RPA-CRISPR / Cas12a-based staphylococcus aureus or drug-resistant gene detection composition thereof, kit, detection method and application of RPA-CRISPR / Cas12a-based staphylococcus aureus or drug-resistant gene detection composition

Abstract

The invention provides a composition, a kit and a detection method for detecting staphylococcus aureus or a drug-resistant gene thereof based on RPA-CRISPR / Cas12a and application of the composition, the kit and the detection method, and belongs to the technical field of gene detection. A CRISPR / Cas12a system is combined with recombinase polymerase amplification (RPA), an RPA-CRISPR / Cas12a detection method for rapidly detecting the staphylococcus aureus in the wastewater and the drug-resistant gene of the staphylococcus aureus is established, a specific primer and crRNA are designed, the high-specificity nucleic acid cutting capability of a gene editing enzyme CRISPR / CAS system and the isothermal rapid amplification advantage of a nucleic acid isothermal amplification technology are fully fused, and the detection method has the advantages of high specificity, high specificity, high specificity, high specificity, high specificity, high specificity, high specificity, high specificity, high specificity, high specificity, high specificity, high specificity, high specificity, high specificity, high specificity, high specificity, high specificity, high specificity, high specificity, high specificity, high specificity, high specificity, high specificity, high specificity The fluorescent probe has high-specificity sequence recognition capability, realizes efficient detection of target nucleic acid, is strong in detection specificity, high in sensitivity and simple and convenient to operate, does not need complex equipment and professionals, and is suitable for rapid detection in an on-site environment with limited resources.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and particularly relates to a composition, kit, detection method and application for detecting Staphylococcus aureus or its drug-resistant genes based on RPA-CRISPR / Cas12a. Background Art

[0002] Bacterial antimicrobial resistance has been listed by the World Health Organization as one of the top ten global public health threats in the 21st century. Due to the overuse or abuse of antibiotics in medicine, veterinary, agriculture and poultry industries, the generation of drug resistance has been accelerated, and sewage systems such as hospitals and municipal wastewater are important environmental vectors for the spread of drug-resistant bacteria and ARGs. Monitoring them is crucial for controlling the spread of drug resistance. Currently, traditional microbial diagnostic methods include heterotrophic plate count (HPC) based on morphological or biological characteristics, enzyme-linked immunosorbent assay (ELISA), and quantitative polymerase chain reaction (qPCR). As the oldest bacterial detection method, the HPC technology takes up to 24 - 48 hours, is cumbersome to operate, and is only applicable to the quantitative analysis of culturable microorganisms, unable to detect non-culturable microorganisms. Due to the cross-specificity of antigen-antibody reactions and complex matrix interference, the ELISA method shows insufficient sensitivity in antibiotic resistance monitoring and is not suitable for AMR monitoring. Although PCR technology and next-generation sequencing (NGS) can meet the current pathogen and AMR monitoring needs, however, the dependence of PCR technology on precision instruments such as thermal cyclers and the skill requirements of professional operators limit its application in resource-limited scenarios. At the same time, although next-generation sequencing (NGS) can achieve metagenomic analysis of microbial communities, its high equipment cost and data analysis complexity still constitute the main obstacles to clinical application.

[0003] With the trend of microbial diagnosis shifting from the laboratory to on-site detection, alternative nucleic acid detection tools have been developed. The CRISPR-Cas system, due to its programmable sequence recognition ability and signal amplification characteristics, shows significant advantages when combined with nucleic acid isothermal amplification technologies (such as RPA, LAMP). By combining the advantages of isothermal amplification and the CRISPR / Cas system, molecular targets can be enriched isothermally, and then Cas effector proteins (such as Cas12, Cas13) can be used as highly specific sequence recognition elements. However, there is currently no reported method for AMR monitoring in wastewater environments based on CRISPR / Cas12a. Therefore, it is crucial to establish a method for rapidly detecting pathogenic bacteria and their drug-resistant genes in wastewater. Summary of the Invention

[0004] The object of the present invention is to provide a detection composition, kit, detection method and application for Staphylococcus aureus or its drug-resistant genes based on RPA-CRISPR / Cas12a, which can achieve rapid, highly sensitive and highly specific on-site detection of Staphylococcus aureus and its drug-resistant genes in environmental water bodies.

[0005] In order to achieve the above object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a detection composition for Staphylococcus aureus or its drug-resistant genes based on RPA-CRISPR / Cas12a, and the detection composition for Staphylococcus aureus or its drug-resistant genes includes detection primers and crRNA for detecting one or more genes among the nuc gene, blaZ gene, mecA gene, ermA gene, ermC gene, msrA gene, vanA gene, and vanB gene of Staphylococcus aureus.

[0007] The present invention also provides an application of the detection composition for Staphylococcus aureus or its drug-resistant genes based on RPA-CRISPR / Cas12a in the detection of wastewater antibiotic resistance.

[0008] The present invention also provides a detection kit for Staphylococcus aureus or its drug-resistant genes based on RPA-CRISPR / Cas12a, and the kit includes the detection composition for Staphylococcus aureus or its drug-resistant genes based on RPA-CRISPR / Cas12a.

[0009] The present invention also provides an application of the detection kit for Staphylococcus aureus or its drug-resistant genes based on RPA-CRISPR / Cas12a in the detection of wastewater antibiotic resistance.

[0010] The present invention also provides an RPA-CRISPR / Cas12a detection method for Staphylococcus aureus or its drug-resistant genes, which includes the following steps:

[0011] (1) RPA reaction: Prepare an RPA reaction system and incubate the reaction system at 37-48 °C.

[0012] (2) CRISPR / Cas12a cleavage reaction: Take the product after incubation in step (1), mix it with a premixed solution and incubate, and take the product for detection after the incubation ends.

[0013] Preferably, in step (1), the RPA reaction system comprises the following components: 29.5-30 μL buffer, 2-2.5 μL magnesium acetate, 2 μL forward primer, 2 μL reverse primer, 14 μL double distilled water, 2 μL genomic DNA; the incubation time is 15-20 min. Preferably, in step (2), the time of mixing and incubating with the premix is ​​25-35 min. Preferably, in step (2), the detection is fluorescence detection or lateral flow chromatography test strip detection.

[0014] The present invention also provides an application of an RPA-CRISPR / Cas12a detection method for Staphylococcus aureus or its drug-resistant gene in monitoring antibiotic resistance in wastewater.

[0015] The beneficial effects of the present invention compared with the prior art are:

[0016] (1) The present invention combines the CRISPR / Cas12a system with recombinase polymerase amplification (RPA) to establish an RPA-CRISPR / Cas12a detection method for rapid detection of Staphylococcus aureus and its drug-resistant genes in wastewater, and designs specific primers and crRNA, which fully integrates the high-specific nucleic acid cleavage ability of the gene editing enzyme CRISPER / CAS system and the isothermal rapid amplification advantages of nucleic acid isothermal amplification technology, has high-specific sequence recognition ability, realizes efficient detection of target nucleic acids, expands the application scope of the gene editing enzyme CRISPER / CAS system in the construction of biosensor platforms, has strong detection specificity and high sensitivity, reaching the level of 1-10 copies / μL, and can detect extremely low concentrations of target nucleic acids. Moreover, the detection method takes a short time and can accurately detect Staphylococcus aureus and its drug-resistant genes (ARGs) within 30 minutes. It is not only suitable for on-site environmental monitoring with limited resources, but also can quickly evaluate the effect of hospital sewage treatment, ensure that sewage is discharged in compliance with standards, reduce pollution to the environment, protect biodiversity, provide society with cleaner and safer environmental resources, enhance public health security capabilities, effectively prevent infectious disease outbreaks, reduce social panic and economic losses, ensure the operation of hospital sewage treatment facilities, and prevent pathogens and drug-resistant genes from causing secondary pollution to the environment. At the same time, this study demonstrates the great potential of the CRISPR / Cas12a system in the field of environmental monitoring, provides an important technical tool for the global drug resistance monitoring network, and helps curb the development of antimicrobial resistance and protect human health.

[0017] (2) The present invention is a single-tube reaction system, which is easy to operate, does not require complex equipment and professional personnel, is suitable for rapid detection in on-site environments with limited resources, can meet the needs of different scenarios, and the results can be interpreted by a variety of visualization methods, including fluorescence-based detection (FBD) and lateral flow dipstick assay (LFDA), making the detection results intuitive and easy to read, lowering the detection threshold, conforming to the development trend of rapid and on-site detection, developing a detection system suitable for resource-limited environments, and promoting the innovation and development of nucleic acid detection technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0019] Figure 1 It is the operation flow chart of the RPA-CRISPR / Cas12a detection system in Example 1 of the present invention;

[0020] Figure 2 It is the screening result diagram of primers and crRNA in Example 2 of the present invention. Among them, A to H are the screening results of pairwise combinations of 3 upstream primers and 3 downstream primers designed for Staphylococcus aureus genes. Among them, A to H are nuc, blaZ, mecA, ermA, ermC, msrA, vanA, vanB respectively; I to P are the experimental results of combining the 3 pairs of primers screened from Staphylococcus aureus genes with 2 crRNAs. Among them, I to P are nuc, blaZ, mecA, ermA, ermC, msrA, vanA, vanB respectively;

[0021] Figure 3 It is the experimental result of optimizing the reaction conditions and reaction system of the Staphylococcus aureus RPA-CRISPR / Cas12a detection method for the housekeeping gene nuc in Test Example 1 of the present invention; A to C are the optimization results of MgAc, and A to C are 2.0 μL, 2.5 μL, and 3.0 μL respectively; D to F are the optimization results of the RPA reaction time, and D to F are 15 min, 20 min, and 25 min respectively; G to I are the optimization results of the LbCas12a reaction temperature, and G to I are 37 °C, 42 °C, and 48 °C respectively;

[0022] Figure 4This is the experimental result of optimizing the reaction conditions and reaction system of the RPA-CRISPR / Cas12a detection method for Staphylococcus aureus against the drug-resistant gene blaZ in Test Example 1 of the present invention; A-C are the optimization results of MgAc, and A-C are 2.0 μL, 2.5 μL, and 3.0 μL respectively; D-F are the optimization results of the RPA reaction time, and D-F are 15 min, 20 min, and 25 min respectively; G-I are the optimization results of the LbCas12a reaction temperature, and G-I are 37 °C, 42 °C, and 48 °C respectively;

[0023] Figure 5 This is the experimental result of optimizing the reaction conditions and reaction system of the RPA-CRISPR / Cas12a detection method for Staphylococcus aureus against the drug-resistant gene mecA in Test Example 1 of the present invention; A-C are the optimization results of MgAc, and A-C are 2.0 μL, 2.5 μL, and 3.0 μL respectively; D-F are the optimization results of the RPA reaction time, and D-F are 15 min, 20 min, and 25 min respectively; G-I are the optimization results of the LbCas12a reaction temperature, and G-I are 37 °C, 42 °C, and 48 °C respectively;

[0024] Figure 6 This is the experimental result of optimizing the reaction conditions and reaction system of the RPA-CRISPR / Cas12a detection method for Staphylococcus aureus against the drug-resistant gene ermA in Test Example 1 of the present invention; A-C are the optimization results of MgAc, and A-C are 2.0 μL, 2.5 μL, and 3.0 μL respectively; D-F are the optimization results of the RPA reaction time, and D-F are 15 min, 20 min, and 25 min respectively; G-I are the optimization results of the LbCas12a reaction temperature, and G-I are 37 °C, 42 °C, and 48 °C respectively;

[0025] Figure 7 This is the experimental result of optimizing the reaction conditions and reaction system of the RPA-CRISPR / Cas12a detection method for Staphylococcus aureus against the drug-resistant gene ermC in Test Example 1 of the present invention; A-C are the optimization results of MgAc, and A-C are 2.0 μL, 2.5 μL, and 3.0 μL respectively; D-F are the optimization results of the RPA reaction time, and D-F are 15 min, 20 min, and 25 min respectively; G-I are the optimization results of the LbCas12a reaction temperature, and G-I are 37 °C, 42 °C, and 48 °C respectively;

[0026] Figure 8Experimental results of optimizing the reaction conditions and reaction system of the RPA-CRISPR / Cas12a detection method for the drug-resistant gene msrA in Staphylococcus aureus in Test Example 1 of the present invention; A-C are the optimization results of MgAc, and A-C are 2.0 μL, 2.5 μL, and 3.0 μL respectively; D-F are the optimization results of the RPA reaction time, and D-F are 15 min, 20 min, and 25 min respectively; G-I are the optimization results of the LbCas12a reaction temperature, and G-I are 37 °C, 42 °C, and 48 °C respectively;

[0027] Figure 9 Experimental results of optimizing the reaction conditions and reaction system of the RPA-CRISPR / Cas12a detection method for the drug-resistant gene vanA in Staphylococcus aureus in Test Example 1 of the present invention; A-C are the optimization results of MgAc, and A-C are 2.0 μL, 2.5 μL, and 3.0 μL respectively; D-F are the optimization results of the RPA reaction time, and D-F are 15 min, 20 min, and 25 min respectively; G-I are the optimization results of the LbCas12a reaction temperature, and G-I are 37 °C, 42 °C, and 48 °C respectively;

[0028] Figure 10 Experimental results of optimizing the reaction conditions and reaction system of the RPA-CRISPR / Cas12a detection method for the drug-resistant gene vanB in Staphylococcus aureus in Test Example 1 of the present invention; A-C are the optimization results of MgAc, and A-C are 2.0 μL, 2.5 μL, and 3.0 μL respectively; D-F are the optimization results of the RPA reaction time, and D-F are 15 min, 20 min, and 25 min respectively; G-I are the optimization results of the LbCas12a reaction temperature, and G-I are 37 °C, 42 °C, and 48 °C respectively;

[0029] Figure 11 Specific experimental result diagram of Test Example 2 of the present invention, where A is the gel image of detecting the housekeeping gene nuc by the PA-CRISPR / Cas12a detection method for Staphylococcus aureus; B is the LFD visualization detection result of the housekeeping gene nuc; C is the visualization result of the housekeeping gene nuc under ultraviolet light; D is the fluorescence result of the housekeeping gene nuc; E is the gel image of detecting the drug-resistant gene; F is the LFD visualization detection result of detecting the drug-resistant gene; G is the visualization result of the drug-resistant gene under ultraviolet light; H is the fluorescence result of detecting the drug-resistant gene, where M: Marker; NEG: Negative;

[0030] Figure 12This is the experimental result of the sensitivity experiment of Staphylococcus aureus RPA-CRISPR / Cas12a in Test Example 3 of the present invention. A is the fluorescence detection result of the housekeeping gene nuc; B is the LFD result of the housekeeping gene nuc and its visualization result under ultraviolet light; C is the blaZ fluorescence result; D is the LFD result of blaZ and its result under ultraviolet light; E is the mecA fluorescence result; F is the LFD result of mecA and its result under ultraviolet light; G is the ermA fluorescence result; H is the LFD result of ermA and its result under ultraviolet light; I is the ermC fluorescence result; J is the LFD result of ermC and its result under ultraviolet light; K is the msrA fluorescence result; L is the LFD result of msrA and its result under ultraviolet light; M is the vanA fluorescence result; N is the LFD result of vanA and its result under ultraviolet light; O is the vanB fluorescence result; P is the result of vanB under LFD and ultraviolet light.

[0031] Figure 13 This is the sample detection result of Test Example 4 of the present invention, where "-" indicates a negative result, "+" indicates a positive result, and " / " indicates that the detection was not performed. Detailed implementation manners

[0032] The embodiments of the present invention are described in detail below. The embodiments are intended to explain the present invention and should not be construed as limiting the present invention. For those not specified in the embodiments regarding specific technologies or conditions, the technologies or conditions described in the literature in the relevant field or according to the product specifications are followed. For reagents or instruments without indicating the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0033] Example 1

[0034] Example 1 of the present invention provides an operation process of an RPA-CRISPR / Cas12a detection system ( Figure 1) The specific steps are as follows: (1) Sequence design: Obtain the sequences of the Staphylococcus aureus thermostable nuclease (nuc) gene (GenBank: BX571856.1) and seven ARGs (blaZ (AOR: 3004197), mecA (ARO: 3000617), ermA (ARO: 3000347), ermC (ARO: 3000250), msrA (ARO: 3000251), vanA (ARO: 3000010), and vanB (ARO: 3000013)) from the Antibiotic Resistance Genes Database (https: / / card.mcmaster.ca / ) and the National Center for Biotechnology Information (NCBI, https: / / www.ncbi.nlm.nih.gov). Design specific RPA primers and verify them through NCBI Prime-BLAST. The crRNA is designed through the CRISPR-DT online platform (http: / / bioinfolab.miamioh.edu / CRISPR-DT / ). All primers, crRNA, and ssDNA reporter molecules for fluorescence detection and lateral flow chromatography detection that have been designed and screened are synthesized by Genewiz Biotechnology Co., Ltd. (Suzhou, China). For detailed information, see the sequence list.

[0035] (2) Construction of the RPA reaction: Nucleic acid amplification is performed using a basic RPA kit (TwistDX, Cambridge, UK). The reaction system contains 29.5 - 30 μL of buffer, 2 - 2.5 μL of magnesium acetate (MgAc), 2 μL of forward primer (10 mM), 2 μL of reverse primer (10 mM), 14 μL of double-distilled water, and 2 μL of genomic DNA. All reaction solutions are thoroughly mixed, centrifuged, and then placed in a constant temperature device with an incubation temperature of 37 - 48 °C for 15 - 20 min. The obtained RPA products are purified using a Universal DNA Gel / PCR Purification Kit (Tiangen, Beijing, China) and electrophoresed in a 2% agarose gel (stained with GeneGreen, Tiangen). The specific reaction conditions for the RPA of nuc and the seven ARGs (blaZ, mecA, ermA, ermC, msrA, vanA, vanB) are as follows: nuc: 2.5 (μL of MgAc concentration), 20 (min of reaction time), 37 (°C of incubation temperature); blaZ: 2.5 μL, 20 min, 42 °C; mecA: 2.0 μL, 20 min, 37 °C; ermA: 2.5 μL, 20 min, 42 °C; ermC: 2.5 μL, 15 min, 42 °C; msrA: 2.0 μL, 15 min, 42 °C; vanA: 2.5 μL, 20 min, 48 °C; vanB: 2.5 μL, 20 min, 37 °C.

[0036] (3) Construction of CRISPR / Cas12a cleavage reaction: The combination of RPA and CRISPR / Cas12a is used for detection. The DNA fragment is pre-amplified by RPA, and the LbCas12a (cpf1) is used to trans-cleave the ssDNA reporter molecule. 5 μL of the RPA product in step (2) is taken and added to 15 μL of the premixed solution (Tolo Biotech, China, catalog number 32108, which contains 2 μL of 10× HOLMES buffer, 1 μM crRNA, 0.35 μM LbCas12a nuclease, 0.5 μM ssDNA fluorescent reporter molecule and 3 μL of sterile enzyme-free water). The 20 μL reaction solution (in an EP tube) is incubated in a fluorescence plate reader or a real-time polymerase chain reaction detection system (SLAN, China) for 30 minutes, and the fluorescence signal is collected every 15 seconds. (4) Visual detection of the CRISPR / Cas12a-assisted biosensing system:

[0037] Fluorescence detection (FBD): After the cleavage of the fluorescent reporter molecule is completed, the result is observed with the naked eye under blue light (λ = 480 nm). As Figure 1 shown, if the target pathogenic bacteria or ARGs exist, the reaction solution shows green fluorescence; if there is no target, it is colorless.

[0038] Lateral flow dipstick assay (LFDA): In LFDA, the fluorescent reporter molecule is replaced by the lateral flow dipstick reporter molecule (Table S1), and the rest of the operations are the same as those of FBD. That is, after the 30-minute incubation reaction is completed, 30 μL of water is added to make up 50 μL. After pipetting and mixing evenly, insert the Cas12 / 13 special nucleic acid test strip (Tiosbio, Beijing, China). Insert the binding pad end (arrow end) of the test strip into the Ep reaction tube, and the liquid level shall not exceed the uppermost end of the binding pad. Wait until the entire reading area is infiltrated (about 1 - 2 min. When the external environmental temperature is low, such as in winter, the water absorption speed will be reduced, and the infiltration time of the reading area will be extended). After the quality control line (C line) shows color, the test strip can be taken out. Observe the result within 10 minutes after the test line (T line) shows color. Read the result with the naked eye or a handheld colloidal gold reader Figure 1 ), and directly read the test result according to the color development of the test strip. The interpretation is invalid after 10 minutes.

[0039] Example 2

[0040] In Example 2 of the present invention, the method of Example 1 is adopted, and the primers shown in the sequence listing are used for the detection of drug-resistant Staphylococcus aureus. The results are as Figure 2 (The 3 pairs of primers for different genes are F1R 1, F2R 2, and F3R 3 in sequence) shown.

[0041] By Figure 2It is known that the detection primers and crRNAs for the nuc gene of Staphylococcus aureus are shown in SEQ ID NO.1, SEQ ID NO.4, and SEQ ID NO.8; the detection primers and crRNAs for the blaZ gene are shown in SEQ ID NO.10, SEQ ID NO.13, and SEQ ID NO.16; the detection primers and crRNAs for the mecA gene are shown in SEQ ID NO.18, SEQ ID NO.19, and SEQ ID NO.24; the detection primers and crRNAs for the ermA gene are shown in SEQ ID NO.25, SEQ ID NO.26, and SEQ ID NO.31; the detection primers and crRNAs for the ermC gene are shown in SEQ ID NO.36, SEQ ID NO.37, and SEQ ID NO.39; the detection primers and crRNAs for the msrA gene are shown in SEQ ID NO.43, SEQ ID NO.44, and SEQ ID NO.48; the detection primers and crRNAs for the vanA gene are shown in Q ID NO.51, SEQ ID NO.52, and SEQ ID NO.55; the detection primers and crRNAs for the vanB gene are shown in SEQ ID NO.61, SEQ ID NO.62, and SEQ ID NO.63.

[0042] Experimental Example 1

[0043] In Experimental Example 1 of the present invention, the method of Example 1 was adopted, and the conditions of the RPA-CRISPR / Cas12a detection system were optimized by controlling a single variable. The specific steps are as follows:

[0044] (1) Screen the optimal MgAc concentration in the RPA reaction. A total of 3 different MgAc addition amounts (2.0 μL, 2.5 μL, and 3.0 μL) were set for RPA amplification at 39°C, and the signal intensities detected by the CRISPR / Cas12a fluorescence method were compared. Figures 3 to 10 The results showed that in the nuc gene detection system, 2.5 μL was the optimal MgAc addition amount. The optimal MgAc addition amounts for the drug-resistant genes blaZ, mecA, ermA, ermC, msrA, vanA, and vanB gene detection systems were 2.5 μL, 2.0 μL, 2.5 μL, 2.5 μL, 2.0 μL, 2.5 μL, and 2.5 μL, respectively.

[0045] In order to screen the optimal RPA reaction time, 3 different reaction times (15 min, 20 min, and 25 min) were set for RPA amplification at 39°C, and the signal intensities detected by the CRISPR / Cas12a fluorescence method were compared. Figures 3 to 10The results showed that in the nuc gene detection system, 20 min was the optimal reaction time. The optimal reaction times for the drug-resistant gene detection systems of blaZ, mecA, ermA, ermC, msrA, vanA, and vanB genes were 20 min, 20 min, 20 min, 15 min, 15 min, 20 min, and 20 min, respectively.

[0046] To screen the optimal CRISPR / Cas12a reaction temperature, three different incubation temperatures (37 °C, 42 °C, and 48 °C) were set and their fluorescence signal intensities were compared. Figures 3 to 10 The results showed that in the nuc gene detection system, 37 °C was the optimal reaction temperature. The optimal reaction temperatures for the detection systems of blaZ, mecA, ermA, ermC, msrA, vanA, and vanB drug-resistant genes were 42 °C, 37 °C, 42 °C, 42 °C, 42 °C, 48 °C, and 37 °C, respectively.

[0047] Test Example 2

[0048] In Test Example 2 of the present invention, the specificity of the RPA-CRISPR / Cas12a detection system for the housekeeping gene nuc was detected. The specific steps were as follows: Using the genomic DNAs of Listeria monocytogenes (ATCC19115), Salmonella (ATCC14028), Pseudomonas aeruginosa (ATCC9027), Escherichia coli (ATCC8739), Proteus mirabilis (ATCC35659), Staphylococcus saprophyticus (ATCC43867), Staphylococcus hominis (ATCC35981), and Staphylococcus aureus (ATCC25923, ATCC29213, ATCC6538, ATCC43300, ATCC23235) as templates, the reaction system and method in Example 1 were adopted for detection, and the results were as Figure 11 shown. Figure 11 As shown in A, B, C, and D, the RPA-CRISPR / Cas12a detection system for Staphylococcus aureus had strong specificity for the housekeeping gene nuc and no detection signal for other strains. It could also be judged from Figure 11 E, F, G, and H that the RPA-CRISPR / Cas12a detection system for Staphylococcus aureus had strong specificity for drug-resistant gene detection and there was no cross-reaction among drug-resistant genes.

[0049] Test Example 3

[0050] In Test Example 3 of the present invention, the sensitivity of the RPA-CRISPR / Cas12a detection system was detected. The specific steps were as follows:

[0051] Construct plasmids containing the full gene sequences of drug-resistant genes for detecting the sensitivity of the RPA-CRISPR / Cas12a detection system. The drug-resistant gene sequences concerned in the present invention were synthesized by Shanghai Sangon Biotech Co., Ltd. and cloned into the pUC57 vector with a size of 2710 bp to generate recombinant plasmids, and then the synthesized genes were verified by Sanger sequencing.

[0052] All plasmids were serially diluted, and plasmids with 1, 1×10 1 , 1×10 2 and 1×10 3 copy / μL were used as templates for the sensitivity experiment, and the results are as Figure 12 shown. Figure 12 The results showed that the detection thresholds of the RPA-CRISPR / Cas12a detection system for Staphylococcus aureus for the housekeeping gene nuc and the drug-resistant genes blaZ, mecA, ermA, ermC, msrA, vanA, and vanB in the fluorescence detection system could all detect 1 copy / μL ( Figure 12 A, C, E, G, I, K, M, and O in Figure 12 ). The LFD detection thresholds of the RPA-CRISPR / Cas12a detection system for Staphylococcus aureus for the housekeeping gene nuc and the drug-resistant genes blaZ, mecA, ermA, ermC, msrA, vanA, and vanB were 10 copy / μL, 1 copy / μL, 1 copy / μL, 10 copy / μL, 10 copy / μL, 1 copy / μL, 10 copy / μL, and 10 copy / μL respectively ( Figure 12 B, D, F, H, J, L, N, and P in

[0053] Test Example 4

[0054] Test Example 4 of the present invention detected the detection effects of the RPA-CRISPR / Cas12a Staphylococcus aureus detection system on samples from hospital sewers, elevators, toilet faucets, and laboratory strains. The specific steps are as follows:

[0055] (1) Sample collection: Wastewater samples were collected from hospital sewers, elevators, laboratories, and toilet faucets. After the wastewater samples were filtered through a 0.22-μm polycarbonate filter membrane (Millipore, USA), the microorganisms on the membrane were collected, and the genomic DNA (gDNA) of the microorganisms was extracted using a water sample DNA purification kit (Omega Bio-tek, USA). The DNA concentration was quantified by Nanodrop 2000c (Thermo Fisher Scientific, USA) and stored at -20 °C.

[0056] (2) Real-time quantitative PCR analysis control: Staphylococcus aureus and seven ARGs (blaZ, mecA, ermA, ermC, msrA, vanA, vanB) were detected by real-time quantitative PCR (qPCR) as reported in the literature ((PMID: 3559734; PMID: 33836339)). The 25-μL reaction system contained 12.5 μL of 2×FastReal qPCR PreMix (Tiangen Biotech Co., Ltd., Beijing), 0.75 μL of forward primer (10 mM), 0.75 μL of reverse primer (10 mM), 2 μL of DNA template, and 9 μL of sterile and enzyme-free water. The amplification procedure was as follows: pre-denaturation at 95 °C for 2 minutes; 40 cycles of denaturation at 95 °C for 5 seconds and annealing at 60 °C for 15 seconds. The melting curve analysis was automatically generated by the system software. (3) RPA-CRISPR / Cas12a Staphylococcus aureus detection system: The RPA-CRISPR / Cas12a Staphylococcus aureus detection system of Examples 1 and 2 was used for detection, and the results were as Figure 13 shown. Figure 13 The results showed that the fluorescence-based detection assay (FBDA) and lateral flow test strip (LFTS) of the RPA-CRISPR / Cas12a Staphylococcus aureus detection system were consistent with the detection results of PCR, with a sensitivity and specificity of 100% and false positives and false negatives of 0.

[0057] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A composition for detecting Staphylococcus aureus or its drug-resistant gene based on RPA-CRISPR / Cas12a, characterized in that: The Staphylococcus aureus or drug-resistant gene detection composition comprises detection primers and crRNA for detecting one or more genes of Staphylococcus aureus nuc gene, blaZ gene, mecA gene, ermA gene, ermC gene, msrA gene, vanA gene, and vanB gene.

2. The composition for detecting Staphylococcus aureus or its drug-resistant gene based on RPA-CRISPR / Cas12a according to claim 1, characterized in that: The detection primers and crRNA of the nuc gene are as follows: SEQ ID NO.1-F1: TTGTAGCTTCAAGTCTAAGTAGCTCAGCAA; SEQ ID NO.4-R2: CCTTTTTTAGGATGCTTTGTTTCAGGTGTA; SEQ ID NO.8-crRNA2: AAUUUCUACUCUUGUAGAUACAGUAUCACCAUCAAUCG; The detection primers and crRNA of the blaZ gene are as follows: SEQ ID NO.10-R1: TACCGAAAGCAGCAGGTGTTGAAGTATCTT; SEQ ID NO.13-F3:GATGATATAGTTGCTTATTCTCCTAT; SEQ ID NO.16-crRNA2: UAAUUUCUACUAAGUGUAGAUUAAUUUUAUUGUUUGCUGUA; The detection primers and crRNA of the mecA gene are as follows: SEQ ID NO.18-R1: GGTTATGTTGGTCCCATTAACTCTGAAGAA; SEQ ID NO.19-F2: GGATAGCAGTACCTGAGCCATAATCATT; SEQ ID NO.24-crRNA2: AAUUUCUACUCUUGUAGAUGCAUCAAUAGUUAGUUGA; The detection primers and crRNA of the ermA gene are as follows: SEQ ID NO.25-F1: ATAACATCAGTACGGATATTGTCAAAAGAA; SEQ ID NO.26-R 1: AGAGTCTACACTTGGCTTAGGATGAAAATA; SEQ ID NO.31-crRNA1: UAAUUUCUACUAAGUGUAGAUGGUUUACUAUUAAUGGUGGA; The detection primers and crRNA of the ermC gene are as follows: SEQ ID NO.36-R2: TGCCAATGAGCGTTTTGTATTTAATAATCT; SEQ ID NO.37-F3:GCTCAGGAAAAGGGGATTTTACCCTTGAAT; SEQ ID NO.39-crRNA1: UAAUUUCUACUAAGUGUAGAUGUAACUGCCAUUGAAAUAGA; The detection primers and crRNA of the msrA gene are as follows: SEQ ID NO.43-F2: GGTGCAAATGGTGTAGGTAAGACAACTTTA; SEQ ID NO.44-R2: TAGCTCTACTGAATGATTCTGATGAATCCGT; SEQ ID NO.48-crRNA2: UAAUUUCUACUAAGUGUAGAUCUUGAAGCUAUUUACCACCA; The detection primers and crRNA of the vanA gene are as follows: SEQ ID NO.51-F2: GGAGCATGACGTATCGGTAAAATCTGCAATAGA; SEQ ID NO.52-R2:GCTGAGCTTTGAATATCGCAGCCTACAAAAGGG; SEQ ID NO.55-crRNA1: UAAUUUCUACUAAGUGUAGAUAGCUGUACUCUCGCCGGAUA; The detection primers and crRNA of the vanB gene are as follows: SEQ ID NO.61-F3: AGGCGAGGACGCTTACCTACCCTGTCTTTG; SEQ ID NO.62-R3: TACTGTGGCTCAACCGGATTGTTGTCCACTT; SEQ ID NO.63-crRNA1: AAUUUCUACUCUUGUAGAUGCGUAACCAAAGUAAACAGU.

3. An application of the RPA-CRISPR / Cas12a-based Staphylococcus aureus or its resistance gene detection composition as described in any one of claims 1 or 2 in the detection of antibiotic resistance in wastewater.

4. A kit for detecting Staphylococcus aureus or its drug-resistant gene based on RPA-CRISPR / Cas12a, characterized in that: The kit comprises the RPA-CRISPR / Cas12a-based Staphylococcus aureus or its drug resistance gene detection composition according to any one of claims 1 or 2.

5. An application of the RPA-CRISPR / Cas12a-based Staphylococcus aureus or its drug resistance gene detection kit as claimed in claim 4 in the detection of antibiotic resistance in wastewater.

6. A RPA-CRISPR / Cas12a detection method for Staphylococcus aureus or its drug resistance gene, characterized in that: The steps include: (1)RPA reaction: Prepare the RPA reaction system and incubate the reaction system at 37-48°C; (2) CRISPR / Cas12a cleavage reaction: The product after incubation in step (1) is mixed with the premixed solution and incubated. After the incubation is completed, the product is taken for detection.

7. The RPA-CRISPR / Cas12a detection method for Staphylococcus aureus or its drug resistance gene according to claim 6, characterized in that: In step (1), the RPA reaction system includes the following components: 29.5-30 μL buffer, 2-2.5 μL magnesium acetate, 2 μL forward primer, 2 μL reverse primer, 14 μL double distilled water, 2 μL genomic DNA; the incubation time is 15-20 min.

8. The RPA-CRISPR / Cas12a detection method for Staphylococcus aureus or its drug resistance gene according to claim 6, characterized in that: In step (2), the time for incubation with the premix is ​​25 to 35 minutes.

9. The RPA-CRISPR / Cas12a detection method for Staphylococcus aureus or its drug resistance gene according to claim 6, characterized in that: In step (2), the detection is fluorescence detection or lateral flow chromatography test strip detection.

10. Use of the RPA-CRISPR / Cas12a detection method for Staphylococcus aureus or its resistance gene according to any one of claims 6 to 9 in the detection of antibiotic resistance in wastewater.

Images