LBP gene knockout A549 and Calu-3 cell strains and application thereof in influenza A virus

Abstract

The invention discloses an LBP gene knockout A549 and Calu-3 cell strain and application thereof in influenza A virus, and relates to the technical field of molecular biology and genetics. Two gene knockout cells are constructed by knocking out LBP genes of an A549 cell and a Calu-3 cell, the expression level of the LBP protein is detected through Western Blot, it is found that the LBP protein in the A549 cell and the Calu-3 cell is not expressed, proliferation of the influenza A virus on the A549 cell and the Calu-3 cell can be effectively inhibited, and therefore the influenza A virus can be effectively inhibited. And the A549 cell and the Calu-3 cell are enabled to have stronger resistance to the influenza A virus.

Description

Technical Field

[0001] The present invention relates to the technical fields of molecular biology and genetics, and particularly to A549 and Calu-3 cell lines with LBP gene knockout and their applications in influenza A virus. Background Art

[0002] Influenza A virus (IAV) belongs to the family Orthomyxoviridae and is a highly contagious and variable RNA virus. This virus can infect a variety of hosts, including humans, birds, and other mammals, and is one of the main pathogens causing seasonal epidemics and pandemics globally. The genome of influenza A virus consists of eight negative-sense single-stranded RNA segments, encoding multiple proteins, some of which play key roles in the viral replication cycle.

[0003] The pathogenic mechanism of influenza A virus is very complex, mainly including the following aspects:

[0004] Virus invasion and cell recognition: The virus binds to sialic acid receptors on the surface of host cells through its hemagglutinin (HA) protein on the surface, initiating the process of virus entry into cells.

[0005] Virus replication and transcription: Once inside the cell, the viral ribonucleic acid polymerase complex begins to replicate the genome and synthesize mRNA, producing the structural and non-structural proteins required for new virus particles.

[0006] Immune escape: Influenza A virus has the ability to evade the host immune system, which mainly depends on its frequent antigenic drift and antigenic shift, reducing the effectiveness of vaccines and increasing the difficulty of prevention and control.

[0007] Inflammatory response and tissue damage: Viral infection triggers strong innate and adaptive immune responses, especially an overactive inflammatory response that may cause severe damage to the lungs and other organs, further exacerbating the condition.

[0008] Given the above complex pathogenic mechanism, it is particularly important to develop efficient and precise antiviral strategies. Traditional small molecule drugs, such as neuraminidase inhibitors, although they can inhibit virus transmission to a certain extent, are prone to drug resistance problems; while antibody-based treatment methods also face problems of high production costs and difficult technical implementation. Therefore, exploring new targets and mechanisms has become a current research hotspot.

[0009] The LBP (Lipopolysaccharide-binding protein) gene was initially thought to be mainly involved in the recognition process of bacterial lipopolysaccharide (LPS). However, recent studies have found that it may also play an important role in the process of viral infection. Specifically, LBP may affect the intensity of the host's immune response to the virus or directly participate in certain links in the viral life cycle. In the complex network of the interaction between influenza A virus and host cells, there is no clear conclusion on exactly how the LBP gene participates in the core links such as the initiation of virus infection, replication and amplification, and the fine regulation of host immune response. Summary of the Invention

[0010] The object of the present invention is to provide A549 and Calu-3 cell lines with LBP gene knockout and their application in influenza A virus to solve the problems existing in the above-mentioned prior art. The present invention's research found that knocking out the LBP gene of A549 cells and Calu-3 cells can effectively inhibit the proliferation of IAV on A549 cells and Calu-3 cells, making A549 cells and Calu-3 cells have stronger resistance to IAV.

[0011] To achieve the above object, the present invention provides the following solutions:

[0012] The present invention provides the application of a biological material with LBP gene knockout in the preparation of a drug for inhibiting the replication of influenza A virus, and the nucleotide sequence of the LBP gene is as shown in SEQ ID NO.1.

[0013] Further, the biological material is the CRISPR / Cas9 gene editing system.

[0014] Further, the sgRNA sequence of the CRISPR / Cas9 gene editing system is as shown in any one of SEQ ID NO.2-7.

[0015] Further, the inhibition of the replication of influenza A virus means inhibiting the replication of influenza A virus in A549 cells or Calu-3 cells.

[0016] The present invention also provides a drug for inhibiting the replication of influenza A virus, including a biological material with LBP gene knockout, and the nucleotide sequence of the LBP gene is as shown in SEQ ID NO.1.

[0017] The present invention also provides a method for constructing an A549 cell line for inhibiting the replication of influenza A virus, including the step of knocking out the LBP gene of A549 cells to construct the A549 cell line for inhibiting the replication of influenza A virus;

[0018] The nucleotide sequence of the LBP gene is shown as SEQ ID NO.1.

[0019] The present invention also provides a method for constructing a Calu-3 cell line that inhibits the replication of influenza A virus, including the step of knocking out the LBP gene of Calu-3 cells to construct the Calu-3 cell line that inhibits the replication of influenza A virus;

[0020] The nucleotide sequence of the LBP gene is shown as SEQ ID NO.1.

[0021] The present invention also provides an A549 cell line that inhibits the replication of influenza A virus constructed according to the above construction method.

[0022] The present invention also provides a Calu-3 cell line that inhibits the replication of influenza A virus constructed according to the above construction method.

[0023] The present invention also provides the application of the above A549 cell line that inhibits the replication of influenza A virus or Calu-3 cell line that inhibits the replication of influenza A virus in screening the action targets for inhibiting influenza A virus.

[0024] The present invention discloses the following technical effects:

[0025] By knocking out the LBP gene of A549 cells and Calu-3 cells, the present invention constructs two gene knockout cells. After detecting the expression level of LBP protein by Western Blot, it is found that the LBP protein is not expressed in A549 cells and Calu-3 cells, which can effectively inhibit the proliferation of IAV on A549 cells and Calu-3 cells, and endow A549 cells and Calu-3 cells with stronger resistance to IAV.

[0026] The cell lines developed by the present invention with stronger resistance to viruses can maintain high survival rate and functional stability under virus infection conditions, which makes them ideal high-throughput screening platforms. Researchers can use these cell lines to quickly test a large number of compound libraries and screen out candidate drugs with potential antiviral activity. By using the cell lines with stronger resistance to viruses provided by the present invention, not only can the efficiency and accuracy of antiviral drug screening be significantly improved, but also valuable research tools can be provided for drug development, promoting the research and development and clinical application of new drugs. Description of the Drawings

[0027] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the accompanying drawings required in the embodiments. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other accompanying drawings can be obtained based on these drawings.

[0028] Figure 1 Schematic diagram of LBP gene knockout;

[0029] Figure 2 Results of Western Blot detection of LBP protein expression in A549 cells;

[0030] Figure 3 Results of Western Blot detection of LBP protein expression in Calu-3 cells;

[0031] Figure 4 Virus titer detection results of LBP gene knockout A549 cells (LBP - / - ) infected with IAV and wild-type A549 cells (WT);

[0032] Figure 5 Virus titer detection results of LBP gene knockout Calu-3 cells (LBP - / - ) infected with IAV and wild-type Calu-3 cells (WT). Detailed implementation manners

[0033] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be regarded as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0034] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0035] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although this invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of this invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the said documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0036] Without departing from the scope or spirit of this invention, various modifications and variations can be made to the specific embodiments of the specification of this invention, which are obvious to those skilled in the art. Other embodiments obtained from the specification of this invention are obvious to those skilled in the art. The specification and examples of this invention are merely exemplary.

[0037] Regarding "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0038] The information of the cells used in the following examples is as follows:

[0039] Human lung adenocarcinoma cells (Calu-3) were purchased from Wuhan Punosai Life Science Co., Ltd.; human non-small cell lung cancer cells (A549) were purchased from Wuhan Punosai Life Science Co., Ltd.

[0040] Example 1 Construction of an A549 cell line with LBP gene knockout

[0041] Based on the CRISPR / Cas9 system, the LBP gene in wild-type A549 cells was edited as detailed below:

[0042] I. Experimental methods

[0043] 1. Design of sgRNA

[0044] Search for the coding region sequence of the human LBP gene on the NCBI website; select the 6th and 7th exons of the LBP gene, and design sgRNAs ([ Figure 1 ) targeting the knockout sites of the 6th and 7th exons on the website. Design sgRNA1 in the 6th exon region and sgRNA2 in the 7th exon region, and use the dual-target knockout method to knockout the LBP gene. After adding restriction enzyme sites according to the sgRNA sequence, the primer sequences were formed, and the primer sequence information is shown in Table 1.

[0045] The nucleotide sequence of the LBP gene is shown in SEQ ID NO.1:

[0046] gtgagggtcctggggccgggctgcgtgggtgaggctttccctcagggtcagccattctttgggccacctgtccccccaacttcagatctgtcctcatcctcccagtggttcccgctttgtcaagggccgggtgatatggagtggtggggagtgtttccagagctaggattctcccacggctgtcttacacctctcaggtcttaacgcttccctcctccttcttcccctactttgccttgcccatcatgcagaaaaggccaatcagagcgggtcttagggagtgtagatgggcctagggcatatagaggggctggccaggacttcctgtgggttaatgtagcaaagcttctggtgagcttttcattaaaagacataacactgcctttaatggtggagtttcaggcagtgttccagccagcgtcccttcatcggactgtgtaggggaatacctagcccctgccccacgataggctttgaaaagtccaattggaccctatttccctctccag。

[0047] sgRNA1: CGACATTGATTATAGCTTAG (SEQ ID NO.2);

[0048] sgRNA2: TAGCTTAGTGGAAGCCCCTC (SEQ ID NO.3);

[0049] Table 1 Primer sequence information

[0050]

[0051] 2. Construction and identification of recombinant plasmid

[0052] (1) sgRNA annealing

[0053] Using the synthesized sgRNA, double-stranded dsDNA was formed by gradient cooling PCR annealing.

[0054] The annealing system was: upstream primer (100 μmol / L) 1 μL, downstream primer (100 μmol / L) 1 μL, 10×T4 ligation Buffer 1 μL, T4 PNK 0.5 μL, ddH 2 O 6.5 μL, with a total of 10 μL.

[0055] After mixing the primers and enzymes according to the annealing system, incubate at 37 °C for 30 min and at 95 °C for 5 min in a PCR instrument, and then cool to 25 °C at a rate of 5 °C / min. Double-stranded dsDNA with sticky ends is formed by gradient temperature drop PCR annealing. Dilute the annealing product 1:200 into sterile water or EB.

[0056] (2) Plasmid linearization

[0057] Digest the vector plasmid with the restriction endonuclease BsmBⅠ. Take 2 μg of LentiCRISPR v2 (L) plasmid, 2 μL of BsmBⅠ endonuclease, and 10 μL of 10× NEB Buffer, and add ddH 2 O to a total volume of 50 μL. After overnight digestion at 37 °C, linearized vector DNA is obtained. After the digestion is completed, perform agarose gel electrophoresis on the digested plasmid (1% gel, 100 V, 30 min). Use a DNA gel recovery kit to purify and recover the linearized fragment and measure its concentration.

[0058] (3) Vector ligation

[0059] Ligate at room temperature for 1 h to obtain the enzyme digestion and ligation product.

[0060] Prepare the system as follows: 50 ng of the purified and digested vector, 1 μL of the diluted double-stranded dsDNA, 5 μL of 2× Quick Ligase Buffer, 1 μL of Quick Ligase, and add ddH 2 O to a total volume of 10 μL for ligation (add Quick Ligase last).

[0061] Then perform transformation. Transfer the enzyme digestion and ligation product into competent Escherichia coli Stbl3 cells, and evenly coat it on a solid medium containing ampicillin (AMP). Centrifuge the transformed bacterial solution at 6000 rpm for 5 min, leave 100 μL of the resuspended bacterial solution, and evenly coat it on an LB agar culture plate (AMP-resistant). Incubate at 37 °C in an inverted position for about 12 h. After single colonies grow on the culture plate, pick 3 - 5 single colony strains from each plate, add them to an LB liquid medium containing AMP, and incubate at 37 °C and 200 rpm for 6 - 8 h. Perform colony PCR identification on the picked colonies. After obtaining positive clones, perform sequencing verification. The positive plasmids are named L-LBP-sg1 and L-LBP-sg2 respectively.

[0062] 3. Lentivirus packaging

[0063] Digest 293T cells in the logarithmic growth phase with trypsin, and adjust the cell density to about 5.0×10 6Cells / 15 mL were inoculated into a 10-cm cell culture dish and cultured in an incubator at 37 °C with 5% CO 2 for 24 h. When the cell density reached 70%-80%, positive plasmid L-LBP (obtained by mixing L-LBP-sg1 and L-LBP-sg2 at a volume ratio of 1:1), lentiviral packaging vectors pLp1, pLp2, and VsVG were mixed evenly at a total volume of 2.0 mL and incubated at room temperature for 15 min. The mixture was added dropwise to the 293T cell culture medium and cultured in an incubator at 37 °C with 5% CO 2 for 6 h. Then, the medium containing the transfection mixture was discarded, and 20 mL of DMEM cell medium containing 10% fetal bovine serum was slowly added and cultured in an incubator at 37 °C with 5% CO 2 for another 36-48 h. The supernatant of the transfected 293T cells was collected, centrifuged at 1000 rpm for 5 min, and the supernatant was taken after centrifugation to obtain the virus solution for the next experiment.

[0064] 4. Lentivirus infection of cells and screening of stable transfected strains

[0065] Determination of the optimal concentration of puromycin tolerated by A549 cells:

[0066] A549 cells were inoculated into a 6-well plate and cultured in an incubator at 37 °C with 5% CO 2 for 24 h. After the A549 cell growth density reached 80%, puromycin at 0, 1, 2, and 3 μg / mL was added respectively. After continuous culture for 5-7 d, the optimal drug screening concentration was the puromycin concentration used when the cell survival rate was lower than 5%. At this time, the puromycin concentration was 1.5 μg / mL.

[0067] Infection of A549 cells with the packaged lentivirus:

[0068] A549 cells were inoculated into a 6-well plate. After 24 h, the medium was replaced with a medium containing 8 μg / mL polybrene and lentivirus was added for infection. A549 cells not infected with the virus were used as the negative control group. The final volume of the 6-well plate was 2 mL. After 16 h of infection, the medium was replaced with DMEM cell medium containing 10% fetal bovine serum. After 36 h, puromycin with a final concentration of 1.5 μg / mL was added to screen the cells. After continuous culture for 5-7 d, when the negative control cells were all dead, the cells were transferred to a 6-cm dish for continued pressure culture.

[0069] 5. Monoclonal cell culture

[0070] Normal pancreatic enzyme digestion of cells. After centrifugation at 1000 rpm for 5 min, the cells were blown into single cells, 50 cells were counted, and the cells were added to 10 mL of medium, and then blown evenly. 100 μL of cell suspension was added to each well of a 96-well plate, so that there were about 0.5 cells per well. After 24 h, the cell adhesion and morphology were observed, and 100 μL of medium was supplemented in the monoclonal wells. When the cells grew confluent in the 96-well plate, the following procedure was followed: passage to a 24-well plate, then to a 6-well plate for expanded culture, and protein samples were collected for Western Blot, and the cells were cryopreserved.

[0071] 6. Detection of LBP protein expression in cells by Western Blot

[0072] Control A549 cells and A549 cells with LBP knockout were selected. After washing with PBS, total cell proteins were extracted with RIPA lysis buffer and protein quantification was performed by the BCA method. 50 μg of total protein from each sample was taken for SDS-PAGE electrophoresis. After electrophoresis, it was transferred to a PVDF membrane and wet transferred for 120 min. It was blocked with 5% BSA on a shaker for 1 h. Incubation with primary and secondary antibodies was carried out, and an exposure substrate was added for exposure. Using β-actin as an internal reference, the expression level of LBP protein was detected.

[0073] II. Experimental results

[0074] Detection results of the expression level of LBP protein in A549 cells after LBP gene knockout:

[0075] The A549 cells with successful LBP gene knockout were subjected to monoclonal culture, and proteins were collected for Western Blot detection of LBP protein expression. The uninfected A549 cell line was used as a control. Western Blot detection showed that LBP protein was not expressed in A549 cells after LBP gene knockout (see Figure 2 ), indicating that the LBP gene knockout was successful.

[0076] Example 2

[0077] A Calu-3 cell line with LBP gene knockout was constructed. The construction method was the same as the construction process of the A549 cells with LBP gene knockout in Example 1. Western Blot detection showed that LBP protein was not expressed in Calu-3 cells after LBP gene knockout (see Figure 3 ), indicating that the LBP gene knockout was successful.

[0078] Example 3 Effect of LBP gene knockout on the proliferation of influenza A virus

[0079] Add A549 cells with knocked-out LBP gene and wild-type A549 cells with the same number of cells into 6-well plates, with 3 wells in each group. When the cell growth density reaches 80%-90%, discard the cell culture medium, wash twice with PBS, add DMEM medium and 100 μL of the original IAV virus solution, and place it in a 37°C, 5% CO 2 cell incubator for 1 h. Gently shake several times every 15 min, discard the DMEM medium, wash twice with PBS, and add virus growth medium (VGM) to culture for 3 days. Observe the cell status during the culture period to see if there is a cytopathic effect (i.e., CPE phenomenon). When most of the cells show apoptosis, collect the supernatant using a centrifuge at 1000 rpm for 10 min. Perform a hemagglutination assay to detect the viral hemagglutinin (HA), and store it in a -80°C refrigerator. Calculate the TCID 50 value of the virus, and thus obtain the virus titer. It was found that compared with the WT group (i.e., the wild-type A549 cell group and the wild-type Calu-3 cell group), the LBP - / - group (i.e., the A549 cell group with knocked-out LBP gene and the Calu-3 cell group with knocked-out LBP gene) had a significantly increased virus titer (see Figure 4 and Figure 5 ), that is, the LBP gene has a protective effect on IAV, and knocking out the LBP gene can reduce the infectivity of IAV virus to A549 cells and Calu-3 cells.

[0080] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of a biological material with LBP gene knocked out in the preparation of a drug for inhibiting the replication of influenza A virus, characterized in that: The nucleotide sequence of the LBP gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The biological material is the CRISPR / Cas9 gene editing system.

3. The use according to claim 2, characterized in that: The sgRNA sequence of the CRISPR / Cas9 gene editing system is shown in any one of SEQ ID NO.2-7.

4. The use according to claim 1, characterized in that: The inhibiting of influenza A virus replication refers to inhibiting influenza A virus replication in A549 cells or Calu-3 cells.

5. A drug for inhibiting the replication of influenza A virus, characterized in that: The invention comprises biological materials with LBP gene knocked out, wherein the nucleotide sequence of the LBP gene is shown as SEQ ID NO.

1.

6. A method for constructing an A549 cell line that inhibits influenza A virus replication, characterized in that: The method comprises the steps of knocking out the LBP gene of A549 cells to construct the A549 cell line that inhibits the replication of influenza A virus; The nucleotide sequence of the LBP gene is shown in SEQ ID NO.

1.

7. A method for constructing a Calu-3 cell line that inhibits influenza A virus replication, characterized in that: The method comprises the steps of knocking out the LBP gene of Calu-3 cells to construct the Calu-3 cell line that inhibits the replication of influenza A virus; The nucleotide sequence of the LBP gene is shown in SEQ ID NO.

1.

8. An A549 cell line constructed according to the construction method of claim 6 and capable of inhibiting the replication of influenza A virus.

9. A Calu-3 cell line constructed according to the construction method of claim 7 and capable of inhibiting the replication of influenza A virus.

10. Use of the A549 cell line for inhibiting influenza A virus replication as claimed in claim 8 or the Calu-3 cell line for inhibiting influenza A virus replication as claimed in claim 9 in screening targets for inhibiting influenza A virus.

Images