Incubation method of self-assembled organic material crystal based on double emulsion droplets

Abstract

The invention discloses a self-assembled organic material crystal incubation method based on double-emulsion droplets, which comprises the following steps: preparing W / O / W type double-emulsion droplets with uniform size through a micro-fluidic chip, in the preparation process of the double-emulsion droplets, taking a self-assembled organic material solution as an inner water phase solution, taking an intermediate oil phase solution as a water-insoluble solution, and taking a micro-fluidic chip as an outer water phase solution; a self-assembled organic material solution is packaged by using an external water phase solution with higher salt concentration, so that the self-assembled organic material is prevented from being dissociated into the external water phase solution, and double emulsion drops loaded with the self-assembled organic material solution are incubated. By utilizing the concentration difference between the external water phase solution and the internal water phase solution, under the influence of osmotic pressure, water molecules in the internal water phase solution migrate to the external water phase, and the concentration of the self-assembled organic material in the double-emulsion liquid drops is also increased, so that the growth of the self-assembled organic material crystal is promoted; finally, self-assembled organic material crystals with uniform sizes are obtained in the double-emulsion droplets, and each double-emulsion droplet contains a single self-assembled organic material crystal.

Description

Technical Field

[0001] The invention relates to the fields of droplet microfluidics technology and crystal material technology, and in particular to a method for incubating self-assembled organic material crystals based on double emulsion droplets. Background Art

[0002] Self-assembled organic materials are a type of organic materials with self-assembly capabilities, which can be assembled into periodic array structures and then assembled into organic material crystals. DNA, as one of the self-assembled organic materials, can be used as a programmable self-assembly unit to participate in the construction of nanostructures. DNA-based structural DNA nanotechnology has been widely used in biology, biosensing, and drug delivery and other fields (Huating Kong, et al. Exploring the Potential of Three-Dimensional DNA Crystals in Nanotechnology: Design, Optimization, and Applications. Adv Sci. 2023, 10 (24): e2302021. doi: 10.1002 / advs. 202302021.). Among them, DNA crystal preparation is to periodically arrange and assemble the designed DNA molecules to construct three-dimensional DNA crystals. DNA crystals are used as periodic molecular scaffolds to load and collect the required guest molecules through precise arrangement.

[0003] At present, the main methods for preparing DNA crystals are: hanging drop method and sitting drop method. The Chinese patent document with publication number CN117384231A discloses a method for preparing engineered DNA crystals. The hanging drop method is used to prepare engineered DNA crystals. The number of DNA crystals prepared by this method is uncontrollable, and the crystal size distribution is relatively wide, making it difficult to obtain DNA crystals with controllable quantity and uniform size. The preparation of DNA crystals with controllable quantity and uniform size will further expand the application of DNA crystals in controllable drug loading and release and responsible nanostructure engineering. The shortcomings of the current method for preparing self-assembled organic material crystals have prompted us to find a better technical method to prepare self-assembled organic material crystals with uniform and controllable size.

[0004] Droplet microfluidics is a technology that has emerged in recent years. It uses microchannels to manipulate microdroplets with a volume of tens of picoliters to hundreds of nanoliters. The prepared microdroplets are small, uniform, independent, stable, controllable, and have a large specific surface area. They have broad application prospects and research value in the fields of chemistry, biomedicine, and new materials. Studies have shown that double-emulsion droplets prepared by droplet microfluidics can be used as micro-reaction containers to carry out nanoliter-level chemical and biological micro-reactions. Therefore, the patent of this invention proposes to use double-emulsion droplets produced by droplet microfluidics technology as incubation containers to prepare self-assembled organic material crystals. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides an incubation method for self-assembled organic material crystals based on double emulsion droplets, which realizes the migration of water molecules in the aqueous phase solution inside the double emulsion droplets by increasing the salt concentration of the aqueous phase outside the double emulsion droplets, thereby increasing the concentration of the self-assembled organic material in the inner aqueous phase, promoting the assembly of the self-assembled organic material into crystals, and achieving the purpose of controllable size of the self-assembled organic material crystals.

[0006] A method for incubating self-assembled organic material crystals based on double emulsion droplets, comprising the following steps:

[0007] (1) preparing an inner aqueous phase solution with a self-assembled organic material and a soluble salt, preparing an intermediate oil phase solution with a water-insoluble substance and a water-insoluble organic solvent, and preparing an outer aqueous phase solution with a soluble salt, wherein:

[0008] (2) introducing the inner aqueous phase solution, the intermediate oil phase solution and the outer aqueous phase solution obtained in step (1) into the corresponding channels of the microfluidic chip to prepare double emulsion droplets loaded with self-assembled organic materials;

[0009] (3) The double emulsion droplets loaded with self-assembled organic materials obtained in step (2) are subjected to water migration and then incubated to obtain self-assembled organic material crystals based on the double emulsion droplets.

[0010] In the present invention, W / O / W (water-in-oil-in-water) double emulsion droplets of uniform size are prepared by a microfluidic chip. In the process of preparing the double emulsion droplets, a self-assembled organic material solution is used as an inner aqueous phase solution, an intermediate oil phase solution is a non-aqueous solution, and a solution containing a relatively high salt concentration is used as an outer aqueous phase solution to encapsulate the self-assembled organic material solution to prevent the self-assembled organic material from being freed into the outer aqueous phase solution. The double emulsion droplets loaded with the self-assembled organic material solution are incubated.

[0011] By utilizing the concentration difference between the outer aqueous phase solution and the inner aqueous phase solution, under the influence of osmotic pressure, the water molecules in the inner aqueous phase solution migrate to the outer aqueous phase, and the concentration of the self-assembled organic material in the double emulsion droplet gradually increases to the crystallization concentration of the self-assembled organic material. This process promotes the growth of self-assembled organic material crystals. When the volume ratio of the inner core droplet of the double emulsion droplet before and after water migration is the same as the salt concentration ratio of the outer and inner aqueous phase solutions before water migration, the degree of water migration in the double emulsion droplet reaches saturation, and the maximum degree of crystallization of the self-assembled organic material in the double emulsion droplet can be achieved. Finally, self-assembled organic material crystals of uniform size are obtained in the double emulsion droplet, and the ratio of a single self-assembled organic material crystal contained in a single double emulsion droplet is high.

[0012] In the present invention, the diameter of the inner core droplet of the double emulsion droplet obtained in step (2) can be controlled to control the diameter of the inner core droplet of the double emulsion droplet after water migration, thereby controlling the size range of the obtained self-assembled organic material crystals, so that the size of the self-assembled organic material crystals is controllable, and the obtained self-assembled organic material crystals of different sizes can be suitable for controllable drug loading and release and responsible for nanostructure engineering.

[0013] Preferably, the self-assembling organic material is a water-soluble organic material that can be assembled into periodic structure crystals, such as DNA chains, block copolymers, supramolecular polymers, proteins, etc., which have self-assembly properties themselves or after synthetic modification and can form periodic structural arrangements.

[0014] Further preferably, the self-assembled organic material is a DNA chain, and the DNA chain is a combination of a central chain L chain, a side chain M chain and a corner chain S chain.

[0015] In the present invention, the DNA chains can be three different DNA chains: a central chain L chain, a side chain M chain, and a corner chain S chain (the nucleotide sequences of the DNA chains are shown in SEQ ID NOs. 1 to 3 or SEQ ID NOs. 6 to 8). Figure 1 and Fig. 9 As shown, three different DNA chains constitute a triangular tensile structural unit, wherein the side chain M chain extends in three double helix directions, the central chain L chain with three repeated sequences is located in the center of the structural unit, and the corner chain S chain is located at the double helix end of the structural unit and is paired with the side chain M chain. Based on the above triangular tensile structural unit, the present invention can obtain three-dimensional DNA crystals of uniform size by periodically assembling and arranging through complementary pairing of two base vacancies.

[0016] Further preferably, the self-assembling organic material is a DNA chain, and the DNA chain is a self-assembling chain Z chain.

[0017] In the present invention, the DNA chain can also be the same self-assembly chain Z chain (nucleotide sequence as shown in SEQ ID NO.4 or SEQ ID NO.5), and the two same self-assembly chains Z chains are paired with each other to form Figure 5 and Figure 7 The structural primitives shown.

[0018] Further preferably, the DNA chains are the central chain L chain with a nucleotide sequence of SEQ NO.1, the side chain M chain with a nucleotide sequence of SEQ NO.2, and the corner chain S chain with a nucleotide sequence of SEQ NO.3.

[0019] In a specific embodiment of the present invention, when the self-assembled organic material is a DNA chain (a central chain L chain with a nucleotide sequence of SEQ NO.1, a side chain M chain with a nucleotide sequence of SEQ NO.2, and a corner chain S chain with a nucleotide sequence of SEQ NO.3), a size-controllable DNA crystal is obtained by controlling the initial concentration of the self-assembled material and the initial salt concentration ratio of the inner and outer phase aqueous solutions, or by regulating the diameter of the initial inner core droplet.

[0020] More preferably, the concentration of the central chain L chain in the inner aqueous phase solution is 6 to 12 μM, and the salt concentration ratio of the outer aqueous phase solution to the inner aqueous phase solution is not less than 20:1.

[0021] In a specific embodiment of the present invention, when the concentration of the central chain L chain in the inner aqueous phase solution and the ratio of the salt concentrations of the inner and outer phase aqueous solutions are within the above range, the product thereof can be made to exceed the self-assembly crystallization concentration of the DNA chain, thereby obtaining a double emulsion droplet with a high crystal content, the crystal content of which is close to 100%, and the ratio of a single DNA crystal in a single double emulsion droplet is more than 80%, and can reach up to about 98%.

[0022] Preferably, in the inner aqueous phase solution and the outer aqueous phase solution, the soluble salt is one of potassium salt, sodium salt, magnesium salt and ammonium salt.

[0023] Preferably, the inner aqueous phase solution and the outer aqueous phase solution both further comprise a buffer and a surfactant.

[0024] In the inner aqueous phase solution and the outer aqueous phase solution,

[0025] More preferably, the buffer is TAE buffer.

[0026] In the present invention, TAE buffer is a buffer composed of Tris base, acetic acid and ethylenediaminetetraacetic acid (EDTA).

[0027] More preferably, the surfactant is polyvinyl alcohol, sodium lauryl sulfate or Tween 80.

[0028] Preferably, the water-insoluble substance is at least one of silicone oil, mineral oil and liposome.

[0029] Preferably, the microfluidic chip is made of glass, polydimethylsiloxane or plastic.

[0030] The microfluidic chip used in the present invention comprises an input channel for a three-phase solution and an output channel, and W / O / W type double emulsion droplets loaded with self-assembled organic materials can be prepared by the microfluidic chip.

[0031] Preferably, the size of the self-assembled organic material crystals based on double emulsion droplets is 15 to 60 μm.

[0032] In the present invention, the size of the self-assembled organic crystal is controlled by the initial self-assembled material concentration, the initial salt concentration ratio of the inner and outer phase aqueous solutions or the diameter of the initial inner core droplet, so that size-controllable self-assembled organic material crystals can be obtained.

[0033] Preferably, the crystal content of the double emulsion droplets after incubation is ≥95%.

[0034] In the present invention, when the inner aqueous phase solution in step (1) When the value of is much larger than the crystal concentration of the self-assembled organic material, the crystal content of the double emulsion droplets after incubation is ≥95% and can even reach 100%.

[0035] Preferably, in the double emulsion droplets after incubation, the ratio of a single self-assembled organic material crystal contained in a single double emulsion droplet is ≥80%.

[0036] In the present invention, in the double emulsion droplets incubated by the method, the ratio of single self-assembled organic material crystals contained in a single double emulsion droplet is high, which can improve the single crystal control and single crystal utilization, making the crystals more controllable and concentrated when used for drug loading and release.

[0037] Compared with the prior art, the present invention has the following beneficial effects:

[0038] The present invention uses double emulsion droplets as incubation containers to prepare self-assembled organic material crystals. Self-assembled organic material crystals of different sizes can be prepared by regulating the concentration of the encapsulated self-assembled organic material, the salt concentration in the outer aqueous phase solution and the inner aqueous phase solution, and the size of the inner core droplets of the initial double emulsion droplets. The double emulsion droplets prepared by the incubation method have a high crystal content, and the ratio of single crystals contained in a single droplet is ≥80%, which can improve single crystal manipulation and single crystal utilization, making the crystals more controllable and concentrated when used for drug loading and release. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 This is a schematic structural diagram of the triangular tensile structural unit of the DNA crystal in Example 1.

[0040] Figure 2 Image of the prepared double emulsion droplets loaded with self-assembled organic materials.

[0041] Figure 3 This is an image of the double emulsion droplet-based DNA crystal prepared in Example 1.

[0042] Figure 4 This is an image of a single DNA crystal contained in a single double emulsion droplet prepared in Example 1.

[0043] Figure 5 Schematic diagram of the structural elements of the DNA crystal of Example 11.

[0044] Figure 6 This is an image of the double emulsion droplet-based DNA crystal prepared in Example 11.

[0045] Figure 7 Schematic diagram of the structural elements of the DNA crystal of Example 12.

[0046] Figure 8 This is an image of the double emulsion droplet-based DNA crystal prepared in Example 12.

[0047] Fig. 9 Schematic diagram of the structure of the triangular tensile structural unit of the DNA crystal in Example 13.

[0048] Fig.10 This is an image of the double emulsion droplet-based DNA crystal prepared in Example 13.

[0049] Fig.11 This is an image of a DNA crystal prepared using the hanging drop method in Comparative Example 1.

[0050] Fig.12 These are the incubation images of DNA crystals based on double emulsion droplets of Examples 1 to 4 and Comparative Example 2, wherein i to v are the images of DNA crystals prepared in Comparative Example 2 and Examples 1 to 4, respectively, and vi is a statistical graph of the DNA crystal size, droplet crystal content, and ratio of single crystals contained in a single droplet of Examples 1 to 4.

[0051] Fig.13 These are double-emulsion droplet-based DNA crystal incubation images of Example 1 and Examples 5 to 8, wherein i to v are respectively the DNA crystal images prepared in Example 1 and Examples 5 to 8, and vi is a statistical graph of the DNA crystal size, droplet crystal content, and ratio of a single crystal in a single droplet of Example 1 and Examples 5 to 8.

[0052] Fig.14 These are the incubation images of DNA crystals based on double emulsion droplets of Examples 1, 9 and 10, and Comparative Examples 3 and 4, wherein i~v are the images of DNA crystals prepared in Comparative Examples 3 and 4, and Examples 9, 1 and 10, respectively, and vi is a statistical graph of the DNA crystal size, droplet crystal content, and ratio of a single crystal contained in a single droplet of Examples 1, 9 and 10.

[0053] Fig.15 Statistical graphs of DNA crystal size, crystal content of droplets, and ratio of single crystals contained in a single droplet based on double emulsion droplets of Examples 11 to 13. DETAILED DESCRIPTION

[0054] The present invention will be further described in detail below in conjunction with the examples, but the embodiments of the present invention are not limited to the following examples.

[0055] The raw materials used in the present invention are all commercially available.

[0056] The specific embodiment of the present invention uses DNA chains as self-assembling organic materials, and all DNA chains are synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0057] Preparation of TAE buffer stock solution (50×TAE buffer): Take 242g (2mol) of Tris and 37.2g (0.1mol) of disodium Na2EDTA, add 800mL of deionized water, stir until fully dissolved. Add 57.1mL of acetic acid, and then add deionized water to make it dilute to 1L.

[0058] Example 1

[0059] Central chain L chain: ACACCGTACACCGTACACCGT (SEQ ID NO. 1);

[0060] Side chain M chain: GAGCAGCCTGTACGGACATCA (SEQ ID NO. 2);

[0061] Corner chain S chain: TCTGATGTGGCTGC (SEQ ID NO. 3).

[0062] In this embodiment, the center chain L chain, the side chain M chain and the angle chain S chain can form the following Figure 1 The triangular tensegrity structural unit shown has a self-assembled crystal concentration of about 120 μM in water at 20°C.

[0063] (1) The three DNA chains (central chain L chain, side chain M chain and corner chain S chain) are mixed in a ratio of 1:3:3 to ensure that the concentration of the central chain L chain (i.e., the concentration of the triangular tensile structure primitives) is Figure 1 ) was 8 μM, and 1×TAE buffer and 25 mM magnesium acetate (i.e., 1×TAE / Mg 2+ ) 0.2% polyvinyl alcohol (PVA) solution to obtain a DNA solution. The DNA solution was transferred to the PCR and cooled from 95°C to 20°C at a rate of 0.6°C / min to obtain an inner aqueous phase solution. Dimethyl silicone oil with a viscosity of 50 cst was mixed with polydimethylsiloxane (PDMS) in a ratio of 8:2 to obtain an intermediate oil phase solution. The outer aqueous phase solution contained 20×TAE buffer and 0.5M magnesium acetate (i.e., 20×TAE / Mg 2+ ) of a 2.5% PVA aqueous solution.

[0064] (2) The inner aqueous phase solution, the middle oil phase solution and the outer aqueous phase solution obtained in step (1) are respectively introduced into the corresponding channels of the glass capillary microfluidic chip, and the self-assembled organic material is encapsulated into W / O / W double emulsion droplets to obtain double emulsion droplets loaded with DNA solution, wherein the inner core droplet of the double emulsion droplet has a diameter of 160 μm, such as Figure 2 As shown, the double emulsion droplet is a core-shell structure, in which the core is the inner aqueous solution, the shell is the middle oil solution, and the external liquid environment of the double emulsion droplet is the outer aqueous solution.

[0065] (3) placing the double emulsion droplets loaded with the DNA solution obtained in step (2) in a 20°C constant temperature box for water migration, wherein the inner core droplet diameter of the double emulsion droplets after water migration is 60 μm, and the inner core droplet volume ratio before and after water migration is the same as the salt concentration ratio of the outer aqueous phase solution and the inner aqueous phase solution, that is, the water migration ratio is 20:1, and then incubating at 20°C for 72 hours to obtain DNA crystals based on double emulsion droplets ( Figure 3 ), where a single double emulsion droplet can be seen to contain a single DNA crystal ( Figure 4 ).

[0066] Example 2

[0067] The preparation method is the same as that of Example 1, except that the concentration of the triangular tensegrity structural unit is 6 μM.

[0068] Example 3

[0069] The preparation method is the same as that of Example 1, except that the concentration of the triangular tensegrity structural unit is 10 μM.

[0070] Example 4

[0071] The preparation method is the same as that of Example 1, except that the concentration of the triangular tensegrity structural unit is 12 μM.

[0072] Example 5

[0073] The preparation method is the same as that of Example 1, except that the inner core droplet diameter of the double emulsion droplets after water migration is 100 μm, and the water migration ratio is 20:1.

[0074] Example 6

[0075] The preparation method is the same as that of Example 1, except that the inner core droplet diameter of the double emulsion droplets after water migration is 110 μm, and the water migration ratio is 20:1.

[0076] Example 7

[0077] The preparation method is the same as that of Example 1, except that the inner core droplet diameter of the double emulsion droplets after water migration is 130 μm, and the water migration ratio is 20:1.

[0078] Example 8

[0079] The preparation method is the same as that of Example 1, except that the inner core droplet diameter of the double emulsion droplets after water migration is 150 μm, and the water migration ratio is 20:1.

[0080] Example 9

[0081] The preparation method is the same as that of Example 1, except that the concentration of TAE and magnesium acetate in the external aqueous phase solution is 15×TAE / Mg 2+ .

[0082] Example 10

[0083] The preparation method is the same as that of Example 1, except that the concentration of TAE and magnesium acetate in the external aqueous phase solution is 25×TAE / Mg 2+ .

[0084] Embodiment 11

[0085] Self-assembly chain Z chain: CGACGCGTGGCGCCGC (SEQ ID NO.4)

[0086] The preparation method is the same as that in Example 1, except that the added DNA chain is the self-assembled chain Z chain, and the concentration of the self-assembled chain Z chain is ensured to be 10 μM (the two self-assembled chains Z chains form a Z chain through base pairing). Figure 5 The concentration of the structural motifs was 5 μM for the structural motifs shown.

[0087] DNA crystals based on double emulsion droplets were prepared ( Figure 6 ), where a single double-emulsion droplet can be seen containing a single DNA crystal.

[0088] Example 12

[0089] Self-assembly chain Z chain: GGACAGCTGGGAG (SEQ ID NO.5)

[0090] The preparation method is the same as that in Example 1, except that the added DNA chain is the self-assembled chain Z chain, and the concentration of the self-assembled chain Z chain is ensured to be 50 μM (the two self-assembled chains Z chains form a Z chain through base pairing). Figure 7 The concentration of the structural motifs was 25 μM for the structural motifs shown.

[0091] DNA crystals based on double emulsion droplets were prepared ( Figure 8 ), where a single double-emulsion droplet can be seen containing a single DNA crystal.

[0092] Embodiment 13

[0093] Center chain L chain:

[0094] CGGTATTCACCACGATGCGGTATTCACCACGATGCGGTATTCACC ACGATG (SEQ ID NO. 6);

[0095] Side chain M chain:

[0096] GAAAAACACTGCCTGAATACCGCATCGTGGACTGACTCAAAA(SEQ ID NO.7);

[0097] Corner chain S chain: TCTTTTGAGTCAGTGGCAGTGTTTT (SEQ ID NO. 8).

[0098] The preparation method is the same as that of Example 1, except that the DNA chains added are DNA chains of SEQ ID NO. 6 to 8, and the concentration of the central chain L chain (i.e., the concentration of the triangular tensile structure primitive, the triangular tensile structure primitive is as follows Fig. 9 As shown) was 2 μM.

[0099] DNA crystals based on double emulsion droplets were prepared ( Fig.10 ), where a single double-emulsion droplet can be seen containing a single DNA crystal.

[0100] Comparative Example 1: Preparation of DNA crystals using the hanging drop method

[0101] DNA crystals were prepared according to the traditional hanging drop method. The DNA chain was the same as that in Example 1, and 10 μL of hanging drop solution was prepared. The concentration of the central chain L chain was 12 μM, and the concentrations of TAE buffer and magnesium acetate were 1×TAE and 25 mM magnesium acetate. Then, the 10 μL hanging drop solution was subjected to the same annealing procedure as in Example 1, adsorbed on a cover glass and hung on a 24-well plate. 0.6 mL of ammonium sulfate (1.7 M) solution was placed under the well plate, and the plate was placed in a 20° C. incubator for 72 hours. The DNA crystals in the hanging drop were as follows: Fig.11 shown.

[0102] Comparative Example 2

[0103] The preparation method is the same as that of Example 1, except that the concentration of the triangular tensegrity structural unit is 4 μM.

[0104] Comparative Example 3

[0105] The preparation method is the same as that of Example 1, except that the concentration of TAE and magnesium acetate in the external aqueous phase solution is 5×TAE / Mg 2+ .

[0106] Comparative Example 4

[0107] The preparation method is the same as that of Example 1, except that the concentration of TAE and magnesium acetate in the external aqueous phase solution is 10×TAE / Mg 2+ .

[0108] Sample analysis

[0109] The crystal incubation conditions of Examples 1 to 13 and Comparative Examples 1 to 4 were observed, and the crystal data (crystal size, crystal content of droplets, and ratio of single crystals contained in a single droplet) were statistically analyzed. The results are as follows: Figure 12 to Figure 15 shown.

[0110] Fig.12 The incubation images of DNA crystals based on double emulsion droplets of Examples 1 to 4 and Comparative Example 2 are shown in FIG. Figure 6 Figures i to v are the incubation images of DNA crystals prepared in Comparative Example 2 and Examples 1 to 4, respectively. In Comparative Example 2, the concentration of the triangular tensile structure unit is too low, and the self-assembly crystallization concentration of the DNA chain is not reached after multiplication by the salt concentration ratio of the external aqueous phase and the internal aqueous phase solution. Therefore, no DNA crystals were observed. In Examples 1 to 4, DNA crystals were observed after incubation for 72 hours. Fig.12 As shown in vi, the size range of the DNA crystals incubated in Examples 1 to 4 is 19.4±0.9μm to 26.4±0.6μm, the double emulsion droplets have a high crystal content, and the ratio of a single droplet containing a single crystal exceeds 80%, and can reach up to 98.6%±0.9%.

[0111] Fig.13 The incubation images of DNA crystals based on double emulsion droplets in Example 1 and Examples 5 to 8 are as follows: Fig.13 As shown in i to v in Figure 1, DNA crystals can be observed in Examples 1 and 5 to 8. Fig.13 As shown in vi, the size range of the DNA crystals incubated in Examples 1 to 4 is 21.6±0.6 μm to 56.8±2.6 μm, the crystal content of the double emulsion droplets can reach 100%, and the ratio of a single crystal in a single droplet exceeds 90%.

[0112] Fig.14 The incubation images of DNA crystals based on double emulsion droplets of Examples 1, 9 and 10 and Comparative Examples 3 and 4 are as follows: Fig.14 As shown in Fig. i to v, the salt concentration ratios of the external aqueous phase solution and the internal aqueous phase solution of Comparative Examples 3 and 4 are 5 and 10, respectively. The difference in salt concentration between the internal and external aqueous phase solutions of Comparative Examples 3 and 4 is small, and the self-assembly crystallization concentration of the DNA chain cannot be reached after water migration, and it is difficult to form DNA crystals. The salt concentration ratio of the external aqueous phase solution and the internal aqueous phase solution of Example 9 is 15. After water migration occurs, the self-assembly crystallization concentration is just reached. It can be observed that a small number of double emulsion droplets can be incubated with DNA crystals, and the crystal content is low; while the salt concentration ratios of the internal and external aqueous phases of Examples 1 and 9 are 20 and 25, respectively, and DNA crystals can be observed, as shown in Figs. Fig.14 As shown in vi, the size range of DNA crystals incubated in Examples 1 and 9 is 19.3±0.9 μm to 56.8±2.6 μm, the crystal content of double emulsion droplets can reach 100%, and the ratio of single crystals in a single droplet exceeds 90%.

[0113] Fig.15 The figures are statistical graphs of DNA crystal size, crystal content of droplets and ratio of single crystals in a single droplet based on double emulsion droplets of Examples 11 to 13. As shown in the figures, the size range of DNA crystals incubated in Examples 11 to 13 is 15.81±0.60μm to 20.80±2.01μm, the crystal content of droplets prepared in Example 12 is >30%, the crystal content of droplets prepared in Examples 11 and 13 can both reach 100%, and the ratio of single crystals in single droplets prepared in Examples 11 to 13 is more than 90%.

[0114] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention is described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A method for incubating self-assembled organic material crystals based on double emulsion droplets, characterized in that: The following steps are involved: (1) preparing an inner aqueous phase solution with a self-assembled organic material and a soluble salt, preparing an intermediate oil phase solution with a water-insoluble substance and a water-insoluble organic solvent, and preparing an outer aqueous phase solution with a soluble salt, wherein: (2) introducing the inner aqueous phase solution, the intermediate oil phase solution and the outer aqueous phase solution obtained in step (1) into the corresponding channels of the microfluidic chip to prepare double emulsion droplets loaded with self-assembled organic materials; (3) The double emulsion droplets loaded with self-assembled organic materials obtained in step (2) are subjected to water migration and then incubated to obtain self-assembled organic material crystals based on the double emulsion droplets.

2. The incubation method of self-assembled organic material crystals based on double emulsion droplets according to claim 1, characterized in that: The self-assembling organic material is a water-soluble organic material that can be assembled into periodic structure crystals.

3. The incubation method of self-assembled organic material crystals based on double emulsion droplets according to claim 1, characterized in that: In the inner aqueous phase solution and the outer aqueous phase solution, the soluble salt is one of potassium salt, sodium salt, magnesium salt and ammonium salt.

4. The incubation method of self-assembled organic material crystals based on double emulsion droplets according to claim 1, characterized in that: The inner aqueous phase solution and the outer aqueous phase solution both further include a buffer solution and a surfactant.

5. The incubation method of self-assembled organic material crystals based on double emulsion droplets according to claim 4, characterized in that: The buffer is TAE buffer.

6. The incubation method of self-assembled organic material crystals based on double emulsion droplets according to claim 4, characterized in that: The surfactant is polyvinyl alcohol, sodium lauryl sulfate or Tween 80.

7. The incubation method of self-assembled organic material crystals based on double emulsion droplets according to claim 1, characterized in that: The water-insoluble substance is at least one of silicone oil, mineral oil and liposome.

8. The incubation method of self-assembled organic material crystals based on double emulsion droplets according to claim 1, characterized in that: The size of the self-assembled organic material crystal based on double emulsion droplets is 15 to 60 μm.

9. The incubation method of self-assembled organic material crystals based on double emulsion droplets according to claim 1, characterized in that: The crystal content of the double emulsion droplets after incubation is ≥95%.

10. The incubation method of self-assembled organic material crystals based on double emulsion droplets according to claim 1, characterized in that: In the double emulsion droplets after incubation, the ratio of a single self-assembled organic material crystal contained in a single double emulsion droplet is ≥80%.

Images