Visual detection kit for prunus necrotic ringspot virus based on RT-RAA-CRISPR / Cas12a and application of visual detection kit

Abstract

The invention discloses a visual detection kit for a prunus necrotic ringspot virus based on RT-RAA-CRISPR / Cas12a and an application of the visual detection kit for the prunus necrotic ringspot virus based on the RT-RAA-CRISPR / Cas12a. The kit comprises an RAA primer pair, crRNA corresponding to the RAA primer pair, Cas12a protein and report DNA (deoxyribonucleic acid). The invention further discloses a visual detection and identification method for the prunus necrotic ringspot virus based on the RT-RAA-CRISPR / Cas12a. Experiments prove that the RT-RAA-CRISPR / Cas12a-based visual detection and identification method for the prunus necrotic ringspot virus, established by the invention, has the characteristics of simplicity, convenience, rapidness, high sensitivity, high specificity and visualization, is suitable for rapidly detecting the prunus necrotic ringspot virus on site, and has important significance for timely discovering, preventing and controlling propagation of the prunus necrotic ringspot virus.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a visual detection kit for Prunus necrotic ring spot virus based on RT-RAA-CRISPR / Cas12a and its application. Background Art

[0002] Prunus necrotic ring spot virus (PNRSV) is a member of the genus Ilarvirus in the family Bromoviridae. It can infect dicotyledonous plants in 21 families and more than 400 woody host plants. Among them, it causes particularly serious harm to fruit trees in the Rosaceae family such as peach (Prunus persica) and cherry (Cerasus pseudocerasus). It often causes a 30%-70% yield loss in fruit trees. In severe cases, it will directly cause bark necrosis, abnormal swelling, and even make the entire fruit tree have no harvest and wither and die. It is an important pathogenic virus in fruit tree production. However, at present, there is no effective control drug for PNRSV, and controlling its large-scale spread mainly depends on epidemic monitoring and early diagnosis means. Therefore, constructing a rapid, convenient and accurate PNRSV detection method is the key measure to effectively prevent and control this virus.

[0003] Currently, the main detection methods for PNRSV include enzyme-linked immunosorbent assay (ELISA), dot blot, in situ hybridization, reverse transcription polymerase chain reaction (PCR), immuno-capture reverse transcription polymerase chain reaction (IC-RT-PCR), multiplex reverse transcription polymerase chain reaction (mPCR), real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR), reverse transcription loop-mediated isothermal amplification (RT-LAMP), etc. However, each of the above detection methods has its own deficiencies. The detection process of enzyme-linked immunosorbent assay (ELISA) takes a relatively long time and is not suitable for the detection of unknown pathogens and highly variable pathogens. The dot blot technique is affected by non-specific binding and target abundance, resulting in certain false positive and false negative phenomena, and is not suitable for the detection of whole genomes or unknown sequences. The in situ hybridization technique is relatively complex, requires high professional qualities of technicians, and is not suitable for large-scale sample screening. Due to the problem of aerosol contamination, polymerase chain reaction is prone to false positives and also has deficiencies in terms of specificity and sensitivity. Immuno-capture reverse transcription PCR depends on high-quality RNA and the design of specific primers, is complex to operate, and the detection results are greatly affected by the capture efficiency of antibodies. The primer design and optimization of reaction conditions for multiplex reverse transcription polymerase chain reaction are difficult. Real-time quantitative reverse transcription polymerase chain reaction is complex to operate, has a high equipment cost, and cannot detect unknown pathogens. Reverse transcription loop-mediated isothermal amplification has the problem of being prone to aerosol contamination and resulting in false positives, and the reaction temperature is relatively higher than that of RAA.

[0004] Recombinase Aided Amplification (RAA) is a novel nucleic acid amplification technology developed in 2012 that can rapidly amplify nucleic acids under constant conditions (usually 37 - 42°C). The CRISPR-Cas system is a genomic region in prokaryotic cells used to store genetic information related to adaptive immunity, mainly consisting of two parts: one is Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR), and the other is the associated protein (CRISPR-associated protein, Cas). The RT-RAA-CRISPR / Cas12a visual detection method has the advantages of simplicity, rapidity, sensitivity, and specificity. However, there is currently no relevant report on the RT-RAA-CRISPR / Cas12a visual detection method for PNRSV. Summary of the Invention

[0005] The object of the present invention is to provide a visual detection kit and method for Prunus necrotic ringspot virus based on RT-RAA-CRISPR / Cas12a.

[0006] In the first aspect, the present invention claims a set of reagents for identifying or assisting in the identification of Prunus necrotic ringspot virus.

[0007] The set of reagents for identifying or assisting in the identification of Prunus necrotic ringspot virus claimed by the present invention includes an RAA primer pair;

[0008] The RAA primer pair consists of primer-F and primer-R;

[0009] The primer-F is as follows a1) or a2):

[0010] a1) A single-stranded DNA molecule shown in Sequence 1 in the sequence listing;

[0011] a2) A single-stranded DNA molecule obtained by substituting and / or deleting and / or adding one or several nucleotides to Sequence 1 and having the same function as Sequence 1;

[0012] The primer-R is as follows a3) or a4):

[0013] a3) A single-stranded DNA molecule shown in Sequence 2 in the sequence listing;

[0014] a4) A single-stranded DNA molecule obtained by substituting and / or deleting and / or adding one or several nucleotides to Sequence 2 and having the same function as Sequence 2.

[0015] In the above-mentioned kit of reagents, the molar ratio of the primer-F to the primer-R is 1:1.

[0016] Furthermore, the kit of reagents further includes the crRNA corresponding to the RAA primer pair;

[0017] The crRNA is as follows a5) or a6):

[0018] a5) A single-stranded RNA molecule shown as sequence 3 in the sequence listing;

[0019] a6) A single-stranded RNA molecule obtained by substituting and / or deleting and / or adding one or several nucleotides to sequence 3 and having the same function as sequence 3.

[0020] Even further, the kit of reagents further includes Cas12a protein and reporter DNA.

[0021] The Cas12a protein is selected from any one of the following proteins: AsCas12a, LbCas12a, Lb4Cas12a, Lb5Cas12a, FnCas12a, HkCas12a, OsCas12a, TsCas12a, BbCas12a, BoCas12a.

[0022] In some embodiments, the Cas12a protein is LbCas12a protein.

[0023] The reporter DNA is a DNA molecule with a signal reporting function, and when the DNA molecule is cleaved and degraded by the Cas12a protein, it can report a positive signal and be detected.

[0024] In some embodiments, the reporter DNA is a single-stranded DNA with a fluorescent group linked to one end and a quenching group linked to the other end.

[0025] The fluorescent group is selected from any one of the following groups: FAM, 6-FAM, VIC, HEX, TRT, CY3, CY5, ROX, JOE, FITC, TET, NED, TAMRA, LC RED640, LC RED705, Quasar705, Texas Red.

[0026] The quenching group is selected from any one of the following groups: TAMRA, BHQ1, BHQ2, BHQ3, MGB, Dabcy1.

[0027] In a preferred embodiment, the reporter DNA is a single-stranded DNA with a FAM fluorescent group linked to the 5′ end and a BHQ1 quenching group linked to the 3′ end. The nucleotide sequence of the single-stranded DNA is as follows: TTATT.

[0028] In a second aspect, the present invention claims a new use of the above-mentioned kit of reagents, the above-mentioned RAA primer pair, or the above-mentioned crRNA.

[0029] The present invention claims the use of the above-mentioned kit of reagents, the above-mentioned RAA primer pair, or the above-mentioned crRNA in any one of the following b1)-b8):

[0030] b1) Identifying or assisting in the identification of Prunus necrotic ringspot virus or its nucleic acid;

[0031] b2) Preparing a product for identifying or assisting in the identification of Prunus necrotic ringspot virus or its nucleic acid;

[0032] b3) Detecting or assisting in the detection of whether a test sample contains Prunus necrotic ringspot virus or its nucleic acid;

[0033] b4) Preparing a product for detecting or assisting in the detection of whether a test sample contains Prunus necrotic ringspot virus or its nucleic acid;

[0034] b5) Distinguishing or assisting in the distinction of Prunus necrotic ringspot virus from other viruses;

[0035] b6) Preparing a product for distinguishing or assisting in the distinction of Prunus necrotic ringspot virus from other viruses;

[0036] b7) Preventing and controlling or assisting in the prevention and control of Prunus necrotic ringspot virus;

[0037] b8) Preparing a product for preventing and controlling or assisting in the prevention and control of Prunus necrotic ringspot virus.

[0038] In a third aspect, the present invention also claims a kit for identifying or assisting in the identification of Prunus necrotic ringspot virus.

[0039] The kit for identifying or assisting in the identification of Prunus necrotic ringspot virus claimed by the present invention contains the above-mentioned kit of reagents; the functions of the kit are any one of the following c1)-c4):

[0040] c1) Identifying or assisting in the identification of Prunus necrotic ringspot virus or its nucleic acid;

[0041] c2) Detecting or assisting in the detection of whether a test sample contains Prunus necrotic ringspot virus or its nucleic acid;

[0042] c3) Distinguishing or assisting in the distinction of Prunus necrotic ringspot virus from other viruses;

[0043] c4) Preventing and controlling or assisting in the prevention and control of Prunus necrotic ringspot virus.

[0044] Furthermore, the kit further includes other reagents for RT-RAA amplification, such as buffer V and magnesium acetate I.

[0045] Further, the kit further includes other reagents for performing CRISPR / Cas12a detection, such as 10× Cas12a Reaction Buffer.

[0046] Furthermore, the kit further includes a negative control (such as an RNA sample derived from healthy peach fruits) and a positive control (such as an RNA sample derived from peach fruits carrying PNRSV).

[0047] In a fourth aspect, the present invention claims to protect a method for detecting or assisting in detecting whether a sample to be tested contains Prunus necrotic ringspot virus.

[0048] The method for detecting or assisting in detecting whether a sample to be tested contains Prunus necrotic ringspot virus claimed by the present invention includes the following steps: extracting the RNA of the sample to be tested, using the RNA of the sample to be tested as a template, performing RT-RAA amplification reaction with the above RAA primer pair to obtain an RT-RAA amplification product; adding the above crRNA, the above Cas12a protein, and the above reporter DNA to the RT-RAA amplification product to perform a CRISPR / Cas12a detection reaction, and determining whether the sample to be tested contains Prunus necrotic ringspot virus.

[0049] In the above method, the method for determining whether the sample to be tested contains Prunus necrotic ringspot virus is as follows: if the CRISPR / Cas12a detection reaction system is green, the sample to be tested contains (or carries) Prunus necrotic ringspot virus; if the CRISPR / Cas12a detection reaction system is colorless and transparent, the sample to be tested does not contain (or does not carry) Prunus necrotic ringspot virus.

[0050] In the above method, the system of the RT-RAA amplification reaction includes buffer V, the above primer-F, the above primer-R, and magnesium acetate I. The final concentrations of the primer-F and the primer-R in the system of the RT-RAA amplification reaction are preferably 0.4 μmol·L -1 .

[0051] In some embodiments, the system of the RT-RAA amplification reaction is as follows: 25 μL of buffer V, 2 μL of the above primer-F (10 μmol·L -1 ), 2 μL of the above primer-R (10 μmol·L -1 ), 5 μL of magnesium acetate I, 2 μL of template RNA, and 14 μL of nuclease-free water.

[0052] In the above method, the conditions of the RT-RAA amplification reaction are to react at 37 - 41 °C for 5 - 20 min, preferably to react at 41 °C for 25 min.

[0053] In the above method, the system of the CRISPR / Cas12a detection reaction includes 10×Cas12a Reaction Buffer, the above-mentioned Cas12a protein, the above-mentioned crRNA, and the above-mentioned reporter DNA.

[0054] The final concentration of the crRNA in the system of the CRISPR / Cas12a detection reaction is preferably 240 nmol·L -1 .

[0055] The final concentration of the Cas12a protein in the system of the CRISPR / Cas12a detection reaction is preferably 200 nmol·L -1 .

[0056] The final concentration of the reporter DNA in the system of the CRISPR / Cas12a detection reaction is preferably 800 nmol·L -1 .

[0057] In some embodiments, the system of the CRISPR / Cas12a detection reaction is as follows: 2.5 μL of 10×Cas12a Reaction Buffer, 1.0 μL of the above-mentioned Cas12a protein (5 μmol·L -1 ), 0.6 μL of the above-mentioned crRNA (10 μmol·L -1 ), 2.0 μL of the above-mentioned reporter DNA (10 μmol·L -1 ), 2 μL of RT-RAA amplification product, and 16.9 μL of ddH2O.

[0058] In the above method, the conditions of the CRISPR / Cas12a detection reaction can be reacting at 37-41 °C for 5-20 min, preferably reacting at 41 °C for 20 min.

[0059] In any of the above-mentioned applications or kits or methods, the other virus can be any one of the following viruses: plum pox virus (PPV), apple mosaic virus (ApMV), cucumber mosaic virus (CMV), potato virus X (PVX), potato virus Y (PVY).

[0060] In any of the above-mentioned applications or kits or methods, the test sample includes different tissue samples from plants (such as peaches, cherries) that can be infected by Prunus necrotic ringspot virus, and specifically can be a peach fruit sample.

[0061] The present invention combines the reverse transcriptase recombinase aided amplification (RT-RAA) technique with the CRISPR / Cas12a system. By designing and screening RT-RAA primers with good amplification effect and strong specificity, and optimizing conditions such as the concentration of RT-RAA primers and probes, amplification system, reaction temperature and time, a visual detection method for Prunus necrotic ringspot virus based on RT-RAA-CRISPR / Cas12a is established. By using this method to detect common viruses in Prunus plants, it is found that this method can specifically detect PNRSV and has no cross-reaction with common viruses in Prunus plants, demonstrating that this method has good specificity. Next, by using this method, the RT-RAA method and the RT-PCR method to detect PNRSV samples with different concentrations, it is found that the sensitivity of this method is 10 times that of the RT-PCR and RT-RAA detection methods, proving that this method has high sensitivity. The present invention further uses this method and the RT-PCR method to detect 31 suspected PNRSV-infected peach fruit samples collected at the port. It is found that the former detects 15 positive samples and the latter detects 14 positive samples, indicating that the method of the present invention is superior to the RT-PCR detection method in terms of detection performance and can be effectively used for the actual on-site detection of PNRSV.

[0062] The beneficial effects of the present invention are as follows: The visual detection method for Prunus necrotic ringspot virus based on RT-RAA-CRISPR / Cas12a established by the present invention requires two reactions, namely RT-RAA amplification and CRISPR / Cas12a detection. Coupled with the strong specificity of CRISPR / Cas, it can avoid false positive results caused by non-specific amplification of RT-RAA, enhance the specificity of detection, and there is no cross-reaction with other common viruses in Prunus plants. At the same time, the sensitivity of this method is also higher than that of RT-PCR, and its sensitivity reaches 10 times that of the RT-PCR detection method. In addition, the method of the present invention can obtain visual results by reacting at 41°C for 45 minutes. It has low requirements for the experimental environment, is easy to operate, and does not require precision instruments throughout the process. It only needs a constant temperature condition to complete, and is suitable for rapid on-site detection of PNRSV. In summary, the RT-RAA-CRISPR / Cas12a visual detection method for PNRSV established by the present invention has the characteristics of simplicity, rapidity, high sensitivity, high specificity and visualization. It can be widely applied to field and port quarantine, etc., and is more suitable for promotion and application at the grass-roots level, providing a more convenient and efficient technical means for the field diagnosis and prediction of Prunus necrotic ringspot virus in China. Description of the Drawings

[0063] Figure 1For primer screening and reaction condition optimization of the RT-RAA amplification reaction system. A: Screening of different primers for RT-RAA. The expected fragment sizes of RT-RAA products are as follows: RT-RAA-PNRSV-F1 / R1 is 220 bp, RT-RAA-PNRSV-F2 / R2 is 310 bp, RT-RAA-PNRSV-F3 / R3 is 320 bp, RT-RAA-PNRSV-F4 / R4 is 352 bp. Among them, CK1 is the blank control for primer RT-RAA-PNRSV-F1 / R1; CK2 is the blank control for primer RT-RAA-PNRSV-F2 / R2; CK3 is the blank control for primer RT-RAA-PNRSV-F3 / R3; CK4 is the blank control for primer RT-RAA-PNRSV-F4 / R4. B: Testing of different primer concentrations in the RT-RAA amplification reaction system. C: Testing of different reaction temperatures in the RT-RAA amplification reaction system. D: Testing of different reaction times in the RT-RAA amplification reaction system. NC: Negative control, CK: Blank control.

[0064] Figure 2 For feasibility analysis and reaction condition optimization of the RT-RAA-CRISPR / Cas12a detection reaction system. A, B: Feasibility analysis of RT-RAA-CRISPR / Cas12a. 1-6 are respectively Cas12a + crRNA + reporter DNA + target DNA, Cas12a + non-target crRNA + reporter DNA + target DNA, Cas12a + reporter DNA + target DNA, crRNA + reporter DNA + target DNA, Cas12a + crRNA + reporter DNA, Cas12a + crRNA + target DNA in sequence. C, D: Testing of different reaction temperatures in the RT-RAA-CRISPR / Cas12a detection reaction system. E, F: Testing of different concentration ratios (Cas12a to crRNA) in the RT-RAA-CRISPR / Cas12a detection reaction system. G, H: Testing of different reporter DNA concentrations in the RT-RAA-CRISPR / Cas12a detection reaction system. NC: Negative control.

[0065] Figure 3 For specificity testing of the RT-RAA-CRISPR / Cas12a visual detection method. 1-6 are respectively PNRSV, PPV, ApMV, CMV, PVX, PVY, 7: Negative control.

[0066] Figure 4Sensitivity test of the RT-RAA-CRISPR / Cas12a visual detection method. A: Sensitivity of RT-PCR. B: Sensitivity of RT-RAA. C, D, E: Sensitivity of RT-RAA-CRISPR / Cas12a. A: 1-7: cDNA dilution is 10 -1 ,10 -2 ,10 -3 ,10 -4 ,10 -5 ,10 -6 ,10 -7 ,8: Negative control, 9: Blank control. B, C, D, E: 1-7: Total RNA is diluted to 3.06 ng·μL -1 、306 pg·μL -1 、30.6 pg·μL -1 、3.06 pg·μL -1 、306 fg·μL -1 、30.6 fg·μL -1 、3.06 fg·μL -1 ,8: Negative control.

[0067] Figure 5 Repeatability test of the RT-RAA-CRISPR / Cas12a visual detection method. The concentration of PNRSV RNA sample in 1-3 is 908 pg·L -1 ,the concentration of PNRSV RNA sample in 4-6 is 90.8 pg·L -1 ,the concentration of PNRSV RNA sample in 7-9 is 9.08 pg·L -1 .

[0068] Figure 6 Actual sample detection of the RT-RAA-CRISPR / Cas12a visual detection method. A: Detection results of the RT-PCR detection method. B, C: Detection results of the RT-RAA-CRISPR / cas12a visual detection method. 1-31: Test samples, 32: Negative control. Detailed implementation manners

[0069] The present invention will be further described in detail below in conjunction with the detailed implementation manners. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0070] In the experimental methods of the following examples, unless otherwise specified, they are all conventional methods, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified.

[0071] The main reagents involved in the following examples and their sources or preparation methods are as follows: Go Taq Green Master Mix(2x) is a product of Promega Corporation, USA; DNA marker and 6×Loading Buffer are products of TaKara; GelRed TM Nucleic Acid Gel Stain(10000×) is a product of Biotium, USA; CRISPR-Cas12a is a product of Guangzhou Boles Biotechnology Co., Ltd., product number: M20301-0500; 10×Cas12a Reaction Buffer is a product of Guangzhou Bolaisi Biotechnology Co., Ltd.; product number: M20301-0500; The reporter DNA was synthesized by Shanghai Bioengineering Co., Ltd.; The recombinase polymerase isothermal amplification (RT-RAA) nucleic acid amplification kit is a product of Qitian Gene Biotechnology (Jiangsu) Co., Ltd., product number: B00R00A-48; Phenol / chloroform (1:1; V:V) was prepared by oneself according to the following method: Mix 20 mL of phenol (manufacturer: Xilong Scientific Co., Ltd.; product number: 108-95-2) completely dissolved at 50 °C and 20 mL of chloroform (manufacturer: Sinopharm Chemical Reagent Co., Ltd.; product number: 67-66-3) evenly, and store in the dark at 4 °C.

[0072] The method for extracting total RNA from the samples in the following examples includes the following steps: Take 100 mg of positive samples carrying PNRSV, extract total RNA by the CTAB method, and store the total RNA at -80 °C for later use.

[0073] The positive samples carrying PNRSV in the following examples are all peach fruits carrying PNRSV.

[0074] The negative control (NC) in the following examples is the total RNA of healthy peach fruit samples.

[0075] The blank control (CK) in the following examples is ddH2O.

[0076] Example 1. RT-RAA primers, crRNA sequences and kits for detecting PNRSV based on RT-RAA-CRISPR / Cas12a

[0077] I. Design and screening of RT-RAA primers

[0078] 1. Design of RT-RAA primers

[0079] Through the Basic Local Alignment Search Tool (BLAST) on the NCBI website, after a large amount of sequence analysis, the target region of PNRSV was obtained, and the design and synthesis of RT-PCR and RT-RAA primer pairs were carried out for this target region. Among them, the design of RT-RAA primers follows the following principles: the primer size is 30 - 35 nt; try to avoid having 5 identical single nucleotides or CG at the 5'-end of the primer; the GC content should be controlled between 40 - 60%; the length of the amplification product is preferably between 100 - 500 bp. The finally designed primer sequences are shown in Table 1.

[0080] Table 1

[0081]

[0082]

[0083] 2. Screening of RT-RAA primers

[0084] Using the total RNA of the positive sample carrying PNRSV as a template, RT-RAA amplification reactions were carried out respectively using 4 groups of specific primers in Table 1, and then the reaction products were analyzed by agarose gel electrophoresis.

[0085] The results showed that: target bands were successfully amplified by all 4 groups of primers, and the band sizes were consistent with the expectations. Among them, the band of primer RT-RAA-PNRSV-F2 / R2 was the brightest and had no obvious miscellaneous bands, and it was the best primer ( Figure 1 A).

[0086] II. Design and synthesis of probes and DNA

[0087] After determining the final RT-RAA amplification primers, find the TTTN sequence within the target region of its amplification product, select 20 - 23 nt backward for the reporter DNA, and then analyze the sequence conservation within the species and species-specificity through NCBI online BLAST comparison, and it cannot overlap with the RAA amplification primers to prevent false positive results in negative samples. Select the crRNA that meets the conditions and add a fixed hairpin structure sequence (UAAUUUCUACUAAGUGUAGAU) before the 23 nt sequence. The crRNA and reporter DNA sequences are shown in Table 2 and are both synthesized by Shanghai Bioengineering Co., Ltd.

[0088] Table 2

[0089] Name Sequence (5' to 3') Reporter DNA FAM-TTATT-BHQ1 PNRSV-crRNA UAAUUUCUACUAAGUGUAGAUGAGCGGUAUAGGACCUGCGGUCC (Sequence 3)

[0090] III. Visual Detection Kit for PNRSV Based on RT-RAA-CRISPR / Cas12a

[0091] The visual detection kit for PNRSV based on RT-RAA-CRISPR / Cas12a of the present invention includes the primers RT-RAA-PNRSV-F2 / R2 in Step 1, the PNRSV-crRNA and reporter DNA in Step 2, and the Cas12a protein.

[0092] Example 2. Establishment and Optimization of Visual Detection Method for PNRSV Based on RT-RAA-CRISPR / Cas12a

[0093] The visual detection method for PNRSV based on RT-RAA-CRISPR / Cas12a of the present invention includes RT-RAA amplification reaction and CRISPR / Cas12a detection reaction. The reaction systems and reaction conditions of the RT-RAA amplification reaction and the CRISPR / Cas12a detection reaction are optimized respectively. The specific steps are as follows:

[0094] I. Optimization of RT-RAA Amplification Reaction

[0095] 1. RT-RAA Amplification Reaction System and Conditions

[0096] Using the total RNA of the positive sample carrying PNRSV as a template, the RT-RAA amplification reaction system was prepared according to Table 3 using an RT-RAA nucleic acid amplification kit. The specific preparation method was operated according to the kit instructions. After the RT-RAA amplification reaction system was prepared, the RT-RAA amplification reaction was carried out to obtain the RT-RAA amplification product. The RT-RAA amplification reaction conditions were as follows: react at 37°C for 30 min.

[0097] Table 3

[0098] Reagent Volume (μL) Buffer V 25 <![CDATA[Primer F (10 μmol·L -1 )]]> 2 <![CDATA[Primer R (10 μmol·L -1 )]]> 2 Magnesium Acetate I 5 Template RNA 2 Nuclease-Free Water 14

[0099] 2. Optimization of RT-RAA Amplification Reaction System and Conditions

[0100] The single variable method was used to optimize the RT-RAA amplification reaction system and reaction conditions. The primer concentration, reaction temperature, and reaction time were set in gradients in turn, and the effects of primer concentration, reaction temperature, and reaction time on the RT-RAA amplification efficiency were analyzed. Specifically, the final concentrations of the primers were set to 0.1 μmol·L -1 、0.2 μmol·L -1 、0.4 μmol·L -1 、0.6 μmol·L -1 、0.8 μmol·L-1 ; The reaction temperatures were sequentially set as 37°C, 39°C, 41°C, 42°C, and 43°C; the reaction times were sequentially set as 15 min, 20 min, 25 min, 30 min, and 35 min. After the RT-RAA amplification reaction was completed, the RT-RAA amplification products were purified with an equal volume of phenol / chloroform (1:1; V:V) and analyzed by 1.5% agarose gel electrophoresis. According to indicators such as the clarity and purity of the electrophoresis bands, the amplification results were analyzed. Considering factors such as cost and convenience, the optimal primer concentration and reaction conditions were determined through comparative analysis.

[0101] The results showed that: in the RT-RAA amplification reaction, the brighter the amplification band was as the primer concentration increased, and the highest amplification efficiency was achieved when the primer concentration was 0.6 μmol·L -1 . Expected-sized bands could be amplified within the range of 37 - 43°C for the reaction temperature, and the highest amplification efficiency was obtained at 39°C or 41°C. Expected-sized bands could be amplified within the range of 15 - 35 min for the reaction time, and the optimal reaction times were 30 min and 35 min ( Figure 1 B - D). Considering both cost and amplification efficiency, the components of the optimal RT-RAA amplification reaction system were finally determined as follows: 25 μL of buffer V, 2 μL of primer RT-RAA-PNRSV-F2 (10 μmol·L -1 ), 2 μL of RT-RAA-PNRSV-R2 (10 μmol·L -1 ), 5 μL of magnesium acetate I, 2 μL of template RNA, and 14 μL of nuclease-free water. After mixing evenly, the reaction was carried out at a constant temperature of 41°C for 25 min.

[0102] II. Optimization of the CRISPR / Cas12a detection reaction system

[0103] 1. Optimization of the RT-RAA-CRISPR / Cas12a detection reaction system and conditions After the RT-RAA amplification reaction was completed, the RT-RAA amplification products did not need to go through the purification step and were directly used to prepare the CRISPR / Cas12a detection reaction system according to Table 4.

[0104] Table 4

[0105] Reagent Volume (μL) 10×Cas12a Reaction Buffer 2.5 <![CDATA[CRISPR-Cas12a (5 μmol·L -1 )]]> 0.5 <![CDATA[PNRSV-crRNA (10 μmol·L -1 )]]> 0.3 <![CDATA[Report DNA (10 μmol·L -1 )]]> 1.0 RT-RAA Amplification Product 2.0 <![CDATA[ddH2O]]> 18.7

[0106] The CRISPR / Cas12a detection reaction system was prepared on ice, and after mixing evenly, it was placed in an LC96 fluorescence quantitative PCR instrument to detect the FAM fluorescence signal. The CRISPR / Cas12a detection reaction conditions were as follows: react at 45°C for 20 min, and collect fluorescence data once per minute.

[0107] 2. Feasibility Analysis of RT-RAA-CRISPR / Cas12a Detection Reaction System

[0108] Prepare different RT-RAA-CRISPR / Cas12a detection reaction systems according to the following combinations from the detection reaction systems shown in Table 4: Cas12a + crRNA + reporter DNA + target DNA, Cas12a + non-target crRNA + reporter DNA + target DNA, Cas12a + reporter DNA + target DNA, crRNA + reporter DNA + target DNA, Cas12a + crRNA + reporter DNA, Cas12a + crRNA + target DNA. Among them, the target DNA is the RT-RAA amplification product in Step 1. Non-target crRNA: crRNA outside the target DNA sequence.

[0109] The results show that: The trans-cleavage activity of Cas12a protein is only activated when Cas12a / crRNA and the target sequence exist simultaneously. At this time, the reporter DNA in the reaction system will be cleaved, thereby releasing significant fluorescence signals, and these signals can be effectively detected by fluorescence detection equipment ( Figure 2 A and Figure 2 B).

[0110] 3. Optimization of the Temperature of RT-RAA-CRISPR / Cas12a Detection Reaction System

[0111] React the RT-RAA-CRISPR / Cas12a detection reaction system at 5 different temperatures (41°C, 42°C, 43°C, 44°C, 45°C) respectively.

[0112] The results show that: Relatively ideal fluorescence intensities can be achieved within the reaction temperature range of 41 - 45°C. Among them, the fluorescence intensity is the highest when the reaction temperature is 41°C. Therefore, 41°C is selected as the optimal reaction temperature for RT-RAA-CRISPR / Cas12a detection reaction ( Figure 2 C and 2D).

[0113] 4. Optimization of Cas12 / crRNA Concentration Ratio

[0114] In order to optimize the concentration ratio of Cas12a and crRNA, use a full-factor orthogonal experiment table (4×4 combination) to design the concentration gradients of Cas12a and crRNA. A total of 16 groups of experiments are required, as shown in Table 5 specifically. Observe the influence of different Cas12a and crRNA concentration ratios on the fluorescence signal intensity, so as to determine the optimal concentration ratio scheme.

[0115] Table 5

[0116] Experiment Group Number <![CDATA[Cas12a concentration (nmol·L -1 )]]> <![CDATA[Concentration of crRNA (nmol·L -1 )]]> 1 400 480 2 300 480 3 200 480 4 100 480 5 400 360 6 300 360 7 200 360 8 100 360 9 400 240 10 300 240 11 200 240 12 100 240 13 400 120 14 300 120 15 200 120 16 100 120

[0117] The results showed that when the concentration ratio of Cas12 / crRNA was 200:240, the fluorescence intensity of the RT-RAA-CRISPR / Cas12a detection reaction system reached the highest ( Figure 2 E and Figure 2 F), so 200 nmol·L -1 and 240 nmol·L -1 were selected as the optimal final concentrations of Cas12a and crRNA.

[0118] 5. Optimization of the concentration of reporter DNA

[0119] After determining the optimal concentrations of Cas12a and crRNA, the concentration of reporter DNA was further optimized. Final concentrations of 0, 200, 400, 800, 1200, 1600, and 2000 nmol·L -1 were set, and other conditions remained constant. The changes in fluorescence signal intensity at different concentrations of reporter DNA were observed to analyze and obtain the optimal concentration of reporter DNA.

[0120] The results showed that the green fluorescence intensity was positively correlated with the concentration of reporter DNA. When the final concentration of reporter DNA was 800 nmol·L -1 , the green fluorescence intensity in the reaction tube had reached an ideal effect ( Figure 2 G and Figure 2 H). Therefore, considering the cost, 800 nmol·L -1 was selected as the optimal final concentration of reporter DNA.

[0121] Based on the above optimization experiment results, the specific components of the finally determined optimal RT-RAA-CRISPR / Cas12a detection reaction system were as follows: 2.5 μL of 10×Cas12a Reaction Buffer, 1.0 μL of CRISPR-Cas12a (5 μmol·L -1 ), 0.6 μL of PNRSV-crRNA (10 μmol·L -1 ), 2.0 μL of reporter DNA (10 μmol·L -1 ), 2.0 μL of RT-RAA amplification product, 16.9 μL of ddH2O, and the optimal reaction condition was to react at 41°C for 20 min.

[0122] III. Visual detection method of PNRSV based on RT-RAA-CRISPR / Cas12a

[0123] After the optimization of Step 1 and Step 2, the PNRSV visual detection method based on RT-RAA-CRISPR / Cas12a of the present invention comprises the following steps:

[0124] 1. Using the RNA of the sample to be tested as a template, perform RT-RAA amplification reaction with primers RT-RAA-PNRSV-F2 and RT-RAA-PNRSV-R2 to obtain RT-RAA amplification products.

[0125] The RT-RAA amplification reaction system is as follows: 25 μL of Buffer V, 2 μL of primer RT-RAA-PNRSV-F2 (10 μmol·L -1 ), 2 μL of RT-RAA-PNRSV-R2 (10 μmol·L -1 ), 5 μL of Magnesium Acetate I, 2 μL of template RNA, and 14 μL of nuclease-free water. The final concentrations of primer RT-RAA-PNRSV-F2 and primer RT-RAA-PNRSV-R2 in the RT-RAA amplification reaction system are both 0.4 μmol·L -1 .

[0126] The RT-RAA amplification reaction conditions are as follows: React at a constant temperature of 41 °C for 25 min.

[0127] 2. Add the following reagents to 2.0 μL of the RT-RAA amplification product: 2.5 μL of 10×Cas12a Reaction Buffer, 1.0 μL of Cas12a protein (5 μmol·L -1 ), 0.6 μL of PNRSV-crRNA (10 μmol·L -1 ), 2.0 μL of reporter DNA (10 μmol·L -1 ), and 16.9 μL of ddH2O to obtain the CRISPR / Cas12a detection reaction system. The final concentration of crRNA in the CRISPR / Cas12a detection reaction system is 240 nmol·L -1 ; the final concentration of Cas12a protein in the CRISPR / Cas12a detection reaction system is 200 nmol·L -1 ; the final concentration of reporter DNA in the CRISPR / Cas12a detection reaction system is 800 nmol·L -1 .

[0128] Put the CRISPR / Cas12a detection reaction system into an LC96 fluorescence quantitative PCR instrument, set to detect FAM fluorescence signal. Collect fluorescence data once per minute. The CRISPR / Cas12a detection reaction conditions are as follows: React at 41 °C for 20 min. After the reaction is completed, observe the results under an ultraviolet lamp.

[0129] 3. Result determination

[0130] If the CRISPR / Cas12a detection reaction system shows green, the sample to be tested contains Prunus necrotic ring spot virus; if the CRISPR / Cas12a detection reaction system shows colorless and transparent, the sample to be tested does not contain Prunus necrotic ring spot virus.

[0131] Example 3. Specificity test

[0132] Using the total RNA of positive samples carrying Prunus necrotic ring spot virus (PNRSV), Plum pox virus (PPV), Apple mosaic virus (ApMV), Cucumber mosaic virus (CMV), Potato virus X (PVX), and Potato virus Y (PVY) as the samples to be tested respectively, the visualization detection method of PNRSV based on RT-RAA-CRISPR / Cas12a established in the present invention was used for detection.

[0133] The results showed that among all the tested samples, only the positive samples carrying PNRSV produced strong fluorescence signals, while the samples carrying other viruses did not show fluorescence signals ( Figure 3 ). It shows that the detection method established in the present invention has good specificity.

[0134] Example 4. Sensitivity test

[0135] Extract the total RNA of the positive sample carrying PNRSV and dilute it by 10-fold gradient to 3.06 ng·L -1 、306 pg·L -1 、30.6 pg·L -1 、3.06 pg·L -1 、306 fg·L -1 、30.6 fg·L -1 、3.06 fg·L -1 。 These 7 different RNA dilutions were detected by the visualization detection method of PNRSV based on RT-RAA-CRISPR / Cas12a established in the present invention. At the same time, RT-PCR and RT-RAA detection methods were used as controls. The lowest detection limits of the three detection methods of RT-PCR, RT-RAA, and RT-RAA-CRISPR / Cas12a were compared to evaluate the sensitivity differences.

[0136] The RT-PCR detection method includes the following steps: reverse transcribing the total RNA of PNRSV extracted to obtain cDNA, performing gradient dilution on the cDNA in the same method, and performing RT-PCR detection on 7 different cDNA dilutions (the primer sequences are shown in Table 1).

[0137] The results showed that RT-PCR and RT-RAA methods performed similarly in terms of sensitivity ( Figure 4 A and Figure 4 B). However, when the RAA method was innovatively combined with the CRISPR / Cas12a system, the sensitivity of detection was significantly enhanced, which was 10 times that of the RT-PCR and RT-RAA detection methods. When the RNA was diluted to 306 fg·μL -1 , the fluorescence signal could still be clearly observed by the RT-RAA-CRISPR / Cas12a method, further verifying its high sensitivity.

[0138] ( Figure 4 C-E).

[0139] Example 5. Repeatability test

[0140] The PNRSV visual detection method based on RT-RAA-CRISPR / Cas12a established by the present invention was used to detect PNRSV RNA samples with concentrations of 908 pg·L -1 , 90.8 pg·L -1 and 9.08 pg·L -1 respectively, and three independent repeated experiments were performed for each concentration.

[0141] The results showed that the coefficient of variation of the PNRSV visual detection method based on RT-RAA-CRISPR / Cas12a established by the present invention was less than 10%, and no fluorescence signal was detected in the set negative control, indicating that the detection method established by the present invention had good repeatability ( Figure 5 ).

[0142] Example 6. Detection of actual samples

[0143] Taking the RNA extracted from 31 peach fruit samples with suspected PNRSV infection symptoms collected at the port as the test samples, the PNRSV visual detection method based on RT-RAA-CRISPR / Cas12a established by the present invention was used for detection, and the RT-PCR method was used as a control at the same time to explore the applicability and accuracy of the PNRSV visual detection method established by the present invention in actual on-site detection.

[0144] The results showed that the number of positive samples detected by the RT-PCR method was 14, while the number of positive samples detected by the visual detection method of PNRSV based on RT-RAA-CRISPR / Cas12a established in the present invention was 15 (Table 6). The coincidence rate of the detection results of the two methods was as high as 96.8%. Thus, it can be seen that the visual detection method of PNRSV based on RT-RAA-CRISPR / Cas12a established in the present invention is superior to the RT-PCR method in terms of detection performance and can be effectively used for the actual on-site detection of PNRSV.

[0145] Table 6

[0146]

[0147] Note: + indicates a positive sample.

[0148] The present invention has been described in detail above. For those skilled in the art, without departing from the gist and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any modifications, uses, or improvements of the present invention, including those that depart from the scope disclosed in this application but are made by using conventional techniques known in the art. Some basic features can be applied within the scope of the following appended claims.

Claims

1. A set of reagents for identifying or assisting in the identification of Prunus necrotic ringspot virus, the set of reagents comprising a RAA primer pair; The RAA primer pair consists of primer-F and primer-R; The primer-F is as follows a1) or a2): a1) a single-stranded DNA molecule shown in Sequence 1 in the sequence listing; a2) a single-stranded DNA molecule having the same function as sequence 1 after one or more nucleotides are substituted and / or deleted and / or added; The primer-R is as follows a3) or a4): a3) a single-stranded DNA molecule shown in Sequence 2 in the sequence listing; a4) A single-stranded DNA molecule having the same function as sequence 2 after one or several nucleotides are substituted and / or deleted and / or added.

2. The reagent set according to claim 1, characterized in that: The molar ratio of the primer-F to the primer-R is 1:

1.

3. The reagent set according to claim 1 or 2, characterized in that: The kit also includes crRNA corresponding to the RAA primer pair; The crRNA is as follows a5) or a6): a5) a single-stranded RNA molecule shown in Sequence 3 in the sequence listing; a6) A single-stranded RNA molecule having the same function as sequence 3 after one or several nucleotides are substituted and / or deleted and / or added.

4. A reagent kit according to any one of claims 1 to 3, characterized in that: The kit also includes Cas12a protein and reporter DNA.

5. Use of the kit of reagents described in any one of claims 1 to 4, or the RAA primer pair described in claims 1 to 4, or the crRNA described in claims 1 to 4 in any one of the following b1) to b8): b1) Identify or assist in the identification of Prunus necrotic ringspot virus or its nucleic acid; b2) preparing products for identifying or assisting in the identification of Prunus necrotic ringspot virus or its nucleic acid; b3) Detecting or assisting in detecting whether the sample to be tested contains Prunus necrotic ringspot virus or its nucleic acid; b4) preparing products for detecting or assisting in detecting whether a sample to be tested contains Prunus necrotic ringspot virus or its nucleic acid; b5) Differentiate or assist in differentiating Prunus necrotic ringspot virus from other viruses; b6) preparing products that differentiate or assist in differentiating Prunus necrotic ringspot virus from other viruses; b7) Control or assist in the control of Prunus necrotic ringspot virus; b8) Preparing products for preventing or controlling or assisting in the prevention and control of Prunus necrotic ringspot virus.

6. A kit for identifying or assisting in the identification of Prunus necrotic ringspot virus, comprising a set of reagents as claimed in any one of claims 1 to 4; the function of the kit is any one of the following c1) to c4): c1) Identify or assist in the identification of Prunus necrotic ringspot virus or its nucleic acid; c2) Detecting or assisting in detecting whether the sample to be tested contains Prunus necrotic ringspot virus or its nucleic acid; c3) Differentiate or assist in differentiating Prunus necrotic ringspot virus from other viruses; c4) Prevent and control or assist in the prevention and control of Prunus necrotic ringspot virus.

7. A method for detecting or assisting in detecting whether a sample to be tested contains Prunus necrotic ringspot virus, the method comprising the following steps: extracting RNA from the sample to be tested, using the RNA of the sample to be tested as a template, and performing an RT-RAA amplification reaction using the RAA primer pair described in claims 1-4 to obtain an RT-RAA amplification product; adding the crRNA, Cas12a protein and reporter DNA described in claims 1-4 to the RT-RAA amplification product to perform a CRISPR / Cas12a detection reaction to determine whether the sample to be tested contains Prunus necrotic ringspot virus.

8. The method according to claim 7, characterized in that: The final concentrations of the primer-F and the primer-R in the RT-RAA amplification reaction system are both 0.4 μmol·L -1 .

9. The method according to claim 7 or 8, characterized in that: The final concentration of the crRNA in the CRISPR / Cas12a detection reaction system is 240 nmol·L -1 ; The final concentration of the Cas12a protein in the CRISPR / Cas12a detection reaction system is 200 nmol·L -1 ; The final concentration of the reporter DNA in the CRISPR / Cas12a detection reaction system is 800 nmol·L -1 .

10. The method according to any one of claims 7 to 9, characterized in that: The conditions of the RT-RAA amplification reaction are 41°C for 25 min; The conditions of the CRISPR / Cas12a detection reaction are 41° C. for 20 min.

Images