Polypeptides for catalyzing lignan cyclization, encoding genes, preparation methods and applications

The catalytic peptide SchCYP719G1b addresses the synthesis challenge of benzocyclooctene-type lignans by catalyzing their formation, enabling their biosynthesis and pharmaceutical applications.

CN119876062BActive Publication Date: 2025-07-15INST OF MEDICINAL PLANT DEV CHINESE ACADEMY OF MEDICAL SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510364253.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-26
Publication Date
2025-07-15
Estimated Expiration
2045-03-26

AI Technical Summary

Technical Problem

The prior art is difficult to efficiently synthesize biphenylcyclooctene lignans, and the difficulty in chemical synthesis leads to limited drug development.

Method used

The polypeptide SchCYP719G1b which catalyzes the cyclization of lignans and its encoding gene are provided to form biphenylcyclooctene lignans by catalyzing the benzene ring C-C coupling of bibenzylbutane lignans.

Benefits of technology

The skeleton biosynthesis of biphenylcycloctene-type lignans has been realized, laying the foundation for the synthesis of various biphenylcycloctene-type lignans in Schisandra, and has important drug development value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119876062B_ABST
    Figure CN119876062B_ABST
Patent Text Reader

Abstract

The present invention discloses a polypeptide for catalyzing the cyclization of lignans, and its encoding gene, preparation method and application, belonging to the technical fields of genetic engineering and enzyme engineering. The polypeptide for catalyzing the cyclization of lignans is polypeptide Sch CYP719G1b, and its amino acid sequence is selected from: (1) the amino acid sequence shown in SEQ ID No. 1; (2) the amino acid sequence generated by substituting, deleting and / or adding one or several amino acids to the amino acid sequence shown in SEQ ID No. 1, and having the same catalytic activity as (1); or (3) a truncated form of (1) or (2) having the same catalytic activity as (1). The polypeptide Sch CYP719G1b can catalyze the C-C coupling on the benzene ring of dibenzylbutane-type lignans, laying an important foundation for the biosynthesis of dibenzocyclooctene-type lignans and drug development.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical fields of genetic engineering and enzyme engineering, and specifically relates to a polypeptide for catalyzing lignan cyclization, an encoding gene thereof, a preparation method, and an application thereof. Background Art

[0002] Schisandra chinensis ( Schisandra chinensis ) is a woody plant of the genus Schisandra in the family Schisandraceae. Schisandra chinensis has a wide range of medicinal values, including liver protection, anti-tumor, anti-viral, antioxidant, neuroprotection and other effects. Biphenylcyclooctene lignans are one of the important categories of lignan compounds, which are characterized by a highly oxidized biphenylcyclooctadiene (eight-membered ring) structure in their structure, and this type of lignan is concentrated in the family Schisandraceae and is also the active ingredient of medicinal plants in the family Schisandraceae.

[0003] In recent years, studies have shown that biphenylcyclooctene lignans have rich and significant pharmacological activities and are potential drug sources, mainly showing the effects of liver protection, anti-viral and neuroprotection. For example, schisandrin B has entered phase II clinical trials as a natural biphenylcyclooctene lignan for the treatment of drug-induced cardiac toxicity; (−)-gomisin M1 can inhibit the proliferation, migration and invasion of liver cancer cells by regulating miRNA biogenesis; (+)-gomisin M2, gomisin J and schisandrin have been shown to inhibit the activity of breast cancer cells.

[0004] The structure of biphenylcyclooctene lignans is special, and it is difficult to chemically synthesize its natural eight-membered ring structure. Therefore, at present, the acquisition of this type of compound mainly relies on the extraction and separation of plants, which severely restricts the development of drugs. The research on the biosynthesis of biphenylcyclooctene lignans can greatly promote the exploration and utilization of medicinal molecules in this type of lignan. The key step is the formation of the eight-membered ring mother nucleus. The analysis of this step lays an important foundation for the subsequent biosynthesis of diverse biphenylcyclooctene lignans and drug development. Summary of the Invention

[0005] In view of the above-mentioned prior art, the present invention provides a polypeptide for catalyzing lignan cyclization, an encoding gene thereof, a preparation method, and an application thereof, and provides a new polypeptide that can catalyze lignan cyclization, which can catalyze the C-C coupling on the benzene ring of dibenzylbutane-type lignans, and lays an important foundation for the biosynthesis of biphenylcyclooctene lignans and drug development.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is: to provide a polypeptide for catalyzing lignan cyclization, and the polypeptide for catalyzing lignan cyclization is polypeptide Sch CYP719G1b, and its amino acid sequence is selected from:

[0007] (1) The amino acid sequence shown in SEQ ID No.1;

[0008] (2) An amino acid sequence produced by substituting, deleting, and / or adding one or more amino acids to the amino acid sequence shown in SEQ ID No.1, and having the same catalytic activity as (1); or

[0009] (3) A truncated form of (1) or (2) having the same catalytic activity as (1).

[0010] The present invention also discloses a coding gene for a polypeptide that catalyzes the cyclization of lignans, the polypeptide Sch The coding gene sequence of CYP719G1b is selected from:

[0011] (1) The nucleotide sequence shown in SEQ ID NO.2;

[0012] (2) A nucleotide sequence having more than 80% homology with the nucleotide sequence shown in SEQ ID NO.2, and the encoded polypeptide having the same catalytic activity as the polypeptide encoded by (1); or

[0013] (3) A truncated form of (1) or (2) having the same catalytic activity as the polypeptide encoded by (1).

[0014] Furthermore, an expression vector containing the above coding gene.

[0015] Furthermore, a recombinant microorganism or transgenic cell line containing the above coding gene.

[0016] Furthermore, a method for preparing a polypeptide that catalyzes the cyclization of lignans, comprising the following steps: introducing the above coding gene into a recipient cell, and performing the expression and extraction of the polypeptide, thereby obtaining the polypeptide.

[0017] Furthermore, the application of the above polypeptide that catalyzes the cyclization of lignans, using the polypeptide Sch CYP719G1b to catalyze the cyclization of dibenzylbutane-type lignans.

[0018] Furthermore, the polypeptide Sch CYP719G1b catalyzes the C-C coupling in dibenzocyclooctene-type lignans.

[0019] Furthermore, the polypeptide Sch CYP719G1b catalyzes the conversion of pregomisin to gomisin J.

[0020] The beneficial effects of the present invention are: The present invention provides a polypeptide Sch CYP719G1b belonging to the CYP450 family and its coding gene, the polypeptide SchCYP719G1b can participate in the formation of the eight-membered ring skeleton of the dibenzylbutane lignans in Schisandra chinensis, and can catalyze the phenyl ring C-C coupling of the dibenzylbutane lignan pregomisin to form the dibenzocyclooctadiene lignan gomisin J. Polypeptide Sch CYP719G1b can convert dibenzylbutane lignans into dibenzocyclooctadiene lignans, which can be used for the skeletal biosynthesis of dibenzocyclooctadiene lignans, laying a foundation for the synthetic biology research of various dibenzocyclooctadiene lignans in Schisandra chinensis and having great application value. Using the polypeptide in the present invention Sch The compound obtained by CYP719G1b is an active ingredient in medicine, or the obtained compound can be used as an intermediate for subsequent synthesis reactions to obtain the active ingredient in medicine. Polypeptide Sch CYP719G1b has a positive application prospect in the pharmaceutical industry. Description of the Drawings

[0021] Figure 1 For expressing the polypeptide Sch Recombinant vector map of CYP719G1b;

[0022] Figure 2 For the polypeptide Sch LC-MS map of the enzymatic catalytic reaction of CYP719G1b using pregomisin as a substrate;

[0023] Figure 3 For the polypeptide Sch Reaction process of CYP719G1b catalyzing the conversion of pregomisin to gomisin J;

[0024] Figure 4 For the polypeptide Sch Relative activity of CYP719G1b mutants compared to the wild type. Detailed Description of the Invention

[0025] The following is a detailed description of the specific embodiments of the present invention in combination with the examples.

[0026] Example 1

[0027] Screening of Schisandra chinensis CYP450 genes based on transcriptome, the steps are as follows:

[0028] (1) Detect the content differences of dibenzylbutane lignans in Schisandra chinensis fruits, mature stems, old leaves and roots by UPLC.

[0029] (2) Based on the Schisandra chinensis genome, identify the members of the Schisandra chinensis CYP450 gene family, and use the HMM model of the CYP450 gene family to preliminarily screen the key enzyme protein sequences of CYP450 in Schisandra chinensis.

[0030] (3)Based on the transcriptome data of different tissue parts of Schisandra chinensis, analyze the differential gene expression. Conduct a correlation analysis on the metabolome and transcriptome, and screen the genes with a high correlation coefficient with gomisin J as candidate genes by calculating the Pearson correlation coefficient to obtain the expressed polypeptides Sch The gene of CYP719G1b; polypeptide Sch The amino acid sequence of CYP719G1b is shown in SEQ ID No.1, encoding polypeptide Sch The gene sequence of CYP719G1b is shown in SEQ ID No.2.

[0031] Example 2

[0032] Expressed polypeptide Sch Cloning of the gene of CYP719G1b

[0033] 1. Extract total RNA of Schisandra chinensis by CTAB-PVP method

[0034] (1)Take fresh Schisandra chinensis plant materials (leaves or fruits) and quickly grind them into powder in liquid nitrogen.

[0035] (2)Estimate and put 100 mg of powder into a pre-cooled 2 mL centrifuge tube, add 800 μL of CTAB-PVP extraction buffer preheated at 65 °C, and place it on a vortex oscillator to shake for 30 s to fully lyse it;

[0036] The CTAB-PVP extraction buffer contains 100 mM Tris·HCl (pH 8.0), 2% CTAB (w / v), 2% PVP (polyvinylpyrrolidone, w / v), 25 mM EDTA, 2 M NaCl. After autoclaving, add 2-mercaptoethanol with a final concentration of 0.2% (v / v); the solution is prepared with double-distilled water (ddH2O) treated with DEPC and autoclaved.

[0037] (3)Water bath at 65 °C for 30 min, and invert and mix once every 10 min.

[0038] (4)After cooling to room temperature, add 800 μL of chloroform, invert and mix, and then centrifuge at 13,000 rpm for 10 min at 4 °C.

[0039] (5)Take the supernatant obtained by centrifugation into a new 2 mL centrifuge tube, add 800 μL of chloroform, shake and mix evenly, and then centrifuge at 13,000 rpm for 10 min at 4 °C.

[0040] (6)Repeat step (5) once.

[0041] (7) Carefully aspirate the supernatant obtained by centrifugation into a new 1.5 mL centrifuge tube, add an 8 M LiCl solution that is 1 / 3 of the volume of the supernatant, and let it stand overnight at -20 °C.

[0042] (8) Centrifuge at 13,000 rpm for 10 min at 4 °C, and discard the supernatant.

[0043] (9) Add 700 μL of 75% (v / v) ethanol (prepared with DEPC water) to wash the precipitate, and then centrifuge at 13,000 rpm for 10 min at 4 °C; repeat washing the precipitate 3 times, and after the third centrifugation, discard the supernatant and evaporate the remaining ethanol to dryness.

[0044] (10) Add 30 μL of sterilized water treated with Proteinase K to dissolve the RNA, and prepare total RNA. Use a nucleic acid and protein analyzer of the BioPhotometer plus model to measure the concentration and quality of the extracted RNA.

[0045] 2. Encoding polypeptide Sch Full-length amplification of the gene encoding CYP719G1b

[0046] (1) Primer design

[0047] Use the software SnapGene to design full-length primers SchCYP719G1b-F / R on both sides of the open reading frame (ORF) of the gene encoding polypeptide CYP719G1b, and amplify the gene; Sch The sequence of SchCYP719G1b-F is:

[0048] CTATAGGGCCCGGGATGGAGGGCCAATGGGTTGT (SEQ ID No.3);

[0049] SchCYP719G1b-R's sequence is:

[0050] CTAGACTTCAGGTTGTCTAACTCCTTCCTTTTCGG (SEQ ID No.4).

[0051] (2) cDNA synthesis

[0052] Using the total RNA of Schisandra chinensis obtained in the above steps as a template, obtain a cDNA template strand through PCR technology with the PrimerScript RT Master Mix reverse transcription system. The reverse transcription system is shown in Table 1, and the reverse transcription program is: 37 °C, 15 min; 85 °C, 15 s. The reverse transcription product is stored at -20 °C and diluted before use.

[0053]

[0054] Table 1 Reverse Transcription PCR System

[0055]

[0056] (3) Amplification of target gene

[0057] Dilute the Schisandra chinensis cDNA obtained in the above steps and use it as a template, and amplify with SchCYP719G1b-F / R as primers. The amplification system is shown in Table 2 and the amplification program is shown in Table 3; Detect the PCR reaction product by agarose gel electrophoresis and cut and recover the band of the target size, and the expressed polypeptide can be obtained. Sch The gene sequence of CYP719G1b.

[0058] Table 2 Target Gene Amplification System

[0059]

[0060] Table 3 Target Gene Amplification Program

[0061]

[0062] Example 3

[0063] Polypeptide Sch Construction of Expression Vector of CYP719G1b

[0064] 1. Amplify the expressed polypeptide with homologous arms Sch The gene fragment of CYP719G1b

[0065] Use primers with homologous arms SchCYP719G1b-pESC-His-F / R to amplify the gene fragment of the expressed polypeptide Sch CYP719G1b. The amplification system and program are shown in Tables 2 and 3 of Example 1. Detect the PCR reaction product by agarose gel electrophoresis and cut and recover the band of the target size, and the target fragment with homologous arms can be obtained;

[0066] The sequence of SchCYP719G1b-pESC-His-F is:

[0067] CCGTAATACGACTCACTATAGGGCCCGGGATGGAGGGCCAATGGGTTGT(SEQ ID No.5);

[0068] The sequence of SchCYP719G1b-pESC-His-R is:

[0069] TAAATAGGGACCTAGACTTCAGGTTGTCTAACTCCTTCCTTTTCGG(SEQ ID No.6).

[0070] 2. Construction of homologous recombination expression vector

[0071] (1)Double digestion of vector: The vector pESC-His was digested with Sal I and Xho I. The double digestion system is shown in Table 4. After the double digestion system reacted in a 37°C water bath for 30 min, the enzyme digestion products were added with 10× Loading buffer to terminate the reaction, and then subjected to agarose gel electrophoresis. The correct-sized band was selected for gel extraction to obtain the double-digested vector.

[0072] Table 4 Double digestion system

[0073]

[0074] (2)Homologous recombination, transformation and positive verification: The target fragment with homologous arms was ligated with the double-digested vector pESC-His using a homologous recombination kit (ClonExpress Ultra One Step Cloning Kit V2). The system is shown in Table 5.

[0075] Table 5 Homologous recombination ligation system

[0076]

[0077] After thoroughly mixing the above components, react at 37°C for 30 min and immediately place on ice for cooling. The ligation product was transformed into Escherichia coli DH5α competent cells. The specific steps are as follows: Take out the Escherichia coli DH5α competent cells stored at -80°C and thaw them on ice. Add all the ligation products, gently pipette and mix well, and place on ice for 30 min. Heat shock in a 42°C water bath for 45 s and then quickly place on ice for 2 min. Add 500 μL of antibiotic-free LB medium and incubate with shaking in a 37°C incubator for 1 h. Take 200 μL of the transformation solution and spread it on LB solid medium (containing 100 μg / mL ampicillin), and incubate statically in a 37°C incubator for 12 h - 16 h.

[0078] Pick monoclonal colonies for colony PCR to verify positive. A bright and single band of the target size amplified is a positive monoclonal colony. Send the positive clone for sequencing. The gene sequence encoding polypeptide Sch CYP719G1b is shown in SEQ ID No. 2. Take the monoclonal colonies with correct sequencing for storage and extract the SchCYP719G1b-pESC-His plasmid. The plasmid map is as Figure 1 shown, with a total of 8179 bp. In the figure, ori represents the origin of plasmid replication, Figure 1It contains ori, 2µ ori and f1 ori; HIS3 represents the histidine synthesis gene; SchCYP719G1b is the inserted polypeptide-encoding Sch gene sequence of CYP719G1b; AmpR is the ampicillin resistance gene; promoter represents the promoter, Figure 1 It contains HIS3 promoter, GAL,10 promoter, AmpR promoter; terminator represents the terminator, and there is ADH1 terminator in the figure; MCS is the multiple cloning site, Figure 1 It contains MCS1 and MCS2.

[0079] (3)Yeast transformation and positive verification

[0080] Transform the constructed SchCYP719G1b-pESC-His plasmid into the competent cells of Saccharomyces cerevisiae WAT11. The transformation method is as follows:

[0081] ① Place the Carrier DNA in a 95°C water bath or metal bath for 3 min, then quickly insert it into an ice bath and let it stand for 3 min. Then place it in a 95°C water bath or metal bath again for 3 min, and quickly insert it into an ice bath and let it stand for more than 3 min.

[0082] ② Take 100 µL of WAT11 competent cells melted on ice, and successively add about 2 µg of the pre-cooled recombinant plasmid, 10 µL of Carrier DNA, and 500 µL of PEG / LiAc, and pipette several times to mix evenly. Incubate in a 30°C water bath for 30 min (invert 8 times to mix evenly at 15 min).

[0083] ③ Then place it in a 42°C water bath for 15 min (invert 8 times to mix evenly at 7.5 min).

[0084] ④ Centrifuge at 5000 rpm for 40 s to discard the supernatant, resuspend the cells with 400 µL of ddH2O, and centrifuge at 5000 rpm for 30 s to discard the supernatant.

[0085] ⑤ Resuspend the cells with 50 µL of ddH2O, spread on plates, and culture at 29°C for about 96 h.

[0086] ⑥ Pick monoclonal colonies on the plate and perform positive verification by the alkaline lysis method to obtain the SchCYP719G1b-pESC-His-WAT11 positive clone.

[0087] Example 4

[0088] Polypeptide Sch Expression and enzyme activity function analysis of CYP719G1b

[0089] 1. Polypeptide SchExpression of CYP719G1b

[0090] (1)Pick a positive clone of strain SchCYP719G1b-pESC-His-WAT11 and inoculate it into 50 mL of His-deficient medium (prepared according to the dosage of adding 8 g of His minus media to 1 L of H2O, autoclaved at high temperature and high pressure), and culture it in a shaker at 29 °C and 220 rpm for 2 days.

[0091] (2)Centrifuge the cultured bacterial solution to collect the bacterial cells, resuspend the cell pellet in 400 mL of YPL medium containing 2% (v / v) galactose, and culture it in a shaker at 29 °C and 220 rpm for 16 h to induce the expression of the target protein; the formula of YPL medium (1 L) is: 10 g of peptone and 10 g of yeast extraction, dissolve in water and make up to 1 L, autoclaved at high temperature and high pressure.

[0092] (3)Harvest the bacteria: Centrifuge the bacterial solution at 5,000 rpm for 5 min and discard the supernatant.

[0093] (4)Wash: Add 40 mL of TEK washing solution to the centrifuge tube to resuspend the cell pellet, incubate on ice for 5 min, centrifuge at 4,000×g for 10 min at 4 °C to collect the bacterial cells, and resuspend the cell pellet in 200 mL of TESB solution, incubate on ice for 10 min; TEK washing solution (350 mL): Dissolve 2.60925 g of KCl in TE solution and make up to 350 mL with TE solution, mix well; TESB solution (1 L): Dissolve 109.3 g of sorbitol in TE solution and make up to 1 L with TE solution, mix well; TE solution (1 L) contains 50 mL of 1 M Tris-HCl solution and 3.2 mL of 0.5 M EDTA solution, make up to 1 L with ddH2O, mix well.

[0094] (5)Lyse: Disrupt the bacterial solution with a homogenizer for 6 min, centrifuge at 12,000×g for 15 min at 4 °C to collect the supernatant.

[0095] (6)Precipitate: Add 40 g of PEG4,000 and 3.52 g of NaCl to the supernatant, shake to dissolve completely.

[0096] (7)Incubate on ice for 15 min, centrifuge at 12,000×g for 15 min at 4 °C, and discard the supernatant.

[0097] (8)Resuspend the precipitate in 6 mL of TEG solution to obtain the extracted microsomal protein; TEG solution (50 mL) contains 40 mL of TE solution and 10 mL of glycerol, mix well; the extracted microsomal protein contains polypeptides SchThe total protein of CYP719G1b. Currently, the common method for CYP450 verification is to extract yeast microsomal proteins for verification.

[0098] 2. Polypeptide Sch Verification of the enzymatic activity function of CYP719G1b

[0099] Polypeptide Sch Perform in vitro enzymatic activity function identification on CYP719G1b, set a control group. The microsomal protein in the control group is the microsomal protein extracted from the empty vector through the same steps above. The substrate is pre-gomisin, and the enzymatic activity reaction system is shown in Table 6.

[0100] Table 6 Enzymatic activity reaction system (250 μL)

[0101]

[0102] Note: The amounts of nicotinamide adenine dinucleotide phosphate (NADPH), flavin adenine dinucleotide (FAD), flavin mononucleotide (FMN), glucose-6-phosphate, and substrate represent the final concentrations in the enzymatic activity reaction system. The amount of microsomal protein of 200 μL means: Take 200 μL from the protein solution resuspended with TEG solution through the above steps for function verification.

[0103] Mix the above components, place them at 29 °C and react overnight, then add 200 μL of ethyl acetate to extract the reaction solution. After centrifuging at 12,000 rpm for 5 min, take the supernatant, repeat the extraction once, evaporate the organic solvent and redissolve it with chromatographic methanol, and perform enzymatic activity reaction analysis using LC-MS.

[0104] The results are as Figure 2 shown. Compared with the blank control, the polypeptide Sch CYP719G1b can catalyze the benzene ring C-C coupling of the dibenzylbutane-type lignan pre-gomisin to form the dibenzocyclooctene-type lignan gomisin J. The product was confirmed by comparison with the standard product, and the reaction process is as Figure 3 shown.

[0105] Example 5

[0106] Design site-directed mutations for the nucleotide sequence (SEQ ID No.2) encoding the polypeptide Sch CYP719G1b, and use the methods of Examples 2 to 4 for expression extraction and verification of enzymatic activity function for the mutated sequence. The results of enzymatic activity function detection are as Figure 4 shown, showing that after mutation, two mutants with increased activity, R218K and E468D, were obtained, and the activities of the other mutants remained unchanged or decreased.

[0107] Figure 4 In it, WT represents the wild type, that is, the polypeptide Sch CYP719G1b;

[0108] I359A represents a polypeptide Sch The isoleucine at position 359 of CYP719G1b is mutated to alanine;

[0109] Y49A represents a polypeptide Sch The tyrosine at position 49 of CYP719G1b is mutated to alanine;

[0110] R218A represents a polypeptide Sch The arginine at position 218 of CYP719G1b is mutated to alanine;

[0111] I222A represents a polypeptide Sch The isoleucine at position 222 of CYP719G1b is mutated to alanine;

[0112] K476A represents a polypeptide Sch The lysine at position 476 of CYP719G1b is mutated to alanine;

[0113] R218K represents a polypeptide Sch The arginine at position 218 of CYP719G1b is mutated to lysine;

[0114] E468D represents a polypeptide Sch The glutamate at position 468 of CYP719G1b is mutated to aspartic acid;

[0115] D224E represents a polypeptide Sch The aspartic acid at position 224 of CYP719G1b is mutated to glutamate;

[0116] F469Y represents a polypeptide Sch The phenylalanine at position 469 of CYP719G1b is mutated to tyrosine;

[0117] R242S represents a polypeptide Sch The arginine at position 242 of CYP719G1b is mutated to serine;

[0118] T109L represents a polypeptide Sch The threonine at position 109 of CYP719G1b is mutated to leucine;

[0119] D224S represents a polypeptide Sch The aspartic acid at position 224 of CYP719G1b is mutated to serine.

[0120] Polypeptide Sch The amino acid sequence of CYP719G1b:

[0121] MEGQWVVAAVLLLIGLILLRLWSKPEEKVAKWPPGPPKLPILGNFHQLYNGGNLLHHTIGKLVQEYGPIMTIWLGGWKPTIVVSDYELVREVLVTKAAEFGARNFPFSTRYLSADLKTVASADYGPYWHTLRKGLQNSSLNPVNISAQLRMLESEFGVIIDTLASEALKNGGVVSPLEHMKLASIRLASRLCFGPKFNDEEFVQQLYALIQIIVRQTRESGISDLVPFTRHIPILGRFFHQRLHAMKLVGDLIRPYLHLSEPSTFLYFLKSQNLPEDILVANVFELFLLSADSSANSTMWGLGYLIHNQGIQQKLYDEIKSICGEGRVKVTAQDLNKMEYIHVVAKETLRMKPIAPLGIPRKATEDNTLMGYKIHKGTAIVLNLYQVLYDGKVWEEPERFMPERFLAGYGDEDRVMAMEKSFVSFGGGRRICPGIDLAKLMIPLALANLVGAYHWYGVDEESPDMTEEFVFGLMMKTPFSARIMPRKSG(SEQ ID No.1);

[0122] Polypeptide-encoding Sch The gene sequence of CYP719G1b:

[0123]

[0124] Although the specific embodiments of the present invention have been described in detail in combination with the embodiments, it should not be construed as a limitation on the protection scope of this patent. Within the scope described in the claims, various modifications and deformations that can be made by those skilled in the art without creative efforts still fall within the protection scope of this patent.

Claims

1. A polypeptide for catalyzing the cyclization of lignans, characterized in that, The amino acid sequence of the polypeptide catalyzing the cyclization of lignan is selected from: (1) The amino acid sequence shown in SEQ ID No.1; (2) Mutants of the amino acid sequence shown in SEQ ID No.1; the mutant is the sequence in which isoleucine at position 359 of the amino acid sequence shown in SEQ ID No.1 is mutated to alanine; The sequence in which tyrosine at position 49 of the amino acid sequence shown in SEQ ID No.1 is mutated to alanine; The sequence in which arginine at position 218 of the amino acid sequence shown in SEQ ID No.1 is mutated to alanine; The sequence in which isoleucine at position 222 of the amino acid sequence shown in SEQ ID No.1 is mutated to alanine; The sequence in which lysine at position 476 of the amino acid sequence shown in SEQ ID No.1 is mutated to alanine; The sequence in which arginine at position 218 of the amino acid sequence shown in SEQ ID No.1 is mutated to lysine; The sequence in which glutamate at position 468 of the amino acid sequence shown in SEQ ID No.1 is mutated to aspartic acid; The sequence in which aspartic acid at position 224 of the amino acid sequence shown in SEQ ID No.1 is mutated to glutamic acid; The sequence in which phenylalanine at position 469 of the amino acid sequence shown in SEQ ID No.1 is mutated to tyrosine; The sequence in which arginine at position 242 of the amino acid sequence shown in SEQ ID No.1 is mutated to serine; The sequence in which threonine at position 109 of the amino acid sequence shown in SEQ ID No.1 is mutated to leucine; Or the sequence in which aspartic acid at position 224 of the amino acid sequence shown in SEQ ID No.1 is mutated to serine.

2. The coding gene of the polypeptide catalyzing the cyclization of lignan according to claim 1.

3. The coding gene of the polypeptide for catalyzing the cyclization of lignans, characterized in that: The coding gene is the nucleotide sequence shown in SEQ ID NO.

2.

4. An expression vector containing the coding gene according to claim 2.

5. A recombinant microorganism containing the coding gene according to claim 2.

6. A transgenic cell line containing the coding gene according to claim 2.

7. The preparation method of the polypeptide for catalyzing the cyclization of lignans according to claim 1, characterized in that, Comprising the following steps: introducing the coding gene according to claim 2 into a recipient cell, expressing and extracting the polypeptide, thus obtaining.

8. Use of the polypeptide for catalyzing the cyclization of lignans, characterized in that: Using the polypeptide to catalyze the cyclization of dibenzylbutane-type lignan.

9. The application according to claim 8, wherein: The polypeptide catalyzes the conversion of pre-gomisin to gomisin J.