Construction and application of bifluorescence reporter plasmid pBmItaE for detecting extracellular itaconic acid level of bacteria

By designing a dual fluorescent reporter plasmid, using mCherry and EGFP to detect the itaconic acid level of bacteria, the accuracy and reliability of the existing detection methods are solved, and efficient and accurate itaconic acid detection is achieved.

CN120099051APending Publication Date: 2025-06-06SHANGHAI VETERINARY RESEARCH INSTITUTE CAAS (CHINESE ANIMAL HEALTH & EPIDEMIOLOGY CENTER SHANGHAI BRANCH)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510297406.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-13
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

The existing itaconic acid detection methods have the disadvantages of expensive, high maintenance costs, inaccurate results and inability to quantify low concentrations of itaconic acid, and there is detection error in the single-report gene plasmid detection.

Method used

A dual fluorescent reporter plasmid was designed, including the first reporter mCherry to measure the background expression of the plasmid, and the second reporter EGFP to detect itaconic acid level. The bidirectional promoter PIct was regulated through the transcriptional regulator BM590_RS11055 to ensure that the expression of the two does not interfere with each other and reduce the impact of plasmid copy number on the detection results.

Benefits of technology

It realizes rapid and accurate detection of bacterial cell protonic acid levels, reduces the impact of plasmid copy number and expression heterogeneity on the detection results, and improves the accuracy and reliability of the detection results.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099051A_ABST
    Figure CN120099051A_ABST
Patent Text Reader

Abstract

The invention discloses a bifluorescence reporter plasmid, construction of the plasmid and application of the bifluorescence reporter plasmid in detection of bacterial extracellular itaconic acid level. The reporter plasmid is composed of a resistance gene, a promoter, a first reporter gene, a terminator, a transcriptional regulation factor BM590RS11055, a bidirectional promoter and a second reporter gene. The promoter Ptac controls the expression of the first reporter gene mCherry, is used for detecting the plasmid background expression level, and can eliminate the influence of the plasmid copy number on the itaconic acid level detection result; the bidirectional promoter PIct controls the expression of the second reporter gene EGFP and is used for detecting the extracellular itaconic acid level, the expression of the first reporter gene and the expression of the second reporter gene are not interfered with each other, and the detection result is more accurate and more reliable. The bifluorescence reporter plasmid constructed by the invention can be used for detecting the extracellular itaconic acid level of bacteria, the operation is simple, and the result is reliable.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and relates to a double fluorescence reporter plasmid for detecting bacterial extracellular itaconic acid levels and an application thereof. Background Art

[0002] Itaconic acid (methylenesuccinic acid) is an important metabolite produced by the tricarboxylic acid cycle (TCA). It is produced under the catalysis of cis-aconitatedecarboxylase (ACD), also known as immune-responsive gene 1 (IRG1). In the early days, itaconic acid was mainly used in the synthesis of industrial polymers such as plastics and rubber. It was not until 2011 that researchers found that macrophages stimulated by lipopolysaccharide (LPS) could promote the production of itaconic acid, which also confirmed that itaconic acid can play an important role in mammalian cells. As an endogenous immune cell metabolite, itaconic acid has important biological functions in anti-inflammatory and antioxidant aspects. For example, itaconic acid can induce electrophilic stress response to upregulate the protein level of ATF3, a negative regulatory transcription factor of immune activation, and interfere with the expression of IκBζ protein in the NF-κB pathway, thereby blocking the secretion of proinflammatory cytokine IL-6 by LPS-stimulated macrophages. In addition, itaconic acid has been reported to have a variety of immunomodulatory effects. Recent studies have found that peritoneal tumor cells can significantly increase the expression of the IRG1 gene in macrophages by acting on tissue-resident macrophages, increase the level of itaconic acid and promote the production of inflammatory factors such as ROS, thereby promoting the growth and survival of tumor cells.

[0003] In recent years, studies have found that itaconic acid also plays an important role in immunity against pathogen infection, and it participates in the inhibition or killing of pathogens by cells through various pathways. In addition, pathogens have also evolved a variety of mechanisms to antagonize the immune function of itaconic acid. For example, in Brucella, Salmonella and Pseudomonas aeruginosa, there are three genes, ict, ich and ccl, which encode itaconate coenzyme A (CoA) transferase, itaconyl-CoA hydratase and (S)-citrate-CoA lyase, respectively. By degrading itaconate into pyruvate and acetyl-CoA, itaconate can be released from the inhibition of bacteria and promote their survival in macrophages and hosts. Therefore, the establishment of itaconic acid detection methods is of great significance for studying and analyzing the regulatory functions and molecular mechanisms of itaconic acid.

[0004] At present, the commonly used method for itaconic acid detection is high performance liquid chromatography (HPLC), which has the disadvantages of being expensive, high maintenance costs, and large differences between different batches, which brings inconvenience to itaconic acid detection and research. Some traditional detection methods, such as acid-base titration and iodine reduction, are subject to many interference factors, have inaccurate results, and cannot quantify low-concentration itaconic acid.

[0005] Some researchers have used the Salmonella succinic acid response operon STM3121 and the promoter P IRO Construct a reporter plasmid. However, the reporter plasmid currently used only determines the bacterial extracellular itaconic acid level by the expression of a single reporter gene, and this design has potential detection errors. Due to the differences in the copy number of the reporter plasmid and the heterogeneity of expression, the copy number of the plasmid in different bacteria is different, that is, there are differences in the copy number of the itaconic acid signal receptor and the reporter gene. When detecting the itaconic acid level of a single cell, the difference in the copy number of the reporter plasmid may cause a large error in the test result. Therefore, the detection of bacterial itaconic acid levels by a single reporter gene plasmid has the disadvantages of inaccurate results. Summary of the invention

[0006] In order to solve the above problems, the present invention provides a dual fluorescence reporter plasmid for detecting the level of extracellular itaconic acid in bacteria.

[0007] Another object of the present invention is to provide a method for constructing the above plasmid.

[0008] Another object of the present invention is to provide the use of the above plasmid in detecting the level of extracellular itaconic acid in bacteria.

[0009] The present invention adopts the following technical solution:

[0010] In the first aspect of the present invention, a dual fluorescence reporter plasmid for detecting the level of extracellular itaconic acid in bacteria is provided, which is composed of a resistance gene, a promoter, a first reporter gene, a terminator, a transcriptional regulatory factor BM590_RS11055, a bidirectional promoter, and a second reporter gene connected in sequence. tac Control the expression of the first reporter gene mCherry to detect the background expression level of the plasmid, which can eliminate the effect of the plasmid copy number on the detection results of itaconic acid levels; the bidirectional promoter P Ict The expression of the second reporter gene EGFP is controlled to detect the level of extracellular itaconic acid, and the expressions of the first reporter gene and the second reporter gene do not interfere with each other, so the detection result is more accurate and reliable.

[0011] Further, preferably, the resistance gene fragment is a kanamycin resistance fragment (sequence as shown in SEQ ID No.7), and the first reporter gene promoter is P tacpromoter (sequence as shown in SEQ ID No.8), the first reporter gene and terminator are mCherry and T7 terminator (sequence as shown in SEQ ID No.9), the second reporter gene is EGFP (sequence as shown in SEQ ID No.10), the transcriptional regulatory factor is BM590_RS11055 (sequence as shown in SEQ ID No.11), the bidirectional promoter is P Ict Promoter (sequence shown in SEQ ID No.12).

[0012] The first reporter gene mCherry is used to measure the background expression of the reporter plasmid. The transcriptional regulatory factor BM590_RS11055 can sense extracellular itaconic acid, control the bidirectional promoter, and thus regulate the expression of the second reporter gene EGFP. When the itaconic acid level is high, the expression of the reporter gene EGFP is high, showing strong fluorescence; when the itaconic acid level is low, the expression of the EGFP reporter gene EGFP is low, showing weak fluorescence. Therefore, the dual fluorescence reporter plasmid provided by the present invention can quickly and accurately detect the extracellular itaconic acid level of bacteria, so as to reduce the influence of plasmid copy number and expression heterogeneity on the detection results.

[0013] In another aspect of the present invention, the method for constructing the pBmItaE plasmid comprises the following steps:

[0014] pBBR1MCS2-Tac-mCherry, pEGFP-N1 plasmid and M5-90 genome were used as templates, respectively.

[0015] Primers DNA nucleotide sequence (5'-3') Sequence number F1 CATATACGCCATGGTGAGCAAGGGCGAGG SEQ ID NO.1 R1 TTGCAGCCCTAGATCGGCCACAGCGGCCCAGGTTCAGGGGGAGGTGTG SEQ ID NO.2 F2 CCAGACCACGTTTGCGGCCGCTGTGGCCTCAAGTTTGCCGAAGATGCTC SEQ ID NO.3 R2 TGCTCACCATGGCGTATATGCTCCGGCTT SEQ ID NO.4 pBmItaE-F TCAAGTTTGCCGAAGATGCTCCACC SEQ ID NO.5 pBmItaE-R CCTCCCACACCTCCCCCTGAACCTG SEQ ID NO.6

[0016] The following primer pairs were used for amplification and identification:

[0017] The method comprises the following steps: using the pBBR1MCS2-Tac-mCherry plasmid as a template and SfiI as a restriction site to obtain a linearized plasmid pBBR1MCS2-Tac-mCherry, which contains a kanamycin resistance gene fragment, a pBBR1 replicon, and a promoter P tac , mCherry gene fragment and T7 terminator; using pEGFP-N1 plasmid as template, F1 and R1 as primers, PCR amplified EGFP gene fragment; using M5-90 genome as template, F2 and R2 as primers, PCR amplified BM590_RS11055 gene fragment and promoter P Ict ; The above PCR product fragments were recovered by gel, and homology arms were added between each gene fragment. Then, the PCR products BM590_RS11055, P Ict , EGFP and linearized pBBR1MCS2-P TacThe -mCherry gene fragment was self-ligated into a circle by homologous recombinase, and pBmItaE-F / R was used as the identification primer. After PCR identification was correct, it was sent to a biological company for sequencing verification to construct the dual fluorescence reporter plasmid pBmItaE.

[0018] In another aspect of the present invention, the reporter plasmid is used for detecting the level of extracellular itaconic acid in bacteria.

[0019] On the basis of the above technical scheme, preferably, the dual fluorescence reporter plasmid pBmItaE is used to detect the extracellular itaconic acid level of bacteria. The dual fluorescence reporter plasmid is transformed into Escherichia coli DH5α or Brucella M5 strain, respectively, and cultured on a kanamycin resistant medium plate. After the transformant grows, a single colony is picked and cultured in a liquid culture medium. By adding different concentrations of itaconic acid to the culture medium, the fluorescence expression of the reporter gene in the bacteria is measured and compared, and the level of extracellular itaconic acid of the bacteria to be tested is judged.

[0020] The reporter plasmid for bacterial extracellular itaconic acid level and its application of the present invention have the following characteristics compared with the prior art: (1) The dual fluorescence reporter plasmid constructed by the present invention contains two reporter genes, which are respectively controlled by a promoter and a bidirectional promoter. The first reporter gene is used to detect the background expression level of the plasmid, which can eliminate the influence of the plasmid copy number on the itaconic acid level detection result. The second reporter gene is used to detect the itaconic acid level, and the expressions of the first reporter gene and the second reporter gene do not interfere with each other, so the detection result is more accurate and reliable.

[0021] (2) The detection process of the dual fluorescence reporter plasmid constructed by the present invention is simple to operate and can efficiently detect the level of bacterial extracellular itaconic acid. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a schematic diagram of the construction process of the dual fluorescence reporter plasmid pBmItaE of the present invention.

[0023] Figure 2 Electrophoresis diagram for gene fragment amplification and plasmid identification; (A) Lane M: DNA molecular weight standard (DL2000); Lanes 1-6: BM590_RS11055 and P Ict Gene fragment; Lanes 7-9: EGFP gene fragment; (B) Lane M: DNA molecular weight standard (DL10000); Lanes 1-4: linearized pBBR1MCS2-Tac-mCherry gene fragment; (C) Lane M: DNA molecular weight standard (DL10000); Lanes 1-6: pBmItaE plasmid.

[0024] Figure 3The ELISA instrument quantitatively detects the expression level of the fluorescent reporter gene of the dual fluorescent reporter plasmid pBmItaE in the Escherichia coli DH5α strain when different concentrations of itaconic acid are added exogenously in Example 2 of the present invention, that is, the level of extracellular itaconic acid. At the same time, the advantages of the dual fluorescent reporter plasmid compared with the single fluorescent reporter plasmid in detecting the level of extracellular itaconic acid in bacteria are compared. (A) The dual fluorescent reporter plasmid pBmItaE is used to detect the level of extracellular itaconic acid in the Escherichia coli DH5α strain; (B) The single fluorescent reporter plasmid is used to detect the level of extracellular itaconic acid in the Escherichia coli DH5α strain.

[0025] Figure 4 The ELISA instrument quantitatively detects the dual fluorescence reporter plasmid pBmItaE in Example 2 of the present invention for detecting the fluorescence reporter gene expression level of the M5 strain when different concentrations of itaconic acid are added exogenously, that is, the extracellular itaconic acid level. DETAILED DESCRIPTION

[0026] The present invention is further described clearly and completely below in conjunction with specific examples. These examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are usually carried out under conventional conditions or under conditions recommended by the manufacturer. Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art.

[0027] The reagents and raw materials not marked in the present invention are all purchased from the market.

[0028] The sequence of the dual fluorescence reporter plasmid pBmItaE constructed in the present invention is detailed in the sequence table.

[0029] Example 1. Construction of dual fluorescence reporter plasmid pBmItaE

[0030] This implementation constructs a dual fluorescence reporter plasmid for detecting the level of extracellular itaconic acid in bacteria, which contains two reporter genes and their expressions are not affected by each other. The first reporter gene mCherry is used to measure the background expression of the reporter plasmid. The transcriptional regulatory factor BM590_RS11055 can sense extracellular itaconic acid, control the bidirectional promoter and thus regulate the expression of the second reporter gene EGFP. When the itaconic acid level is high, the expression level of the reporter gene EGFP is high, showing strong fluorescence; when the itaconic acid level is low, the expression level of the EGFP reporter gene EGFP is low, showing weak fluorescence. Therefore, the dual fluorescence reporter plasmid provided by the present invention can quickly and accurately detect the level of extracellular itaconic acid in bacteria, so as to reduce the impact of plasmid copy number and expression heterogeneity on the test results. The reporter plasmid contains a kanamycin resistance gene for easy screening.

[0031] The construction of dual fluorescence reporter plasmid pBmItaE is as follows Figure 1shown. Using the pBBR1MCS2-Tac-mCherry plasmid as a template (merchant: Beijing Huayueyang Biological Company, catalog number: VECT75505) and SfiI as a restriction site, a linearized plasmid pBBR1MCS2-Tac-mCherry was obtained, which contained a kanamycin resistance gene fragment, a pBBR1 replicon, a promoter Ptac, an mCherry gene fragment and a T7 terminator; using the pEGFP-N1 plasmid as a template, F1 and R1 as primers, the EGFP gene fragment was amplified by PCR; using the M5 genome as a template (ZHANG et al., Ferroptosis to Facilitate Its Intracellular Replication and Egress in RAW264.7 Macrophages. Antioxidants, 2024, 13: 15.), F2 and R2 as primers, the BM590_RS11055 gene fragment and the promoter PIct were amplified by PCR; the above PCR product fragments were recovered by gel. In addition, each gene fragment contained interconnected homology arms. Then, the PCR products BM590_RS11055, PIct, EGFP and linearized pBBR1MCS2-PTac-mCherry gene fragments obtained by gel recovery were self-ligated into a circle by homologous recombinase, and pBmItaE-F / R was used as the identification primer. After the PCR identification was correct, it was sent to a biological company for sequencing verification to construct the dual fluorescence reporter plasmid pBmItaE.

[0032] Example 2: Application of the dual fluorescence reporter plasmid pBTmLE in detecting the level of extracellular itaconic acid in Escherichia coli

[0033] This example uses the dual fluorescence reporter plasmid pBmItaE to compare and analyze the differences in the extracellular itaconic acid levels of Escherichia coli. The specific steps are as follows:

[0034] (1) The dual fluorescence reporter plasmid pBmItaE was transformed into Escherichia coli DH5α and cultured on a kanamycin medium plate until transformants grew.

[0035] (2) Pick the transformants grown in step (1) and culture them in LB (Kan) liquid medium until the logarithmic growth phase.

[0036] (3) Take the bacterial solution from step (2), centrifuge at 6000 rpm for 5 min, wash twice with LB (containing different concentrations of itaconic acid), and measure the OD of the bacterial solution. 600nm The value was adjusted to 1, and the strains were inoculated into LB (containing different concentrations of itaconic acid) at a ratio of 1:10 and cultured at 37°C and 220 rpm for 12 h.

[0037] (4) Take the bacterial solution from step (3), centrifuge at 6000 rpm for 5 min, wash twice with PBS, resuspend in 1 mL of PBS, and calculate the OD of all strains. 600nm Adjust to consistency.

[0038] (6) Take 200 μL of the sample prepared in step (4) and add it to a black opaque 96-well plate. Use a microplate reader to detect the fluorescence intensity of the strain. The excitation light of green fluorescence is set to 485 nm, the emission light is set to 528 nm, and the emission light value is recorded as EGFP; the excitation light of red fluorescence is set to 552 nm, the emission light is set to 600 nm, and the emission light value is recorded as mCherry. Each sample is repeated 3 times. The formula for calculating the itaconic acid level is: EGFP / mCherry, and the size of this value is used to characterize the extracellular itaconic acid level of the strain.

[0039] (7) To further compare the advantages and disadvantages of the dual fluorescence reporter plasmid and the single fluorescence reporter plasmid, take 200 μL of the sample prepared in step (4) and add it to a black opaque 96-well plate. Use an ELISA reader to detect the fluorescence intensity of the strain. The excitation light of green fluorescence is set to 485 nm, the emission light is set to 528 nm, and the emission light value is recorded as EGFP. Each sample is repeated 3 times. The formula for calculating the itaconic acid level is: EGFP, and the size of this value characterizes the extracellular itaconic acid level of the strain.

[0040] (8) Figure 3 As shown in the figure, in the values ​​characterizing itaconic acid levels, the EGFP / mCherry ratio gradually increased with the increase of exogenously added itaconic acid concentration, but the EGFP value did not continue to increase with the increase of exogenously added itaconic acid concentration, indicating that the plasmid copy number significantly affects the bacterial extracellular itaconic acid detection results. The advantage of the dual-fluorescence reporter plasmid is that the background expression level of the plasmid is detected by the reporter gene mCherry, eliminating the influence of the plasmid copy number on the itaconic acid level detection results.

[0041] This embodiment uses the dual fluorescence reporter plasmid pBmItaE to detect the extracellular itaconic acid level of Escherichia coli DH5α, which can be used to analyze the effect of the extracellular itaconic acid level on Escherichia coli, and the result is more accurate.

[0042] Example 3: Application of the dual fluorescence reporter plasmid pBTmLE in detecting extracellular itaconic acid levels in Brucella

[0043] This example uses the dual fluorescence reporter plasmid pBmItaE to compare and analyze the differences in extracellular itaconic acid levels in Brucella. The specific steps are as follows:

[0044] (1) Prepare competent wild-type Brucella strain M5, introduce the dual-fluorescence reporter plasmid pBmItaE into Brucella M5 by electroporation, and culture on a kanamycin medium plate until transformants grow.

[0045] (2) The transformants grown in step (1) were selected and cultured in TSB (Kan) liquid medium until the logarithmic growth phase.

[0046] (3) Take the bacterial solution from step (2), centrifuge at 6000 rpm for 5 min, wash twice with TSB (containing different concentrations of itaconic acid), and measure the OD of the bacterial solution. 600nm The value was adjusted to 1, and the strains were inoculated into TSB (containing different concentrations of itaconic acid) at a ratio of 1:10 and cultured at 37°C and 220 rpm for 36 h.

[0047] (4) Take the bacterial solution from step (3), centrifuge at 6000 rpm for 5 min, wash twice with PBS, resuspend in 1 mL of PBS, and calculate the OD of all strains. 600nm Adjust to consistency.

[0048] (5) Take 200 μL of the sample prepared in step (4) and add it to a black opaque 96-well plate. Use a microplate reader to detect the fluorescence intensity of the strain. The excitation light of green fluorescence is set to 485 nm, the emission light is set to 528 nm, and the emission light value is recorded as EGFP; the excitation light of red fluorescence is set to 552 nm, the emission light is set to 600 nm, and the emission light value is recorded as mCherry. Each sample is repeated 3 times. The formula for calculating the itaconic acid level of the strain is: EGFP / mCherry, and the size of this value represents the extracellular itaconic acid level of the strain.

[0049] (6) Figure 4 As shown, in the values ​​representing the level of itaconate, as the concentration of exogenously added itaconate increases, the EGFP / mCherry ratio gradually increases.

[0050] This embodiment uses the dual fluorescence reporter plasmid pBmItaE to detect the extracellular itaconic acid level of Brucella M5, which can be used to analyze the effect of the extracellular itaconic acid level on Brucella.

[0051] The above-described embodiments only express the implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the present invention. In fact, in addition to the contents described herein, those skilled in the art can easily grasp various improvements to the present invention with reference to the above description and drawings. The improvements also fall within the scope of the appended claims.

Claims

1. A dual fluorescence reporter plasmid pBmItaE for detecting bacterial extracellular itaconic acid levels, characterized in that: The reporter plasmid consists of a resistance gene, a promoter, a first reporter gene, a terminator, a transcriptional regulatory factor BM590_RS11055, a bidirectional promoter, and a second reporter gene. tac Control the expression of the first reporter gene mCherry to detect the background expression level of the plasmid, which can eliminate the effect of the plasmid copy number on the detection results of itaconic acid levels; the bidirectional promoter P Ict The expression of the second reporter gene EGFP is controlled to detect the level of extracellular itaconic acid, and the expressions of the first reporter gene and the second reporter gene do not interfere with each other, so the detection result is more accurate and reliable.

2. The dual fluorescence reporter plasmid for detecting bacterial extracellular itaconic acid levels according to claim 1, characterized in that: The resistance gene contained is the kanamycin resistance gene, the first reporter gene is the red fluorescent protein mCherry, and its promoter is P tac The terminator is T7 terminator, the second reporter gene is green fluorescent protein EGFP, and its promoter is P Ict , the transcription regulatory factor is BM590_RS11055.

3. The composition of the dual fluorescence reporter plasmid for detecting the level of extracellular itaconic acid in bacteria according to claim 2, characterized in that: The kanamycin resistance gene fragment is shown in SEQ ID No.7 in the sequence list, and the promoter P tac The nucleotide sequence is shown in SEQ ID No.8 in the sequence list, the mCherry and T7 terminator nucleotide sequences are shown in SEQ ID No.9 in the sequence list, the EGFP nucleotide sequence is shown in SEQ ID No.10 in the sequence list, the transcriptional regulatory factor BM590_RS11055 nucleotide sequence is shown in SEQ ID No.11 in the sequence list, the bidirectional promoter P Ict The nucleotide sequence is shown as SEQ ID No. 12 in the sequence listing.

4. The method for constructing a dual fluorescence reporter plasmid for detecting extracellular itaconic acid levels of bacteria according to claims 1-3, characterized in that: The method comprises the following steps: using the pBBR1MCS2-Tac-mCherry plasmid as a template and SfiI as a restriction site to obtain a linearized plasmid pBBR1MCS2-Tac-mCherry, which contains a kanamycin resistance gene fragment, a pBBR1 replicon, and a promoter P tac , mCherry gene fragment and T7 terminator; using pEGFP-N1 plasmid as template, F1 and R1 as primers, PCR amplified EGFP gene fragment; using M5-90 genome as template, F2 and R2 as primers, PCR amplified BM590_RS11055 gene fragment and promoter P Ict ; The above PCR product fragments were recovered by gel, and homology arms were added between each gene fragment. Then, the PCR products BM590_RS11055, P Ict , EGFP and linearized pBBR1MCS2-Tac-mCherry fragments were self-ligated into a circle by homologous recombinase, pBmItaE-F / R was used as identification primers, and after PCR identification was correct, it was sent to a biological company for sequencing verification to construct the dual fluorescence reporter plasmid pBmItaE.

5. Use of the dual fluorescence reporter plasmid according to claim 1 in detecting the level of extracellular itaconic acid in bacteria.

6. Use of the dual fluorescence reporter plasmid as claimed in claim 5 in detecting the level of extracellular itaconic acid in bacteria, characterized in that: The dual fluorescence reporter plasmids were transformed into Escherichia coli DH5α or Brucella M5 strains, respectively, and cultured on kanamycin resistant medium plates. After transformants grew out, single colonies were picked and cultured in liquid culture medium. By adding different concentrations of itaconic acid to the culture medium, the fluorescence expression of the reporter gene in the bacteria was measured and compared to determine the level of extracellular itaconic acid in the bacteria to be tested.