Hepatocellular carcinoma prognosis marker and application thereof

Abstract

The invention particularly discloses a hepatocellular carcinoma prognostic marker and application thereof, and relates to the technical field of biological medicine. The invention provides the application of the expression level of the debranching enzyme homolog 1 as the hepatocellular carcinoma diagnosis and / or prognosis marker, compared with the traditional marker, the debranching enzyme homolog 1 more emphasizes screening or early diagnosis, and the DBR1 has potential value in reflecting tumor invasiveness and predicting patient prognosis. Experimental results show that high DBR1 expression is often related to poor prognosis indexes such as poor lifetime and high recurrence risk of liver cancer patients, and patients with low expression show relatively better prognosis. Due to the difference, the DBR1 can provide more accurate risk stratification basis for clinicians and help to formulate personalized treatment schemes and follow-up visit plans, theoretical basis and experimental basis are provided for developing new treatment strategies, and good clinical transformation and clinical application prospects are achieved.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and particularly to a prognostic marker for hepatocellular carcinoma and its applications. Background Art

[0002] Hepatocellular carcinoma (HCC) is one of the main causes of cancer-related deaths globally. Despite significant progress in prevention, screening, diagnosis, and treatment technologies in recent years, the incidence and mortality of HCC remain high. According to 2022 data, HCC has become the sixth most common cancer globally and the third leading cause of cancer death. The occurrence of liver cancer is usually accompanied by long-term chronic liver disease or hepatitis virus infection, and its development process takes decades. However, many patients are already in the advanced stage of the disease at the time of diagnosis, and the tumor often has invasive metastasis. Existing treatment methods are difficult to effectively control the disease progression, resulting in an overall unsatisfactory prognosis for HCC patients.

[0003] Currently, the prognosis assessment of HCC mainly relies on imaging examinations (such as CT, MRI) and liver function indicators (such as tumor markers like AFP), but these methods still have deficiencies in the prediction accuracy of overall survival time, recurrence risk, and metastasis trend. Imaging examinations can usually only evaluate tumor progression after obvious lesions appear, and markers such as AFP are often interfered by non-tumor diseases such as hepatitis and cirrhosis, resulting in false positive or false negative results. In addition, although some novel biomarkers have been proposed, most have not yet entered clinical applications, or their correlation with HCC progression and prognosis lacks large-scale verification, making it difficult to meet the needs of individualized prognosis judgment and treatment strategy formulation.

[0004] At the therapeutic level, in recent years, the interventions for HCC have mainly focused on angiogenesis, immune checkpoints, as well as other emerging targets and gene therapy. Angiogenesis plays a crucial role in the development of HCC. Multi-target tyrosine kinase inhibitors such as sorafenib and lenvatinib have become the first-line treatment options for HCC by inhibiting multiple kinase signaling pathways such as VEGFR. FGFR4 inhibitors (such as epigallocatechin) have also gradually shown good efficacy in patients with advanced HCC (especially those with overexpression of FGF19). Immune checkpoint inhibitors (ICIs) have become an important part of HCC treatment. For example, PD-1 / PD-L1 inhibitors (tislelizumab, camrelizumab, etc.) have been approved for clinical use, and CTLA-4 inhibitors (such as ipilimumab) have also shown potential in combination therapy. The multi-target combination strategy (such as the combination of TKI and ICI, the combination of dual immune checkpoint inhibitors) has shown a high remission rate and conversion treatment rate in multiple clinical trials. In addition, some emerging targets (such as phosphatidylserine) and gene therapy strategies are also being actively explored. Some genes such as AKR1B10, SNPD1, SNOZ6, ZXDC, etc. are closely related to the prognosis of HCC. However, the heterogeneity and invasiveness of HCC still make the overall effect of existing treatment options not ideal enough, and the long-term survival rate of patients needs to be improved urgently.

[0005] Based on the above situation, it is urgent to find new molecular markers and potential therapeutic targets that are closely related to tumor malignancy and patient prognosis to promote the individualized diagnosis and treatment of HCC. Summary of the Invention

[0006] (I) Technical problems to be solved

[0007] In view of this, one of the main purposes of the present invention is to provide the application of the expression level of debranching enzyme homolog 1 as a diagnostic and / or prognostic marker for hepatocellular carcinoma. The present invention proposes that DBR1 (debranching enzyme homolog 1, RNA lariat debranching enzyme 1) is a new prognostic marker for hepatocellular carcinoma, which can to a certain extent make up for the deficiencies of the existing prognostic prediction system. The high expression of DBR1 may be related to poor prognostic factors such as tumor malignant progression and poor survival, so it can provide more accurate prognostic judgment for clinical practice. In addition, the key role of DBR1 in the proliferation, migration and invasion of liver cancer cells suggests that it may become a potential therapeutic target, providing new ideas for the precision treatment and drug development of liver cancer. By integrating DBR1 with existing indicators or multi-omics data, the accuracy of prognostic evaluation can be further improved, laying an important foundation for the optimization of personalized treatment plans and the improvement of long-term survival of patients.

[0008] (II) Technical solutions

[0009] To solve the above problems, the present invention provides the use of the expression level of debranching enzyme homolog 1 as a diagnostic and / or prognostic marker for hepatocellular carcinoma.

[0010] In another aspect, the present invention provides the use of a reagent for measuring the expression level of debranching enzyme homolog 1 in a sample in the preparation of a diagnostic agent for evaluating the prognosis of hepatocellular carcinoma in a subject.

[0011] In one embodiment, the use specifically includes:

[0012] S1: Obtaining a biological sample from a subject;

[0013] S2: Measuring the expression level of debranching enzyme homolog 1 in the biological sample of the subject;

[0014] S3: Comparing the expression level of debranching enzyme homolog 1 in the biological sample of the subject with the average level of the expression level of debranching enzyme homolog 1 from one or more control biological samples;

[0015] S4: Based on the comparison with the control debranching enzyme homolog 1 expression level, a higher debranching enzyme homolog 1 expression level indicates a poor prognosis of hepatocellular carcinoma in the subject.

[0016] In one embodiment, the subject is a mammal.

[0017] In one embodiment, the mammal is a human.

[0018] In one embodiment, the subject is healthy.

[0019] In one embodiment, the subject is non - healthy.

[0020] In one embodiment, the subject has hepatocellular carcinoma.

[0021] In one embodiment, the biological sample includes one or a combination of blood, serum, plasma, blood components, synovial fluid, urine, semen, saliva, feces, cerebrospinal fluid, gastric contents, vaginal secretions, mucus, tissue biopsy samples, tissue homogenates, bone marrow aspirates, bone homogenates, sputum, aspirates, wound exudates, swabs or swab rinses.

[0022] In one embodiment, the biological sample is a tissue sample.

[0023] In one embodiment, the tissue sample is a liver tissue.

[0024] In one embodiment, the liver tissue is hepatocellular carcinoma tissue.

[0025] In one embodiment, the liver tissue is adjacent non - cancerous tissue.

[0026] In one embodiment, the liver tissue is fresh.

[0027] In one embodiment, the liver tissue is frozen.

[0028] In one embodiment, the control biological sample includes a biological sample from the subject.

[0029] In one embodiment, the control biological sample includes a biological sample from a non-subject.

[0030] In one embodiment, based on a comparison with the average level of DBR1 expression in the control, a subject with a higher level of DBR1 expression has a high recurrence rate and a poor prognosis, and is thus a high-risk patient.

[0031] In one embodiment, based on a comparison with the average level of DBR1 expression in the control, a subject with a lower level of DBR1 expression has a low recurrence rate and a good prognosis, and is thus a low-risk patient.

[0032] In one embodiment, the method for detecting the level of DBR1 expression includes one or a combination of quantitative PCR (RT-qPCR), electrophoresis technology, DNA microarray, next-generation sequencing (NGS), Western blot analysis, mass spectrometry (MS) analysis, fluorescence-activated cell sorting (FACS) analysis, enzyme-linked immunosorbent assay (ELISA), immunohistochemistry (IHC), and immunofluorescence.

[0033] In one embodiment, the method for detecting the level of DBR1 expression is quantitative PCR and Western blot analysis.

[0034] In another aspect, the present invention provides a diagnostic kit for evaluating the prognosis of hepatocellular carcinoma in a subject, and the diagnostic kit contains the above-mentioned diagnostic agent.

[0035] In another aspect, the present invention provides the use of a DBA1 inhibitor in the preparation of a drug for preventing and / or treating hepatocellular carcinoma and / or diseases and / or symptoms associated with hepatocellular carcinoma.

[0036] In one embodiment, the inhibitor includes one or a combination of an antibody, siRNA, miRNA, gRNA, sgRNA, and antisense oligonucleotide.

[0037] In one embodiment, the inhibitor is sgRNA.

[0038] In another aspect, the present invention provides the use of a pharmaceutical composition in the preparation of a drug for preventing and / or treating hepatocellular carcinoma and / or diseases and / or symptoms associated with hepatocellular carcinoma, and the pharmaceutical composition contains a therapeutically effective amount of the above-mentioned inhibitor.

[0039] In one embodiment, the pharmaceutical composition further comprises a pharmaceutically or immunologically acceptable carrier or excipient.

[0040] On the other hand, the present invention provides the use of a pharmaceutical preparation in the manufacture of a drug for preventing and / or treating hepatocellular carcinoma and / or diseases and / or symptoms associated with hepatocellular carcinoma, wherein the pharmaceutical preparation comprises the above-mentioned pharmaceutical composition.

[0041] On the other hand, the present invention provides a kit for detecting hepatocytes, which comprises a DBR1 antibody.

[0042] (III) Beneficial effects

[0043] The present invention provides the use of DBR1 expression level as a diagnostic and / or prognostic marker for hepatocellular carcinoma. Compared with the prior art, the following beneficial effects are achieved:

[0044] 1. Compared with traditional markers that focus more on screening or early diagnosis, DBR1 has more potential value in reflecting tumor invasiveness and predicting patient prognosis. Experimental results show that high DBR1 expression is often associated with poor prognosis indicators such as shorter survival time and higher recurrence risk in liver cancer patients, while patients with low expression show relatively better prognosis. This difference enables DBR1 to provide a more accurate basis for risk stratification for clinicians, helping to develop personalized treatment plans and follow-up programs.

[0045] 2. Although traditional markers such as AFP and DCP can reflect certain tumor biological characteristics to a certain extent, they are still not ideal in predicting the long-term survival, recurrence, and metastasis of liver cancer patients. Incorporating DBR1 detection into the prognostic assessment system can complement existing indicators: for patients with negative traditional marker tests but still at high risk, high DBR1 expression indicates potential malignant progression, thus strengthening the monitoring and treatment intervention for such patients.

[0046] 3. In addition to being used for prognosis judgment, the important role of DBR1 in tumor cell proliferation, migration, and invasion also makes it have the potential to become a therapeutic target. High expression of DBR1 may promote the malignant biological behavior of liver cancer cells. Intervening in DBR1 or jointly regulating its downstream signaling pathway may provide new solutions to the problems of drug resistance and recurrence. When combined with existing targeted drugs or immunotherapy, DBR1-targeted intervention is expected to further improve the efficacy or delay tumor progression.

[0047] (IV) Terms and definitions

[0048] As used herein, the terms "DBR1" and "RNA lariat debranching enzyme 1" are used interchangeably and refer to debranching enzyme homolog 1.

[0049] The DBR1 disclosed in the present invention can be a naturally purified product, a chemically synthesized product, or a product produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher animals, insects, and mammalian cells). Preferably, the DBR1 disclosed in the present invention is encoded by the human DBR1 gene or its homologous gene or family gene.

[0050] Depending on the host used in the recombinant production protocol, the DBR1 disclosed in the present invention can be glycosylated or can be non-glycosylated. The term also includes active fragments and active derivatives of DBR1.

[0051] As used herein, the terms "inhibitor" or "inhibitor of DBR1 or its encoding nucleic acid molecule" are used interchangeably and refer to a substance that can reduce the level or activity of DBR1 or its encoding nucleic acid molecule. Inhibitors that can be used in the present disclosure include, but are not limited to: antibodies against DBR1 or the nucleic acid molecule encoding the protein, siRNA, miRNA, gRNA, sgRNA, antisense oligonucleotides.

[0052] As used herein, a "patient" or "subject" can be a vertebrate. In one embodiment, the term "subject" includes humans and animals, particularly mammals and other organisms.

[0053] As used herein, the term "diagnosis" involves the identification and (early) detection of a clinical condition. In addition, the assessment of severity can be encompassed in the term "diagnosis".

[0054] As used herein, the term "prognosis" involves predicting the outcome or specific risks of a subject. This can also include an estimate of the chance of recovery or the chance of an adverse outcome for the subject.

[0055] As used herein, terms such as "marker", "surrogate", "prognostic marker", "factor", or "biomarker" are used interchangeably and refer to a measurable and quantifiable biological marker (e.g., the concentration of a specific protein or enzyme or a fragment thereof, the concentration of a specific hormone or a fragment thereof, or the presence of a biological substance or a fragment thereof), which is used as an indicator for assessments related to health and physiology, such as the risk of a disease / disorder / clinical condition, preferably an adverse event. A marker or biomarker is defined as a characteristic that can be objectively measured and evaluated as an indicator of normal biological processes, the pathogenesis process, or the pharmacological response to a therapeutic intervention.

[0056] As used herein, the term "biological sample" is a biological sample obtained or isolated from a patient or subject. The "sample" as used herein can refer, for example, to a body fluid or tissue sample obtained for analysis, diagnosis, prognosis, or evaluation of a subject of interest (such as a patient). Preferably herein, the sample is blood, serum, plasma, blood components, synovial fluid, urine, semen, saliva, feces, cerebrospinal fluid, gastric contents, vaginal secretions, mucus, tissue biopsy sample, tissue homogenate, bone marrow aspirate, bone homogenate, sputum, aspirate, wound exudate, swab, or swab rinse fluid, etc.

[0057] As used herein, the term "antisense oligonucleotide" refers to an unmodified or modified nucleic acid having a nucleotide sequence complementary to a polynucleotide sequence of the DBR1 gene, the polynucleotide sequence of the DBR1 gene including a polynucleotide sequence related to the transcription or translation of the DBR1 gene (such as the promoter of the DBR1 gene polynucleotide), wherein the antisense polynucleotide is capable of hybridizing with the DBR1 gene polynucleotide sequence. Particular attention is paid to antisense polynucleotides capable of inhibiting the transcription and / or translation of the polynucleotide encoding the DBR1 gene in vitro or in vivo.

[0058] As used herein, the terms "siRNA oligonucleotide", "RNAi oligonucleotide", "short interfering RNA", or "siRNA" are used interchangeably and refer to oligonucleotides that act via post-transcriptional gene silencing (also known as RNA interference (RNAi)).

[0059] As used herein, the terms "guide RNA", "mature crRNA", "guide sequence", "gRNA" are used interchangeably and have the meaning commonly understood by those skilled in the art. Generally, a guide RNA can contain a direct repeat (DR) and a guide sequence, or consist essentially of or of a direct repeat and a guide sequence (also known as a spacer in the context of the endogenous CRISPR system).

[0060] As used herein, the term "therapeutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level includes factors such as the type and severity of the subject, age, gender, drug activity, sensitivity to the drug, administration time, administration route and excretion rate, duration of treatment, factors including concomitant drugs, and other factors well known in the medical field.

[0061] As used herein, the term "pharmaceutically acceptable" ingredient is a substance that is suitable for humans and / or animals without excessive adverse reactions (such as toxicity, irritation, and allergic reactions), that is, having a reasonable benefit / risk ratio.

[0062] As used herein, the term "treating" a condition or a patient refers to taking steps to obtain a beneficial or desired result, including a clinical result. Beneficial or desired clinical results include, but are not limited to, alleviating, substantially inhibiting, slowing, or reversing the progression of a disease, condition, or disorder, substantially ameliorating or relieving the clinical or aesthetic symptoms of a condition, substantially preventing the clinical or aesthetic symptoms of a disease, condition, or disorder, and avoiding adverse or undesirable symptoms. Treating also refers to accomplishing one or more of the following: (a) reducing the severity of a disorder; (b) limiting the development of characteristic symptoms of the disorder being treated; (c) limiting the worsening of the characteristic symptoms of the disorder being treated; (d) limiting the recurrence of the disorder in patients previously having the disorder; and / or (e) limiting the recurrence of symptoms in patients previously without symptoms of the disorder.

[0063] As used herein, the term "preventing" refers to reducing the likelihood of the onset (or recurrence) of a disease, disorder, condition, or associated symptoms (such as acute myeloid leukemia). BRIEF DESCRIPTION OF THE DRAWINGS

[0064] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0065] Figure 1 (A) shows the expression difference of the DBR1 gene in normal tissues and liver cancer tissues. The results show that the expression of DBR1 is significantly reduced in liver cancer tissues. Figure 1 (B) further compares the expression of DBR1 in different liver cancer stages (stages 1 and 2 vs. stages 3 and 4), and finds that the expression of DBR1 in advanced liver cancer (stages 3 and 4) is significantly lower than that in early liver cancer (stages 1 and 2). Figure 1 (C) is a survival curve, grouped according to the DBR1 expression level (high expression vs. low expression). The results show that the survival rate of patients in the high-expression group is significantly higher than that in the low-expression group, suggesting that high DBR1 expression may be associated with a better survival prognosis. Figure 1 (D) is an immunohistochemical staining sample from the Human Protein Atlas database (HPA) (tumors: ID3477, ID3196; normal tissues: ID3222, ID2429), showing the expression of DBR1 in the liver tissues of patients. The results show that the expression of DBR1 is higher in normal tissues and significantly reduced in liver cancer tissues. Figure 1 (E) and Figure 1(F) The difference in DBR1 expression was further verified using the GSE60502 and GSE64041 datasets. In the GSE60502 dataset, DBR1 expression in liver cancer tissues was significantly lower than that in normal tissues (p<0.01), while in the GSE64041 dataset, similar results showed that DBR1 expression in liver cancer tissues was significantly decreased (p<0.05). Figure 1 (G) shows the HE staining images and spatial analysis results of liver cancer tissues from the HCC DB database. In HE staining, the tumor area can be clearly distinguished from other areas. Spatial analysis marked the tumor area (red), stroma area (green), normal tissue (blue), and immune cell area (orange). At the same time, the expression heat map of DBR1 showed that the expression of DBR1 in the tumor area was significantly lower than that in other areas, further supporting the correlation between DBR1 expression and the occurrence and development of liver cancer.

[0066] Figure 2 (A) is a schematic diagram of intraoperative samples from 5 patients with primary hepatocellular carcinoma collected from the Department of Liver Surgery, First Affiliated Hospital of USTC. All patients were first diagnosed and treated without any anti-cancer treatment. Liver cancer tissue and corresponding adjacent normal liver tissue were collected from each patient to ensure the authenticity and initial nature of the samples. Figure 2 (B): The relative expression level of DBR1 mRNA in liver cancer tissues and adjacent normal tissues was detected by quantitative PCR. The results showed that the mRNA expression level of DBR1 in liver cancer tissues was significantly higher than that in adjacent normal tissues (*p<0.05). The data are expressed as mean ± standard error (SEM), and each point represents one patient. Figure 2 (C) Paired analysis results showed that the mRNA expression level of DBR1 in liver cancer tissues of all patients was higher than that in the corresponding adjacent normal tissues. The connecting line represents two tissue samples from the same patient. Figure 2 (D): Western blot was used to detect the expression level of DBR1 protein in liver cancer tissues and adjacent normal tissues. ACTIN was used as an internal reference, and the results showed that the protein expression of DBR1 in liver cancer tissues was significantly higher than that in adjacent normal tissues, further supporting its high expression in liver cancer.

[0067] Figure 3 (A): The relative expression levels of DBR1 protein were detected by RT-qPCR and Western Blot in different liver cancer cell lines (HepG2, Hep3B, LM3, MHCC97H, Huh7). The results showed that the expression of DBR1 in different cell lines was quite different, and the expression of DBR1 was the highest in Huh7 cell line. Figure 3(B): Effects of DBR1 knockout (DBR1KO) and re-expression of human DBR1 after DBR1 knockout (DBR1KO+hDBR1OE) on the transcriptional level and protein expression of DBR1 in Huh7 cells. DBR1KO significantly reduced the expression level of DBR1, while DBR1KO+hDBR1OE could restore the expression of DBR1. Data are presented as mean ± standard error of the mean (SEM), ns indicates no statistical difference, and **** indicates p < 0.0001. Figure 3 (C): Scratch assay was used to evaluate the effect of DBR1 on the migration ability of Huh7 cells. DBR1KO significantly inhibited the migration ability of cells, while DBR1KO+hDBR1OE could significantly restore the migration ability of cells. The right bar graph shows the quantitative analysis of the migration distance, ns indicates no statistical difference, and * indicates p < 0.05. Figure 3 (D): Cell proliferation assay (MTT method) was used to detect the effect of DBR1 on the proliferation ability of Huh7 cells. DBR1KO significantly reduced the proliferation ability of cells, while DBR1KO+hDBR1OE could restore the proliferation ability of cells. **** indicates p < 0.0001. Figure 3 (E): Transwell assay was used to evaluate the effect of DBR1 on the invasion ability of Huh7 cells. DBR1KO significantly inhibited the invasion ability of cells, while DBR1KO+hDBR1OE could restore the invasion ability of cells. The right bar graph shows the quantitative analysis of the number of invasive cells, **** indicates p < 0.0001. Detailed implementation manners

[0068] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention. Apparently, the described embodiments are some, but not all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0069] As used herein, "comprising", "having" or "including" includes "containing", "consisting essentially of", "substantially consisting of", and "consisting of"; "consisting essentially of", "substantially consisting of" and "consisting of" are subordinate concepts of "comprising", "having" or "including".

[0070] The experimental methods used in the following embodiments are all conventional methods unless otherwise specified, and the reagents, methods and equipment used are all conventional reagents, methods and equipment in the technical field of the present invention unless otherwise specified.

[0071] Example 1

[0072] Bioinformatics analysis of DBR1 gene expression:

[0073] 1. Data acquisition and preprocessing

[0074] Download the RNA-seq data and its clinical information of hepatocellular carcinoma patients from the TCGA database, including the survival time and tumor stage of the patients. Additionally, download the GSE60502 and GSE64041 datasets from the GEO database, which contain gene expression data of normal liver tissues and liver cancer tissues. The downloaded data is cleaned and standardized (such as log2 transformation) using the R language, and the expression data of the DBR1 gene is screened for subsequent analysis, while low-quality samples and missing values are excluded.

[0075] 2. Differential gene expression analysis

[0076] In the TCGA dataset, extract the expression levels of the DBR1 gene in normal liver tissues and liver cancer tissues. Use the Wilcoxon rank sum test to analyze the expression differences between the two groups, and visually display the results through box plots ( Figure 1 A), and the results show that the expression of DBR1 is significantly decreased in liver cancer tissues. According to the tumor stage information, the liver cancer patients are divided into an early group (stages I and II) and a late group (stages III and IV). Use the Kruskal-Wallis test to analyze the differences in DBR1 expression levels among samples of different stages, and display the results with box plots ( Figure 1 B).

[0077] 3. Survival analysis

[0078] Based on the median value of DBR1 expression in the TCGA database samples, the patients are divided into a high-expression group and a low-expression group. Use the survival package in the R language to calculate the survival rate and draw the Kaplan-Meier survival curve, compare the overall survival rates (Overall Survival, OS) of the two groups of patients, and evaluate the statistical significance of the survival differences through the log-rank test ( Figure 1 C).

[0079] 4. Immunohistochemistry data analysis

[0080] Immunohistochemical staining samples obtained from the Human Protein Atlas (HPA) database contain normal liver tissue samples (ID3222, ID2429) and liver cancer tissue samples (ID3477, ID3196). By observing the immunohistochemical images, compare the expression levels of the DBR1 protein in normal tissues and liver cancer tissues, and analyze in combination with the quantitative results provided by the database ( Figure 1 D).

[0081] 5. Validation of GEO data

[0082] In the GEO dataset, the expression levels of DBR1 in the data of GSE60502 and GSE64041 were extracted, and the expression differences between normal tissues and liver cancer tissues were verified. The t-test was used to analyze the significance of the expression levels, and bar charts were respectively drawn to show the results. Figure 1 E, Figure 1 F).

[0083] 6. Spatial transcriptome data analysis

[0084] HE staining images of liver cancer tissues and corresponding spatial transcriptome data were obtained from the HCCDB database. The data included annotation information of tumor regions, stromal regions, normal tissues, and immune cell enrichment regions. By analyzing the expression levels of the DBR1 gene in different regions, a spatial expression heatmap was drawn to show the distribution pattern of DBR1 in the microenvironment of liver cancer tissues, and the expression levels in tumor regions were mainly compared with those in other regions. Figure 1 G).

[0085] 7. Statistical analysis

[0086] All data analyses were completed using R language (version 4.1.3). The Wilcoxon rank-sum test was used for the expression differences between two groups, the Kruskal-Wallis test was used for the differences among multiple groups, and the Kaplan-Meier curve and log-rank test were used for the survival rate analysis. All statistical tests were based on a significance level of p < 0.05.

[0087] Example 2

[0088] Tissue expression analysis of DBR1 protein

[0089] 1. Sample collection and processing

[0090] Intraoperative samples from 5 patients with primary hepatocellular carcinoma (HCC) were collected. These patients were all newly diagnosed and untreated with any anti-cancer therapy. For each patient, liver cancer tissue and its corresponding adjacent normal liver tissue samples were collected. The samples were immediately frozen in liquid nitrogen and then transferred to an -80°C refrigerator for storage for subsequent experiments. Figure 2 A).

[0091] 2. RNA extraction

[0092] Total RNA was extracted from liver cancer tissues and adjacent normal tissues. For each tissue sample, 0.1 g of tissue was placed in a 1.5 mL EP tube, 3 - 4 grinding beads and 500 μL of Trizol were added, and the tissue was shaken at a frequency of 60 Hz for 60 seconds using a tissue disruptor to fully break and homogenize the tissue. Subsequently, 200 μL of chloroform was added to every 1 mL of Trizol, shaken vigorously for 15 seconds, and then left to stand at room temperature for 5 minutes. After the sample was centrifuged at 4°C and 12,000 g for 15 minutes, approximately 200 μL of the supernatant was transferred to a new RNase-free EP tube. After adding an equal volume of isopropanol and mixing well, it was left at 4°C for 10 minutes to precipitate RNA. After centrifuging again at 4°C and 12,000 g for 15 minutes, the supernatant was discarded, and the RNA pellet was washed with 1 mL of 75% ethanol and centrifuged at 4°C and 7,500 g for 3 minutes. Finally, the supernatant was discarded, the lid of the centrifuge tube was opened, and the RNA pellet was dried at room temperature for about 15 minutes until it became transparent, and then an appropriate amount of DEPC water was added to dissolve the RNA sample. The concentration and purity of RNA were detected by a NanoDrop 2000 spectrophotometer, and samples with an OD260 / OD280 value between 1.8 - 2.0 were used for subsequent experiments. The RNA samples were stored short-term at -80°C in a refrigerator.

[0093] 3. Reverse transcription

[0094] The extracted RNA was reverse-transcribed using the Nanjing Novizan HiScript III RT SuperMix for qPCR + gDNA wiper kit (R323 - 01) to remove genomic DNA and synthesize cDNA. First, according to the reaction system (4 μL), 1 μL of gDNA Eraser Mix, 500 ng of RNA, and RNase-free H2O were added to make up to 4 μL, and the total volume was reacted at 42°C for 2 minutes, 37°C for 5 minutes, and stored at 4°C. Then, in a 5 μL system, 4 μL of the reaction solution after removing genomic DNA and 1 μL of 5×RT Enzyme Mix were added. The program was 37°C for 15 minutes, 85°C for 5 seconds, and stored at 4°C. The reverse transcription product was diluted 10 times with ddH2O, stored short-term at 4°C, and long-term at -20°C.

[0095] 4. RT-qPCR detection

[0096] The RT-qPCR reaction was performed using Nanjing Novizan SYBR qPCR Master Mix (Q311-03) to analyze the mRNA expression level of the DBR1 gene. The reaction system was 5 μL, including 2.5 μL of SYBR Master Mix, 0.125 μL each of the forward and reverse primers, and 2.25 μL of diluted cDNA. The reaction was completed on a BIO-RAD CFX384 real-time quantitative PCR instrument. Each sample was set with three replicates, and the ACTB gene was used as an internal reference gene. The relative expression level was calculated by the ΔΔCt method. The results showed that the mRNA expression level of DBR1 in liver cancer tissues was significantly higher than that in adjacent normal tissues (*p<0.05)( Figure 2 B). The paired analysis results showed that the mRNA expression level of DBR1 in liver cancer tissues of all patients was higher than that in the corresponding adjacent normal tissues( Figure 2 C).

[0097] RT-qPCR primers:

[0098]

[0099]

[0100] 5. Protein extraction and Western Blot detection

[0101] Total proteins were extracted from liver cancer tissues and adjacent normal tissues. 1 mL of pre-cooled RIPA lysis buffer (added with PMSF at 1:100) and 3-4 steel beads were added to every 100 mg of tissue, and the tissue was homogenized thoroughly using a tissue grinder. After the samples were placed on ice for 15 minutes, they were centrifuged at 4°C and 12,000 rpm for 10 minutes, and the supernatant was taken as the total protein sample. The protein sample was mixed with 3×loading buffer and boiled at 100°C for 10 minutes, and then stored at -20°C after cooling.

[0102] Place the prepared 10% gel slab into the electrophoresis apparatus, add 1x running buffer to the electrophoresis apparatus. After checking for no liquid leakage, load the samples in the preset loading order; turn on the power supply, set the voltage for the stacking gel to 80V for 30 minutes, and for the separating gel to 120V for 1 hour. The voltage can be appropriately increased according to the size of the target protein, and the running time of the gel can be adjusted. Immerse the cut PVDF membrane in methanol for about 30 seconds until it becomes semi-transparent. Open the transfer cassette, soak the black side in Transfer, and place a filter paper soaked in transfer on each side of the black and white cassette; Pry open the gel slab, cut off the stacking gel, remove the separating gel from the long gel slab, and place the black gauze - filter paper - gel - PVDF membrane (about 9×5.6 cm) - filter paper (about 10×8.5 cm) - black gauze in order from bottom to top to enclose the gel in the transfer cassette. Fix the gel slightly with fingers, cover the activated PVDF membrane on the gel, expel the air bubbles between the membrane and the gel, and close the transfer cassette. Place the closed transfer cassette in the electrophoresis tank, place it in the transfer tank with the red and black corresponding, and place an ice box in the transfer tank. Fill it with transfer buffer. Set the voltage to 90V and the current to about 300mA for 1.5 hours; After the transfer is completed, take out the PVDF membrane, transfer the PVDF membrane to 5% skim milk and incubate it on a shaker at room temperature for one hour; After the blocking is completed, rinse the PVDF membrane three times with PBST, 5 minutes each time on a shaker at room temperature. Then place the PVDF membrane in a clean incubation box, place it on a shaker at 4°C, and incubate with the primary antibody overnight; Recover the primary antibody, wash the membrane three times with TBST, 10 minutes each time on a shaker at room temperature. Add the secondary antibody prepared at 1:5000 and incubate on a shaker at room temperature for 30 minutes; After the secondary antibody blocking is completed, wash the membrane 3 times with PBST, 10 minutes each time, and then react the PVDF membrane with the developing substrate and expose it directly, and develop the image using a Biorad imager. The results showed that the protein expression of DBR1 in liver cancer tissues was significantly higher than that in adjacent normal tissues( Figure 2 D).

[0103] Western Blot antibodies:

[0104] Antibody Source Identification Code DBR1 Polyclonal Antibody Proteintech Cat#: 16019 - 1 - AP Beta Actin Monoclonal Antibody Proteintech Cat#: 66009 - 1 - Ig

[0105] 6. Data analysis

[0106] The relative expression level of DBR1 was calculated by the ΔΔCt method for RT-qPCR data, and the gray value of the bands was analyzed by ImageJ software for Western Blot results. All data were expressed as mean ± standard error of the mean (SEM), and the differences between groups were analyzed using paired t-tests. p<0.05 was considered statistically significant.

[0107] Example 3

[0108] Effect of DBR1 on the proliferation ability of hepatocellular carcinoma cells:

[0109] 1. Detection of DBR1 Expression in Hepatocellular Carcinoma Cell Lines

[0110] 1) Cell culture: Inoculate hepatocellular carcinoma cell lines Hep3B, HepG2, LM3, MHCC97H, and Huh7 into 6-well plates. For Hep3B and HepG2, use MEM medium (containing 10% fetal bovine serum and 1% penicillin / streptomycin) (Gibco, Cat#: C12571500BT), and for LM3, MHCC97H, and Huh7, use high-glucose DMEM medium (containing 10% fetal bovine serum and 1% penicillin / streptomycin) (Gibco, Cat#: 12491015). Culture in an incubator at 37°C and 5% CO 2 until the cells grow to 70%-80% confluence.

[0111] 2) RNA extraction and RT-qPCR detection: After washing the cells with PBS, add 1 mL of Trizol lysis solution to each well to extract total RNA. According to the kit instructions, the extracted RNA is synthesized into cDNA using a reverse transcription kit, and then SYBR Green qPCR reagent is used for RT-qPCR analysis of the relative expression level of DBR1 mRNA, with GAPDH as the internal reference gene.

[0112] 3) Protein extraction and detection: After washing the cells with PBS, add 200 μL of pre-cooled RIPA lysis solution (containing 1:100 diluted PMSF protease inhibitor) to each well of Hep3B, HepG2, LM3, MHCC97H, and Huh7. Scrape the cells with a cell scraper and transfer them to a 1.5 mL EP tube. After lysing on ice for 15 minutes, centrifuge at 4°C and 12,000 rpm for 10 minutes, and collect the supernatant as the total protein sample. Detect the expression level of DBR1 protein by Western Blot, with ACTIN as the internal reference.

[0113] 4) Data analysis: The relative expression of DBR1 is calculated by the ΔΔCt method for RT-qPCR data, and the gray value of the bands is analyzed by ImageJ software for Western Blot results. The experiment is repeated 3 times, and the data are expressed as mean ± standard error of the mean (SEM). The differences between groups are analyzed by t-test using statistical analysis software, and p < 0.05 is considered statistically significant.

[0114] 5) Results: The results show that the expression of DBR1 varies greatly among different cell lines, with the highest expression of DBR1 in the Huh7 cell line ( Figure 3 A).

[0115] 2. Construction of Gene Knockout Cell Lines Using CRISPR-Cas9 Technology

[0116] 1) Primer design and annealing: Screen for eligible sgRNA sequences (NNNNNNNNNNNNNNNNNNNN+NGG) in the exon near the target gene (DBR1) (100 bp after ATG to the first third). Design the primer sequences as sg-hDBR1-F1 (SEQ ID No. 3: CACCGTGCATGTGACGATACTTGGG) and sg-hDBR1-R1 (SEQ ID No. 4: AAACCCCAAGTATCGTCACATGCAC). Subsequently, configure the primer annealing reaction system in a PCR instrument, including NEB buffer2 (2 μL), Oligo A (100 μM, 2 μL), Oligo S (100 μM, 2 μL), and ddH2O (14 μL). The annealing program is to heat at 95 °C for 5 minutes and then cool naturally to room temperature.

[0117] 2) Vector linearization and ligation reaction: Use the Pl301 plasmid (800 ng) and Bsmb1 endonuclease (1 μL) to prepare the digestion reaction system (buffer 2 μL, made up to 20 μL with ddH2O), and digest at 37 °C for 1 hour. Load the digested product onto a 1% agarose gel, and the electrophoresis conditions are 100 V for 1 hour. The electrophoresis result shows two bands (11 kb and 2 kb). Cut out the 11 kb band and perform gel extraction. Ligate the recovered linearized vector with the renatured sgRNA product. The reaction system includes 5×buffer (2 μL), T4 ligase (0.2 μL), digested product (200 ng), renatured product (5 μL), made up to 10 μL with ddH2O, and ligate overnight at room temperature.

[0118] 3) Competent cell transformation and plating: Take out the DH5α competent cells from the -80 °C refrigerator and thaw them on ice. Add 15 μL of competent cells to 5 μL of the ligation product, gently mix, and incubate on ice for 30 minutes. Heat shock in a 42 °C water bath for 45 seconds and then quickly incubate on ice for 2 - 3 minutes. Add 500 μL of antibiotic-free LB liquid medium and culture on a shaker at 37 °C for 1 hour. Spread the bacterial solution on an LB solid plate containing Amp resistance, evenly spread it with a spreader, and after the bacterial solution dries, invert the plate and culture it overnight at 37 °C.

[0119] 4) Monoclonal picking and bacterial liquid identification: The next day, pick 3 - 5 monoclonal colonies from the culture plate into a 15 mL centrifuge tube, add 9 mL of LB liquid medium containing Amp resistance, and culture overnight on a shaker at 37°C. When preserving the bacterial liquid, take 500 μL of the bacterial liquid, add 500 μL of 50% glycerol, mix well, and store at -80°C. After plasmid extraction, perform concentration detection and verify the plasmid quality by electrophoresis. The electrophoresis system is as follows: Mix plasmid (2 μL) with 10×loading buffer (0.2 μL) and load it onto a 1% agarose gel. The electrophoresis conditions are 100 V for 1 hour. The electrophoresis band of the positive plasmid is 2 kb smaller than that of the control plasmid. Send the detected positive clones for sequencing, and the total amount of plasmid should be greater than 2 μg. The sequencing primer is h-DBR1#3: SEQ ID No.5: CAAGGCTGTTAGAGAGATAA.

[0120] 5) Construction of gene knockout cell line: Transfect the constructed plasmid into 293T cells for lentivirus packaging. The transfection reaction system is PL1 (3 μg), PL2 (6 μg), constructed plasmid (10 μg), and PEI (38 μL). After the virus solution infects the target cells, add 2 μg / mL puromycin for resistance screening. Dilute the screened cells into a culture dish to ensure that the dilution ratio can form a monoclonal cell population. After the monoclonal colonies are visible to the naked eye, pick the monoclonal colonies with a 1 mL pipette tip into a 24-well plate for culture. When the cells grow confluent, transfer them to a 6-well plate for continued culture. After culture, take some cells for qPCR detection and Western Blot detection to verify the DBR1 gene knockout effect. After confirming the positive clones, perform expansion culture and preservation.

[0121] 6) Results: The DBR1 knockout cell line and the re-expressed cell line after knockout were successfully constructed. DBR1KO significantly reduced the expression level of DBR1, ( Figure 3 B).

[0122] SgRNA primers:

[0123]

[0124] 3. Experimental procedures for re-expression (complementation) of DBR1 in knockout cells

[0125] 1) Vector construction and sequencing verification: Obtain the complete DBR1 insertion fragment by PCR amplification. Using a sample containing the DBR1 cDNA template, amplify the full-length hDBR1 sequence with specific amplification primers (such as plvx-hDBR1-F and plvx-hDBR1-R). Subsequently, perform PCR linearization on pLVX-CMV-MCS-2a-puroR and recover the corresponding band (about 11 kb) by electrophoresis. Add the recovered linearized vector and the PCR-amplified DBR1 fragment to the T4 ligase reaction system at a molar ratio of 1:3, and ligate overnight at 16°C or for 2 hours at room temperature. Transform the ligation product into DH5α competent cells, recover after heat shock at 42°C for 45 seconds, coat on an LB plate containing Amp resistance, and incubate overnight at 37°C. Pick monoclonal colonies for plasmid extraction and verify by PCR or sequencing using pIvx-F / pIvx-R and plvx-hDBR1-F / plvx-hDBR1-R primers to ensure the correct insertion of the DBR1 fragment.

[0126] 2) Lentivirus packaging and collection: Use 293T cells in the logarithmic growth phase for lentivirus packaging. Inoculate them in a 6-cm culture dish to make the cell density reach 40–50% on the day of transfection. Mix the recombinant pLVX-DBR1 vector with envelope plasmids (such as pMD2.G) and packaging plasmids (such as psPAX2) according to the recommended ratio (such as pLVX:psPAX 2:pMD2.G = 2:2:1), and add transfection reagents (PEI or Lipofectamine 2000). After mixing, add the mixture dropwise to 293T cells. Replace the fresh medium 4–6 hours after transfection. Collect the supernatant within 48–72 hours after transfection, centrifuge at 12,000 rpm to remove cell debris, and if necessary, concentrate the virus by sucrose cushion ultracentrifugation or PEG method to improve the infection efficiency.

[0127] 3) Establishment and verification of the DBR1 rescue cell line: Plate the DBR1KO cells. When the cell density reaches 30–50%, infect the cells with the pLVX-DBR1 virus solution (added with 8 μg / mL polybrene). Replace the fresh medium 24 hours after infection. If the vector has drug resistance (such as puromycin), add the drug for screening 48–72 hours later, and the recommended concentration is 1–2 μg / mL. After screening for 3–5 days, monoclonal colonies can be picked according to experimental needs or the mixed positive cell population can be directly used for experiments. For monoclonal colony picking, dilute the screened cells into a culture dish to ensure that the cell spacing is sufficient to form monoclonal colonies. After the monoclonal colonies are visible, pick them into a 24-well plate for culture, and then transfer them to a 6-well plate for amplification culture. Verify the expression level of DBR1 by Western Blot or qPCR to confirm the successful establishment of the rescue cell line.

[0128] 4) Results: The expression level of DBR1 protein in the DBR1 rescue cell line (DBR1KO+hDBR1OE) was detected by Western Blot to confirm that DBR1 was successfully restored or upregulated ( Figure 3 B).

[0129] Plvx primers:

[0130]

[0131] 4. Steps for wound healing assay:

[0132] Huh7 cells were seeded into 12-well plates, and the cell density was adjusted to 80,000–100,000 cells / well. The cells were cultured until they formed a confluent monolayer in the culture plate. Before seeding the cells, a horizontal line was drawn on the back of the 12-well plate with a marker pen (for positioning the same field of view during photography). After the cells covered the bottom of the plate, a 200 μL pipette tip was used to vertically draw a straight line to form a "wound", keeping the width of the wound consistent and avoiding tilting or using a damaged pipette tip. After making the wound, the well plate was gently washed 3 times with PBS to remove cell debris, and then serum-free medium was added to inhibit the interference of cell proliferation on the experiment. The cells were then cultured at 37 °C and 5% CO 2 conditions. Images of the initial state of the wound were taken at 0 h, and then the wound healing was recorded every 6 h. After the experiment, ImageJ software was used to measure the change in the width of the wound or the migration area to evaluate the cell migration ability. The experimental groups included the WT group, the DBR1KO group, and the DBR1KO+hDBR1OE group. By comparing the wound healing, the inhibitory effect of DBR1 knockout on the migration ability of Huh7 cells and the recovery effect of DBR1 re-expression on the migration ability were observed. Serum-free medium was used during the experiment to avoid interference from cell proliferation. The cells were gently washed to prevent adherent cells from detaching, and the width of the wound was ensured to be uniform to guarantee the reliability of the experimental data. The results are shown in Figure 3 (C).

[0133] 5. MTT cell proliferation assay

[0134] First, a 5 mg / mL MTT stock solution (dissolved in sterile PBS) (Beyotime, Cat#: C0009M) was prepared and diluted 1:10 into the medium before use to make the final concentration 0.5 mg / mL. The target cells were seeded into 96-well plates, with 500 - 10,000 cells per well and a total volume of 100 μL, and cultured at 37 °C and 5% CO 2Culture overnight under the same conditions. If needed, the test compound can be added at this step to evaluate its effect on cell proliferation. Subsequently, add 10-15 μL of diluted MTT solution to each well to maintain a final concentration of 0.5 mg / mL, and place the plate in an incubator for 1-4 hours under the same conditions. After incubation, add 100 μL of DMSO or other dissolving solution to each well to dissolve the formed formazan crystals, and gently shake the plate to ensure complete dissolution. Use an ELISA reader to measure the absorbance at a wavelength of 570 nm (630 nm can be selected as a reference wavelength), and analyze the data by calculating the percentage of cell viability [(OD value of the treatment group - OD value of the blank control) / (OD value of the untreated control group - OD value of the blank control) × 100%] to draw a cell survival rate curve or a dose-response curve. During the experiment, it is necessary to ensure that the initial number of cells in each well is consistent, avoid excessive contact time between the MTT reagent and the cells (no more than 4 hours), and protect the light-sensitive compounds from light to ensure the accuracy of the experimental results. The results are as follows Figure 3 (D) as shown.

[0135] 6. Transwell invasion assay steps

[0136] In the Transwell invasion assay, Huh7 cells were first starved for 12-24 hours to reduce background migration interference. Subsequently, the cells were digested, washed once with PBS, and resuspended in serum-free medium containing 0.1% BSA. The cell density was adjusted to 1×10 5 / mL. In the experiment, a Transwell chamber (8μm pore size) with Matrigel matrix gel (Biyuntian, Cat#: FTW067) was used. 40μL of Matrigel gel was diluted and spread on the upper chamber of the chamber. Gel was allowed to gel at 37℃ for 2 hours and then hydrated with serum-free medium for 30 minutes. 200μL of cell suspension (total cell amount was 2×10 4 ), and at the same time, add 500 μL of complete medium containing 10% FBS to the lower chamber of the 24-well plate as a chemical attraction factor. Use tweezers to carefully insert the Transwell chamber into the 24-well plate, making sure to avoid bubbles that interfere with the experimental results. Place the device at 37°C and 5% CO 2Cultivate for 24 hours in an incubator. Subsequently, carefully aspirate the culture medium in the upper chamber. After washing with PBS, gently wipe off the non-transmembrane cells in the upper chamber with a moistened cotton swab. Fix the transmembrane cells on the lower membrane of the chamber. After fixing with 10% methanol solution for 30 seconds, stain with 0.1% crystal violet solution for 20 minutes, and then wash with tap water until the background is clear. Randomly select 3-5 fields of view under the microscope to count the number of transmembrane cells. To quantitatively analyze the invasion ability, the stained cells can be decolorized with 33% acetic acid solution, and the OD value can be measured at a wavelength of 570 nm to indirectly reflect the number of cells. The experimental groups include the WT group, the DBR1KO group, and the DBR1KO+hDBR1OE group. The results show that DBR1KO significantly reduces the invasion ability of Huh7 cells, while DBR1KO+hDBR1OE significantly restores the invasion ability. The experiment needs to be repeated at least 3 times. The data are expressed as the mean ± standard error (SEM), and the differences between groups are determined by statistical analysis. The results are as Figure 3 (E) shows.

[0137] It should be noted that in this article, relational terms such as first and second are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any actual relationship or order between these entities or operations. Moreover, the term "comprising", "including" or any other variant thereof is intended to cover non-exclusive inclusion, so that a process, method, article or device comprising a series of elements not only includes those elements, but also includes other elements not expressly listed, or further includes elements inherent to such process, method, article or device. Without further limitation, an element defined by the statement "comprising an..." does not exclude the existence of additional identical elements in the process, method, article or device comprising the element.

[0138] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements for some of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of debranching enzyme homolog 1 expression level as a diagnostic and / or prognostic marker for hepatocellular carcinoma.

2. Use of a reagent for measuring the expression level of debranching enzyme homolog 1 in a sample for preparing a diagnostic agent for evaluating the prognosis of hepatocellular carcinoma in a subject.

3. The use according to claim 2, characterized in that: The applications specifically include: S1: Obtain biological samples from subjects; S2: measuring the expression level of debranching enzyme homolog 1 in the biological sample of the subject; S3: comparing the expression level of the debranching enzyme homolog 1 in the biological sample of the subject with the average level of the expression level of the debranching enzyme homolog 1 from one or more control biological samples; S4: Based on the debranching enzyme homolog 1 expression level compared to the control debranching enzyme homolog 1 expression level, a higher debranching enzyme homolog 1 expression level indicates that the subject has a poor prognosis for hepatocellular carcinoma.

4. The use according to claim 3, characterized in that: The biological sample includes one or a combination of blood, serum, plasma, blood components, joint fluid, urine, semen, saliva, feces, cerebrospinal fluid, gastric contents, vaginal secretions, mucus, tissue biopsy samples, tissue homogenates, bone marrow puncture fluid, bone homogenates, sputum, aspirates, wound exudate, swabs or swab rinses.

5. The use according to any one of claims 2 to 4, characterized in that: The method for detecting the expression level of the debranching enzyme homolog 1 includes one or a combination of quantitative PCR, electrophoresis technology, DNA microarray, next generation sequencing, Western blot analysis, mass spectrometry analysis, fluorescence activated cell sorting analysis, enzyme-linked immunosorbent assay, and immunohistochemistry.

6. Use of a DBR1 inhibitor in the preparation of a medicament for preventing and / or treating hepatocellular carcinoma and / or diseases and / or symptoms associated with hepatocellular carcinoma.

7. The use according to claim 6, characterized in that: The DBR1 inhibitor includes one or a combination of antibodies, siRNA, miRNA, gRNA, sgRNA, antisense oligonucleotides.

8. Use of a pharmaceutical composition in the preparation of a medicament for preventing and / or treating hepatocellular carcinoma and / or diseases and / or symptoms associated with hepatocellular carcinoma, characterized in that: The pharmaceutical composition comprises a therapeutically effective amount of the inhibitor according to claim 6 or 7.

9. A pharmaceutical preparation, characterized in that The pharmaceutical preparation comprises the pharmaceutical composition according to claim 8.

10. A kit for detecting hepatocellular carcinoma, characterized in that: The kit comprises the antibody of claim 7.

Images