Mutant aspergillus niger strain and application thereof

Abstract

The invention relates to a mutated aspergillus niger strain and application thereof. Specifically, the present invention relates to a mutated Aspergillus niger strain, which is an auxotrophic strain of orotidin-5 '-phosphate decarboxylase, and which has an increased production capacity of an endogenous enzyme and / or a foreign protein relative to a starting strain.

Description

Technical Field

[0001] The present invention relates to the field of microorganisms, and more particularly to mutant Aspergillus niger strains, recombinant strains, biocatalysts, etc. obtained by using such strains, and a method for producing exogenous proteins using such strains. Background Art

[0002] Aspergillus niger belongs to the common species of fungi in the Ascomycotina subphylum, Moniliaceae family, and Aspergillus genus. It is also the most common filamentous fungus in nature and is widely distributed in plant products, grains, and soil. Its conidial head is dark brown and radiate, with a spherical vesicle, conidiophores of varying lengths, well-developed hyphae, and many branches. Aspergillus niger can grow rapidly by degrading organic matter in nature and absorbing nutrients therein. Aspergillus niger is listed as GRAS (Generally Regards As Safe) by the US Food and Drug Administration (FDA) and is recognized by the World Health Organization. It is a very common genus in filamentous fungi. Since Aspergillus niger can produce enzyme preparations and organic acids, it has become an important industrial production strain.

[0003] Aspergillus niger has a high ability to secrete and express proteins. The expression of exogenous proteins by Aspergillus niger has the characteristics of high expression level, high extracellular secretion rate, and a protein molecule folding and modification system close to that of higher eukaryotic cells, and the expressed exogenous proteins have natural activity. In addition, Aspergillus niger can also perform various post-translational processing, such as glycosylation modification, protease cleavage, and disulfide bond formation. Therefore, the use of Aspergillus niger as an expression strain to express homologous and heterologous proteins has been increasingly emphasized. Currently, commercial enzyme preparations produced by Aspergillus niger include amylase, glucose oxidase, catalase, cellulase, pectinase, protease, phytase, xylanase, etc. used in industries such as food, washing, textile, and papermaking. Heterologous proteins expressed by it include lysozyme, interleukin-6, human lactoferrin, bovine chymosin, thaumatin, lipase, etc.

[0004] Enzyme preparations applied to food in China must comply with the National Standard of the People's Republic of China GB2760 - National Food Standard \ Standard for the Use of Food Additives. Among them, the heterologous expression food-grade lysophospholipase (derived from Aspergillus niger) and lipase (derived from Candida antarctica) that comply with the regulations can only be heterologously expressed by Aspergillus niger, which reflects the importance of the Aspergillus niger expression system in the production of food enzymes.

[0005] Therefore, there is still a need in the art for Aspergillus niger strains that can efficiently express various proteins, especially food-grade lysophospholipase. Summary of the Invention

[0006] The present invention uses Aspergillus niger CICC2212 as the starting strain to construct a orotate phosphoribosyltransferase auxotrophic strain (pyrE-), and through ARTP mutagenesis screening, a colony with a lighter color is obtained. Tests show that the efficiency of protoplast transformation and Agrobacterium-mediated transformation of this strain is increased by 10 times and 5 times respectively. Moreover, when the strain expresses lysophospholipase, the color of the shake flask fermentation broth is significantly lighter, and the enzyme activity of the expressed lysophospholipase, endogenous glucoamylase, and endogenous amylase are increased by 104%, 243%, and 115% respectively. It is speculated that the secretion ability of this strain is significantly improved, and it can be used for highly efficient heterologous expression of various proteins, especially food-grade lysophospholipase.

[0007] Specifically, the present invention relates to the following aspects.

[0008] On the one hand, the present invention relates to a mutant Aspergillus niger strain, which is an orotate phosphoribosyltransferase auxotrophic strain, and its production ability of endogenous enzymes and / or foreign proteins is improved compared with the starting strain. For example, it can be increased by at least 100%, such as 100% - 300%.

[0009] In the present invention, the term "endogenous enzyme" refers to the enzyme expressed by the mutant Aspergillus niger strain itself. For example, it includes but is not limited to glucoamylase and amylase expressed by the mutant Aspergillus niger strain itself. In particular, compared with the starting strain, the expression of endogenous glucoamylase and endogenous amylase in the mutant Aspergillus niger strain of the present invention can be increased by 243% and 115% respectively.

[0010] In one embodiment, the mutant Aspergillus niger strain of the present invention has a deposit number of CGMCC NO.40941.

[0011] In addition to its own endogenous enzymes, the mutant Aspergillus niger strain of the present invention can efficiently express foreign proteins. The mutant Aspergillus niger strain of the present invention can be used to express a wide range of foreign proteins, such as amylase, glucose oxidase, catalase, cellulase, pectinase, protease, phytase, xylanase, lysozyme, interleukin-6, human lactoferrin, bovine chymosin, thaumatin, lipase, etc. In particular, when the mutant Aspergillus niger strain of the present invention recombinantly expresses lysophospholipase LPL, the protein expression level can be increased by more than 100% compared with the starting strain, such as 100% - 150%, especially 100% - 120%, and more especially 104%. Therefore, this strain has obvious practicality for highly efficient expression of foreign proteins.

[0012] On the other hand, the present invention relates to a recombinant Aspergillus niger strain, which is obtained by introducing a gene encoding an exogenous protein into the above-mentioned mutant Aspergillus niger strain. In one embodiment, the exogenous protein is an enzyme and other proteins, such as amylase, glucose oxidase, catalase, cellulase, pectinase, protease, phytase, xylanase, lysozyme, interleukin-6, human lactoferrin, bovine chymosin, thaumatin, lipase, etc., especially lysophospholipase.

[0013] On the other hand, the present invention relates to a method for producing a target protein, which includes introducing a gene encoding the target protein into the above-mentioned mutant Aspergillus niger strain and culturing the strain to produce the target protein. Alternatively, it includes culturing the Aspergillus niger strain of the present invention to produce the target protein. In one embodiment, the target protein is an enzyme and other proteins, such as amylase, glucoamylase, glucose oxidase, catalase, cellulase, pectinase, protease, phytase, xylanase, lysozyme, interleukin-6, human lactoferrin, bovine chymosin, thaumatin, lipase, etc., especially lysophospholipase.

[0014] On the other hand, the present invention relates to a composition, which contains the Aspergillus niger strain of the present invention. The composition may also contain excipients suitable for microorganisms, such as culture media, etc.

[0015] On the other hand, the present invention relates to an exogenous protein produced by the strain described above. The exogenous protein is an enzyme and other proteins, such as amylase, glucose oxidase, catalase, cellulase, pectinase, protease, phytase, xylanase, lysozyme, interleukin-6, human lactoferrin, bovine chymosin, thaumatin, lipase, etc., especially lysophospholipase. The exogenous protein can be used in food, preferably as an enzyme for food, more preferably as a lysophospholipase for food.

[0016] The present invention also relates to a recombinant microbial cell, into which an intracellular component derived from the above-mentioned mutant Aspergillus niger strain is introduced. After obtaining the strain of the present invention, its intracellular components can be separated by conventional techniques and introduced into other microorganisms. The recombinant microbial cell into which the components are introduced has the excellent properties of the strain described in the present invention. In the present invention, the term "intracellular component" refers to the sum total of all genetic materials of an organism, specifically including, but not limited to: coding DNA and non-coding DNA, mitochondrial DNA.

[0017] Specifically, the mutant Aspergillus niger strain of the present invention can be used to express foreign proteins. After obtaining the mutant Aspergillus niger of the present invention, a commonly used expression vector can be introduced into it for expressing foreign proteins. For example, the expression vector may contain a promoter and a terminator, and there is a multiple cloning site between the promoter and the terminator, into which a gene encoding a foreign protein can be inserted. The promoter may contain one or more copies of an enhancer. Many commercial vectors can be used for expressing foreign proteins in the mutant Aspergillus niger strain of the present invention.

[0018] When expressing foreign proteins not derived from Aspergillus niger, the codons of some species may be rare codons in Aspergillus niger. Therefore, when introducing the expression vector, the gene encoding the foreign protein can be first optimized for the codons of Aspergillus niger suitable for the present invention, so as to increase the expression level.

[0019] The Aspergillus niger of the present invention can express a variety of foreign proteins, including food enzymes, such as food lipases, pharmaceutical proteins, various enzymes from plants, animals and bacteria, membrane receptor proteins, proteins containing cofactors, and proteins that can be used for studying crystal structures, etc. The Aspergillus niger expressing foreign enzyme components of the present invention can also use whole cells as biocatalysts.

[0020] The present invention also relates to the use of the Aspergillus niger strain of the present invention in the production of enzymes, such as enzymes selected from amylase, glucoamylase and lysophospholipase. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 is a schematic diagram of the LPL gene expression vector constructed in the present invention.

[0022] Figure 2 is a comparative protein electrophoresis map of the expression of LPL by CICC2212, AN17E and AN17E-S strains.

[0023] Figure 3 is an electrophoresis map of the expression of LPL, endogenous glucoamylase and endogenous amylase by the AN19E-13 strain in Patent Application CN116376725A.

[0024] Description of Preservation

[0025] The strain AN17E-S of the present invention was deposited on November 30, 2023 at the China General Microbiological Culture Collection Center (CGMCC), Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC No. 40941 and the taxonomic name Aspergillus niger. DETAILED DESCRIPTION OF THE INVENTION

[0026] The initial strain Aspergillus niger of the present invention was purchased from the China Center of Industrial Culture Collection (abbreviated as CICC), and the strain preservation number is CICC2212. The initial strain was first spread on a MM solid medium plate, and spores were cultured at 28 °C for 5 days. After eluting the spores, they were then subjected to ultraviolet mutagenesis, and finally screened by adding 5-fluorouracil and uracil on the screening plate to obtain the orotate phosphoribosyltransferase auxotrophic strain AN17E.

[0027] Then, by means of ARTP mutagenesis, a strain AN17E-S was screened. On the plate supplemented with uracil, compared with the starting strains CICC2212 and AN17E, the colony color of AN17E-S became significantly lighter.

[0028] Attempts were made to find the mutated genes in AN17E-S by resequencing. Suzhou Genewiz Biotechnology Co., Ltd. was commissioned to perform resequencing experiments on the mutant strain AN17E-S and the starting strain AN17E.

[0029] The results showed that mutations existed in at least the following genes:

[0030] kinesin light chain (XP_001393261.2); ssd1 (XP_001392470.1); cullin-3 (XP_001394191.1); integral membrane protein (XP_025458391.1); aspergillopepsin A-like aspartic endopeptidase (XP_001401093.1); MFS transporter (XP_001399738.2); csmA (XP_001399377.2); prpA (XP_001398580.1).

[0031] Attempts were made to express exogenous lysophospholipase (LPL) in the Aspergillus niger strain AN17E-S, and it was found that the efficiency of protoplast transformation and Agrobacterium-mediated transformation of this strain increased by 10 times and 5 times respectively. Moreover, when the strain was expressing lysophospholipase, the color of the shake flask fermentation broth became significantly lighter, and the enzyme activity of the expressed lysophospholipase, endogenous glucoamylase and endogenous amylase increased by 104%, 243% and 115% respectively. It is speculated that the secretion ability of this strain has been significantly improved and can be used for highly efficient heterologous expression of various proteins, especially food-grade lysophospholipase.

[0032] In the present invention, the term "ARTP" is an abbreviation for Atmospheric and Room Temperature Plasma, specifically referring to a plasma jet that can be generated under atmospheric pressure and has a temperature between 25 - 40°C and a high concentration of active particles (including excited helium atoms, oxygen atoms, nitrogen atoms, OH radicals, etc.). The term "ARTP mutagenesis" means using the atmospheric and room temperature plasma technology for strain mutagenesis. Specifically, in an atmospheric and room temperature plasma source using helium as the working gas, there are various chemically active particle components, such as OH, nitrogen molecule two positive systems, nitrogen molecule one negative system, excited helium atoms, hydrogen atoms, and oxygen atoms. The active energy particles rich in ARTP cause damage to the genetic material of strains / plants / cells, etc., and induce biological cells to initiate the SOS repair mechanism. The SOS repair process is a high-error tolerance repair. Therefore, a rich variety of mismatch sites will be generated during the repair process, and finally, it will be stably inherited to form mutant strains. The intensity of SOS repair is highly correlated with the degree of DNA damage.

[0033] Example 1: Obtaining a orotate phosphoribosyltransferase auxotrophic Aspergillus niger strain

[0034] Inoculate and spread the spores of Aspergillus niger CICC2212 strain on an MM solid medium (1% glucose, 0.15% KH2PO4, 0.6% NaNO3, 0.05% KCl, 0.05% MgSO4, 2% agar powder), and culture statically at 28°C for 5 days to obtain Aspergillus niger spores. Elute the fresh Aspergillus niger CICC2212 spores with a spore washing solution (0.9% NaCl, 0.05% Tween 80), and prepare a spore suspension by filtering through Miracloth (Calbiochem, Cat#475885). Wash the cells with sterile water twice and adjust to 1×107 cells / mL. Take 2 mL of the spore suspension and evenly disperse it on the surface layer of a petri dish, and irradiate it under an ultraviolet lamp in a laminar flow hood for 90 s. Take 100 μL and spread it on an MM solid medium supplemented with 0.3% uracil and 1 mg / mL 5-fluoroorotic acid (5-FOA), and culture in the dark at 28°C (operate under red light throughout the process to prevent back mutation) for 7 days. Transfer the single colonies grown on the MM solid medium in the previous step to an MM solid medium and an MM-Uracil solid medium, and pick the strains that can only grow on the MM-Uracil solid medium to obtain the orotate phosphoribosyltransferase pyrE auxotrophic Aspergillus niger AN17E strain. Through sequencing of the pyrE gene of Aspergillus niger AN17E strain, it was found that a base deletion occurred at the 71st amino acid (a total of 241 amino acids), resulting in a frameshift mutation and gene inactivation.

[0035] Example 2: Construction of LPL Expression Vector

[0036] The exogenous Aspergillus niger lysophospholipase (LPL) gene sequence is as follows:

[0037] Nucleic acid sequence:

[0038]

[0039] Amino acid sequence:

[0040] APAPAPMQRRDISSTVLDNIDLFAQYSAAAYCSSNIESTGTTLTCDVGNCPLVEAAGATTIDEFDDTSSYGDPTGFIAVDPTNELIVLSFRGSSDLSNWIADLDFGLTSVSSICDGCEMHKGFYEAWEVIADTITSKVEAAVSSYPDYTLVFTGHSYGAALAAVAATVLRNAGYTLDLYNFGQPRIGNLALADYITGQNMGSNYRVTHTDDIVPKLPPELLGYHHFSPEYWITSGNDVTVTTSDVTEVVGVDSTAGNDGTLLDSTTAHRWYTIYISECS(SEQ ID NO:2)

[0041] For specific operations, refer to the method in "Molecular Cloning: A Laboratory Manual" (Third Edition, New York, Cold Spring Harbor Laboratory Press, New York: Cold Spring Harbor Laboratory Press, 1989) to construct the LPL gene expression vector pANE-LPL. The construction process is as follows:

[0042] The LPL gene (SEQ ID NO:1, with the Aspergillus oryzae α-amylase signal peptide (NCBI sequence number: XM_001821384.2, 1-63bp sequence)) obtained by gene synthesis from Sangon Biotech (Shanghai) Co., Ltd. was inserted into the expression cassette containing the Aspergillus oryzae enolase promoter (NCBI sequence number: D63941.1, 215-734bp; containing 12 copies of the enhancer sequence (gtcgtgtcgggcatttatcgggggatggaccaatcagcgtagg, SEQ ID NO:3)) and the Aspergillus niger glucoamylase terminator (NCBI sequence number: AF214480.1, the terminator sequence part) using the SphI and HindIII restriction enzyme sites. The entire expression cassette was inserted into the multiple cloning site of the cloning vector pSP72 (Promega: P2191) with BglII and XhoI. Finally, the PyrE expression gene from Aspergillus niger (NCBI sequence number: AY840014.1) was inserted into the vector at the XhoI restriction enzyme site to construct the LPL gene expression vector pANE-LPL. Its structure is shown in Figure 1 .

[0043] Example 3: Complementation experiment of Aspergillus niger AN17E

[0044] Elute fresh Aspergillus niger AN17E spores with spore wash solution, filter through Miracloth to prepare a spore suspension, and adjust it to 1×107 spores / mL. Inoculate 1 mL of the spore suspension into the mycelium medium (2% tryptone, 1% yeast extract, 2% glucose, 0.3% uracil), and culture at 28 °C and 180 rpm for 40 hours. Filter the grown mycelium with sterilized Miracloth and collect it.

[0045] Wash the collected mycelium three times with sterilized osmotic stabilizer (0.6 M MgSO4, 10 mM NaH2PO4, pH = 5.8), and press dry. Transfer the mycelium to a 100 mL Erlenmeyer flask, and resuspend every 0.8 g of mycelium in 20 mL of enzymatic hydrolysis solution (enzymatic hydrolysis solution prepared with 1% lysing enzyme, 1% cellulase, 0.1% snail enzyme using osmotic stabilizer, filtered and sterilized with a 0.22 μm microporous membrane). Incubate at 30 °C and 90 rpm for 60 - 90 min. Filter the well-hydrolyzed protoplast mixture with Miracloth, collect the filtrate, centrifuge at 4 °C and 1000 g for 10 min, resuspend the protoplast pellet with 5 mL of pre-cooled 1.0 mol / L sorbitol solution, centrifuge at 800 g and 4 °C for 10 min, and discard the supernatant. Then adjust the protoplasts to 1×107 protoplasts / mL with pre-cooled STC solution (1.0 M sorbitol, 50 mM CaCl2, 50 mM Tris-HCl, pH = 7.5), and keep it on ice for use.

[0046] To 200 μL of the protoplast suspension, add 10 μL of the LPL expression vector pANE-LPL with a concentration of 1 μg / μL, and then add 50 μL of PTC solution (40% PEG4000, 50 mM CaCl2, 50 mM Tris-HCl, pH = 7.5). Mix well and incubate on ice for 30 min. Add 0.2 mL of PTC solution, mix well, then add 0.8 mL of PTC solution, mix well, and keep at room temperature for 30 min.

[0047] Spread the above mixture on the regeneration medium (1% glucose, 0.6% NaNO3, 0.15% KH2PO4, 0.05% KCl, 0.05% MgSO4, 0.001% FeSO4, 1 M sucrose, 2% agar powder), and culture at 28 °C for 7 days until colonies grow.

[0048] Transfer the colonies grown on the plate to the lysophospholipase LPL screening medium, and culture at 28 °C for 3 days.

[0049] The components of the LPL screening medium are as follows:

[0050] Solution A: 2% maltose, 1.34% YNB, 6.88 g of citric acid / 500 mL, 5.07 g of sodium citrate / 500 mL, 5 mM CaCl₂, made up to 200 mL with water.

[0051] Solution B: 1% lecithin, emulsified with a homogenizer in 200 mL of water, 2% agarose, 0.02% Triton-x-100, made up to 300 mL with water.

[0052] After sterilization, mix Solution A and Solution B and pour into plates.

[0053] Transformation found that Aspergillus niger AN17E could well achieve the pyrE gene complementation experiment, and the transformants showed the activity of lysophospholipase LPL in the lysophospholipase LPL screening medium, further proving the successful establishment of an Aspergillus niger expression system with the uracil phosphoribosyltransferase auxotrophic Aspergillus niger AN17E as the host.

[0054] Example 4: ARTP mutagenesis and screening of Aspergillus niger AN17E

[0055] Elute fresh Aspergillus niger AN17E spores with spore washing solution, prepare a spore suspension by filtering through Miracloth, and adjust to 2×10⁷ cells / mL. After mixing the spore suspension with 10% glycerol at a ratio of 1:1, take 10 μL of the mixed solution onto an iron sheet and treat it with an ARTP instrument (Wuxi Yuanqing Tianmu Biotechnology Co., Ltd., instrument model: ARTP-M) for 100 s. Instrument parameters are set as follows: radio frequency power range 120 W, helium gas volume 10 SLM (99.999% high-purity helium gas), irradiation distance 2 mm.

[0056] After the treatment, remove the small iron sheet and put it into a centrifuge tube containing 1 mL of sterile water. Then, repeatedly aspirate with a pipette tip to wash the bacteria on the iron sheet. After diluting 100 times, spread it on a suitable culture plate (MM solid medium supplemented with 0.3% uracil) and place it in an incubator at 30 °C for 3 days.

[0057] After mutagenesis screening, a strain AN17E-S with significantly lighter colony color was found. Strain AN17E-S was deposited on November 30, 2023, at the China General Microbiological Culture Collection Center (CGMCC), Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit number is CGMCC No. 40941, and the taxonomic name is Aspergillus niger.

[0058] Example 5: Investigation of the expression ability of Aspergillus niger AN17E-13

[0059] The transformation operation of Aspergillus niger AN17E-S was the same as that in Example 3, and the LPL expression vector pANE-LPL was transformed into the strain.

[0060] The Aspergillus niger AN17E transformant in Example 3 was used as a control. In addition, pANE-LPL was transformed into Aspergillus niger CICC2212, and the operation steps were the same as those in Example 3, but there were the following differences: Since Aspergillus niger CICC2212 could not use pyrE as a screening marker, p3SR2 (BCCM / LMBP: Accession number: 2363), containing the acetamidase (amdS) gene, was used for transformation screening. In addition, sodium nitrate needed to be removed from the regeneration medium, and 15 mM acetamide and 20 mM cesium chloride needed to be supplemented.

[0061] Forty transformants were selected from each of the three transformants for shake flask fermentation. The fermentation medium (2% glucose, 15% maltose, 7% sodium citrate, 1.5% ammonium sulfate, 4% TSB, 0.1% sodium dihydrogen phosphate, 0.1% magnesium sulfate, 0.07% Tween 80, trace elements) was autoclaved at 115 °C for 15 min. The fermentation conditions were 28 °C, 200 rpm, 8 d, the inoculum size was 1×107 spores / 50 mL, and the activity of lysophospholipase LPL was measured.

[0062] The method for measuring the activity of lysophospholipase LPL was as follows:

[0063] 9 mL of substrate: 5 mL of 1% soybean phospholipid, 1 mL of 20% Triton X-100, 2.5 mL of 0.1 M citric acid-sodium citrate buffer at pH 4.0.

[0064] 10 μL of diluted enzyme solution + 90 μL of substrate were reacted at 50 °C for 10 min, inactivated at 95 °C for 5 min, centrifuged at 7000 rpm for 5 min, 1 μL of the supernatant was taken and added to 80 μL of reagent A in the NEFA kit (Wako: 294-63601), reacted at 37 °C for 10 min, and then 160 μL of reagent B was added and reacted for 10 min. The absorbance at 550 nm was measured.

[0065] The results showed that the enzyme activity of lysophospholipase LPL expressed by AN17E-S was 36800 U / mL, which was increased by 103% and 104% compared with the starting strains CICC2212 (18128 U / mL) and AN17E (18039 U / mL).

[0066] At the same time, it was measured using the general test method for industrial enzyme preparations QB / T 1803-1993, and it was found that the expression levels of endogenous glucoamylase and amylase in Aspergillus niger AN17E-S were increased by 243% and 115% compared with the starting strain AN17E.

[0067] Polyacrylamide gel electrophoresis analysis: The supernatant was filtered through a 0.22 μm filter membrane. After concentrating equal volumes of the supernatant to the same volume using a Milipore 10KDa ultrafiltration concentrator, the same volume of the concentrated enzyme solution was taken for polyacrylamide gel electrophoresis analysis. The electrophoresis results are as Figure 2 shown.

[0068] The results of the protein electrophoresis pattern showed that the concentrations of the lysophospholipase, glucoamylase, and amylase protein bands of the AN17E-S transformant were consistent with the enzyme activity results and were significantly higher than those of the control. It is speculated that the secretion ability of this strain has been significantly improved through mutagenesis and can be used for the efficient heterologous expression of various proteins, especially the expression of food-grade lysophospholipase and lipase.

[0069] In addition, when preparing and transforming Aspergillus niger protoplasts according to the steps of Example 3 as described above, it was also found that the transformation efficiency of AN17E-S was increased by at least 10 times compared with the starting strains CICC2212 and AN17E. Using the same 0.8 g of mycelium to prepare protoplasts and 10 μg of the expression vector for transformation, under the same operation and other reagents, AN17E-S could obtain more than 3000 transformants, while the starting strains CICC2212 and AN17E could only obtain 286 and 263 transformants respectively. This characteristic facilitates the genetic manipulation of the strain and increases the number of transformants that can be screened.

[0070] Example 6: Investigation of the Agrobacterium-mediated transformation efficiency of Aspergillus niger AN17E-13

[0071] Using Aspergillus niger starting strains CICC2212, AN17E, and AN17E-S as expression host bacteria and pCambia1300 as the transformation vector, transformation was carried out by the Agrobacterium-mediated transformation method.

[0072] The transformation method is as follows: The pCambia1300 plasmid (Abcam: ab275754) was transformed into Agrobacterium tumefaciens EHA105 (Beijing Huayueyang Biology NRR01040) by electrotransformation; The positive Agrobacterium tumefaciens containing the plasmid was inoculated into LB (containing 100 μg / mL rifampicin and 100 μg / mL kanamycin) liquid medium and cultured for about 24 h, and the cells were collected; Suspended with MMAS liquid (1% glucose, 0.15% KH2PO4, 0.6% NaNO3, 0.05% KCl, 0.05% MgSO4, 40 mM MES, 200 μM acetosyringone), diluted to an OD value of 0.5, and shaken at 28 °C for about 6 h, and the OD value was measured to be about 0.6 - 0.8. The spores of Aspergillus niger were washed off with Tween saline (0.9% NaCl, 0.05% Tween 80), counted, and were about 107 / ml. 100 μL of Agrobacterium tumefaciens and Aspergillus niger spores were each taken, mixed well and evenly spread on an IMAS solid plate (MMAS supplemented with 0.2% uracil, 0.5% uridine and 2% agar powder), and cultured in the dark at 23 °C for 72 h. Directly lay a layer of IMAS solid medium supplemented with 100 μg / mL hygromycin and 100 μg / mL cephalosporin antibiotics on the co-culture solid plate, and culture at 28 °C for 3 d.

[0073] The number of transformants grown was calculated. The results showed that when the same 106 Aspergillus niger spores were transformed, AN17E-S could obtain 83 transformants, while the starting strains CICC2212 and AN17E could only obtain 13 and 16 transformants. The transformation efficiency of AN17E-S was at least 5 times higher than that of the starting strains CICC2212 and AN17E. Further verified the effect of the improved transformation efficiency of the mutant strain AN17E-S.

[0074] Example 7: Comparison between Aspergillus niger AN17E-S and AN19E-13

[0075] The Aspergillus niger mutant strain AN19E-13 (Patent Publication No.: CN116376725A) is a mutant strain obtained in a similar manner, so relevant comparisons were made here.

[0076] Comparison of transformation efficiency: The transformation method of Example 3 and the LPL expression vector were used for transformation. Similarly, 0.8 g of mycelium was used to prepare protoplasts, and 10 μg of the expression vector was used for transformation. Under the same operation and other reagents, AN19E-13 and its starting strain CICC2243 could obtain about 1050 and 1200 transformants, while AN17E-S could obtain more than 3000 transformants, proving the specificity of the mutation effect of AN17E-S.

[0077] Comparison of secretion ability: The electrophoresis pattern of AN19E-13 expressing LPL (refer to patent CN116376725A) is as Figure 3 shown.

[0078] It can be seen from the electrophoresis pattern that AN19E-13 only has a specific effect of promoting the expression of LPL, and at the same time reduces the expression of endogenous glucoamylase and amylase in Aspergillus niger. This result is significantly different from that of the mutant strain AN17E-S in this case. The expression levels of all secreted proteins (including amylase and glucoamylase) in AN17E-S have increased. Therefore, the inventor believes that the mutation has changed the protein secretion pathway of AN17E, resulting in an improvement in the protein secretion ability of AN17E-S.

Claims

1. A mutant strain of Aspergillus niger, which is a orotidine-5'-phosphate decarboxylase auxotrophic strain and has an improved production capacity of endogenous enzymes and / or exogenous proteins as compared to the parental strain.

2. The mutant Aspergillus niger strain of claim 1, wherein the endogenous enzymes are selected from amylase and glucoamylase, and the exogenous protein is an enzyme, preferably lysophospholipase.

3. The mutant Aspergillus niger strain of claim 1 or 2, which has a deposit number of CGMCC NO. 40941.

4. A recombinant Aspergillus niger strain, which is obtained by introducing a gene encoding an exogenous protein into the strain of any one of claims 1-3.

5. The recombinant Aspergillus niger strain of claim 4, wherein the exogenous protein is an enzyme, preferably lysophospholipase.

6. A method for producing a target protein, comprising introducing a gene encoding the target protein into the strain of any one of claims 1-3 and culturing the strain to produce the target protein, or culturing the strain of any one of claims 1-5 to produce the target protein.

7. The method of claim 6, wherein the target protein is an enzyme, preferably an enzyme selected from amylase, glucoamylase and lysophospholipase.

8. A composition, which comprises the Aspergillus niger strain of any one of claims 1-5.

9. A recombinant microbial cell, into which an intracellular component derived from the strain of any one of claims 1-3 has been introduced.

10. Use of the strain of any one of claims 1-5 in the production of an enzyme, preferably an enzyme selected from amylase, glucoamylase and lysophospholipase.

Images