agents capable of changing the distribution of extracellular vesicles (e.g., exosomes, nanovesicles) in vivo or in vitro (e.g., in mixed cultures of different types of cells). In some aspects, the targeting moiety changes the tropism of EV (e.g., exosomes), i.e., the targeting moiety is a "tropism moiety". As used herein, the term "tropism moiety" refers to a targeting moiety that changes and / or enhances the natural movement of EV when expressed on EV (e.g., exosomes). For example, in some aspects, the tropism moiety can promote the absorption of EV (e.g., exosomes) by specific cells, tissues or organs.

[0519] EV (e.g., exosomes) exhibit preferential uptake in discrete cell types and tissues, and their tropism can be directed by adding proteins to their surface that interact with receptors on the surface of target cells. The tropism portion can include biomolecules, such as proteins, peptides, lipids or carbohydrates, or synthetic molecules. For example, in some aspects, the tropism portion can include affinity ligands, such as antibodies (such as anti-CD19 nanobodies, anti-CD22 nanobodies, anti-CLEC9A nanobodies or anti-CD3 nanobodies), VHH domains, phage display peptides, fibronectin domains, camelid nanobodies and / or vNARs. In some aspects, the tropism portion can include, for example, synthetic polymers (e.g., PEG), natural ligands / molecules (e.g., CD40L, albumin, CD47, CD24, CD55, CD59) and / or recombinant proteins (e.g., XTEN).

[0520] V. PD-1 antagonists

[0521] Certain aspects of the present disclosure relate to a method for preventing or treating a disease or condition in a subject in need thereof, the method comprising administering to the subject (i) an extracellular vesicle comprising an ASO and (ii) a PD-1 antagonist. In some aspects, the PD-1 antagonist blocks or reduces PD-1 signaling. In some aspects, the PD-1 antagonist inhibits the interaction between PD-1 and PD-L1. Any PD-1 antagonist can be used in the methods disclosed herein. In some aspects, the PD-1 antagonist comprises a polypeptide (e.g., an antibody, an antigen-binding portion of an antibody, a ligand, or any combination thereof), a small molecule, a nucleic acid molecule (e.g., miRNA, siRNA, antisense oligonucleotides, or any combination thereof) or any combination thereof.

[0522] In some aspects, the PD-1 antagonist comprises an antibody or antigen binding portion thereof that specifically binds to PD-1 (e.g., human PD-1). In some aspects, the PD-1 antagonist comprises an antibody or antigen binding portion thereof that specifically binds to PD-L1 (e.g., human PD-L1). In some aspects, the PD-1 antagonist comprises an antibody or antigen binding portion thereof that specifically binds to PD-L2 (e.g., human PD-L2). Many therapeutic anti-PD-1 and anti-PD-L1 antibodies are known in the art, any one or more of which are suitable for the methods disclosed herein. In certain aspects, the anti-PD-1 antibody comprises an antibody selected from the group consisting of nivolumab, pembrolizumab, PDR001, MEDI-0680, cemiplimab, JS001, BGB-A317, INCSHR1210, TSR-042, GLS-010, AM-0001, STI-1110, AGEN2034, MGA012, IBI308, and any combination thereof. In certain aspects, the anti-PD-1 antibody comprises nivolumab. In certain aspects, the anti-PD-1 antibody comprises pembrolizumab. In certain aspects, the anti-PD-1 antibody comprises PDR001. In certain aspects, the anti-PD-1 antibody comprises MEDI-0680. In certain aspects, the anti-PD-1 antibody comprises cemiplimab. In certain aspects, the anti-PD-1 antibody comprises JS001. In certain aspects, the anti-PD-1 antibody comprises BGB-A317. In some aspects, the anti-PD-1 antibody comprises INCSHR1210. In some aspects, the anti-PD-1 antibody comprises TSR-042. In some aspects, the anti-PD-1 antibody comprises GLS-010. In some aspects, the anti-PD-1 antibody comprises AM-0001. In some aspects, the anti-PD-1 antibody comprises STI-1110. In some aspects, the anti-PD-1 antibody comprises AGEN2034. In some aspects, the anti-PD-1 antibody comprises MGA012. In some aspects, the anti-PD-1 antibody comprises IBI308. In some aspects, the anti-PD-1 antibody comprises a bispecific antibody comprising one or more anti-PD-1 antibodies listed herein.

[0523] In some aspects, the anti-PD-L1 antibody comprises an antibody selected from the group consisting of atezolizumab, durvalumab, avelumab, STI-1014, CX-072, KN035, LY3300054, CK-301, BMS-936559, and any combination thereof. In some aspects, the anti-PD-L1 antibody comprises atezolizumab. In some aspects, the anti-PD-L1 antibody comprises durvalumab. In some aspects, the anti-PD-L1 antibody comprises avelumab. In some aspects, the anti-PD-L1 antibody comprises STI-1014. In some aspects, the anti-PD-L1 antibody comprises CX-072. In some aspects, the anti-PD-L1 antibody comprises KN035. In some aspects, the anti-PD-L1 antibody comprises LY3300054. In some aspects, the anti-PD-L1 antibody comprises CK-301. In some aspects, the anti-PD-L1 antibody comprises BMS-936559. In certain aspects, the anti-PD-1 antibody comprises a bispecific antibody comprising one or more of the anti-PD-L1 antibodies listed herein.

[0524] In some aspects, the extracellular vesicles and the PD-1 antagonist are administered simultaneously. In some aspects, the extracellular vesicles and the PD-1 antagonist are administered sequentially. In some aspects, the extracellular vesicles and the PD-1 antagonist are administered on the same day. In some aspects, the extracellular vesicles and the PD-1 antagonist are administered on different days.

[0525] In some aspects, the ASO and PD-1 antagonist of the present disclosure can be administered in the same EV. In other aspects, the ASO and PD-1 antagonist of the present disclosure are administered in different EVs. For example, the present disclosure includes a pharmaceutical composition comprising an EV comprising an ASO and an EV comprising a PD-1 antagonist. In some aspects, a pharmaceutical composition comprising EVs (e.g., exosomes) is administered before administering the PD-1 antagonist. In other aspects, a pharmaceutical composition comprising EVs (e.g., exosomes) is administered after administering the PD-1 antagonist. In another aspect, a pharmaceutical composition comprising EVs (e.g., exosomes) is administered simultaneously with a PD-1 antagonist.

[0526] VI. Pharmaceutical Compositions

[0527] Provided herein is a pharmaceutical composition comprising an EV (e.g., exosome) of the present disclosure having a desired purity and a pharmaceutically acceptable carrier or excipient in a form suitable for administration to a subject. In some aspects, the pharmaceutical composition further comprises a PD-1 antagonist. A pharmaceutically acceptable excipient or carrier may be determined in part by the specific composition administered and by a specific method for administering the composition. Therefore, there are various suitable formulations of pharmaceutical compositions comprising multiple extracellular vesicles. (See, for example, Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 21st edition, (2005)). Pharmaceutical compositions are typically formulated aseptically and in full compliance with all good manufacturing practices (GMP) regulations of the U.S. Food and Drug Administration.

[0528] In some aspects, the pharmaceutical composition comprises one or more therapeutic agents (e.g., PD-1 antagonists) and exosomes described herein. In certain aspects, EVs (e.g., exosomes) are co-administered with one or more additional therapeutic agents (e.g., PD-1 antagonists) in a pharmaceutically acceptable carrier.

[0529] Acceptable carriers, excipients or stabilizers are nontoxic to recipients (e.g., animals or humans) at the dosages and concentrations employed, and include buffers such as phosphates, citrates and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride; benzethonium chloride; phenolic alcohol, butyl alcohol or benzyl alcohol; alkyl parabens such as methyl paraben or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight The present invention can be a polypeptide having a molecular weight (less than about 10 residues); a protein such as serum albumin, gelatin or immunoglobulin; a hydrophilic polymer such as polyvinylpyrrolidone; an amino acid such as glycine, glutamine, asparagine, histidine, arginine or lysine; a monosaccharide, a disaccharide and other carbohydrates including glucose, mannose or dextrin; a chelating agent such as EDTA; a sugar such as sucrose, mannitol, trehalose or sorbitol; a salt-forming counterion such as sodium; a metal complex (e.g., a Zn protein complex); and / or a nonionic surfactant such as TWEEN®. TM 、PLURONICS TM or polyethylene glycol (PEG).

[0530] Examples of carriers or diluents include, but are not limited to, water, saline, Ringer's solution, dextrose solution, and 5% human serum albumin. The use of such media and compounds for pharmaceutically active substances is well known in the art. Except in the case where any conventional media or compounds are incompatible with the extracellular vesicles described herein, the use of such media or compounds in the compositions is contemplated.

[0531] In some aspects, the diluent comprises NaCl. In some aspects, the diluent comprises at least about 10 mM to at least about 200 mM NaCl, at least about 10 mM to at least about 175 mM NaCl, at least about 10 mM to at least about 150 mM NaCl, at least about 10 mM to at least about 125 mM NaCl, at least about 10 mM to at least about 100 mM NaCl, at least about 10 mM to at least about 75 mM NaCl, at least about 10 mM to at least about 50 mM NaCl, at least about 25 mM to at least about 200 mM NaCl, at least about 25 mM to at least about 175 mM NaCl, at least about 25 mM to at least about 150 mM NaCl, at least about 25 mM to at least about 125 mM NaCl, at least about 25 mM to at least about 100 mM NaCl, at least about 25 mM to at least about 75 mM NaCl, NaCl, at least about 25 mM to at least about 50 mM NaCl, at least about 50 mM to at least about 200 mM NaCl, at least about 50 mM to at least about 175 mM NaCl, at least about 50 mM to at least about 150 mM NaCl, at least about 50 mM to at least about 125 mM NaCl, at least about 50 mM to at least about 100 mM NaCl, at least about 50 mM to at least about 75 mM NaCl, at least about 75 mM to at least about 200 mM NaCl, at least about 75 mM to at least about 175 mM NaCl, at least about 75 mM to at least about 150 mM NaCl, at least about 75 mM to at least about 125 mM NaCl, at least about 75 mM to at least about 100 mM NaCl, at least about 100 mM to at least about 200 mM NaCl, at least about 100 mM to at least about 175 mM NaCl NaCl, at least about 100 mM to at least about 150 mM NaCl, at least about 125 mM to at least about 200 mM NaCl, at least about 125 mM to at least about 175 mM NaCl, at least about 125 mM to at least about 150 mM NaCl, or at least about 150 mM to at least about 200 mM NaCl.In some aspects, the diluent comprises at least about 25 mM NaCl, at least about 30 mM NaCl, at least about 35 mM NaCl, at least about 40 mM NaCl, at least about 45 mM NaCl, at least about 50 mM NaCl, at least about 55 mM NaCl, at least about 60 mM NaCl, at least about 70 mM NaCl, at least about 75 mM NaCl, at least about 80 mM NaCl, at least about 90 mM NaCl, at least about 100 mM NaCl, at least about 110 mM NaCl, at least about 120 mM NaCl, at least about 125 mM NaCl, at least about 130 mM NaCl, at least about 135 mM NaCl, at least about 140 mM NaCl, at least about 145 mM NaCl, at least about 150 mM NaCl, at least about 155 mM NaCl, at least about 160 mM NaCl, at least about 165 mM NaCl, at least about 170 mM NaCl, at least about In some aspects, the diluent comprises about 150 mM NaCl. In some aspects, the diluent comprises about 200 mM NaCl, about 175 mM NaCl, about 180 mM NaCl, about 190 mM NaCl, or about 200 mM NaCl. In some aspects, the diluent comprises about 50 mM NaCl. In some aspects, the diluent comprises about 150 mM NaCl. In some aspects, the diluent comprises about 155 mM NaCl.

[0532] In some aspects, the diluent comprises phosphate (PO 4). In some aspects, the phosphate is a phosphate salt. In some aspects, the diluent comprises at least about 1 mM to at least about 50 mM phosphate. In some aspects, the diluent comprises at least about 1 mM to at least about 30 mM, at least about 1 mM to at least about 20 mM, at least about 1 mM to at least about 10 mM, at least about 1 mM to at least about 5 mM, at least about 2 mM to at least about 25 mM, at least about 3 mM to at least about 20 mM, at least about 5 mM to at least about 30 mM, at least about 5 mM to at least about 25 mM, at least about 5 mM to at least about 20 mM, at least about 10 mM to at least about 30 mM, at least about 10 mM to at least about 25 mM, at least about 20 mM, at least about 10 mM to at least about 20 mM, at least about 10 mM to at least about 25 ... 5 mM, at least about 10 mM to at least about 20 mM, at least about 15 mM to at least about 30 mM, at least about 15 mM to at least about 25 mM, at least about 15 mM to at least about 20 mM, at least about 20 mM to at least about 30 mM, at least about 20 mM to at least about 25 mM, at least about 2 mM to at least about 9 mM, at least about 3 mM to at least about 8 mM, at least about 4 mM to at least about 7 mM, at least about 4 mM to at least about 6 mM, or at least about 4 mM to at least about 5 mM phosphate. In some aspects, the diluent comprises at least about 1mM, at least about 2mM, at least about 3mM, at least about 4mM, at least about 4.1mM, at least about 4.2mM, at least about 4.3mM, at least about 4.4mM, at least about 4.5mM, at least about 5mM, at least about 6mM, at least about 7mM, at least about 8mM, at least about 9mM, at least about 10mM, at least about 11mM, at least about 12mM, at least about 13mM, at least about 14mM, at least about 15mM, at least about 16mM, at least about 17mM, at least about 18mM, at least about 19mM, at least about 20mM, at least about 21mM, at least about 22mM, at least about 23mM, at least about 24mM, at least about 25mM or at least about 30mM phosphate. In some aspects, the diluent comprises at least about 4.2mM phosphate. In some aspects, the diluent comprises at least about 20 mM phosphate. In some aspects, the diluent comprises at least about 15 mM phosphate. In some aspects, the diluent comprises at least about 10 mM phosphate. In some aspects, the diluent comprises at least about 5 mM phosphate.

[0533] In some aspects, the diluent comprises sugar. In some aspects, the sugar present in the diluent is a monosaccharide, a disaccharide, a trisaccharide or any other sugar. In some aspects, the sugar is sucrose. In some aspects, the sugar is trehalose. In some aspects, sugar (for example, sucrose or trehalose) is present in the diluent at a concentration of at least about 1% to at least about 10%, at least about 2% to at least about 9%, at least about 3% to at least about 8%, at least about 4% to at least about 7%, at least about 4% to at least about 6%, at least about 3% to at least about 7%, at least about 5% to at least about 10%, at least about 5% to at least about 9%, at least about 5% to at least about 8% or at least about 5% to at least about 7%. In some aspects, sugar (for example, sucrose or trehalose) is present in the diluent at a concentration of at least about 1%. In some aspects, sugar (for example, sucrose or trehalose) is present in the diluent at a concentration of at least about 2%. In some aspects, sugar (e.g., sucrose or trehalose) is present in the diluent at a concentration of at least about 3%. In some aspects, sugar (e.g., sucrose or trehalose) is present in the diluent at a concentration of at least about 4%. In some aspects, sugar (e.g., sucrose or trehalose) is present in the diluent at a concentration of at least about 5%. In some aspects, sugar (e.g., sucrose or trehalose) is present in the diluent at a concentration of at least about 6%. In some aspects, sugar (e.g., sucrose or trehalose) is present in the diluent at a concentration of at least about 7%. In some aspects, sugar (e.g., sucrose or trehalose) is present in the diluent at a concentration of at least about 8%. In some aspects, sugar (e.g., sucrose or trehalose) is present in the diluent at a concentration of at least about 9%. In some aspects, sugar (e.g., sucrose or trehalose) is present in the diluent at a concentration of at least about 10%.

[0534] In some aspects, the diluent comprises at least about 1% sucrose. In some aspects, the diluent comprises at least about 2% sucrose. In some aspects, the diluent comprises at least about 2.5% sucrose. In some aspects, the diluent comprises at least about 3% sucrose. In some aspects, the diluent comprises at least about 4% sucrose. In some aspects, the diluent comprises at least about 5% sucrose. In some aspects, the diluent comprises at least about 6% sucrose. In some aspects, the diluent comprises at least about 7% sucrose. In some aspects, the diluent comprises at least about 8% sucrose. In some aspects, the diluent comprises at least about 9% sucrose. In some aspects, the diluent comprises at least about 10% sucrose.

[0535] In some aspects, the diluent comprises at least about 10 mg / ml sucrose. In some aspects, the diluent comprises at least about 20 mg / ml sucrose. In some aspects, the diluent comprises at least about 25 mg / ml sucrose. In some aspects, the diluent comprises at least about 30 mg / ml sucrose. In some aspects, the diluent comprises at least about 40 mg / ml sucrose. In some aspects, the diluent comprises at least about 50 mg / ml sucrose. In some aspects, the diluent comprises at least about 60 mg / ml sucrose. In some aspects, the diluent comprises at least about 70 mg / ml sucrose. In some aspects, the diluent comprises at least about 80 mg / ml sucrose. In some aspects, the diluent comprises at least about 90 mg / ml sucrose. In some aspects, the diluent comprises at least about 100 mg / ml sucrose.

[0536] In some aspects, the diluent comprises phosphate buffered saline (PBS).

[0537] In some aspects, the diluent has a pH of at least about 6.5 to about 7.5. In some aspects, the diluent has a pH of about 6.5, about 6.6, about 6.7, about 6.8, about 6.9, about 7.0, about 7.1, about 7.2, about 7.3, about 7.4, or about 7.5. In some aspects, the diluent has a pH of about 7.2.

[0538] In some aspects, the osmotic pressure of the diluent is between about 250 mOsm / kg and about 450 mOsm / kg. In certain aspects, the osmotic pressure of the diluent is between about 275 mOsm / kg and about 450 mOsm / kg, between about 280 mOsm / kg and about 450 mOsm / kg, between about 300 mOsm / kg and about 450 mOsm / kg, between about 275 mOsm / kg and about 400 mOsm / kg, between about 280 mOsm / kg and about 400 mOsm / kg, between about 300 mOsm / kg and about 400 mOsm / kg, between about 275 mOsm / kg and about 38 ... In some embodiments, the present invention relates to a method for producing an aqueous phase of the present invention that is at least about 20 mOsm / kg to about 380 mOsm / kg, between about 300 mOsm / kg and about 380 mOsm / kg, between about 275 mOsm / kg and about 350 mOsm / kg, between about 280 mOsm / kg and about 350 mOsm / kg, between about 300 mOsm / kg and about 350 mOsm / kg, between about 275 mOsm / kg and about 310 mOsm / kg, between about 280 mOsm / kg and about 310 mOsm / kg, or between about 300 mOsm / kg and about 310 mOsm / kg.

[0539] In some aspects, the osmotic pressure of the diluent is about 360mOsm / kg, about 370mOsm / kg, about ...

Claims

1. A method for preventing or treating a disease or condition in a subject in need thereof, the method comprising administering to the subject a dose of one or more antisense oligonucleotides (ASOs) targeting a STAT6 transcript (SEQ ID NO: 1 or SEQ ID NO: 3), wherein each of the one or more ASOs comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within the STAT6 transcript; and wherein the amount of the one or more ASOs in the dose is at least about 0.01 mg to at least about 240 mg.

2. A method of increasing or enhancing an immune response in a subject in need thereof, the method comprising administering to the subject a dose of one or more antisense oligonucleotides (ASOs) targeting a STAT6 transcript (SEQ ID NO: 1 or SEQ ID NO: 3), wherein each of the one or more ASOs comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within the STAT6 transcript; and wherein the amount of the one or more ASOs in the dose is at least about 0.01 mg to at least about 240 mg.

3. The method of claim 1 or 2, wherein the ASO is delivered via one or more extracellular vesicles (EVs).

4. The method of claim 3, wherein the one or more ASOs are associated with the one or more EVs.

5. The method of claim 3 or 4, wherein at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, or at least about 90% of the one or more ASOs are associated with the one or more EVs.

6. The method of any one of claims 1 to 5, wherein the dose is at least about 0.01 mg, at least about 0.05 mg, at least about 0.1 mg, at least about 0.5 mg, at least about 1 mg, at least about 2 mg, at least about 3 mg, at least about 4 mg, at least about 5 mg, at least about 6 mg, at least about 7 mg, at least about 8 mg, at least about 9 mg, at least about 10 mg, at least about 11 mg, at least about 12 mg, at least about 13 mg, at least about 14 mg, at least about 15 mg, at least about 16 mg, at least about 17 mg, at least about 18 mg, at least about 19 mg, at least about 20 mg, at least about 21 mg, at least about 22 mg, at least about 23 mg, at least about 24 mg, at least about 25 mg, at least about 26 mg, at least about 27 mg At least about 7 mg, at least about 28 mg, at least about 29 mg, at least about 30 mg, at least about 35 mg, at least about 40 mg, at least about 45 mg, at least about 50 mg, at least about 55 mg, at least about 60 mg, at least about 65 mg, at least about 70 mg, at least about 75 mg, at least about 80 mg, at least about 85 mg, at least about 90 mg, at least about 95 mg, at least about 100 mg, at least about 110 mg, at least about 120 mg, at least about 125 mg, at least about 130 mg, at least about 140 mg, at least about 150 mg, at least about 160 mg, at least about 170 mg, at least about 180 mg, at least about 190 mg, at least about 200 mg, at least about 220 mg or at least about 240 mg of the one or more ASOs.

7. The method of any one of claims 1 to 6, wherein the dose is at least about 5 mg of the one or more ASOs.

8. The method of any one of claims 1 to 6, wherein the dosage is at least about 15 mg of the one or more ASOs.

9. The method of any one of claims 1 to 6, wherein the dose is at least about 30 mg of the one or more ASOs.

10. The method of any one of claims 1 to 6, wherein the dose is at least about 60 mg of the one or more ASOs.

11. The method of any one of claims 1 to 10, wherein the dose is administered about once a week, about once every two weeks, about once every three weeks, or about once every four weeks.

12. The method of any one of claims 1 to 11, wherein the dose is administered on about day 1 and day 15 of the first 28-day cycle.

13. The method of claim 12, wherein the dose is administered on about Day 1 and Day 15 of a second 28-day cycle.

14. The method of claim 13, wherein the dose is administered on about day 1 of a third 28-day cycle.

15. The method of claim 14, wherein the dose is administered approximately every 56 days after the third 28-day cycle.

16. The method according to any one of claims 1 to 15, wherein the contiguous nucleotide sequence is complementary to a nucleic acid sequence within nucleotides 1 to 2056 of a STAT6 transcript corresponding to the nucleotide sequence as shown in SEQ ID NO:3 or nucleotides 2059 to 3963 of a STAT6 transcript corresponding to the nucleotide sequence as shown in SEQ ID NO:

3.

17. The method of any one of claims 1 to 16, wherein the ASO is an interpolymer, a mixed polymer, or a full polymer.

18. The method of any one of claims 1 to 17, wherein the ASO comprises one or more nucleoside analogs.

19. The method of claim 18, wherein one or more of the nucleoside analogs comprises 2'-O-alkyl-RNA; 2'-O-methyl RNA (2'-OMe); 2'-alkoxy-RNA; 2'-O-methoxyethyl-RNA (2'-MOE); 2'-amino-DNA; 2'-fluoro-RNA; 2'-fluoro-DNA; arabinose nucleic acid (ANA); 2'-fluoro-ANA; or a bicyclic nucleoside analog.

20. The method of claim 18 or 19, wherein one or more of the nucleoside analogs are sugar-modified nucleosides.

21. The method of claim 20, wherein the sugar-modified nucleoside is an affinity-enhanced 2' sugar-modified nucleoside.

22. The method of any one of claims 18 to 21, wherein one or more of the nucleoside analogs comprises a nucleoside comprising a bicyclic sugar.

23. The method of any one of claims 18 to 21, wherein one or more of the nucleoside analogs comprises LNA.

24. The method of any one of claims 18 to 23, wherein one or more of the nucleotide analogs are selected from the group consisting of constrained ethyl nucleosides (cEt), 2',4'-constrained 2'-O-methoxyethyl (cMOE), α-L-LNA, β-D-LNA, 2'-O,4'-C-ethylene bridged nucleic acids (ENA), amino-LNA, oxy-LNA, thio-LNA, and any combination thereof.

25. The method of any one of claims 1 to 24, wherein the ASO comprises one or more 5'-methyl-cytosine nucleobases.

26. The method of any one of claims 1 to 25, wherein the contiguous nucleotide sequence is complementary to a nucleic acid sequence within: (i) a 5' untranslated region (UTR); (ii) a coding region; or (iii) a 3' UTR of a target transcript.

27. The method according to any one of claims 1 to 26, wherein the contiguous nucleotide sequence is complementary to a nucleic acid sequence comprising: (i) nucleotides 1-700 of SEQ ID NO:3; (ii) nucleotides 1000-1500 of SEQ ID NO:3; (iii) nucleotides 1500-2000 of SEQ ID NO:3; (iv) nucleotides 2000-2500 of SEQ ID NO:3; (v) nucleotides 2500-3000 of SEQ ID NO:3; (vi) nucleotides 3000-3700 of SEQ ID NO:3, (vii) nucleotides 413-803 of SEQ ID NO:3; (viii) nucleotides 952-1688 of SEQ ID NO:3; (ix) nucleotides 1726-2489 of SEQ ID NO:3; (x) nucleotides 2682-2912 of SEQ ID NO:3; (xi) nucleotides 2970-3203 of SEQ ID NO:3; (xii) nucleotides 3000-3700 of SEQ ID NO:3 NO:3; (xiii) nucleotides 463-753 of SEQ ID NO:3; (xiv) nucleotides 1002-1638 of SEQ ID NO:3; (xv) nucleotides 1776-2439 of SEQ ID NO:3; (xvi) nucleotides 2682-2862 of SEQ ID NO:3; (xvii) nucleotides 3020-3153 of SEQ ID NO:3; (xviii) nucleotides 3381-3511 of SEQ ID NO:3; (xix) nucleotides 503-713 of SEQ ID NO:3; (xx) nucleotides 1042-1598 of SEQ ID NO:3; (xxi) nucleotides 1816-2399 of SEQ ID NO:3; (xxii) nucleotides 2722-2822 of SEQ ID NO:3; (xxiii) nucleotides 3060-3113 of SEQ ID NO:3; or (xxiv) SEQ ID NO:3421-3471.

28. The method of any one of claims 1 to 27, wherein the contiguous nucleotide sequence is complementary to a nucleic acid sequence within: (i) nucleotides 513-703 of SEQ ID NO:3; (ii) nucleotides 1052-1588 of SEQ ID NO:3; (iii) nucleotides 1826-2389 of SEQ ID NO:3; (iv) nucleotides 2732-2812 of SEQ ID NO:3; (v) nucleotides 3070-3103 of SEQ ID NO:3; or (vi) nucleotides 3431-3461 of SEQ ID NO:

3.

29. The method of any one of claims 1 to 28, wherein the ASO comprises a nucleic acid sequence selected from the group consisting of GAAAGGTTCCGTCGGGC (SEQ ID NO: 144), CTGAGTCGCTGAAGCGG (SEQ ID NO: 145), GCCCTTGTACTTTTGCATAG (SEQ ID NO: 193), GCAAGATCCCGGATT CGGTC (SEQ ID NO: 185), and any combination thereof.

30. The method according to any one of claims 1 to 29, wherein the contiguous nucleotide sequence comprises a nucleotide sequence complementary to a sequence selected from the sequences in Figures 1A-1B.

31. The method of any one of claims 1 to 30, wherein the contiguous nucleotide sequence is fully complementary to a nucleotide sequence within the target transcript.

32. The method according to any one of claims 1 to 31, wherein the ASO comprises a nucleotide sequence selected from SEQ ID NOs: 91-193 having one or two mismatches.

33. The method of any one of claims 1 to 32, wherein the ASO has a design selected from the group consisting of the designs in Figures 1A-1B, wherein the uppercase letters are sugar-modified nucleosides and the lowercase letters are DNA.

34. The method of any one of claims 1 to 33, wherein the ASO is 14 to 20 nucleotides in length.

35. The method of any one of claims 1 to 34, wherein the contiguous nucleotide sequence comprises one or more modified internucleoside bonds.

36. The method of claim 35, wherein the one or more modified internucleoside linkages are phosphorothioate linkages.

37. The method of claim 35 or 36, wherein at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% of the internucleoside linkages are modified.

38. The method of claim 37, wherein each of the internucleoside linkages in the ASO is a phosphorothioate linkage.

39. The method of any one of claims 1 to 38, wherein the ASO is linked to an anchoring moiety.

40. The method of claim 39, wherein the anchoring moiety comprises a sterol, GM1, a lipid, a vitamin, a small molecule, a peptide, or a combination thereof.

41. The method of claim 39 or 40, wherein the anchoring moiety comprises cholesterol.

42. The method of any one of claims 38 to 40, wherein the anchoring moiety comprises a phospholipid, a lysophospholipid, a fatty acid, a vitamin (e.g., vitamin D and / or vitamin E), or any combination thereof.

43. A method according to any one of claims 36 to 42, wherein the anchoring portion is associated with the EV.

44. A method according to any one of claims 39 to 43, wherein the EV comprises a lipid bilayer, wherein the anchoring moiety is associated with the lipid bilayer of the EV.

45. The method of any one of claims 39 to 44, wherein the ASO is attached to the anchoring moiety on the outer surface of the EV.

46. ​​The method of any one of claims 39 to 44, wherein the ASO is attached to the anchoring moiety on the luminal surface of the EV.

47. The method of any one of claims 39 to 44, wherein the ASO is linked to the anchoring moiety.

48. The method of any one of claims 39 to 47, wherein the anchoring portion comprises a stent portion.

49. The method of any one of claims 3 to 48, wherein the ASO is linked to the EV via a linker.

50. The method of claim 48 or 49, wherein the linker is a polypeptide.

51. The method of claim 48 or 49, wherein the linker is a non-polypeptide moiety.

52. The method of claim 48 or 49, wherein the linker comprises ethylene glycol.

53. The method of claim 52, wherein the linker comprises HEG, TEG, PEG, or any combination thereof.

54. The method of claim 48 or 49, wherein the linker comprises an acrylic acid phosphoramidite (e.g., ACRYDITE TM ), adenylation, azide (NHS ester), digoxin (NHS ester), cholesterol-TEG, I-LINKER TM , amino modifiers (e.g., amino modifier C6, amino modifier C12, amino modifier C6dT or Uni-Link TM amino modification), alkyne, 5' hexynyl, 5-octadiynyl dU, biotinylation (e.g., biotin, biotin (azide), biotin dT, biotin-TEG, dual biotin, PC biotin, or desthiobiotin), thiol modification (thiol modification C3 SS, dithiol, or thiol modification C6 SS), or any combination thereof.

55. The method of any one of claims 48 to 54, wherein the linker is a cleavable linker.

56. The method of claim 55, wherein the linker comprises valine-alanine-p-aminobenzylcarbamate or valine-citrulline-p-aminobenzylcarbamate.

57. The method of any one of claims 48 to 56, wherein the linker comprises (i) a maleimide moiety and (ii) valine-alanine-p-aminobenzylcarbamate or valine-citrulline-p-aminobenzylcarbamate.

58. The method of any one of claims 1 to 57, wherein the extracellular vesicle further comprises an exogenous targeting moiety.

59. The method of claim 58, wherein the exogenous targeting moiety comprises a peptide, an antibody or antigen-binding fragment thereof, a chemical compound, an RNA aptamer, or any combination thereof.

60. The method of claim 58 or 59, wherein the exogenous targeting moiety comprises a peptide.

61. The method of any one of claims 58 to 60, wherein the exogenous targeting moiety comprises a microprotein, a designed ankyrin repeat protein (darpin), anticalin, an adnectin, an aptamer, a peptide mimetic molecule, a natural ligand of a receptor, a camelid nanobody, or any combination thereof.

62. The method of any one of claims 58 to 61, wherein the exogenous targeting moiety comprises a full-length antibody, a single domain antibody, a heavy chain only antibody (VHH), a single chain antibody, a shark heavy chain only antibody (VNAR), scFv, Fv, Fab, Fab', F(ab')2, or any combination thereof.

63. The method of claim 62, wherein the antibody is a single chain antibody.

64. The method of any one of claims 58 to 63, wherein the exogenous targeting moiety targets the exosomes to the liver, heart, lung, brain, kidney, central nervous system, peripheral nervous system, muscle, bone, joints, skin, intestine, bladder, pancreas, lymph nodes, spleen, blood, bone marrow, or any combination thereof.

65. The method of any one of claims 58 to 64, wherein the exogenous targeting moiety targets the extracellular vesicle to a tumor cell, a dendritic cell, a T cell, a B cell, a macrophage, a neuron, a hepatocyte, a Kupffer cell, a myeloid cell (e.g., a neutrophil, a monocyte, a macrophage, a hematopoietic stem cell, an MDSC (e.g., a monocytic MDSC or a granulocytic MDSC)), or any combination thereof.

66. The method of any one of claims 58 to 64, wherein the extracellular vesicle comprises a scaffold moiety connecting the exogenous targeting moiety to the extracellular vesicle.

67. The method of claim 48 or 66, wherein the scaffold portion is Scaffold X.

68. The method of claim 48 or 67, wherein the scaffold portion is scaffold Y.

69. The method of any one of claims 3 to 68, wherein the extracellular vesicles are exosomes.

70. The method of any one of claims 3 to 69, wherein the ASO or the ASO and the extracellular vesicles are administered by a route selected from the group consisting of parenteral administration, topical administration, intravenous administration, oral administration, subcutaneous administration, intraarterial administration, intradermal administration, transdermal administration, rectal administration, intracranial administration, intraperitoneal administration, intrathecal administration, intranasal administration, intratumoral administration, intramuscular administration, inhalation, and any combination thereof.

71. The method of any one of claims 1 to 70, further comprising administering a PD-1 antagonist to the subject.

72. The method of claim 71, wherein the PD-1 antagonist comprises an antibody or antigen-binding portion thereof ("anti-PD-1 antibody") that specifically binds to human PD-1 and blocks or inhibits the interaction between PD-1 and PD-L1.

73. The method of claim 72, wherein the anti-PD-1 antibody is selected from the group consisting of nivolumab, pembrolizumab, PDR001, MEDI-0680, cemiplizumab, JS001, BGB-A317, INCSHR1210, TSR-042, GLS-010, AM-0001, STI-1110, AGEN2034, MGA012, IBI308, and any combination thereof.

74. The method of claim 71 or 72, wherein the PD-1 antagonist comprises an antibody or antigen-binding portion thereof ("anti-PD-L1 antibody") that specifically binds to human PD-L1 and blocks or inhibits the interaction between PD-1 and PD-L1.

75. The method of claim 74, wherein the anti-PD-L1 antibody is selected from the group consisting of atezolizumab, durvalumab, avelumab, STI-1014, CX-072, KN035, LY3300054, CK-301, BMS-936559, and any combination thereof.

76. The method of any one of claims 71 to 75, wherein (i) the ASO or the ASO and the extracellular vesicles and (ii) the PD-1 antagonist are administered simultaneously.

77. The method of any one of claims 71 to 75, wherein (i) the ASO or the ASO and the extracellular vesicle and (ii) the PD-1 antagonist are administered sequentially.

78. The method of claim 77, wherein (i) the ASO or the ASO and the extracellular vesicles and (i) the PD-1 antagonist are administered on different days.

79. The method of any one of claims 71 to 78, wherein the PD-1 antagonist is linked or associated with the extracellular vesicle.

80. The method of any one of claims 1 to 79, wherein the subject has cancer.

81. The method of claim 80, wherein the cancer is selected from the group consisting of fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's sarcoma, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, head and neck cancer squamous cell carcinoma, colorectal cancer, lymphoma, leukemia, liver cancer, gastric cancer, glioblastoma, melanoma, myeloma basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, Papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatocarcinoma, bile duct carcinoma, choriocarcinoma, seminoma, non-seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, testicular cancer, lung cancer, small cell lung cancer, bladder cancer, epithelial carcinoma, glioma, glioblastoma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, retinoblastoma, follicular lymphoma, Hodgkin's lymphoma, B-cell lymphoma, and any combination thereof.

82. The method of claim 80 or 81, wherein the cancer comprises hepatocellular carcinoma (HCC).

83. The method of any one of claims 80 to 82, wherein the cancer comprises advanced HCC.

84. The method of claim 80 or 81, wherein the cancer comprises gastric cancer.

85. The method of claim 80 or 81, wherein the cancer comprises colorectal cancer.

86. The method of any one of claims 80 to 83, wherein the cancer has metastasized to the liver.

87. The method of any one of claims 80 to 84, wherein the cancer is refractory to prior therapy.

88. The method of any one of claims 80 to 87, comprising administering an additional anti-cancer agent.

89. The method of claim 88, wherein the additional anti-cancer agent comprises a standard of care therapy.

90. The method of any one of claims 1 to 89, wherein the amount of the one or more ASOs in the dose is measured using anion exchange chromatography (AEX).

91. The method of claim 90, wherein the AEX comprises AEX ultrapure liquid chromatography (UPLC).

92. The method of any one of claims 1 to 89, wherein the amount of the one or more ASOs in the dose is measured using hydrophilic chromatography.

93. The method of any one of claims 1 to 89, wherein the amount of the one or more ASOs in the dose is measured using a ribogreen assay.

Images