Sucrase-labeled solid-phase reporter, CRISPR-POCT detection composition and application of CRISPR-POCT detection composition

Abstract

The invention relates to the technical field of medical detection, in particular to a sucrase-labeled solid-phase reporter, a CRISPR-POCT (clustered regularly interspaced short palindromic repeats-point-of-care testing) detection composition and application thereof. The invention relates to a sucrase labeled solid phase reporter, which is prepared by the following method: S1, modifying T30 ssDNA (deoxyribonucleic acid) or U30 ssRNA (ribonucleic acid) at the 5'end by using DBCO TEG (dibasic copper oxide), and modifying the T30 ssDNA or U30 ssRNA at the 3 'end by using biotin to obtain 5'-DBCO TEG-U30-biotin-3 'RNA or 5'-DBCO TEG-T30-biotin-3 'DNA; s2, carrying out covalent binding on the sucrase modified by the azide group and 5 '-DBCO TEG-U30-biotin-3' RNA (Ribonucleic Acid) or 5 '-DBCO TEG-T30-biotin-3' DNA (Deoxyribose Nucleic Acid) oligonucleotide; and S3, modifying the surfaces of the microbeads with the sucrase-RNA or sucrase-DNA conjugate obtained in the step S2 to obtain a sucrase-labeled solid-phase reporter (ILR).

Description

Technical Field

[0001] The present invention relates to the field of medical detection technologies, and particularly relates to a sucrase-labeled solid-phase reporter, a CRISPR-POCT detection composition and their applications. Background Art

[0002] The development of viral antigen, antibody and nucleic acid detections has dominated viral infection screening and diagnosis. Among them, nucleic acid detection is generally superior to the other two detections in terms of accuracy and sensitivity, and is widely used clinically. At the same time, nucleic acid detection has particular advantages when early detection of infection is crucial or when antibody levels are below the detectable threshold.

[0003] Quantitative PCR integrates thermal cycle-based target amplification and fluorescence measurement into an independent device and occupies the position of the gold standard in nucleic acid detection. However, due to its physical size, high cost and special requirements for certified operators, the centralized distribution of this device in hospitals or laboratories is restricted. Complementary detection methods must be developed to meet the detection needs in resource-poor areas. These detection methods are particularly effective and important for the management of certain diseases, such as cervical cancer, which is characterized by persistent HPV infection. Multiple studies have concluded that expanding the coverage and frequency of pre-disease screening is effective in eliminating disease mortality.

[0004] Alternative methods for nucleic acid detection have been widely studied. This system offers excellent simplicity because target recognition, signal transduction and amplification can all be accomplished by a single ribonucleoprotein (RNP). Specifically, when the CRISPR effector proteins Cas12, Cas13 and Cas9 are complexed with the corresponding crRNA and bind to the target nucleic acid, they will cleave any surrounding DNA / RNA indiscriminately, a process called trans-cleavage. The concomitant activity on a simple fluorescent oligoribonucleic acid reporter molecule can be recorded as an output result by a fluorometer. Target specificity is determined by the spacer region of the crRNA, and the sequence design of the crRNA can be easily carried out to detect the nucleic acid of interest.

[0005] CRISPR-Cas-based biosensing has advantages in many aspects, including simple detection setup, short detection time and isothermal reaction, and has currently been widely used in the diagnosis of many pathogens, genetic alterations and the detection of miRNA biomarkers. However, target specificity becomes a major problem, especially in biological samples such as cells, blood and urine, where interfering substances coexist with trace amounts of target molecules. At the same time, the high cost of fluorometers hinders its large-scale use in clinics, not to mention its application in the home detection scenario.

[0006] The current gold standard for nucleic acid detection, real-time quantitative PCR detection, requires high-cost PCR instruments and professionally trained personnel to perform laboratory operations and cannot perform point-of-care testing (POCT) in clinics to quickly obtain reports. Summary of the Invention

[0007] The object of the present invention is to provide an invertase-labeled solid-phase reporter (ILR) for use in a biosensing platform for common nucleic acid targets to achieve rapid detection of nucleic acids.

[0008] The technical solution adopted by the present invention to solve its technical problems is as follows:

[0009] An invertase-labeled solid-phase reporter, which is prepared by the following method:

[0010] S1. T30 ssDNA or U30 ssRNA is modified with DBCO TEG at the 5' end and biotin at the 3' end to obtain 5'-DBCO TEG-U30-biotin-3' RNA or 5'-DBCO TEG-T30-biotin-3' DNA;

[0011] S2. Azide-modified invertase is covalently bound to 5'-DBCO TEG-U30-biotin-3' RNA or 5'-DBCO TEG-T30-biotin-3' DNA oligonucleotide;

[0012] S3. The invertase-RNA or invertase-DNA conjugate of S2 is modified on the surface of the microbead to obtain an invertase-labeled solid-phase reporter (ILR).

[0013] Preferably, the solid-phase reporter is prepared by the following method:

[0014] S1. T30 ssDNA or U30 ssRNA is modified with DBCO TEG at the 5' end and biotin at the 3' end;

[0015] S2. Azide-modified invertase is covalently bound to 5'-DBCO TEG-U30-biotin-3' RNA or 5'-DBCO TEG-T30-biotin-3' DNA oligonucleotide;

[0016] The RNA or DNA obtained by S1 and azide-modified invertase are shaken in a nuclease-free solution to react at room temperature to obtain an invertase-RNA or invertase-DNA conjugate, washed, and centrifugally concentrated;

[0017] S3. Modify the sucrase-RNA or sucrase-DNA conjugate of S2 on the surface of the microbeads:

[0018] Add the microbeads into a nuclease-free PBS solution containing Tween 20; the microbeads are streptavidin-coated magnetic microbeads;

[0019] Add sucrase-RNA-biotin or sucrase-DNA-biotin, and after the reaction, centrifuge to separate the unreacted materials;

[0020] The obtained microbeads are washed thoroughly with a PBS solution containing Tween 20 and centrifuged to precipitate them; Resuspend the ILR reporter in a nuclease-free PBS solution containing Tween 20 for storage.

[0021] Preferably, the content of Tween 20 in the PBS solution is 0.1% - 0.5%.

[0022] Preferably, the preparation of the azide group-modified sucrase in S2: React sucrase with an excessive amount of azide-PEG4-NHS ester linker at room temperature to react with the lysine residues on the surface of sucrase, and then remove the excess linker through a Sephadex desalting gravity column, concentrate to obtain the azide group-modified sucrase.

[0023] A CRISPR-POCT detection composition, comprising: the sucrase-labeled solid-phase reporter of the present invention and a CRISPR reaction system, the CRISPR reaction system comprising: a Cas enzyme, a crRNA; the crRNA is designed according to the gene information of the specific sequence of the target to be detected and matches the sequence fragment to be detected.

[0024] Preferably, when the Cas enzyme is Cas12a, the sucrase-labeled solid-phase reporter is a sucrase-DNA conjugate; when the Cas enzyme is Cas13a, the sucrase-labeled solid-phase reporter is a sucrase-RNA conjugate.

[0025] A CRISPR-POCT detection method, the method is:

[0026] This method uses loop-mediated isothermal amplification (LAMP) combined with a two-step reaction and a personal glucose meter (PGM) to read the results. The two-step reaction includes the reaction in tube 1 and the reaction in tube 2.

[0027] The reaction in tube 1 uses the amplification product to react with the CRISPR-POCT detection composition described in claim 4 to obtain the reaction solution of tube 1;

[0028] The reaction in tube 2 uses the reaction solution of tube 1 and the sucrose solution in tube 2 to react to obtain the reaction solution of tube 2;

[0029] Take a sample of the reaction solution in tube 2 and detect glucose using a personal glucose meter (PGM) and read out the result.

[0030] Preferably, the CRISPR-POCT detection method comprises the following steps:

[0031] S1. Sample lysis to obtain a lysate;

[0032] S2. Loop-mediated isothermal amplification (LAMP): Design specific primer pairs for the gene sequence to be detected, amplify the gene sequence to be detected in the above lysate to obtain an amplification product;

[0033] S3. CRISPR reaction: Add the above amplification product to tube 1 for CRISPR reaction. The T30 ssDNA or U30 ssRNA in the sucrase-labeled solid-phase reporter described in claim 1 is cleaved, so that the azide group-modified sucrase is disconnected from the stationary phase, and the stationary phase is separated to obtain the reaction solution in tube 1;

[0034] S4. Sucrase reaction: Add the reaction solution in tube 1 to tube 2, and react the reaction solution in tube 1 with the sucrose solution in tube 2 to obtain the reaction solution in tube 2;

[0035] S5. Result reading of a personal glucose meter (PGM): Take a sample of the reaction solution in tube 2 and detect glucose using a personal glucose meter (PGM) and read out the result.

[0036] Preferably, when the gene sequence to be detected is HPV18, the LAMP amplification primer sequences used include the following primer P123L1 composition:

[0037] P123L1_F3, CGAACCACAACGTCACAC, SEQ ID NO: 1;

[0038] P123L1_B3, CCTTCTGGATCAGCCATTG, SEQ ID NO: 2;

[0039] P123L1_FIP,

[0040] TCGTCTGCTGAGCTTTCTACTACGTTGTGTATGTGTTGTAAGTGTG, SEQ ID NO: 3;

[0041] P123L1_BIP, CTTCGAGCATTCCAGCAGCTTTGCTTACTGCTGGGATG, SEQ ID NO: 4;

[0042] P123L1_LB, GTTTCTGAACACCCTGTCCTTTGT, SEQ ID NO: 5, the crRNA sequence corresponding to the hpv18 target is P123L1 crRNA,

[0043] UAAUUUCUACUAAGUGUAGAUuacuacuagcucaauucuggc, SEQ ID NO: 6;

[0044] When the gene sequence to be detected is HPV16, the LAMP amplification primer sequences used include the following primer HPV16_LAMP composition:

[0045] HPV16_LAMP_F3, AGCCCATTACAATATTGTAACC, SEQ ID NO: 7,

[0046] HPV16_LAMP_B3, CATCCCGTACCCTCTTCC, SEQ ID NO: 8,

[0047] HPV16_LAMP_FIP,

[0048] CGAATGTCTACGTGTGTGCTTTTTTTGTTGCAAGTGTGACT, SEQ ID NO: 9,

[0049] HPV16_LAMP_BIP,

[0050] TGGGCACACTAGGAATTGTGTTTGGTACCTGCAGGATCA, SEQ ID NO: 10,

[0051] HPV16_LAMP_LB CCCCATCTGTTCTCAGAAACCATAA, SEQ ID NO: 11, the crRNA sequence corresponding to the hpv16 target is HPV16 crRNA,

[0052] UAAUUUCUACUAAGUGUAGAUtacgcacaaccgaagcgtag, SEQ ID NO: 12;

[0053] When the gene sequence to be detected is HPV52, the LAMP amplification primer sequences used include the following primer HPV52_LAMP composition:

[0054] HPV52_LAMP_F3, GTTCAGAGTGTTGGAGACC, SEQ ID NO: 13,

[0055] HPV52_LAMP_B3, ACAATGTAGTAATTGCTTGTGG, SEQ ID NO: 14,

[0056] HPV52_LAMP_FIP,

[0057] GTCAGTTGTTTCAGGTTGCAGATCCTGTGACCCAAGTGTAACG, SEQ ID NO: 15,

[0058] HPV52_LAMP_BIP,

[0059] TATGAGCAATTAGGTGACAGCTCACTTGTTCTGCTTGTCCATC, SEQ ID NO: 16,

[0060] HPV52_LAMP_LF TGCTTTGTCTCCACGCATGA, SEQ ID NO: 17, the crRNA sequence corresponding to the hpv52 target is; HPV52 crRNA,

[0061] UAAUUUCUACUAAGUGUAGAUagguugcagaucuaauauau, SEQ ID NO: 18.

[0062] Preferably, the sucrose solution is a 0.3 M sucrose solution (acetic acid buffer) with a pH of 5.0; the personal glucose meter (PGM) is Roche Accu-Chek PGM.

[0063] Use of a sucrose enzyme-labeled solid-phase reporter or a CRISPR-POCT detection composition or a CRISPR-POCT detection method according to the present invention in the detection of nucleic acid and non-nucleic acid targets. Detection of HPV18, HPV16 and HPV52 DNA has been successfully achieved under the tests of the present invention.

[0064] The present invention has developed an immobilized invertase-labeled reporter (ILR) through multiple chemical couplings. This reporter molecule responds to CRISPR-Cas activation triggered by target nucleic acids and releases active invertase, which further converts sucrose into glucose proportional to the target abundance. Cas12a / Cas13a and invertase signal amplification largely compensate for the insufficient sensitivity of personal glucose meters (PGMs). When configured for human papillomavirus (HPV) detection, the CRISPR-POCT detection composition targeting HPV18 can detect as few as 7 HPV18-positive HeLa cells in 7000 samples, achieving a sensitivity of 95.8% and a specificity of 100%. In addition, through minimal reagent reconfiguration, CRISPR-POCT detection compositions targeting HPV16 and HPV52 can also be easily established to achieve optimal sensitivity, specificity, and cross-species specificity. These findings highlight an efficient detection center suitable for multiple nucleic acid pathogens and suitable for point-of-care testing environments and home use.

[0065] The beneficial effects of the present invention are as follows:

[0066] 1. The invertase-labeled solid-phase reporter (ILR) constructed by the present invention through multiple coupling chemistries can promote signal transduction from nucleic acids to glucose; compared with other invertase-labeled reporters based on PGM detection, such as the invertase-labeled reporter in the method of integrating a personal glucose meter (PGM) into a paper-based analytical device (e.g., Figure 14 in the second line, the reporting system reported in this reference can only store for up to 4 weeks at most), the chemical structure of this invertase-labeled solid-phase reporter (ILR) is more stable and can be stored at -30 °C for more than 9 weeks without obvious structural and functional decay;

[0067] 2. For the CRISPR-POCT detection method described in the present invention, which integrates and verifies pre-amplification, target recognition, and signal transduction elements, the POCT detection method / CRISPR-POCT detection method integrating this invertase-labeled solid-phase reporter (ILR) has a lower detection limit compared to other POCT reporting systems based on personal glucose meters (PGMs). The lowest detection limit for each reaction can be as low as 7 HPV18-positive cells to detect the target nucleic acid (see Figure 14 );

[0068] 3. The present invention comprehensively evaluates the diagnostic performance of the described CRISPR-POCT detection method in laboratory synthetic models and actual clinical cervical cell samples. After verification, the CRISPR-POCT detection method described in the present invention can be used as a general nucleic acid target biosensing platform, and the detection of HPV18, HPV16, and HPV52 DNA has been successfully achieved under the tests of the present invention. Description of the Drawings

[0069] Figure 1 is a schematic diagram of a complete CRISPR - POCT detection method;

[0070] Figure 2 is the design and validation of a CRISPR - POCT detection composition for DNA detection, where (A) schematic diagram of the construction and detection procedure of the ILR reporter; (B) primary amine (4EQV) on the surface of sucrase; (C) UV - Vis absorption spectrum to reveal the composition of the sucrase - ssDNA conjugate; (D) confocal fluorescence microscopy study to confirm target - dependent sucrase release, scale bar: 50 μm. (E) Fluorescence in the supernatant; (F) Glucose conversion catalyzed by the released sucrase detected by PGM; synthetic ssDNA target (miR21) was used for stimulation in D - F;

[0071] Figure 3 is a representative Coomassie blue - stained gel photograph of LbCas12a purification, where (A) the filtered and cleared lysate supernatant was loaded onto Ni - NTA resin and eluted with buffers containing 10 mM and 50 mM imidazole after washing; (B) the elution fraction with high protein content was TEV - cleaved and washed again with Ni - NTA resin to finally obtain a high - purity LbCas12a preparation;

[0072] Figure 4 is the optimization of detection parameters, where (A) the reaction time of tube 1 was selected as 30 minutes because the signal had approached the plateau at this time; (B) the reaction time of tube 2 was selected as 20 minutes because its noise signal was negligible and the PGM readout was relatively satisfactory; (C) a sucrose concentration of 20% (i.e., 0.3 M) was selected;

[0073] Figure 5 is the stability results of ILR during long - term storage. The ILR reporter thawed after long - term storage at 4 °C or - 30 °C was directly stimulated with 0 (A) or 10 (B) pM ssDNA target, and then Cas12a - ILR / PGM detection was performed;

[0074] Figure 6 is that the CRISPR - POCT detection method (without LAMP) provides sensitivity comparable to that of a laboratory fluorometer. (A) A typical Cas12a trans - cleavage activity detection experiment. (B) LOD determination showed that the experimental detection limit was 5 pM. (C) PGM readout of serial dilutions of DNA targets by the CRISPR - POCT detection composition (Cas12a - ILR - PGM in the figure) obtained a comparable detection limit (LOD);

[0075] Figure 7The CRISPR-POCT detection composition (Cas13a) provides satisfactory sensitivity in RNA detection. (A) The target-dependent release of invertase was confirmed by confocal fluorescence microscopy. Scale bar represents 25 μm. (B) A typical Cas13a trans-cleavage activity detection experiment recorded by a BioTek Synergy Neo2 fluorescence spectrometer. (C) LOD determination showed that the experimental detection limit was 5 pM. (D) Serial dilutions of the RNA target were read out by PGM of the CRISPR-POCT detection composition (Cas13a-ILR-PGM in the figure), and a better LOD of 2.5 pM was obtained;

[0076] Figure 8 The HPV18 LAMP primer set with low self-amplification was screened. (A) Real-time fluorescence measurement of LAMP amplification reactions performed separately with various primer sets. (B) Agarose gel image of the LAMP amplification reaction products in A. (C) Positions of the P123L1 primer and the corresponding Cas12a crRNA on the HPV18 genome. (D) Agarose gel image of the products of LAMP reactions using various primer sets and the HPV18 E6E7E1 gene template. (E) Cas12a-ILR / PGM responded to the LAMP products in D;

[0077] Figure 9 Detection of the HPV18 gene in solution and cell lysates based on the CRISPR-POCT detection method of the present invention. (A) Agarose gel image showing the LAMP reaction products of plasmid templates. (B) Subsequent PGM readout of the LAMP products in A. (C) Specificity assessment of the CRISPR-POCT detection composition using 10,000 copies of the HPV plasmid. (D and E) Agarose gel and real-time fluorescence images of the LAMP reactions of cell lysates of cell mixtures containing different numbers of HeLa cells. The markers to the left of the dashed line are enhanced for clear visualization. (F) Subsequent Cas12a-ILR / PGM readout of the LAMP products in D and E;

[0078] Figure 10 Real-time fluorescence of LAMP reactions using pCDNA3.1 (A) and pCDNA-E6E7E1 (B) plasmid templates;

[0079] Figure 11 HeLa cells were detected as positive by the CRISPR-POCT detection method of the present invention. (A and D) Agarose gel images showing the LAMP reaction products of HEK-293, HeLa, and MIA PaCa-2 cell lysates. (B and E) Real-time fluorescence measurement of the LAMP reactions. (C and F) Subsequent PGM readout of the LAMP products in (A-B) and (D-E) respectively;

[0080] Figure 12 Detection of HPV18 gene in cultured cell samples based on RPA-Cas12a / fluorometer. (A) Different primer sets were tested to optimize RPA amplification of the HPV18 gene. (B) Appearance of FAM fluorescence was monitored in real time in RPA-Cas12a / fluorometer detection (DETECTR);

[0081] Figure 13 Detection of HPV18 in clinical cervical brush samples using the CRISPR-POCT detection method of the present invention. (A) Schematic diagram of comparative evaluation. (B) Heat map view of the detection values of qPCR and the CRISPR-POCT detection method of the present invention. Samples were vertically sorted according to their qPCR Cq values. (C) Comparison of PGM readings between the qPCR negative group and the positive group. The mean and standard deviation are represented by solid lines. The mean of the qPCR negative group plus 4 standard deviations was adopted as the threshold for detection by the CRISPR-POCT detection method of the present invention. (D) Correlation between qPCR and PGM readings in the qPCR positive group. (E) Table showing the consistency between qPCR and detection by the CRISPR-POCT detection method of the present invention in clinical samples. (F) Heat map view of the specific HPV18 detection results of the CRISPR-POCT detection method of the present invention for HPV18, HPV16, and HPV52 positive samples;

[0082] Figure 14 is the comparison of different integrated CRIPSR-Cas and PGM nucleic acid detection systems;

[0083] Figure 15 is the comparison of different HPV detection technologies. Detailed implementation mode

[0084] The technical solutions of the present invention will be further specifically described below through specific examples. It should be understood that the implementation of the present invention is not limited to the following examples, and any form of modification and / or change made to the present invention will fall within the protection scope of the present invention.

[0085] In the present invention, unless otherwise specified, all parts and percentages are in weight units, and the equipment and raw materials used can be purchased from the market or are commonly used in the art. The methods in the following examples are conventional methods in the art unless otherwise specified.

[0086] The reagents used in the following examples can be obtained from conventional biochemical reagent stores unless otherwise specified.

[0087] Preparation of LbCas12a ( Figure 3), and the specific purification method is as follows: The pMBP-LbCas12a (addgene#: 113431) expression plasmid was transformed into E. coli BL21(DE3) competent cells. The initial culture (5 mL) was grown overnight in rich medium and used to inoculate 1 L of TB medium, which was grown at 37 °C and 200 rpm until the OD600 reached 0.5 - 0.6. Subsequently, protein expression was induced with 500 μM IPTG at 18 °C for 16 hours. The cells were harvested after centrifugation at 5200 g for 15 minutes at 4 °C and stored at -80 °C for further purification. The cell pellet was thawed on ice and resuspended in lysis buffer (20 mM Tris-HCl, 500 mM NaCl, pH 7.9, 1 mM DTT, 0.5 mM PMSF, and 1 mg / mL lysozyme). After sonication and centrifugation, the clear supernatant was filtered through a 0.22 μm pore size filter and purified using Ni-NTA resin. The eluted fraction was incubated with TEV protease overnight at 4 °C to cleave the MBP tag. The cleavage mixture was dialyzed and further purified using Ni-NTA resin again to remove the His-tagged proteins. The flow-through was collected, concentrated, and buffer-exchanged into storage buffer, followed by concentration determination. The protein was then aliquoted, quickly frozen in liquid nitrogen, and transferred to an -80 °C freezer for long-term storage.

[0088] It maintained satisfactory trans-cleavage activity when forming a ribonucleoprotein (RNP) complex with the model ssDNA target (miR21) and its corresponding crRNA (the sequences are shown in Table 1).

[0089] Activated Cas12a effectively released invertase from the magnetic beads, which was evidenced by the disappearance of the green staining on the bead surface ( Figure 2 lower part of D) and the enrichment of green fluorescence in the supernatant ( Figure 2 E). Further verification and optimization included the reaction time in tubes 1 and 2, and the concentration of sucrose in tube 2 ( Figure 4 ). To further evaluate the feasibility of nucleic acid detection using the integrated CRISPR-POCT detection composition (Cas12a), the present invention observed different PGM readings ([[]] Figure 2 F) generated by 0, 10, and 50,000 pM ssDNA targets in solution. The 50 nM target resulted in an "HI" reading beyond the reporting range (0.6 - 33.3 mmol / L), while the 10 pM target produced a reading of 2.9 mmol / L, which was significantly higher than the blank.

[0090] The present invention uses the detection of HPV to prove the comprehensive evaluation effect of the CRISPR-POCT detection method described in the present invention in laboratory synthetic models and actual clinical cervical cell samples, thereby proving that the CRISPR-POCT detection method described in the present invention can be used as a general nucleic acid target biosensing platform.

[0091] Example 1 Construction of Invertase-Labeled Solid-Phase Reporter (ILR)

[0092] T30 ssDNA and U30 ssRNA were modified with DBCO TEG at the 5'-end (for binding to azide-modified invertase) and biotin at the 3'-end (for attachment to streptavidin-coated beads), and were synthesized by Tsingke Biotech. 5'-DBCO TEG-U30-biotin-3' RNA or 5'-DBCO TEG-T30-biotin-3' DNA was obtained.

[0093] 12 mg of invertase (Sigma-Aldrich Cat.No.I4504) was dissolved in 2 mL of 0.1 M NaHCO3 to obtain a 100 μM invertase solution. Next, approximately 100-fold molar excess of azide-PEG4-NHS ester (Aladdin Cat.No.A305020) linker was added to the solution and reacted at room temperature for 2 hours to react with lysine residues on the surface of invertase. Then, the excess linker was removed by a Sephadex desalting gravity column (Sangon, Cat.No.C500090). Subsequently, the azide-modified invertase was concentrated by a 30 kD centrifugal filter (centrifuged at 7,000 rcf for 5 minutes).

[0094] The azide-modified invertase was functionalized with 5'-DBCO TEG-U30-biotin-3' RNA or 5'-DBCO TEG-T30-biotin-3' DNA oligonucleotides. For this purpose, 200 μL of 10 μM azide-modified invertase and 2 equivalents of RNA or DNA were shaken in a nuclease-free solution for 15 hours at room temperature. The invertase-RNA or invertase-DNA conjugate was washed twice (centrifuged at 4,000 rcf for 5 minutes) and then concentrated by a 30 kD centrifugal filter (centrifuged at 14,000 rcf for 5 minutes). To perform fluorescence characterization of the ILR reporter, a small amount of invertase-RNA and invertase-DNA conjugates were washed twice with 20 mM sodium phosphate, 150 mM NaCl, pH 7.2, crosslinked with fluorescein-maleimide, then cysteine quenched, and finally concentrated.

[0095] The microbeads are surface - modified with invertase - RNA or invertase - DNA conjugates. First, 20 μL of streptavidin - coated microbeads (5 μm, BEAVER Biomed, Cat.No.22306) are added to 500 μL of nuclease - free PBS solution containing 0.1% Tween 20. Then, 1 μL of 20 μM invertase - RNA - biotin or invertase - DNA - biotin is added, and gently rotated for 30 minutes. To separate the unreacted invertase - RNA - biotin or invertase - DNA - biotin, the solution is centrifuged at 20,000 rcf for 1 minute. The microbeads are then washed six times with 1X PBS containing 0.1% Tween 20 and centrifuged at 20,000 rcf for 1 minute to precipitate them at the bottom of the tube. Finally, the ILR reporter is resuspended in 10 μL of nuclease - free PBS solution containing 0.1% Tween 20.

[0096] The above method yields microbeads with a surface - modified solid - phase reporter (ILR) labeled with invertase, and the ILR is invertase - RNA - biotin or invertase - DNA - biotin.

[0097] Example 2 verifies the invertase - labeled solid - phase reporter (ILR)

[0098] The specific method for verifying the invertase - labeled solid - phase reporter (ILR) mainly includes several stages: the reaction of the CRISPR - POCT detection composition (including the CRISPR reaction in tube 1 and the invertase reaction in tube 2) and the PGM readout ( Figure 1 ). The detection of the miR21 target is used as an example below.

[0099] S1. Reaction of the CRISPR - POCT detection composition

[0100] The CRISPR reaction in tube 1: The Cas12a - assisted reaction is carried out on a 384 - well plate. The reaction system includes 50 nM crRNA (see the sequence in Table 1), 60 nM LbCas12a, 2.5 μL of ILR, and 2 μL of miR21 ssDNA targets at different concentrations (0, 10 pM, 50 nM). The above reaction is carried out in a reaction buffer (40 mM Tris - HCl, 5 mM MgCl2, 100 mM KCl, 1 mM DTT, 5% glycerol, pH 7.5), and the total volume is 10 μL.

[0101] Table 1 miR21 ssDNA target and its corresponding crRNA sequence

[0102] Name Sequence miR21 crRNA UAAUUUCUACUAAGUGUAGAUucaacaucagucugauaagcua(Cas12a) miR21target TAGCTTATCAGACTGATGTTGA(DNA,Cas12a) T12ssDNA reporter FAM-TTTTTTTTTTTT-BHQ1

[0103] The reaction was carried out in a PCR tube using a BIO-RAD PCR instrument at 37 °C for 30 minutes. Then the reaction tube was placed on a magnetic rack on ice for 1 minute to precipitate the beads of the invertase-labeled solid-phase reporter (ILR) to the bottom of the tube, obtaining the reaction solution of Tube 1.

[0104] Invertase reaction in Tube 2: 5 μL of the supernatant reaction solution obtained from the reaction in Tube 1 was added to Tube 2 containing 5 μL of sucrose solution (0.3 M, pH 5.0, acetate buffer), and then placed in a BIO-RAD PCR instrument for another 20-minute reaction at 37 °C to obtain the reaction solution of Tube 2.

[0105] S3, PGM reading

[0106] 2 μL of the reaction solution of Tube 2 was used for glucose measurement with a Roche Accu-Chek PGM (using a PGM test strip), and the result was read out.

[0107] Among the numerous PGM devices tested in the market, only the Roche Accu-Chek Active is compatible with the glucose detection in the supernatant of Tube 2 described in the present invention. Therefore, this device was used throughout the detection work.

[0108] The design and verification results of the CRISPR-POCT detection composition for DNA detection are as Figure 2 shown, where (A) Schematic diagram of the construction and detection procedure of the ILR reporter; (B) Primary amine (4EQV) located on the surface of invertase; (C) UV-Vis absorption spectrum to reveal the composition of the invertase-ssDNA conjugate; (D) Confocal fluorescence microscopy study to confirm target-dependent invertase release, scale bar: 50 μm. (E) Fluorescence in the supernatant; (F) Glucose conversion catalyzed by the released invertase detected by PGM; The synthetic ssDNA target (miR21) was used for stimulation in D-F.

[0109] In the present invention, the signal transmission from CRISPR-Cas activation to PGM reading is achieved through an enzyme-labeled magnetic bead reporter, which consists of a short single-stranded DNA (composed of 30 thymines) oligonucleotide and a series of chemical couplings ( Figure 2 ). After activation, Cas12a trans-cleaves the single-stranded DNA (ssDNA) linker in the reporter, resulting in the release of invertase from the solid phase of Tube 1. The free invertase then converts sucrose to glucose in the second tube, and subsequent quantification is conveniently carried out by PGM. The present invention hypothesizes that the additional signal amplification provided by invertase can compensate for the relatively high detection limit (LOD) of commercial PGM, enabling the sensitivity of this POCT system to reach a level comparable to that of traditional fluorescence instruments.

[0110] Therefore, the ILR described in the present invention can realize the POCT of the detection method based on the CRISPR-Cas system. Compared with the traditional laboratory real-time quantitative PCR detection method, the CRISPR-POCT detection method realized based on the ILR described in the present invention has the characteristics of being portable and cost-effective. Compared with other detection methods based on the CRISPR-Cas system, it can achieve POCT (see Figure 15 for parallel comparison), and compared with other crispr-POCT methods (see Figure 14 for parallel comparison), the detection limit of this invention is lower and the lowest detection limit per reaction can reach 7 positive Hpv18 cells.

[0111] According to Figure 2 it is known that sucrase has multiple surface-exposed primary amines (about 20), making it very suitable for chemical coupling ( Figure 2 B). Although all these primary amines are saturatedly linked by NHS-PEG4-N3 linkers, the ratio of DNA to sucrase remains at a low level of 1.7:1 ( Figure 2 C) to avoid the adverse effects caused by excessive DNA per enzyme, otherwise more Cas12 cleavage would be required to release the enzyme, resulting in a decrease in enzyme release efficiency. The ILR shows the red autofluorescence of its Fe3O4 core under a confocal fluorescence microscope, surrounded by green sucrase staining ([[]] Figure 2 upper part of D), confirming the successful binding of the ILR reporter.

[0112] Stability test of ILR during long-term storage: The ILR reporter thawed after long-term storage at 4 °C or -30 °C was directly stimulated with 0 ( Figure 5 A) or 10 ( Figure 5 B) pM ssDNA target, and the detection of the CRISPR-POCT detection composition was carried out. The test results are as Figure 5 shown. According to Figure 5 it is known that the ILR produced according to the method of the present invention can be stored at -30 °C for more than 9 weeks without obvious integrity and functional decline.

[0113] Example 3 Detection sensitivity test of the CRISPR-POCT detection method of the present invention

[0114] In order to compare and evaluate the detection limit (LOD) of the CRISPR-POCT detection method provided by the present invention, a typical Cas12a / fluorometer trans-cleavage activity detection experiment was carried out. The specific method is as follows:

[0115] A typical Cas12a / fluorometer trans-cleavage activity detection experiment was carried out using a Biotek Synergy Neo2 fluorescence reader on a 384-well plate. The reaction system of the typical Cas12a / fluorometer trans-cleavage activity detection experiment included 50 nM crRNA (sequences shown in Table 1), 60 nM LbCas12a, 500 nM T12 fluorescent reporter, and 2 μL of ssDNA targets at different concentrations (such as Figure 6 ). In the Cas12a enzyme reaction buffer (40 mM Tris-HCl, 5 mM MgCl2, 100 mM KCl, 1 mM DTT, 5% glycerol, pH 7.5), the total volume was 10 μL. All components were mixed on ice and transferred to a plate reader preheated to 37 °C for time-course fluorescence measurement. Specifically, an excitation wavelength of 485 nm and an emission wavelength of 520 nm were used to detect FAM fluorescence.

[0116] The test results of the detection sensitivity of the CRISPR-POCT detection composition of the present invention are as shown in Figure 6 . Figure 6 . (A) A typical Cas12a trans-cleavage activity detection experiment. (B) LOD determination showed that the experimental detection limit was 5 pM. (C) PGM readout of serial dilutions of DNA targets by the CRISPR-POCT detection composition (Cas12a) obtained a comparable detection limit (LOD).

[0117] Using the FAM-T12-BHQ reporter and a BioTek Synergy Neo2 fluorometer capable of time recording ( Figure 6 A). The relative fluorescence signal I / I0 was analyzed at 60 minutes, showing that the experimental detection limit was 5 pM for the ssDNA target ( Figure 6 B). On the other hand, the Cas12a-ILR / PGM POCT system was able to distinguish targets as low as 5 pM in a similar serial dilution ( Figure 6 C). These results indicate that the integrated and convenient PGM device can provide satisfactory sensitivity when using invertase signal amplification. It is worth noting that the Accu-Chek instrument and other commercial glucometers can only achieve a sensitivity of mmol / L. Therefore, several orders of magnitude improvement in LOD can be achieved through a customized glucometer module.

[0118] The test proved that the detection sensitivity of the Cas12a-ILR / PGM POCT system was comparable to the fluorescence-based detection method in the laboratory. The CRISPR-POCT detection composition provided for CRISPR-POCT detection of the present invention provided a sensitivity comparable to that of a laboratory fluorometer.

[0119] Example 4 Detection Sensitivity Test

[0120] The CRISPR-POCT detection method based on the CRISPR-POCT detection composition (Cas13a) is the same as that in Example 2, except that the Cas12a enzyme is replaced with the Cas13a enzyme. The beads with surface-modified invertase-labeled solid-phase reporter (ILR) are used in the method, and ILR is invertase-RNA-biotin. The Cas13a enzyme used is LbuCas13a, which is purified by the inventor's laboratory. The purification method is as follows:

[0121] The expression plasmid of LbuCas13a (addgene#115267) was transformed into E. coli BL21(DE3) competent cells. The initial culture (5 mL) was grown overnight in rich medium and used to inoculate 1 L of TB medium, and grown at 37 °C and 200 rpm until the OD600 reached 0.5 - 0.6. Subsequently, protein expression was induced with 500 μM IPTG at 18 °C for 16 hours. The cells were harvested after centrifugation at 5200 g for 15 minutes at 4 °C and stored at -80 °C for further purification.

[0122] The cell pellet was thawed on ice and resuspended in lysis buffer (20 mM Tris-HCl, 500 mM NaCl, pH 7.9, 1 mM DTT, 0.5 mM PMSF, and 1 mg / mL lysozyme). After sonication and centrifugation, the clear supernatant was filtered through a 0.22 μm pore size filter and purified using Ni-NTA resin. The effluent was collected, concentrated, and buffer-exchanged into storage buffer, followed by concentration determination. The protein was then aliquoted, quickly frozen in liquid nitrogen, and transferred to an -80 °C refrigerator for long-term storage.

[0123] The prepared CRISPR-POCT detection composition (Cas13a) was used for the CRISPR-POCT detection described in the present invention. The specific method was the same as that in Example 2. At the same time, the CRISPR-POCT detection composition (Cas13a) was also compared with the traditional fluorescence-based detection method for the CRISPR-POCT detection described in the present invention. The latter method is as follows:

[0124] The Cas13a-assisted reaction was carried out on a 384-well plate, and the results of the 384-well plate were read using a Biotek Synergy Neo2 fluorescence reader. The reaction system (10 μL) contained 25 nM crRNA, 15 nM Cas13a or its variant, 125 nM U5 reporter, and 50 nM miR21 RNA, and was carried out in a Cas13a enzyme reaction buffer (40 mM Tris-HCl, 9 mM MgCl2, 1 mM DTT, 5 U RNase inhibitor, pH 7.5) (the sequences of crRNA, miR21 RNA, and U5 reporter are shown in Table 2). After all components were mixed on ice, they were transferred to a preheated plate reader at 37 °C for time-course or endpoint fluorescence measurement. Specifically, an excitation wavelength of 485 nm and an emission wavelength of 520 nm were used to measure FAM fluorescence.

[0125] The sensitivity results are shown in Figure 7 , (A) Target-dependent release of invertase was confirmed by confocal fluorescence microscopy. The scale bar represents 25 μm. (B) A typical Cas13a trans-cleavage activity detection experiment recorded by a BioTek Synergy Neo2 fluorometer. (C) LOD determination showed that the experimental detection limit was 5 pM. (D) Serial dilution PGM readout of the RNA target by the CRISPR-POCT detection composition (Cas13a) obtained a better LOD of 2.5 pM. First, the ssRNA (U30) linker was effectively cleaved after Cas13a activation ( Figure 7 A). Second, the detection sensitivity of the CRISPR-POCT detection composition (Cas13a) (LOD = 2.5 pM) was better than its laboratory fluorescence-based detection method (LOD = 5 pM) ( Figure 7 B-D). The CRISPR-POCT detection composition (Cas13a) provided satisfactory sensitivity in RNA detection.

[0126] Table 2 miR21 target and its corresponding crRNA sequence

[0127]

[0128] Example 5 Ring-mediated isothermal amplification reaction (LAMP) primers targeting HPV18 and genomic selection with target specificity and low self-amplification

[0129] Cervical cancer, characterized by persistent high-risk HPV infection, is the fourth most common cancer in women, causing approximately 350,000 deaths annually. Current cervical cancer screening methods mainly rely on DNA testing, which has been proven to significantly reduce the incidence of cervical cancer and the economic burden on major economies. The CRISPR-POCT detection composition (Cas12a) has been used to develop a novel HPV point-of-care (POC) test that can be directly delivered to end-users.

[0130] For low-abundance HPV18 in cervical swab samples, direct nucleic acid detection in cell lysates has proven impractical due to a very low signal / noise ratio (data not shown). Therefore, loop-mediated isothermal amplification (LAMP) was introduced for target amplification. Many reported primers have been observed to have non-specific target and primer-initiated self-amplification, seriously affecting the reliability of LAMP-assisted biosensing.

[0131] In this example, a screening of HPV18 LAMP primer sets with low self-amplification was carried out. Using the NEB LAMP primer tool, one previously reported and six LAMP primer sets were designed, with the HPV18 E6, E7, and E1 genes as templates, synthesized by Sangon Biotech (see the sequences in Table 3). These six primer sets were used to individually amplify the HPV18 target gene sequence. The results are shown in Figure 8 , where (A) Real-time fluorescence measurements of LAMP amplification reactions carried out individually with various primer sets. (B) Agarose gel image of the LAMP amplification reaction products in A. (C) Positions of the P123L1 primer and the corresponding Cas12a crRNA on the HPV18 genome. (D) Agarose gel image of the products of LAMP reactions using various primer sets and the HPV18 E6E7E1 gene template. (E) Detection method based on the CRISPR-POCT detection composition (Cas12a) responding to the LAMP products in D.

[0132] Table 3 Isothermal amplification LAMP primer sequences for HPV18

[0133]

[0134]

[0135] Among the numerous LAMP primer sets reported in previous studies (see the sequences in Table 3), only one primer set, P123L1, exhibited negligible self-amplification ( Figure 8 A and B). This primer set targets the boundary between the E7 and E1 genes ( Figure 8 C), and produces distinct amplification products after amplification mediated by the template (HPV18 E6E7E1 plasmid) ( Figure 8 D). The other 3 primer setsFigure 8 Relatively low self-amplification levels were exhibited in B, showing that the self-amplification was similar to the amplification pattern in the presence of a template. Further detection of these significantly amplified products using a CRISPR-POCT detection composition (Cas12a) showed that only the LAMP products mediated by primer P123L1 produced a significant PGM response ( Figure 8 E), so this primer was used for subsequent experiments.

[0136] Therefore, when the gene sequence to be detected is HPV18, LAMP amplification is performed using the primer P123L1 composition shown in SEQ ID NO: 1 to SEQ ID NO: 5.

[0137] A similar screening procedure was used to determine the optimal LAMP primer sets for HPV16 and HPV52 amplification (sequences shown in Table 4). When the gene sequences to be detected are HPV16 and HPV52, the LAMP amplification primer sequences used correspond to the HPV16_LAMP and HPV52_LAMP compositions in Table 4, respectively.

[0138] Table 4 Isothermal amplification LAMP primer sequences for HPV16 and HPV52

[0139]

[0140] Example 6. CRISPR-POCT detection method

[0141] A CRISPR-POCT detection method, the steps of which are in sequence: sample lysis, loop-mediated isothermal amplification (LAMP), reaction based on a CRISPR-POCT detection composition (Cas12a) (including a CRISPR reaction and a sucrase reaction in sequence), and PGM readout ( Figure 1 ).

[0142] S1. Sample preparation and lysis:

[0143] Synthetic gene sequence preparation: The E6, E7, and E1 (partial) gene sequences of HPV18, HPV16, and HPV52 were synthesized by Sangon Biotech and cloned into the pCDNA3.1(-) plasmid between the EcoRI and NotI sites to form the pCDNA3.1-HPVE6E7E1 plasmid.

[0144] Preparation of laboratory-cultured cells: HeLa, HEK-293, and MIA PaCa-2 cells were provided by Procell Life Science and Technology and cultured in DMEM supplemented with 10% FBS and 1% penicillin-streptomycin mixture in a Thermo Forma incubator with 5% CO2.

[0145] Sample lysis: For laboratory-cultured cells, 100,000 cells were prepared and reacted with lysis buffer at room temperature (Vazyme Biotech, P073) for 5 minutes to obtain a sample lysate with a final volume of 30 μL. The obtained samples could maintain good nucleic acid integrity in a -20°C refrigerator for one month.

[0146] S2, Pre-amplification: The P123L1 composition in Example 5 was used and loop-mediated isothermal amplification (LAMP) method was used for target nucleic acid amplification.

[0147] The reaction mixture included 1 μL of Bst II polymerase (Vazyme Biotech, P702), 6 mM MgSO4, 1.4 mM of each dNTP, 1.6 μM of each FIP / BIP primer, 0.2 μM of each F3 / B3 primer, 0.8 μM of LF / LB primer, 1X LAMP fluorescent dye (Vazyme Biotech, RP001), 1X isothermal amplification buffer, and 2 μL of DNA template (plasmid or cell lysate) in a total volume of 15 μL (made up with water, the same below). The reaction was carried out at 60°C for 1 hour in a Biorad real-time thermal cycler.

[0148] A 1-hour LAMP reaction time was used in the present invention because it was sufficient to complete all amplifications, whether specific targets or non-specific targets. In fact, a 40-minute reaction time could be used to improve efficiency because it was sufficient for specific target amplification.

[0149] S3, Reaction based on CRISPR-POCT detection composition (Cas12a): It included the reaction in Tube 1 and the reaction in Tube 2. The reaction in Tube 1 was a Cas12a-assisted reaction, and the reaction in Tube 2 was a sucrase reaction. The specific steps were as follows:

[0150] Reaction of Tube 1: The Cas12a-assisted reaction was carried out in a 384-well plate. The reaction system included 50 nM crRNA (sequence shown in Table 5), 60 nM LbCas12a, 2.5 μL ILR, and 2 μL of the amplification product in S2. The above reaction was carried out in a reaction buffer (40 mM Tris-HCl, 5 mM MgCl2, 100 mM KCl, 1 mM DTT, 5% glycerol, pH 7.5), and the total volume was 10 μL.

[0151] Table 5 crRNA sequences corresponding to HPV18 targets and E6, E7, and E1 sequences

[0152]

[0153] The reaction was carried out in a PCR tube at 37 °C for 30 minutes using a BIO-RAD PCR instrument. Then the reaction tube was placed on a magnetic stand on ice for 1 minute to precipitate the beads of the invertase-labeled solid-phase reporter (ILR) to the bottom of the tube, and the supernatant was the reaction solution of Tube 1.

[0154] Reaction of Tube 2: 5 μL of the reaction solution of Tube 1 was added to Tube 2 containing 5 μL of sucrose solution (0.3 M, pH 5.0, acetate buffer), and then placed in a BIO-RAD PCR instrument for another 20 minutes of reaction at 37 °C to obtain the reaction solution of Tube 2.

[0155] S4, PGM reading

[0156] 2 μL of the reaction solution of Tube 2 was taken for Roche Accu-Chek PGM glucose measurement (using a PGM test strip), and the result was read out.

[0157] The pCDNA3.1 plasmid carrying the HPV18 E6, E7, and E1 gene insertions was used to test the performance of the CRISPR-POCT detection composition (Cas12a) in a homogeneous solution.

[0158] The above method was used to detect HPV18 in solution and cell environment samples respectively. The solution environment sample was sourced from the pCDNA3.1 plasmid carrying the HPV18 E6, E7, and E1 gene insertions synthesized in the laboratory; the cell samples were sourced from HeLa, HEK-293, and MIA PaCa-2 cells cultured in the laboratory.

[0159] 1. The detection results of HPV18 DNA in the solution environment sample (for the synthesized plasmid) are shown in Figure 9, where (A) shows the agarose gel image of the LAMP reaction products of the plasmid template. (B) Readout of the subsequent CRISPR-POCT detection assay (Cas12a) for the LAMP products in (A). (C) Specificity assessment of the CRISPR-POCT detection assay using 10,000 copies of the HPV plasmid. (D and E) Show the agarose gel and real-time fluorescence images of the LAMP reaction of cell lysates of cell mixtures containing different numbers of HeLa cells. The markers to the left of the dotted line are enhanced for clear visualization. (F) Readout of the subsequent CRISPR-POCT detection assay (Cas12a) for the LAMP products in (D) and (E).

[0160] Real-time fluorescence of the LAMP reaction using pCDNA3.1 (A) and pCDNA-E6E7E1 (B) plasmid templates is shown in Figure 10 .

[0161] The individual LAMP reaction showed HPV18 gene-dependent amplification, although non-specific amplification also occurred in the high-concentration control plasmid ( Figure 9 A and Figure 10 A, B). Subsequent detection by the CRISPR-POCT detection assay (Cas12a) was able to distinguish 100 copies of the target plasmid from the blank solution with statistical significance while avoiding non-specific amplification products ( Figure 9 B). Next, the full procedure of the CRISPR-POCT detection assay was evaluated for specificity. Among the empty vector and three HPV types, the system gave a strict response only to 10,000 copies of the HPV18 plasmid, indicating satisfactory specificity in solution ( Figure 9 C).

[0162] 2. Detection of cell samples by the CRISPR-POCT detection assay is shown in Figure 11 , where (A and D) show the agarose gel images of the LAMP reaction products of HEK-293, HeLa, and MIA PaCa-2 cell lysates. (B and E) Real-time fluorescence measurements of the LAMP reaction. (C and F) Are the subsequent detection readouts based on the CRISPR-POCT detection assay (Cas12a) for the LAMP products in (A - B) and (D - E) respectively; HeLa cells were detected as positive by the CRISPR-POCT detection assay.

[0163] Consistent with the known HPV infection status of the laboratory-cultured cell lines, the immortalized cervical epithelial cell line HeLa could be detected as positive by the CRISPR-POCT detection assay (Cas12a), while MIA PaCa-2 or HEK-293 cells could not ( Figure 11(A-F). A series of HeLa cells mixed with the HPV-negative cell line HEK-293 were used to evaluate the detection limit of the system. The LAMP reaction using the P123L1 primer set produced distinct amplification products in cell samples containing ≥7 HeLa cells ( Figure 9 D and E). Although the LAMP amplification curves showed considerable variability within the group, which is a recognized reproducibility issue of this technique, LAMP was indeed sufficient to achieve effective amplification within a certain time point. Subsequently, the detection method based on the CRISPR-POCT detection composition (Cas12a) successfully distinguished the mixture containing 7 HeLa cells from the mixture without HeLa cells ( Figure 9 F). Notably, this procedure was inert to non-specific amplification products in the mixture without HeLa cells, highlighting the significant advantage of this system in minimizing false positives.

[0164] In addition, when compared with the previously reported HPV detection method combining pre-amplification and Cas12a trans-cleavage, the present invention reproduced the RPA-Cas12a / fluorometer method (DETECTR) using the best primers targeting the same HPV18 locus ( Figure 12 A). Figure 12 is the detection of the HPV18 gene in cultured cell samples based on RPA-Cas12a / fluorometer. (A) Different primer sets were tested to optimize the RPA amplification of the HPV18 gene. (B) The appearance of FAM fluorescence was monitored in real time during the RPA-Cas12a / fluorometer detection (DETECTR).

[0165] The results of the present invention show that the CRISPR-POCT detection method described in the present invention has higher sensitivity and can detect 7 HeLa cells, while the DETECTR method can only detect 70 cells ( Figure 12 B).

[0166] Example 7. Detection of HPV18 in clinical samples using the method of the present invention

[0167] Detecting HPV in clinical samples using the CRISPR-POCT detection method described in the present invention can improve the detection coverage rate and frequency. The specific method refers to Example 6. Among them, the clinical samples were collected by cell brushes stored in the Department of Laboratory Medicine, the First Affiliated Hospital of Zhejiang University School of Medicine.

[0168] Detecting HPV18 in clinical cervical brush samples using the CRISPR-POCT detection composition of the present invention. The results are as Figure 13As shown, where (A) is a schematic diagram of comparative evaluation. (B) Heat map view of the detection values of qPCR and CRISPR-POCT detection methods (i.e., LAMP-Cas12a-ILR / PGM in the figure). Samples are vertically sorted by their qPCR Cq values. (C) Comparison of PGM readings between the qPCR negative group and the positive group. The mean and standard deviation are represented by solid lines. The mean of the qPCR negative group plus 4 standard deviations is adopted as the threshold for detection by the CRISPR-POCT detection method. (D) Correlation between qPCR and PGM readings in the qPCR positive group. (E) Table showing the consistency between HPV18 qPCR and CRISPR-POCT detection in clinical samples. (F) Heat map view of the specific HPV18 detection results of the CRISPR-POCT detection method for HPV18, HPV16, and HPV52 positive samples.

[0169] When combined with a self-sampling swab and a lysis buffer specifically designed for nucleic acid extraction at ambient temperature, the implementation potential of this system in home self-testing is significant. To evaluate the feasibility of this system in cervical cell specimens, 182 cervical cell brush samples with known HPV results were collected from institutional hospitals and analyzed in parallel using real-time PCR and the CRISPR-POCT detection method ( Figure 13 A). The real-time PCR results were generally consistent with the HPV18 detection results of this method, and the Cq values of all positive samples (n = 24) were below 30. The readings of positive cases by the CRISPR-POCT detection method were significantly higher than those of negative cases ( Figure 13 B and C). In addition, the Cq values and PGM readings within the positive group were closely related to each other ( Figure 13 D), indicating that the CRISPR-POCT detection composition shows a dose-dependent response in cervical samples. The mean of the negative group plus 4 standard deviations was adopted as the threshold for detection by the CRISPR-POCT detection method. Among the 24 positive samples, 23 were correctly identified as positive, and all 158 negative samples were correctly detected as negative, with a detection sensitivity of 95.8% and a specificity of 100% ( Figure 13 C and E). In addition, this system was able to better distinguish HPV18 from other HPV strains in the detection of single HPV18, HPV16, or HPV52 positive samples ( Figure 13 F).

[0170] Example 8. Detection of HPV16 and HPV52 in clinical samples using the CRISPR-POCT detection method of the present invention

[0171] Next, the present invention sought to evaluate the potential of the system in detecting other HPV strains. Through a screening procedure similar to that of HPV18, effective LAMP primers (sequences shown in Table 3) and crRNAs (sequences shown in Table 6) targeting the E6, E7, and E1 genes of HPV16 and HPV52 were identified and incorporated into the CRISPR-POCT detection method of the present invention to detect HPV16 and HPV52. The specific method is referred to Example 6. Among them, the clinical samples were collected by cell brushes in cryopreservation provided by the Clinical Laboratory of the First Affiliated Hospital of Zhejiang University School of Medicine.

[0172] Among 88 cell brush samples with a determined HPV profile, an increase in the PGM test strip readings of the CRISPR-POCT detection method was observed in all HPV16-positive samples (n = 14), and the difference in PGM readings between the positive and negative groups was statistically significant. A strong correlation was observed between the qPCR Cq value and the PGM reading in the positive group. The potential of the system in HPV16 diagnosis is obvious. When applying a threshold similar to the mean plus 4 standard deviations, both the detection sensitivity and specificity reached 100%. More importantly, when the LAMP primers and crRNAs were replaced with the primer set targeting HPV52 (Table 6), comparable detection performance to HPV52 could also be achieved. In addition, the cross-species specificity of the CRISPR-POCT detection composition (Cas12a) targeting HPV16 and HPV52 was well retained. These data emphasize the flexibility of the CRISPR-POCT detection composition (Cas12a) as a fixed detection platform capable of detecting a wide range of targets.

[0173] Table 6 HPV16, HPV52 targets and their corresponding crRNA sequences

[0174] Name Sequence HPV16 crRNA UAAUUUCUACUAAGUGUAGAUtacgcacaaccgaagcgtag(Cas12a) HPV52crRNA UAAUUUCUACUAAGUGUAGAUagguugcagaucuaauauau(Cas12a)

[0175] In summary, the present invention has developed a super-efficient nucleic acid detection platform coordinated by a solid-phase enzyme reporter molecule (ILR), which combines the superior nucleic acid detection capabilities of Cas12a or Cas13a and the efficient signal conversion of sucrase to glucose abundance. The complete detection process is simple to operate, including two tube reactions and one PGM reading. Therefore, the PGM is so far the most user-friendly medical device for the general population, even in resource-poor areas.

[0176] The limit of detection (LOD) of the CRISPR-POCT detection method of the present invention is comparable to that evaluated by the CRISPR-Cas detection method based on high-end laboratory fluorometers. The CRISPR-POCT detection composition operates at ambient temperature without the need for complex equipment or professional personnel, making it an affordable POCT or home detection.

[0177] The feasibility of the system for nucleic acid target detection in biological samples was demonstrated by the detection of HPV18, HPV16, and HPV52 in cultured HPV-positive cell samples and clinical cervical cell specimens. Compared with previous efforts combining CRISPR-Cas with PGM (see Figure 14 ) and the development of HPV-targeted detection (see Figure 15 for surveys and listings), the CRISPR-POCT detection composition of the present invention represents multifaceted progress in terms of target diversity, limit of detection (LOD), POCT compatibility, biological sample volume, and cross-species specificity. When using cultured cells as a model of real-world samples, the CRISPR-POCT detection composition (Cas12a) was able to detect approximately 7 HPV18-positive cells in a mixed cell sample. More importantly, the CRISPR-POCT detection composition (Cas12a) performed well in detecting the HPV18, HPV16, and HPV52 genes in clinical patient cervical cell samples, with sensitivities of 95.8% (n = 182), 100% (n = 88), and 100% (n = 88), respectively. At the same time, the method exhibited significant cross-species specificity.

Claims

1. A solid phase reporter labeled with sucrase, characterized in that The solid phase reporter was prepared by the following method: S1, T30 ssDNA or U30 ssRNA was modified with DBCO TEG at the 5' end and biotin at the 3' end to obtain 5'-DBCO TEG-U30-biotin-3' RNA or 5'-DBCO TEG-T30-biotin-3' DNA; S2, azide group-modified sucrase was covalently bound to 5'-DBCO TEG-U30-biotin-3' RNA or 5'-DBCO TEG-T30-biotin-3' DNA oligonucleotide; S3, modifying the sucrase-RNA or sucrase-DNA conjugate of S2 on the surface of microbeads to obtain a sucrase-labeled solid phase reporter (ILR).

2. The solid phase reporter labeled with sucrase according to claim 1, characterized in that The solid phase reporter was prepared by the following method: S1, T30 ssDNA, or U30 ssRNA was modified with DBCO TEG at the 5′ end and biotin at the 3′ end; S2, azide group-modified sucrase was covalently bound to 5'-DBCO TEG-U30-biotin-3' RNA or 5'-DBCO TEG-T30-biotin-3' DNA oligonucleotide; The azido group-modified sucrase and the RNA or DNA obtained from S1 are shaken in a nuclease-free solution to react at room temperature to obtain a sucrase-RNA or sucrase-DNA conjugate, which is then washed and concentrated by centrifugation; S3, Modify the sucrase-RNA or sucrase-DNA conjugate of S2 on the microbead surface: Add the beads to a nuclease-free PBS solution containing Tween 20; The microbeads are magnetic microbeads coated with streptavidin; Sucrase-RNA-biotin or sucrase-DNA-biotin was added and centrifuged after the reaction to separate unreacted materials; The obtained microbeads were washed thoroughly with a PBS solution containing Tween 20 and centrifuged to precipitate; the ILR reporter was resuspended in a nuclease-free PBS solution containing Tween 20 and stored.

3. The solid phase reporter labeled with sucrase according to claim 1, characterized in that: Preparation of the azide-modified sucrase in S2: The sucrase is reacted with an excess of azidated PEG4-NHS ester linker at room temperature to react with lysine residues on the surface of the sucrase, and then the excess linker is removed by a Sephadex desalting gravity column and concentrated to obtain the azide-modified sucrase.

4. A CRISPR-POCT detection composition, characterized in that include: The sucrase-labeled solid phase reporter and CRISPR reaction system of claim 1, wherein the CRISPR reaction system comprises: a Cas enzyme and crRNA; the crRNA is designed according to the specific sequence gene information of the target to be detected and matches the sequence fragment to be detected.

5. The CRISPR-POCT detection composition according to claim 4, characterized in that: When the Cas enzyme is Cas12a, the solid phase reporter labeled with sucrase is a sucrase-DNA conjugate; when the Cas enzyme is Cas13a, the solid phase reporter labeled with sucrase is a sucrase-RNA conjugate.

6. A CRISPR-POCT detection method, characterized in that The method is: The method uses loop-mediated isothermal amplification (LAMP) combined with a two-step reaction and a personal glucose meter (PGM) to read the results. The two-step reaction includes a reaction in tube 1 and a reaction in tube 2. The reaction of tube 1 is carried out by reacting the amplified product with the CRISPR-POCT detection composition of claim 4 to obtain a reaction solution of tube 1; The reaction in tube 2 is carried out by reacting the reaction solution in tube 1 with the sucrose solution in tube 2 to obtain the reaction solution in tube 2; Take a sample of the reaction solution in tube 2 and test the glucose using a personal glucose meter (PGM) and read the result.

7. The CRISPR-POCT detection method according to claim 6, characterized in that The CRISPR-POCT detection method includes the following steps: S1, sample lysis to obtain lysis solution; S2, loop-mediated isothermal amplification (LAMP): design a specific primer pair for the gene sequence to be tested, amplify the gene sequence to be tested in the above lysate, and obtain an amplification product; S3, CRISPR reaction: adding the above amplified product to tube 1 for CRISPR reaction, the T30 ssDNA or U30 ssRNA in the solid phase reporter labeled with the sucrase according to claim 1 is cut, so that the azido group-modified sucrase is disconnected from the stationary phase, and the stationary phase is separated to obtain the reaction solution in tube 1; S4, sucrase reaction: add the reaction solution in tube 1 to tube 2, so that the reaction solution in tube 1 reacts with the sucrose solution in tube 2 to obtain the reaction solution in tube 2; S5. Reading the results of the personal glucose meter (PGM): Sampling the reaction solution in tube 2 is used to detect glucose through a personal glucose meter (PGM) and the results are read.

8. The CRISPR-POCT detection method according to claim 6, characterized in that: When the gene sequence to be detected is HPV18, the LAMP amplification primer sequence used includes the following primer P123L1 composition: P123L1_F3,CGAACCACAACGTCACAC,SEQ ID NO:1, P123L1_B3, CCTTCTGGATCAGCCATTG, SEQ ID NO: 2, P123L1_FIP,TCGTCTGCTGAGCTTTCTACTACGTTGTGTATGTGTTGTAAGTGTG, SEQ ID NO: 3, P123L1_BIP, CTTCGAGCATTCCAGCAGCTTTGCTTACTGCTGGGATG, SEQ ID NO: 4, P123L1_LB,GTTTCTGAACACCCTGTCCTTTGT, SEQ ID NO: 5, The crRNA sequence corresponding to the HPV18 target is P123L1 crRNA, UAAUUUCUAAGUGUAGAUuacuacuagcucaauucuggc, SEQ ID NO: 6; When the gene sequence to be detected is HPV16, the LAMP amplification primer sequence used includes the following primer HPV16_LAMP composition: HPV16_LAMP_F3, AGCCCATTACAATATTGTAACC, SEQ ID NO: 7, HPV16_LAMP_B3, CATCCCGTACCCTTCTCC, SEQ ID NO: 8, HPV16_LAMP_FIP,CGAATGTCTACGTGTGTGCTTTTTTTGTTGCAAGTGTGACT, SEQ ID NO: 9, HPV16_LAMP_BIP, TGGGCACACTAGGAATTGTGTTTGGTACCTGCAGGATCA, SEQ ID NO: 10, HPV16_LAMP_LB, CCCCATCTGTTCTCAGAAACCATAA, SEQ ID NO: 11, the crRNA sequence corresponding to the hpv16 target is HPV16 crRNA, UAAUUUCUAAGUGUAGAUtacgcacaaccgaagcgtag, SEQ ID NO: 12; When the gene sequence to be detected is HPV52, the LAMP amplification primer sequence used includes the following primer HPV52_LAMP composition: HPV52_LAMP_F3,GTTCAGAGTGTTGGAGACC, SEQ ID NO: 13, HPV52_LAMP_B3,ACAATGTAGTAATTGCTTGTGG, SEQ ID NO: 14, HPV52_LAMP_FIP, GTCAGTTGTTTCAGGTTGCAGATCCTGTGACCCAAGTGTAACG, SEQ ID NO: 15, HPV52_LAMP_BIP, TATGAGCAATTAGGTGACAGCTCACTTGTTCTGCTTGTCCATC, SEQ ID NO: 16, HPV52_LAMP_LF, TGCTTGTCTCCACGCATGA, SEQ ID NO: 17, the crRNA sequence corresponding to the hpv52 target is; HPV52 crRNA, UAAUUUCUAAGUGUAGAUagguugcagaucuaauauau, SEQ ID NO:

18.

9. The CRISPR-POCT detection method according to claim 6, characterized in that: The sucrose solution is a 0.3 M sucrose solution (acetate buffer) with a pH of 5.0; the personal blood glucose meter (PGM) is a Roche Accu-Chek PGM.

10. Use of the sucrase-labeled solid phase reporter according to claim 1, the CRISPR-POCT detection composition according to claim 4, or the CRISPR-POCT detection method according to claim 6 in the detection of nucleic acid and non-nucleic acid targets.

Images