Preparation method of FGF-19 overexpressed mesenchymal stem cells without immunogenicity

Abstract

The invention aims to provide a preparation method of non-immunogenicity FGF-19 overexpressed mesenchymal stem cells. According to the preparation method, polyclonal cells are knocked in through MSC (mesenchymal stem cells) at fixed points. The method comprises the following steps: knocking a mesenchymal stem cell into a polyclone cell at a fixed point, knocking out a B2M gene, and inserting a DonorDNA target sequence including a homologous arm, a promoter and an FGF coding sequence at the same time, so as to obtain the polyclone cell knocked into a target segment at a fixed point after the B2M gene is damaged.

Description

Technical Field

[0001] The present invention relates to the field of biological genetic technology, and in particular to a method for preparing non-immunogenic mesenchymal stem cells that overexpress FGF-19. Background Art

[0002] CRISPR / Cas9 originates from an immune regulatory system found in bacteria and archaea that defends against viruses and foreign DNA. The pairing of crRNA (CRISPR-derived RNA) and tracrRNA (trans-activating RNA) forms a complex that specifically recognizes genomic sequences, guiding the Cas9 endonuclease to cleave the target fragment. Two-in-one optimization of these two RNAs yields sgRNA (single-guide RNA), which can also guide Cas9 for targeted cleavage. Leveraging its specific targeting capabilities, precise gene editing, including gene knockout, knockin, and point mutations, is possible. This system has been widely used for gene editing in a variety of organisms, including zebrafish, mice, rats, Caenorhabditis elegans, plants, and bacteria.

[0003] The CRISPR-Cas9 system edits and cuts to produce double-strand breaks (DSBs) in DNA, which can induce the natural repair mechanism of DNA. If a homologous exogenous DNA is introduced into the cell as a repair template (DonorDNA) at the same time, and the DonorDNA sequence carries the target mutation, then the cell can obtain the target mutation through the homologous recombination (HDR) repair mechanism, thereby achieving stable and precise gene editing. The specific principle is as follows Figure 1 shown.

[0004] Mesenchymal stem cells (MSCs) are a type of multipotent stem cell, a multipotent cell with the ability to self-replicate. Under certain conditions, they can differentiate into a variety of functional cells, such as APSCs.

[0005] MSCs originate from the mesoderm during embryonic development. During normal tissue repair, they are a crucial cell reservoir involved in tissue regeneration. In response to specific signals induced by tissue damage, MSCs migrate to the damaged area, where they aggregate and proliferate, and differentiate along distinct pathways depending on the damage signal. MSCs are easy to isolate and proliferate, exhibiting a robust in vitro multiplication capacity and maintaining their multidirectional differentiation potential even after 100 million-fold expansion. Therefore, MSCs are a practical seed cell for tissue repair.

[0006] FGF-19 is a member of the fibroblast growth factor (FGF) family. FGF family members have a wide range of mitogenic and cell survival activities and are involved in multiple biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. Summary of the Invention

[0007] The present invention aims to provide a method for preparing non-immunogenic mesenchymal stem cells that overexpress FGF-19. The method uses MSCs to generate polyclonal cells. The B2M gene is knocked out, and a target sequence (homologous arm + promoter + FGF coding sequence + homology arm) is simultaneously inserted to obtain polyclonal cells in which the target fragment is knocked in after the B2M gene is disrupted.

[0008] To achieve the above object, the present invention adopts the following technical solutions:

[0009] A method for preparing non-immunogenic mesenchymal stem cells that overexpress FGF-19, characterized in that the method comprises the following steps: knocking out the B2M gene through site-directed knock-in of mesenchymal stem cells, and simultaneously inserting a DonorDNA target sequence, including homology arms, a promoter and an FGF coding sequence, to obtain polyclonal cells in which the target fragment is site-directedly knocked in after the B2M gene is destroyed.

[0010] A method for preparing non-immunogenic mesenchymal stem cells that overexpress FGF-19, the method comprising the following steps:

[0011] Step 1. Preliminary experiment on living cells:

[0012] The cells were subjected to puro drug concentration screening and electroporation pre-experiments to confirm the drug resistance screening conditions and electroporation conditions and efficiency of the cells;

[0013] Step 2: Target detection:

[0014] MSC cells were collected to extract genomic DNA and amplify the B2M gene target site. The amplified product was sent for sequencing, and the sequencing results were compared with the reference sequence in the NCBI database to confirm whether the target site was correct.

[0015] Step 3: sgRNA plasmid design and construction and Donor DNA synthesis:

[0016] Select the target site, design sgRNA, construct sgRNA-Cas9 plasmid, and synthesize DonorDNA based on the sgRNA sequence;

[0017] Step 4: Cell transfection and screening experiments:

[0018] Each sgRNA-Cas9 and DonorDNA were co-transfected into MSC cells. After 72 hours, puro was added for positive screening. The surviving cells were screened and expanded for culture. Genomic DNA was extracted from some cells and verified by PCR sequencing to detect whether there were edited cells with site-specific integration.

[0019] Step 5: Preservation of polyclonal cells:

[0020] The polyclonal edited cells that have been detected to have site-specific integration will be further expanded and cultured and delivered to cell culture flasks. After receiving the cells, they will be immediately passaged and cryopreserved for seed preservation.

[0021] The DonorDNA target sequence is as follows:

[0022]

[0023] TTGTCACCGGACTGGAGGCCGTGAGGAGTCCCAGCTTTGAGAAGgagggcagaggaagtctgctaacatgcggtgacgtcgaggagaatcctggcccaaccatgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccccagggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagcaacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctgaTTAAGCTTG

[0024] GTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGGCCCGTTTAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACC CTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGG(SEQ ID NO.1).

[0025] The following steps are also included:

[0026] Live cell pre-experiment:

[0027] ① Confirmation of puro drug screening concentration: The lowest drug concentration that can kill all wild-type cells within 5 days is 0.3ug / ml puro;

[0028] ② Results of electroporation pre-experiment:

[0029] MSC cells were electroporated using a LONZA4DXunit electroporator using SE electroporation solution and FF104 protocol.

[0030] The 5K GFP plasmid PmaxGFP was tested by electroporation. The 5K GFP plasmid can be effectively expressed, and the electroporation efficiency reaches 90%.

[0031] The following steps are also included:

[0032] sgRNA design and target detection:

[0033] Based on the B2M gene sequence, software prediction and evaluation were performed to identify three sgRNAs with higher scores. Primers were designed for the locations of these three sgRNA sequences to perform target site amplification and sequencing to confirm whether the target sites had mutations.

[0034] ①sgRNA+PAM sequence is as follows (5'-3')

[0035] B2M-sgRNA1:ACTCTCTCTTTCTGGCCTGGAGG(SEQ ID NO.2);

[0036] B2M-sgRNA2: ACAAAGTCACATGGTTCACACGG (SEQ ID NO.3);

[0037] B2M-sgRNA3:TGGGCTGTGACAAAGTCACATGG (SEQ ID NO.4);

[0038] ② The target PCR and sequencing primer sequences are as follows (5'-3'):

[0039] B2M-SG1-PF1:ATATAAGTGGAGGCGTCGCG (SEQ ID NO.5);

[0040] B2M-SG1-PR1:GACGCTTATCGACGCCCTAA (SEQ ID NO.6);

[0041] B2M-SG2 / 3-PF1:ACTCACGTCATCCAGCAGAG(SEQ ID NO.7);

[0042] B2M-SG2 / 3-PR1:TGCTCAACTGCAGGGAAACT(SEQ ID NO.8);

[0043] The sgRNA target site has no mutation, and sgRNA plasmid construction can be performed.

[0044] The following steps are also included:

[0045] Construction of MC-CRISPR plasmid and MC-donor plasmid:

[0046] After induction, the MC-CRISPR mother plasmid can produce a 5.7k sgRNA-Cas9 expression plasmid; after induction, the MC-donor mother plasmid can produce a 2.5k donor expression plasmid.

[0047] The following steps are also included:

[0048] Transfection experiments:

[0049] MSC cells were co-transfected with sgRNA-Cas9 plasmid and DonorDNA respectively. After 72 hours, some cells were taken to extract genomic DNA, the target sites were amplified, recovered and sent for sequencing to confirm the presence of edited polyclonal cells.

[0050] The following steps are also included:

[0051] Polyclonal drug screening and identification:

[0052] The polyclonal cells transfected with MC-sg3-Cas9+MC-sg3-donor plasmid were screened using puro at a final concentration of 0.3ug / ml. After 7 days of screening, the number of surviving cells was low, so the drug was withdrawn and the culture was resumed.

[0053] After the cell status and cell number reach normal, a portion of the cells is taken to extract genomic DNA and perform breakpoint PCR to detect whether there are cells with the donor inserted at the designated site;

[0054] The breakpoint PCR primer sequences are as follows (5'-3'):

[0055] B2M-CMV-F1:TTCATCCATCCGACATTGAA (SEQ ID NO.9);

[0056] B2M-CMV-R1: GGCGGAGTTGTTACGACATT (SEQ ID NO. 10);

[0057] B2M-BGH-F1:GGGAGGATTGGGAAGACAAT (SEQ ID NO. 11);

[0058] B2M-BGH-R1: AGAGCTACCCAGCAGGAACA (SEQ ID NO. 12).

[0059] Compared with the prior art, the present invention has the following beneficial effects:

[0060] The present invention provides a method for preparing non-immunogenic mesenchymal stem cells that overexpress FGF-19. This method involves constructing an expression vector carrying the FGF-19 gene and transfecting it into mesenchymal stem cells to achieve FGF-19 overexpression. This technology can enhance the therapeutic effects of mesenchymal stem cells, for example, in the treatment of liver diseases by promoting hepatocyte regeneration and functional recovery, thereby improving therapeutic efficacy.

[0061] At the same time, it reduces the immunogenicity of mesenchymal stem cells and reduces the immune rejection reaction after transplantation. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] Figure 1 This is a schematic diagram of the gene editing principle of the CRISPR-Cas9 system in the background technology.

[0063] Figure 2 This is a diagram of MSC cells electroporated with PmaxGFP plasmid 48H (SE, FF104) of the present invention.

[0064] Figure 3 This is a diagram of MSC cells electroporated with the psi-lv-U6GFP plasmid 48H (SE, FF104) of the present invention.

[0065] Figure 4 This is a diagram of MSC cells electroporated with lenti-Cas9-GFP plasmid 48H (SE, FF104) of the present invention.

[0066] Figure 5 Schematic diagram of the target sequencing results of the present invention.

[0067] Figure 6 The MC-CRISPR mother plasmid map of the present invention is as follows, and a schematic diagram of an sgRNA-Cas9 expression plasmid with a size of about 5.7k can be obtained after induction.

[0068] Figure 7 The MC-donor parent plasmid map of the present invention is as follows, and a schematic diagram of a donor expression plasmid of about 2.5k in size can be obtained after induction.

[0069] Figure 8 This is a schematic diagram of the present invention in which sgRNA-Cas9 plasmid and DonorDNA are co-transfected into MSC cells. After 72 hours, some cells are taken to extract genomic DNA, the target site is amplified, recovered and sent for sequencing, and the edited polyclonal cells are confirmed.

[0070] Figure 9 This is a schematic diagram of the breakpoint PCR principle of the present invention.

[0071] Figure 10 This is a diagram of the breakpoint PCR electrophoresis detection results of the present invention.

[0072] Figure 11 This is one of the gene positioning schematic diagrams of the present invention.

[0073] Figure 12 This is the second schematic diagram of gene positioning of the present invention. DETAILED DESCRIPTION

[0074] The technical solution of the present invention will be clearly and completely described below in conjunction with the accompanying drawings of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0075] like Figures 2 to 12 ,

[0076] A method for preparing non-immunogenic mesenchymal stem cells that overexpress FGF-19, characterized in that the method comprises the following steps: knocking out the B2M gene through site-directed knock-in of mesenchymal stem cells, and simultaneously inserting a DonorDNA target sequence, including homology arms, a promoter and an FGF coding sequence, to obtain polyclonal cells in which the target fragment is site-directedly knocked in after the B2M gene is destroyed.

[0077] The sequence of the DonorDNA fragment is as follows:

[0078]

[0079] TTGTCACCGGACTGGAGGCCGTGAGGAGTCCCAGCTTTGAGAAGgagggcagaggaagtctgctaacatgcggtgacgtcgaggagaatcctggcccaaccatgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccccagggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagcaacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctgaTTAAGCTTG

[0080] GTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGGCCCGTTTAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACC CTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGG(SEQ ID NO.1)

[0081] 1. Experimental materials:

[0082] 1. Cell Line

[0083] MSC primary cells: provided by Thermo Fisher Scientific China.

[0084] 2. Main reagents:

[0085] ①FBS (gibco);

[0086] ②MEM-ALPHA (VivaCell);

[0087] ③0.25% Trypsin-EDTA (gibco);

[0088] ④SECellLine4D-Nucleofector TM XKit (LONZA);

[0089] ⑤PenStre dual antibody (gibco);

[0090] ⑥2xGreenTaqMix (Vazyme);

[0091] ⑦TIANampGenomicDNAKit(TIANGEN);

[0092] 3. Instrument consumables:

[0093] ① Biological safety cabinet: Thermo

[0094] ② Carbon dioxide incubator: Thermo

[0095] ③Fluorescence microscope: Nikon

[0096] ④Low temperature refrigerator: Haier

[0097] ⑤-80℃ Refrigerator: Thermo

[0098] ⑥Cell culture dish: Costar

[0099] ⑦Low temperature high speed centrifuge: Thermo

[0100] ⑧PCR instrument: Thermo

[0101] 2. Preparation process:

[0102] 1. Preliminary experiments on living cells:

[0103] The cells were subjected to puro drug concentration screening and electroporation pre-experiments to confirm the cell resistance screening conditions and electroporation conditions and efficiency.

[0104] 2. Target detection:

[0105] MSC cells were collected to extract genomic DNA and amplify the B2M gene target site. The amplified products were sent for sequencing, and the sequencing results were compared with the reference sequences in the NCBI database to confirm whether the target site was correct.

[0106] 3. sgRNA plasmid design and construction and Donor DNA synthesis:

[0107] Select the target site, design sgRNA to construct sgRNA-Cas9 plasmid, and design and synthesize DonorDNA based on the sgRNA sequence.

[0108] Note: The CRIPSR plasmid and donor plasmid used in this step are both Minicricle plasmids, so the preparation of MC plasmid is required.

[0109] 4. Cell transfection and screening experiments:

[0110] Each sgRNA-Cas9 was co-transfected with DonorDNA into MSC cells. After 72 hours, puro was added for positive screening. The surviving cells were screened for expansion culture. Some cells were collected to extract genomic DNA and perform PCR sequencing verification to detect whether there were edited cells with site-specific integration.

[0111] 5. Polyclonal cell preservation:

[0112] The polyclonal edited cells that have been detected to have site-specific integration will be further expanded and cultured and delivered to cell culture flasks. After receiving the cells, they will be immediately passaged and cryopreserved for seed preservation.

[0113] 3. Test results:

[0114] 1. Preliminary experiments on living cells:

[0115] ① Confirmation of puro drug screening concentration: The lowest drug concentration that can kill all wild-type cells within 5 days is 0.3ug / ml puro.

[0116] ② Results of electroporation pre-experiment:

[0117] MSC cells were electroporated using LONZA4DXunit electroporator, using SE electroporation solution and FF104 program.

[0118] Electroporation was performed on a GFP plasmid of approximately 5kb (PmaxGFP), a GFP plasmid of approximately 8kb (psi-lv-U6GFP), and a GFP plasmid of approximately 13kb (lenti-Cas9-GFP). Fluorescence expression was observed 48 hours later. Only the GFP plasmid of approximately 5kb showed effective expression, with an electroporation efficiency of up to 90%.

[0119] Conclusion: If Figures 2 to 4 , the size of CRISPR plasmid and donor plasmid should be kept within 5k as much as possible to achieve better transfection efficiency.

[0120] 2. sgRNA design and target detection:

[0121] Based on the B2M gene sequence, software prediction and evaluation identified three high-scoring sgRNAs. Primers were designed for the locations of these three sgRNA sequences and target site amplification and sequencing were performed to confirm whether the target site had mutations.

[0122] ①sgRNA+PAM sequence is as follows (5'-3')

[0123] B2M-sgRNA1:ACTCTCTCTTTCTGGCCTGGAGG(SEQ ID NO.2);

[0124] B2M-sgRNA2: ACAAAGTCACATGGTTCACACGG (SEQ ID NO.3);

[0125] B2M-sgRNA3:TGGGCTGTGACAAAGTCACATGG (SEQ ID NO.4);

[0126] ② The target PCR and sequencing primer sequences are as follows (5'-3'):

[0127] B2M-SG1-PF1:ATATAAGTGGAGGCGTCGCG (SEQ ID NO.5);

[0128] B2M-SG1-PR1:GACGCTTATCGACGCCCTAA (SEQ ID NO.6);

[0129] B2M-SG2 / 3-PF1:ACTCACGTCATCCAGCAGAG(SEQ ID NO.7);

[0130] B2M-SG2 / 3-PR1:TGCTCAACTGCAGGGAAACT(SEQ ID NO.8);

[0131] Conclusion: There is no mutation in the sgRNA target site, and sgRNA plasmid construction can be performed.

[0132] 3. Construction of MC-CRISPR plasmid and MC-donor plasmid:

[0133] MC-CRISPR maternal plasmid map Figure 6 After induction, a sgRNA-Cas9 expression plasmid with a size of about 5.7k can be obtained. The MC-donor mother plasmid map is as follows Figure 7 After induction, a donor expression plasmid with a size of about 2.5k can be obtained.

[0134] 4. Transfection Experiment:

[0135] MSC cells were co-transfected with sgRNA-Cas9 plasmid and DonorDNA respectively. After 72 hours, genomic DNA was extracted from some cells, the target sites were amplified, and the recovered DNA was sent for sequencing to confirm the presence of edited polyclonal cells. Figure 8 .

[0136] Conclusion: Only sgRNA2 and sgRNA3 have weak editing peaks at the target sites, among which sgRNA3 has a slightly better effect.

[0137] 5. Polyclonal drug screening and identification:

[0138] Polyclonal cells transfected with the MC-sg3-Cas9 and MC-sg3-donor plasmids were screened using puromycin at a final concentration of 0.3 μg / ml. After seven days of screening, the number of surviving cells was low, so the drug was removed and culture resumed. Once the cell status and cell number returned to normal, genomic DNA was extracted from a subset of cells and analyzed by breakpoint PCR to detect the presence of cells with the targeted donor insertion.

[0139] ① Breakpoint PCR principle diagram as shown Figure 9 .

[0140] The breakpoint PCR primer sequences are as follows (5'-3'):

[0141] B2M-CMV-F1:TTCATCCATCCGACATTGAA (SEQ ID NO.9);

[0142] B2M-CMV-R1: GGCGGAGTTGTTACGACATT (SEQ ID NO. 10);

[0143] B2M-BGH-F1:GGGAGGATTGGGAAGACAAT (SEQ ID NO. 11);

[0144] B2M-BGH-R1: AGAGCTACCCAGCAGGAACA (SEQ ID NO. 12).

[0145] ② The results of breakpoint PCR electrophoresis test are as follows Figure 10 .

[0146] Conclusion: The breakpoint PCR showed the target band, indicating that DonorDNA was inserted at the designated site.

[0147] The above shows and describes the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The above embodiments and descriptions are merely preferred examples of the invention and are not intended to limit the present invention. Various changes and improvements may be made to the present invention without departing from the novel spirit and scope of the present invention. Such changes and improvements fall within the scope of the invention claimed. The scope of protection claimed in the present invention is defined by the appended claims and their equivalents.

Claims

1. A method for preparing non-immunogenic mesenchymal stem cells overexpressing FGF-19, characterized in that: The method comprises the following steps: knocking out the B2M gene through site-specific knock-in of polyclonal cells using mesenchymal stem cells, and inserting a DonorDNA target sequence, including homology arms, a promoter and an FGF coding sequence, to obtain polyclonal cells in which the target fragment is site-specifically knocked in after the B2M gene is destroyed.

2. A method for preparing non-immunogenic mesenchymal stem cells overexpressing FGF-19, characterized in that: The method comprises the following steps: Step 1: Preliminary experiment of living cells: The cells were subjected to puro drug concentration screening and electroporation pre-experiments to confirm the drug resistance screening conditions and electroporation conditions and efficiency of the cells; Step 2: Target detection: Collect MSC cells to extract genomic DNA and amplify the B2M gene target site. The amplified product is sent for sequencing. The sequencing results are compared with the reference sequence in the NCBI database to confirm whether the target site is correct; Step 3: sgRNA plasmid design and construction and DonorDNA synthesis: Select the target site, design sgRNA to construct sgRNA-Cas9 plasmid, and design and synthesize DonorDNA according to the sgRNA sequence; Step 4: Cell transfection and screening experiments: Each sgRNA-Cas9 and DonorDNA were co-transfected into MSC cells. After 72 hours, puro was added for positive screening. The surviving cells were screened for expansion culture. Some cells were collected to extract genomic DNA and perform PCR sequencing verification to detect whether there were edited cells with fixed-site integration. Step 5: Polyclonal cell preservation: The polyclonal edited cells that have been detected to have site-specific integration will be further expanded and cultured and delivered to cell culture flasks. After receiving the cells, they will be immediately passaged and cryopreserved for seed preservation.

3. The method for preparing a non-immunogenic mesenchymal stem cell overexpressing FGF-19 according to claim 1 or 2, characterized in that: The DonorDNA target sequence is shown as SEQ ID NO.

1.

4. The method for preparing a non-immunogenic mesenchymal stem cell overexpressing FGF-19 according to claim 1, characterized in that: The following steps are also included: Live cell pre-experiment: ① Confirmation of puro drug screening concentration: The lowest drug concentration that can kill all wild-type cells within 5 days is 0.3ug / ml puro; ②Electroporation pre-experiment results: The MSC cells were electroporated using LONZA4DXunit electroporator, and the electroporation program was SE electroporation solution and FF104 program. The 5k GFP plasmid PmaxGFP was tested by electroporation, and the 5K GFP plasmid could be effectively expressed, and the electroporation efficiency reached 90%.

5. The method for preparing non-immunogenic mesenchymal stem cells overexpressing FGF-19 according to claim 1, characterized in that: The following steps are also included: sgRNA design and target detection: According to the B2M gene sequence, the software predicts and evaluates three sgRNAs with higher scores; primers are designed according to the positions of these three sgRNA sequences to perform target amplification sequencing to confirm whether the target has mutations; ①sgRNA+PAM sequence is as follows (5'-3') B2M-sgRNA1: SEQ ID NO.2; B2M-sgRNA2: SEQ ID NO.3; B2M-sgRNA3: SEQ ID NO.4; ② The target PCR and sequencing primer sequences are as follows (5'-3'): B2M-SG1-PF1: SEQ ID NO.5; B2M-SG1-PR1: SEQ ID NO.6; B2M-SG2 / 3-PF1: SEQ ID NO.7; B2M-SG2 / 3-PR1: SEQ ID NO.8; There is no mutation in the sgRNA target site, and sgRNA plasmid construction can be performed.

6. The method for preparing non-immunogenic mesenchymal stem cells overexpressing FGF-19 according to claim 1, characterized in that: The following steps are also included: Construction of MC-CRISPR plasmid and MC-donor plasmid: After induction, the MC-CRISPR mother plasmid can obtain a 5.7k sgRNA-Cas9 expression plasmid; after induction, the MC-donor mother plasmid can obtain a 2.5k donor expression plasmid.

7. The method for preparing non-immunogenic mesenchymal stem cells overexpressing FGF-19 according to claim 1, characterized in that: The following steps are also included: Transfection experiments: MSC cells were co-transfected with sgRNA-Cas9 plasmid and DonorDNA respectively. After 72 hours, some cells were taken to extract genomic DNA, the target sites were amplified, recovered and sent for sequencing to confirm the presence of edited polyclonal cells.

8. The method for preparing non-immunogenic mesenchymal stem cells overexpressing FGF-19 according to claim 1, characterized in that: The following steps are also included: Polyclonal drug screening and identification: The polyclonal cells transfected with MC-sg3-Cas9+MC-sg3-donor plasmid were screened using puro at a final concentration of 0.3ug / ml. After 7 days of screening, there were few surviving cells, so the drug was removed and the culture was restored; After the cell status and cell number reach normal, take a portion of the cells to extract genomic DNA and perform breakpoint PCR to detect whether there are cells with fixed-site donor insertion; The breakpoint PCR primer sequences are as follows (5'-3'): B2M-CMV-F1: SEQ ID NO.9; B2M-CMV-R1: SEQ ID NO.10; B2M-BGH-F1: SEQ ID NO.11; B2M-BGH-R1:SEQ ID NO.12.

Images