A lipoic acid-derived ceramide and its synthesis method and application

Abstract

The application discloses a lipoic acid derivatized ceramide and a synthesis method and application thereof, and relates to the technical field of biological medicines. The ceramide has the structure of a general formula I or the structure of an isomer of the general formula I; the isomer includes enantiomers, diastereoisomers and cis-trans isomers. The lipoic acid is reacted with a sphingosine, a phytosphingosine, a dihydrosphingosine and 6-hydroxysphingosine to obtain a novel ceramide. The application introduces a lipoic acid fragment with better solubility, thereby improving the solubility of the ceramide. The ceramide has an obvious promoting effect on the expression of catalase and can effectively prevent the generation of free radicals, thereby having good antioxidant effect.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, and particularly relates to a lipoic acid derived ceramide, a synthesis method and application thereof. BACKGROUND

[0002] Alpha-lipoic acid, also known as 6,8-dithioctanoic acid or thioctic acid, is a powerful antioxidant that helps cells convert glucose into energy, and also helps fight inflammation in the skin and stabilize blood sugar. Alpha-lipoic acid is known as a universal antioxidant because it dissolves in water and fat, and can penetrate the nervous system and the heart, which are mainly composed of fat and water, thus playing a protective role to avoid damage from free radicals. Alpha-lipoic acid can also help the body increase the supply of glutathione, which is the most abundant natural antioxidant in the body, and can clear free radicals out of the body before they damage cells. It has been confirmed that free radicals can damage the immune system and make the body more susceptible to infection, heart disease and cancer.

[0003] Ceramides are a class of compounds composed of long-chain sphingosine bases and fatty acids, in which the carbon chain length, unsaturation and number of hydroxyl groups of the sphingosine base and fatty acid moieties can vary. Ceramides are the main component of lipids in the extracellular matrix of the epidermis of human skin, accounting for about 50%. Ceramides, together with cholesterol and saturated fatty acids, produce a water-impermeable protective structure to prevent excessive water evaporation, and also prevent the entry of microorganisms. Due to the importance of ceramides, there is a wide demand for functional ceramides on the market, however, the existing ceramides have poor solubility in water and oil, which leads to certain difficulties in their application.

[0004] US20080249073A discloses a cosmetic composition comprising: a) salicyloyl sphingosine and / or derivatives thereof, and b) a dermatologically acceptable carrier, for treating and / or preventing pitted skin by increasing dermal structural proteins (collagen and fibrillar proteins) and reducing the level of MMP-1 activity. The salicyloyl sphingosine has the following structure:

[0005]

[0006] The salicyloyl sphingosine derivative has the following structure:

[0007]

[0008] The patent discloses that the plant sphingosine and salicylic acid derived ceramide can be used for treating the skin barrier and effectively treating and preventing the skin disorders caused by time aging or light aging. However, the patent does not study the solubility of the salicyloyl sphingosine base and its derivatives in water / oil.

[0009] The Chinese patent CN115894278A discloses a linolenic acid derived ceramide and a preparation method and application thereof. The patent reacts long chain linolenic acid with sphingosine and phytosphingosine to obtain a novel structure ceramide compound. The compound has obvious inhibitory effect on tyrosinase and can effectively prevent the generation of melanin, thereby having good skin whitening effect and can be used in the field of cosmetics. However, the patent does not study the solubility of the linolenic acid derived ceramide in water / oil.

[0010] Therefore, in order to solve the problems in the prior art, the application provides a lipoic acid derived ceramide and a synthesis method and application thereof. SUMMARY

[0011] The application aims to provide a lipoic acid derived ceramide and a synthesis method and application thereof. The application prepares a novel ceramide, improves the solubility of the ceramide, and improves the antioxidant and other biological activities of the ceramide.

[0012] In order to achieve the above application purposes, the technical solutions of the application are as follows.

[0013] In one aspect, the application provides a lipoic acid derived ceramide having the structure of general formula I or the structure of isomers of general formula I:

[0014]

[0015] wherein, R 1 is a substituted or non-substituted alkyl group;

[0016] The isomers include enantiomers, diastereoisomers and cis-trans isomers.

[0017] Preferably, the alkyl group is -(C 10-20 )alkyl; the -(C 10-20 )alkyl group can be optionally substituted by 0-5 substituents, and each of the substituents is independently selected from -OH, -CHO, -COOH, -NH2, -NO2, a halogen atom and a phenyl group.

[0018] Further preferably, the alkyl group is -C 15 alkyl.

[0019] More preferably, the -C 15The alkyl group is optionally substituted with 0-1 substituents, which are -OH.

[0020] More preferably, R 1 is selected from one of the following structures:

[0021]

[0022] wherein, the -C 13 H 27 , -C 15 H 31 , -C 14 H 29 , -C 12 H 25 is linear or branched.

[0023] More preferably, the R 1 is selected from one of the following structures:

[0024]

[0025] Most preferably, the ceramide is one of the following structures:

[0026]

[0027] In another aspect, the present application provides a synthesis method of the above-mentioned ceramide, comprising the following steps:

[0028]

[0029] wherein, R 1 in compound S3 is substituted or unsubstituted alkyl.

[0030] Preferably, the synthesis method comprises the following steps:

[0031] (1) reacting compound S1 and dichlorodiphenylmethane under catalysis of a Lewis acid to obtain compound S2; and (2) reacting compound S2 and compound S3, an organic base to obtain compound I.

[0032] Further preferably, in step (1), the Lewis acid is ferrous chloride.

[0033] Further preferably, in step (2), the organic base is diisopropylethylamine.

[0034] Further preferably, in steps (1) and (2), the solvent of the reaction is dichloromethane.

[0035] Further preferably, the molar ratio of the compound S1, dichlorodiphenylmethane, Lewis acid, organic base, compound S3 is 1-2.2: 1-2.2: 0.05-0.2: 1-5: 1.

[0036] In still another aspect, the present application provides a medical dressing comprising the ceramide described above.

[0037] Preferably, the medical dressing further comprises octyldodecanol, hexyldecanol, caprylyl / capryl methicillin, tocopheryl acetate, water, glycerin, sodium hyaluronate, collagen, and hydroxybenzoic acid ester.

[0038] In still another aspect, the present application provides a composition comprising the ceramide described above, a pharmaceutically acceptable salt thereof, a hydrate thereof, or a solvate thereof.

[0039] Finally, the present application provides use of the ceramide described above in cosmetics, skin care products, health care products, medical devices, or pharmaceutical products.

[0040] As used herein, "pharmaceutically acceptable salt" means a salt of an aspect of the present application that is pharmaceutically acceptable and that possesses the desired pharmacological activity of the parent compound. Such salts include: (1) acid addition salts, formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like; or formed with organic acids such as acetic acid, propionic acid, hexanoic acid, cyclopentanepropionic acid, glycolic acid, pyruvic acid, lactic acid, malonic acid, succinic acid, malic acid, tartaric acid, citric acid, benzoic acid, 3-(4-hydroxybenzoyl) benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, 1,2-ethanedisulfonic acid, 2-hydroxyethanesulfonic acid, benzenesulfonic acid, 4-chlorobenzenesulfonic acid, 2-naphthalenesulfonic acid, 4-toluenesulfonic acid, camphorsulfonic acid, 4-methylbicyclo[2.2.2]-oct-2-ene-1-carboxylic acid, glucoheptonic acid, 3-phenylpropionic acid, trimethylacetic acid, tertiary butylacetic acid, lauryl sulfuric acid, gluconic acid, glutamic acid, hydroxynaphthoic acid, salicylic acid, stearic acid, and muconic acid; or (2) salts formed when an acidic proton present in the parent compound either is replaced by a metal ion, for example, an alkali metal ion, an alkaline earth ion, or an aluminum ion; or coordinates with an organic base.

[0041] As used herein, "hydrate" means a compound that is combined with water. The combination between the compound and water includes non-covalent combination.

[0042] As used herein, "solvate" means a complex of solute molecules or ions with solvent molecules or ions.

[0043] As used herein, "medical device" refers to a Class II medical device, which is a medical device whose safety and effectiveness should be controlled, including dressings, wound care materials, hemostatic sponges, medical absorbent cotton, medical absorbent gauze, etc. In a specific embodiment, the Class II medical device is a medical dressing, which refers to a covering for a wound or a material placed near a wound, which has absorbency, adhesiveness, protectiveness, permeability regulation, pH regulation, or pressure initiation. The dressing can be in direct or indirect contact with the wound.

[0044] The beneficial effects of the present application are:

[0045] (1) The present application reacts lipoic acid with sphingosine, phytosphingosine, dihydrosphingosine, 6-hydroxysphingosine to obtain a novel structure of ceramide compound.

[0046] (2) The preparation of lipoic acid derived ceramide has certain challenges compared to other types of long chain carboxylic acids, because the disulfide bond in lipoic acid is easily oxidized to thiol, and the reaction system obtained under the conventional carboxylic acid and amine condensation reaction conditions is difficult to purify. In the preparation process of the present application, the high-activity acyl chloride intermediate of lipoic acid tert-butyl ester is prepared under mild conditions, and then the corresponding ceramide is successfully obtained by one-pot docking with alcohol compounds.

[0047] (3) The present application improves the solubility of ceramide by introducing a lipoic acid fragment with better solubility, making it more convenient to use in formulations. Compared with traditional ceramide NP, lipoic acid derived ceramide has better solubility.

[0048] (4) Lipoic acid derived ceramide has obvious promoting effect on the expression of catalase, and can effectively prevent the generation of free radicals, thereby having good antioxidant effect.

[0049] (5) Compared with traditional ceramide NP, lipoic acid derived ceramide can better improve the activity of reduced glutathione, and has stronger inhibitory ability on lipid peroxidation expression.

[0050] (6) Lipoic acid derived ceramide has good inhibitory effect on advanced glycation end products, thereby having good anti-glycation effect.

[0051] (7) Lipoic acid derived ceramide can increase collagen expression and improve the elasticity and toughness of the skin. Compared with traditional ceramide NP, lipoic acid derived ceramide shows better ability to increase collagen content. BRIEF DESCRIPTION OF DRAWINGS

[0052] Figure 1The solubility comparison test result pictures of ceramide NP and ceramide prepared in Examples 1-4 in octyldodecanol; wherein a is the test result picture of ceramide NP; b is the test result picture of ceramide prepared in Example 1; c is the test result picture of ceramide prepared in Example 2; d is the test result picture of ceramide prepared in Example 3; e is the test result picture of ceramide prepared in Example 4.

[0053] Figure 2 The solubility comparison test result pictures of ceramide NP and ceramide prepared in Examples 1-4 in isohexadecanol; wherein a is the test result picture of ceramide NP; b is the test result picture of ceramide prepared in Example 1; c is the test result picture of ceramide prepared in Example 2; d is the test result picture of ceramide prepared in Example 3; e is the test result picture of ceramide prepared in Example 4.

[0054] Figure 3 The result column chart of the influence of ceramide prepared in Example 1 on cell proliferation activity.

[0055] Figure 4 The result column chart of the influence of lipoic acid on cell proliferation activity.

[0056] Figure 5 The result column chart of the influence of ceramide prepared in Example 2 on CAT enzyme activity in cells.

[0057] Figure 6 The result column chart of the influence of ceramide prepared in Example 1 on CAT enzyme activity in cells.

[0058] Figure 7 The result column chart of the influence of lipoic acid on CAT enzyme activity in cells.

[0059] Figure 8 The result column chart of the influence of ceramide prepared in Example 3 on GSH activity in cells.

[0060] Figure 9 The result column chart of the influence of ceramide prepared in Example 4 on GSH activity in cells.

[0061] Figure 10 The result column chart of the influence of lipoic acid on GSH activity in cells.

[0062] Figure 11 The result column chart of the influence of ceramide NP on GSH activity in cells.

[0063] Figure 12Bar graph of the results of ceramide prepared from Example 2 inhibiting the expression of lipid peroxidation.

[0064] Figure 13 Bar graph of the results of ceramide prepared from Example 1 inhibiting the expression of lipid peroxidation.

[0065] Figure 14 Bar graph of the results of ceramide prepared from Example 3 inhibiting the expression of lipid peroxidation.

[0066] Figure 15 Bar graph of the results of ceramide NP inhibiting the expression of lipid peroxidation.

[0067] Figure 16 Bar graph of the results of ceramide prepared from Example 2 inhibiting the formation of AGEs.

[0068] Figure 17 Bar graph of the results of ceramide prepared from Example 1 inhibiting the formation of AGEs.

[0069] Figure 18 Bar graph of the results of ceramide prepared from Example 4 inhibiting the formation of AGEs.

[0070] Figure 19 Bar graph of the results of ceramide prepared from Example 2 affecting the content of Col-1.

[0071] Figure 20 Bar graph of the results of ceramide prepared from Example 1 affecting the content of Col-1.

[0072] Figure 21 Bar graph of the results of ceramide NP affecting the content of Col-1.

[0073] Figures 3-21 In the middle, statistical analysis was performed by One-way ANOVA, the P value of the Control group compared with other concentrations was >0.05, represented by "ns", indicating no significant difference; the P value was <0.05, represented by "*", the P value was <0.01, represented by "**", the P value was <0.001, represented by "***", the P value was <0.0001, represented by "****", indicating significant difference. DETAILED DESCRIPTION

[0074] The following non-limiting examples can make those of ordinary skill in the art more fully understand the present application, but in no way limit the present application. The following content is only an exemplary description of the scope of the present application claimed by the present application, and those skilled in the art can make various changes and modifications to the application disclosed, which should also belong to the scope of the present application claimed.

[0075] The application will be further described in the following with specific examples. The various chemical reagents used in the examples of the application are obtained through conventional commercial routes unless otherwise specified. The amounts described hereinafter are mass amounts unless otherwise specified. It is understood that the procedures are carried out at room temperature unless otherwise specified.

[0076] Example 1

[0077] Sulfohydroxamic acid phytosphingosine is prepared according to the following scheme in one pot:

[0078]

[0079] Compound sulfohydroxamic acid tert-butyl ester (50 mmol), dichlorodiphenyl methane (55 mmol), ferrous chloride (0.05 mmol), dichloromethane 150 mL, is added to a 250 mL round bottom flask, stirred at room temperature for 1 h, then phytosphingosine (47.5 mmol) and diisopropylethylamine (DIPEA) (75 mmol) are added to the reaction mixture, continue stirring at room temperature for 1-3 h until thin layer chromatography (TLC) monitors the complete reaction of phytosphingosine base. Work-up: quenched with saturated aqueous sodium bicarbonate solution. Separate the organic layer, dry, filter and concentrate under vacuum. The residue thus obtained is purified by silica gel column to obtain sulfohydroxamic acid phytosphingosine, 65% yield.

[0080] 1 H NMR (400 MHz, CDC13) δ 6.40 (d, J = 7.5 Hz, 1H), 5.82 - 5.70 (m, 1H), 5.50 (ddt, J = 15.4, 6.3, 1.5 Hz, 1H), 4.27 (t, J = 4.9 Hz, 1H), 3.95 - 3.83 (m, 2H), 3.67 (dd, J = 11.1, 3.3 Hz, 1H), 3.61 - 3.50 (m, 1H), 3.33 (s, 2H), 3.22 - 3.04 (m, 2H), 2.51 - 2.38 (m, 1H), 2.23 (t, J = 7.4 Hz, 2H), 2.03 (q, J = 7.1 Hz, 2H), 1.90 (dd, J = 13.0, 6.7 Hz, 1H), 1.67 (td, J = 9.0, 3.7 Hz, 4H), 1.46 (td, J = 8.6, 4.5 Hz, 2H), 1.25 (d, J = 4.1 Hz, 22H), 0.86 (t, J = 6.7 Hz, 3H).

[0081] Example 2

[0082] Sulfohydroxamic acid phytosphingosine is prepared according to the following scheme in one pot:

[0083]

[0084] Compound lipoic acid tert-butyl ester (50 mmol), dichlorodiphenyl methane (55 mmol), ferrous chloride (0.05 mmol), dichloromethane 150 mL, was added to a 250 mL round bottom flask, stirred at room temperature for 1 h, then phytosphingosine (47.5 mmol) and DIPEA (75 mmol) were added to the reaction, stirred at room temperature for 1-3 h until TLC monitored the phytosphingosine base reaction was complete. Work-up: quenched with saturated aqueous sodium bicarbonate solution. The organic layer was separated, dried, filtered and concentrated in vacuo. The residue thus obtained was purified by silica gel column to give lipoic acid phytosphingosine, 68% yield.

[0085] 1 H NMR (400 MHz, Chloroform-d) δ 6.50 (d, J = 7.7 Hz, 1H), 4.17 (ddt, J = 8.2, 5.7, 2.7 Hz, 1H), 4.07 - 3.83 (m, 2H), 3.75 (dd, J = 11.5, 5.6 Hz, 1H), 3.61 (tdd, J = 14.6, 12.4, 10.8, 4.6 Hz, 3H), 3.29 - 3.05 (m, 2H), 2.49 (dq, J = 12.5, 6.3 Hz, 1H), 2.27 (t, J = 7.4 Hz, 2H), 2.00 - 1.80 (m, 2H), 1.71 (tt, J = 13.4, 5.5 Hz, 5H), 1.60 - 1.41 (m, 4H), 1.28 (s, 22H), 0.90 (t, J = 6.7 Hz, 3H).

[0086] Example 3

[0087] Lipoic acid dihydrosphingosine was prepared according to the following one-pot procedure:

[0088]

[0089] Compound lipoic acid tert-butyl ester (50 mmol), dichlorodiphenyl methane (55 mmol), ferrous chloride (0.05 mmol), dichloromethane 150 mL, was added to a 250 mL round bottom flask, stirred at room temperature for 1 h, then phytosphingosine (47.5 mmol) and DIPEA (75 mmol) were added to the reaction, stirred at room temperature for 1-3 h until TLC monitored the phytosphingosine base reaction was complete. Work-up: quenched with saturated aqueous sodium bicarbonate solution. The organic layer was separated, dried, filtered and concentrated in vacuo. The residue thus obtained was purified by silica gel column to give lipoic acid phytosphingosine, 68% yield.

[0090] 1H NMR (400 MHz, CDC13) δ 6.68 - 5.88 (m, 1H), 4.56 - 3.46 (m, 4H), 3.16 (dddd, J = 17.9, 13.3, 11.0, 6.2 Hz, 2H), 2.81 (s, 1H), 2.65 - 2.41 (m, 1H), 2.36 (t, J = 7.4 Hz, 1H), 2.24 (dt, J = 11.4, 7.4 Hz, 2H), 1.80 - 1.60 (m, 4H), 1.60 - 1.39 (m, 5H), 1.27 (s, 21H), 0.89 (t, J = 6.8 Hz, 3H).

[0091] Example 4

[0092] Lipoic acid-6-hydroxysphingosine was prepared according to the following one-pot procedure:

[0093]

[0094] Compound lipoic acid tert-butyl ester (50 mmol), dichlorodiphenyl methane (55 mmol), ferrous chloride (0.05 mmol), dichloromethane 150 mL, was added to a 250 mL round bottom flask, stirred at room temperature for 1 h, then 6-hydroxysphingosine (47.5 mmol) and DIPEA (75 mmol) were added to the reaction, stirred at room temperature for 1-3 h until TLC monitoring of the sphingosine base reaction was complete. Work-up: quenched with saturated aqueous sodium bicarbonate solution. The organic layer was separated, dried, filtered and concentrated in vacuo. The residue thus obtained was purified by silica gel column to give lipoic acid-6-hydroxysphingosine in 60% yield.

[0095] 1 H NMR (400 MHz, CDC13) δ 6.48 (d, J = 7.6 Hz, 1H), 5.92 - 5.76 (m, 1H), 5.50 - 5.47 (m, 1H), 4.24 (t, J = 4.8 Hz, 1H), 3.91 - 3.85 (m, 3H), 3.62 (dd, J = 11.2, 3.2 Hz, 1H), 3.66 - 3.52 (m, 1H), 3.31 (s, 2H), 3.25 - 3.08 (m, 2H), 2.55 - 2.37 (m, 1H), 2.06 (q, J = 7.2 Hz, 2H), 1.94 (dd, J = 13.0, 6.7 Hz, 1H), 1.62 - 1.56 (m, 4H), 1.44 (td, J = 8.4, 4.6 Hz, 2H), 1.25 - 1.17 (m, 22H), 0.89 (t, J = 6.7 Hz, 3H).

[0096] Example 5

[0097] A kind of medical dressing of class II (liquid type) is prepared, and the steps are as follows:

[0098] First, 1 part of lipoic acid phytosphingosine is heated and dissolved uniformly with 10 parts of oil (3 parts of octyldodecanol, 2 parts of hexyldecanol, 4 parts of octanoic acid / decanoic acid triglyceride, 1 part of tocopherol acetate) at 90-100 ℃, then emulsified, high-pressure homogenized, and mixed with 80 parts of purified water, 11 parts of glycerol, 0.1 parts of sodium hyaluronate, 0.2 parts of collagen, 0.1 parts of hydroxybenzoic acid methyl ester after cooling, and finally sterilized to prepare a medical dressing (liquid type) containing lipoic acid phytosphingosine. The above parts are all weight parts.

[0099] Results detection

[0100] 1. Solubility comparison of ceramide NP and ceramides prepared in Examples 1-4

[0101] The solubility of ceramide NP and ceramides prepared in Examples 1-4 was compared by using octyldodecanol and isohexadecanol commonly used in cosmetic formulation systems as test solvents. 0.1 g of sample was added to 9.9 g of solvent to prepare a 1% sample solution, and 0.2 g of sample was added to 9.8 g of solvent to prepare a 2% sample solution, and the solubility was tested at 25°C and 50°C, respectively.

[0102] Table 1 Solubility comparison test results in octyldodecanol

[0103] Sample 1％(25℃) 1％(50℃) 2％(50℃) Ceramide NP Very slightly soluble Slightly soluble Slightly soluble Example 1 Slightly soluble Soluble Soluble Example 2 Soluble Soluble Soluble Example 3 Slightly soluble Soluble Soluble Example 4 Soluble Soluble Soluble

[0104] Table 2 Solubility comparison test results in isohexadecanol

[0105] Sample 1％(25℃) 1％(50℃) 2％(50℃) Ceramide NP Very slightly soluble Slightly soluble Slightly soluble Example 1 Slightly soluble Soluble Soluble Example 2 Soluble Soluble Soluble Example 3 Slightly soluble Soluble Soluble Example 4 Soluble Soluble Soluble

[0106] The results are shown in Tables 1-2 and Figures 1-2 The ceramides obtained by introducing lipoic acid fragments exhibit more excellent solubility than traditional ceramide NP, which is beneficial to high-content addition application in formulations.

[0107] 2. MTT method for detecting the proliferation activity of compounds on cells

[0108] Human keratinocytes HaCaT cells were seeded in a 96-well plate at a density of 1×10 4 After 24 h, the supernatant was discarded, and different concentrations of samples (ceramides prepared in Example 1, lipoic acid) or blank DMEM medium 100 μL (three sets for each concentration) were added, and incubated for another 24 h. The medium was removed, 100 μL of thiazolyl blue (MTT) was added to each well, the absorbance at 450 nm was measured, and the cell survival rate was calculated.给药孔 / A 空白孔 ×100%.

[0109] Table 3 Test results of lipoic acid sphingosine and lipoic acid on the proliferation activity of cells (HaCaT cells)

[0110]

[0111] The results are shown in Table 3, Figures 3-4 The ceramide prepared in Example 1 has no toxic side effects on human keratinocytes in the concentration range of 500 mg / L, and shows good biological safety. In high concentrations (250 mg / L and 500 mg / L), the ceramide prepared in Example 1 shows better safety for human keratinocytes than lipoic acid.

[0112] 3. Intracellular CAT enzyme activity detection

[0113] HFF-1 cells were seeded in a 6-well plate at a density of 1 x 10 6 The supernatant was discarded after 24 h, and 100 μL of culture medium containing different concentrations of samples (ceramide prepared in Examples 1-2 and lipoic acid) was added. The blank control group was DMEM medium without drugs. After 24 h of drug administration, the model group, the positive control group (0.5 mM VC), and the experimental group were incubated with 8 mM / L H2O2 for 2 h. Each group had 3 replicate wells. After 4 h of incubation, total protein was extracted, cells were lysed, and the supernatant was taken. The protein concentration was tested using a BCA protein concentration determination kit, and the CAT (catalase) activity was tested. Antioxidant enzymes such as CAT can remove free radicals and active oxygen produced by the body. With increasing age, the activity of antioxidant enzymes decreases, leading to an excess of free radicals and active oxygen, causing the body to gradually age.

[0114] The results are shown in Table 3, Figures 5-7 The relative activity of CAT in the blank control group was set to 1.03, the CAT activity of the model group was 0.38, and the activity of the positive control group was 0.75. At concentrations of 3.91 mg / L, 7.81 mg / L, and 15.62 mg / L, the CAT activity of the ceramide prepared in Example 2 was 0.69, 0.58, and 0.78, respectively, the CAT activity of the ceramide prepared in Example 1 was 0.65, 0.89, and 1.04, respectively, and the CAT activity of lipoic acid was 0.56, 0.61, and 0.62, respectively. The results show that the ceramide prepared in Examples 1-2 can enhance CAT expression, thereby inhibiting the overexpression of free radicals in cells, and the higher the concentration of the sample, the more significant the enhancement of CAT activity and the more obvious the inhibition of overexpressed free radicals in cells. Compared with lipoic acid, the ceramide prepared in Examples 1-2 has a more obvious effect on the enhancement of CAT activity.

[0115] 4. Intracellular GSH activity detection

[0116] Cells were seeded in 6-well plates and placed in an incubator until the cells were about 80% confluent. The old medium was discarded and the sample (ceramide, lipoic acid, ceramide NP prepared in Examples 3-4) solution was diluted with DMEM medium, 1 mL of sample solution with different concentrations was added to each well, and 1 mL of DMEM medium was added to the control and model groups. The plates were placed in the incubator for 24 h. After 24 h, the old medium was discarded, and 0.5-0.8 mM H2O2 was added to each well according to the cell density and state to stimulate for 3 h (the concentration of H2O2 was determined according to the cell density and state). 1 mL of DMEM medium was added to the control group. After 3 h of oxidation stimulation, the old medium was discarded, and the cells were washed with PBS for 3 times. The cells were scraped with a scraper and ultrasonicated while vortexing (ultrasonic for 30 s, vortexing once, ultrasonic for 5 min, and an ice bag was added to prevent the water bath temperature from being too high). The cells were centrifuged at 7000 r / min for 5 min, and the supernatant was collected. The experiment was performed according to the instructions of the micro-reduced glutathione (GSH) assay kit.

[0117] The results are shown in Table 1. Figures 8-11 The relative activity of GSH in the blank control group was set as 100.50, the GSH activity in the model group was 52.79%, and the activity in the positive control group was 90.80%. At concentrations of 3.91 mg / L, 7.81 mg / L, and 15.62 mg / L, the GSH activity of ceramide prepared in Example 3 was 49.09%, 60.24%, and 78.94%, respectively, the GSH activity of ceramide prepared in Example 4 was 55.92%, 70.98%, and 77.77%, respectively, the GSH activity of lipoic acid was 65.05%, 75.84%, and 79.04%, respectively, and the GSH activity of ceramide NP was 22.21%, 36.17%, and 42.05%, respectively. The results showed that ceramide and lipoic acid prepared in Examples 3-4 could enhance the GSH activity, and at a concentration of 15.62 mg / L, the three compounds had similar effects on the enhancement of GSH activity. However, the enhancement of GSH activity by ceramide NP was much less significant than that by ceramide prepared in Examples 3-4.

[0118] 5. Anti-lipid peroxidation expression detection

[0119] Lipid peroxidation is a process of free radical oxidation of biological membranes that occurs after oxidative stress is enhanced, thereby changing the fluidity and permeability of cell membranes, and ultimately leading to changes in cell structure and function. The TBARS method measures the expression of lipid peroxidation based on the reaction of lipid peroxides with thiobarbituric acid (TBA) to form thiobarbituric acid reactants.

[0120] 3g lecithin was dissolved in 300mL PBS (10mmol / L, pH 7.4); 75g trichloroacetic acid (TCA), 1.875g TBA, 10.5mL concentrated HCl (mass fraction 36%) were added to 500mL pure water at one time, and mixed; 1mL lecithin, 1mL FeSO4 solution (400μmol / L), 1mL ascorbic acid solution (400μmol / L) were added to the centrifuge tube in turn, and then 1mL sample (ceramide, ceramide NP prepared in examples 1-3) solution of different concentrations was added; after mixing, it was kept in constant temperature water bath for 60min (37℃) in dark; then 2mL TCA-TBA-HCl mixed solution was added, and water bath was carried out at 90-100℃ for 15min; after rapid cooling, 4000r / min was taken, and the supernatant was measured for 535nm absorbance. Inhibition rate (%) = [(A 空白 -A 样品 ) / A 空白 ]×100%.

[0121] The results are shown in Figures 12-15 , the blank control group is set to 0.00, and the model group is set to 52.95%; at the concentrations of 7.8125mg / L, 15.625mg / L, 31.25mg / L, the lipid peroxidation inhibition rate of ceramide prepared in example 2 is 20.47%, 29.05%, 40.23%, the lipid peroxidation inhibition rate of ceramide prepared in example 1 is 19.57%, 36.41%, 43.16%, the lipid peroxidation inhibition rate of ceramide prepared in example 3 is 19.16%, 31.64%, 41.09%, and the lipid peroxidation inhibition rate of ceramide NP is 10.42%, 17.02%, 22.47%. The results show that the ceramides prepared in examples 1-3 can significantly inhibit the expression of lipid peroxidation, and the inhibition ability of ceramide NP on the expression of lipid peroxidation is far less significant than that of the ceramides prepared in examples 1-3.

[0122] 6. Anti-glycation detection

[0123] Glycation is the process of reducing sugar reacting with the terminal amino group on proteins, nucleic acids, lipids and other macromolecules to ultimately form irreversible advanced glycation end products (AGEs). AGEs not only promote the production of a large number of free radicals to trigger inflammatory reactions, but also destroy skin homeostasis, cause skin dullness, and promote the skin aging process.

[0124] Under sterile conditions, 4 mL of bovine serum albumin solution and 4 mL of glucose solution, which were sterilized by sterilization membrane, were added into a sterile bottle, mixed uniformly, and then 4 mL of sample (ceramide prepared in Example 1, ceramide prepared in Example 2, and ceramide prepared in Example 4) solution and 4 mL of phosphate buffer were added. The mixture was incubated at 37°C for 10 days in the dark. Amino guanidine was used as a positive control group instead of the sample, and phosphate was used as a blank control group instead of the sample. AGEs content was determined on the 10th day of the reaction. Each group was tested in triplicate.

[0125] The AGEs test method was as follows: 3 mL of glycosylated substance was determined for the fluorescence value F of the glycosylation end product at an excitation wavelength of 340 nm and an emission wavelength of 420 nm s (F represents the content of total fluorescent AGEs); and the fluorescence value determined for the phosphate solution was F0.

[0126] The inhibition rate was calculated as (F0-F s ) / F0x 100%.

[0127] The results are shown in Table 1. Figures 16-18 The AGEs content of the blank control group was set as 0.00, and the AGEs content of the model group was set as 76.80%. When the concentration was 3.90625 mg / L, 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L, the AGEs inhibition rate of the ceramide prepared in Example 2 was 20.73%, 26.23%, 29.31%, and 40.49%, respectively; the AGEs inhibition rate of the ceramide prepared in Example 1 was 23.59%, 31.17%, 38.04%, and 48.48%, respectively; and the AGEs inhibition rate of the ceramide prepared in Example 4 was 25.20%, 31.66%, 39.96%, and 45.58%, respectively. The ceramides prepared in Examples 1, 2, and 4 all had good anti-glycation effects.

[0128] 7. Collagen Col-1 activity detection

[0129] HFF-1 cells were seeded in a 6-well plate at a density of 1x10 6 cells / well, and incubated in a 37°C incubator with 5% CO2 overnight. After 24 h, the supernatant was discarded, and 100 μL of culture medium containing different concentrations of samples (ceramide prepared in Example 1 and ceramide NP) was added. The blank control group was DMEM culture medium without drugs, and 0.025 mM EGCG was used as a positive control. After 24 h of administration, the expression of Col-1 was detected by a Col-1 kit, total RNA was extracted, and the RNA was reverse transcribed into cDNA for quantification by a fluorescence quantitative PCR instrument.

[0130] Primer sequence:

[0131] Col1a1-F:CGATGGATTCCCGTTCGAGT

[0132] Col1a1-R:GAGGCCTCGGTGGACATTAG

[0133] The results are as follows Figures 19-21 As shown, the relative expression level of Col-1 mRNA in the blank control group was set at 99.70%, and the expression level in the positive control group was 129.50%. At concentrations of 3.90625 mg / L, 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L, the relative expression levels of Col-1 in the ceramide prepared in Example 2 were 94.02%, 100.30%, 108.70%, and 114.50%, respectively; the relative expression levels of Col-1 in the ceramide prepared in Example 1 were 99.13%, 106.10%, 115.10%, and 121.30%, respectively; and the relative expression levels of Col-1 in ceramide NP were 96.35%, 101.00%, 101.70%, and 108.10%, respectively.

[0134] The content of collagen Col-1 is closely related to the elasticity and toughness of the skin. Both the ceramide and ceramide NP prepared in Examples 1-2 can increase Col-1 expression and improve the elasticity and toughness of the skin. The dose-dependent effect is obvious. The higher the concentration of the ceramide prepared in Examples 1-2, the more significant the increase in Col-1 content and the more obvious the improvement in skin elasticity and toughness. Among them, the ceramide prepared in Examples 1-2 has a significantly better effect on increasing Col-1 content than ceramide NP.

[0135] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A lipoic acid-derived ceramide, characterized in that, having the general formula I: ； wherein R 1 is selected from one of the following structures: ； wherein said -C 13 H 27 , -C 15 H 31 , -C 14 H 29 , -C 12 H 25 is straight-chain or branched.

2. The ceramide according to claim 1, characterized in that, said R 1 is selected from one of the following structures: 。 3. The ceramide according to claim 1, characterized in that, the ceramide is one of the following structures: 。 4. The method of synthesizing ceramides according to any one of claims 1 to 3, characterized in that, comprising the following steps: ； wherein R in compound S3 is 1 selected from one of the following structures: ； wherein said -C 13 H 27 , -C 15 H 31 , -C 14 H 29 , -C 12 H 25 is linear or branched.

5. The method of synthesis of claim 4, wherein, comprising the following steps: (1) reacting compound S1 and dichlorodiphenylmethane under the catalysis of a Lewis acid to obtain compound S2; (2) reacting compound S2 and compound S3, an organic base to obtain compound I.

6. The synthesis method according to claim 5, characterized in that, in step (1), the Lewis acid is ferrous chloride; in step (2), the organic base is diisopropylethylamine; in step (1) and step (2), the solvent of the reaction is dichloromethane.

7. The method of synthesis of claim 5, wherein, the molar ratio of the compound S1, dichlorodiphenylmethane, Lewis acid, organic base, compound S3 is 1-2.2:1-2.2:0.05-0.2:1-5:

1.

8. A medical dressing, characterized in that the medical dressing comprises the ceramide according to any one of claims 1-3.

9. A composition characterized in that, the composition comprises the ceramide according to any one of claims 1-3 or a pharmaceutically acceptable salt thereof.

10. Use of the ceramide according to any one of claims 1-3 in the preparation of a cosmetic product, a skin care product, a medical device or a pharmaceutical product.

Images