Reversion of neuronal cell injury by erianin and application of erianin in preparation of medicine for preventing and treating cerebral arterial thrombosis

Through the umlanin drug targeting GPX4 protein, it inhibits ferrous death, and solves the problem of neuronal cell damage after ischemic stroke, achieving effective treatment for ischemic stroke.

CN120284925APending Publication Date: 2025-07-11NANTONG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510542680.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-28
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

There is a lack of effective strategies for reversing and regulating cell ferrodemortem death in the prior art, resulting in limited treatment options for secondary nerve injury after ischemic stroke.

Method used

Uranin is used to target GPX4 protein, inhibit the ferrodynamic pathway, restore neuronal cell activity, and prepare drugs to prevent and treat ischemic stroke.

Benefits of technology

Malanin significantly reduces the pathological damage of ischemic stroke, inhibits ferrous death of neuronal cells, restores cell activity, and provides a more effective treatment plan for ischemic stroke.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120284925A_ABST
    Figure CN120284925A_ABST
Patent Text Reader

Abstract

The invention provides reversion of neuronal cell injury by erianin and application of erianin in preparation of drugs for preventing and treating cerebral arterial thrombosis, relates to the technical field of drug therapy, and is technically characterized by providing application of erianin in preparation of drugs for reversion of neuronal cell injury. Specific verification experiments prove that erianin can remarkably relieve pathological damage of cerebral arterial thrombosis and relieve symptoms of cerebral arterial thrombosis, and meanwhile erianin can effectively inhibit the ferroptosis level of neuronal cells in an in-vivo and in-vitro cerebral arterial thrombosis model and recover cell viability. Besides, erianin can target GPX4 protein, so that the ferroptosis level of cells is effectively regulated and controlled, and a theoretical basis is provided for preparing the medicine for treating cerebral arterial thrombosis by erianin.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of drug treatment, and particularly to the application of erianin in reversing neuronal cell damage and in the preparation of drugs for preventing and treating ischemic stroke. Background Art

[0002] Ischemic stroke is a serious neurological disease. By rapidly restoring cerebral blood and oxygen flow, it has a good protective effect on neurons, thereby achieving the purpose of disease treatment. Usually, cerebral ischemia-reperfusion is the main clinical treatment method for ischemic stroke. However, this restorative treatment has risks. It may cause mitochondrial damage, oxidative stress, and free radical damage due to the outflow of reactive oxygen species (ROS), as well as excitotoxicity caused by the excessive release of glutamate, thereby causing new damage. The treatment of ischemic stroke mainly includes ultra-early arterial thrombolysis using recombinant tissue-type plasminogen activator or urokinase within 6 hours, and mechanical thrombectomy. Although the prognosis has been significantly improved due to the drug and endovascular interventions for ischemic stroke, the treatment options for subsequent secondary nerve damage are still limited. Therefore, seeking more effective diagnostic and treatment methods for ischemic stroke remains an urgent clinical challenge.

[0003] The progression of ischemic stroke is the result of the complex interaction of multiple mechanisms. Neuronal death is the core pathological event, including immediate and delayed neuronal death, which usually occurs in the form of programmed cell death. Programmed neuronal cell death is considered to be the direct cause of the deterioration of ischemic stroke. Among them, ferroptosis is a recently discovered form of programmed cell death, which is characterized by iron-dependent lipid peroxidation of cell membranes, triggered by the dissipation of mitochondrial membrane potential. This process plays a key role in the pathogenesis and progression of ischemic stroke. Summary of the Invention

[0004] The purpose of the present invention is to solve the problem of the lack of strategies for reversing and regulating ferroptosis in cells in the prior art.

[0005] To achieve the above purpose, the present invention adopts the following technical solutions:

[0006] Application of erianin in the preparation of drugs for reversing neuronal cell damage.

[0007] Preferably, the erianin restores cell activity by inhibiting the ferroptosis pathway to increase the activity of neuronal cells.

[0008] Preferably, the erianin targets the GPX4 protein, thereby effectively regulating the level of ferroptosis in cells.

[0009] The present application also provides the application of erianin in the preparation of drugs for preventing and treating ischemic stroke.

[0010] The present application also provides a drug for preventing and treating ischemic stroke, and the drug contains erianin.

[0011] Preferably, the drug targets the GPX4 protein to promote the stability of the GPX4 protein, further inhibit the occurrence of ferroptosis, and restore the activity of neuronal cells, thereby achieving the purpose of preventing and treating ischemic stroke.

[0012] Compared with the prior art, the present application has the following beneficial effects:

[0013] (1) Erianin significantly reduces the pathological damage of ischemic stroke and alleviates the symptoms of ischemic stroke.

[0014] (2) Erianin effectively inhibits the ferroptosis level of neuronal cells in in vivo and in vitro ischemic stroke models and restores cell activity.

[0015] (3) Erianin can target the GPX4 protein, thereby effectively regulating the ferroptosis level of cells, providing a theoretical basis for the preparation of drugs for treating ischemic stroke with erianin. Description of the Drawings

[0016] Figure 1 Detection of the body weight of rats in the ischemic stroke model before and after treatment with erianin;

[0017] Figure 2 Detection of mNSS of rats in the ischemic stroke model before and after treatment with erianin;

[0018] Figure 3 Detection of the cerebral infarction volume of rats with ischemic stroke before and after treatment with erianin;

[0019] Figure 4 HE staining of brain tissue of rats with ischemic stroke before and after treatment with erianin;

[0020] Figure 5 Statistical analysis of immune cell infiltration in brain tissue of rats with ischemic stroke before and after treatment with erianin;

[0021] Figure 6 Nissl staining of brain tissue of rats with ischemic stroke before and after treatment with erianin;

[0022] Figure 7 Statistical analysis of Nissl staining of brain tissue of rats with ischemic stroke before and after treatment with erianin

[0023] Figure 8 Detection of the level of ferroptosis markers in brain tissue of rats with ischemic stroke before and after treatment with erianin;

[0024] Figure 9Detection of Prussian blue in the brain tissue of rats with ischemic stroke before and after treatment with eupomatenoid

[0025] Figure 10 Statistical analysis of Prussian blue detection in the brain tissue of rats with ischemic stroke before and after treatment with eupomatenoid

[0026] Figure 11 Detection of mRNA level of GPX4 in the brain tissue of rats with ischemic stroke before and after treatment with eupomatenoid

[0027] Figure 12 Detection of protein level of GPX4 in the brain tissue of rats with ischemic stroke before and after treatment with eupomatenoid

[0028] Figure 13 Detection of the change of cell viability over time in neurons P12 and their OGD / R cell models treated with eupomatenoid

[0029] Figure 14 CCK8 detection in neuron OGD / R cell models treated with eupomatenoid or other death inhibitors

[0030] Figure 15 Detection of mRNA level of genes related to death modes in neuron OGD / R models treated with eupomatenoid

[0031] Figure 16 Detection of the level of ferroptosis markers in neuron OGD / R models treated with eupomatenoid

[0032] Figure 17 Detection of ROS level in neuron OGD / R models treated with eupomatenoid

[0033] Figure 18 Statistical analysis of ROS level in neuron OGD / R models treated with eupomatenoid

[0034] Figure 19 Detection of lipid peroxidation level in neuron OGD / R models treated with eupomatenoid

[0035] Figure 20 Statistical analysis of lipid peroxidation level in neuron OGD / R models treated with eupomatenoid

[0036] Figure 21 Detection of mRNA of GPX4 gene in neuron OGD / R models before and after treatment with eupomatenoid

[0037] Figure 22 Detection of protein level of GPX4 in neuron OGD / R models before and after treatment with eupomatenoid

[0038] Figure 23 Molecular docking analysis between eupomatenoid and GPX4 protein Detailed implementation manners

[0039] The following further describes the present invention in detail with reference to specific embodiments.

[0040] Application of erianin in preparing a drug for reversing neuronal cell injury

[0041] The erianin is a phytoestrogen, and the erianin improves the activity of neuronal cells by inhibiting the ferroptosis pathway, thereby restoring cell activity. Specifically, in one embodiment, the erianin targets the GPX4 protein, thereby effectively regulating the ferroptosis level of cells.

[0042] The present application also provides an application of erianin in preparing a drug for preventing and treating ischemic stroke.

[0043] In addition, the present application also provides a drug for preventing and treating ischemic stroke, the drug includes erianin, and the drug promotes the stability of the GPX4 protein by targeting the GPX4 protein, further inhibits the occurrence of ferroptosis, restores the activity of neuronal cells, thereby achieving the purpose of preventing and treating ischemic stroke.

[0044] In one embodiment, the drug further includes other pharmaceutically acceptable excipients or reagents.

[0045] The following elaborates on the above content in combination with specific verification tests:

[0046] Experimental materials and sources in the present application:

[0047]

[0048]

[0049]

[0050] Example 1: Construction of an animal model of ischemic stroke (MCAO / R) and drug treatment

[0051] Establishment of the rat MCAO / R model: SPF-grade Sprague Dawley rats weighing 300±10 g were selected and adaptively fed for 1 week in an environment with a temperature of 25±1°C, a relative humidity of 50%±10%, and a 12-h light / dark cycle, with free access to food and water. After the adaptive feeding, the rats were randomly grouped. For the rats to undergo MCAO / R injury, they were anesthetized by intraperitoneal injection of 1% sodium pentobarbital (50 mg / kg), and a heating pad was used to maintain the rectal temperature at 37°C. The hair on the neck was shaved off, and an incision was made along the midline of the neck to expose the common carotid artery, internal carotid artery, and external carotid artery. The distal end of the external carotid artery was ligated, and the distal end of the internal carotid artery was clamped. A suture was inserted through the internal carotid artery into the middle cerebral artery to a depth of 18 - 20 mm, causing 2 h of cerebral ischemia. Then, the suture was withdrawn, the proximal end of the internal carotid artery was ligated, and blood flow was restored to achieve reperfusion. The control group rats only underwent vascular dissection without inserting a suture.

[0052] In the successfully constructed MCAO / R animal model, the rats were randomly divided into 2 groups. One group was injected with erianin (at a dose of 20 mg / kg) intraperitoneally every day, and the untreated group and the model control group were given the same volume of normal saline for 2 consecutive weeks. After the last administration, the mice were euthanized, and blood and brain tissues were collected for subsequent detection of relevant indicators.

[0053] Example 2: Detection of rat body weight

[0054] The rats were placed in a clean, dry, and temperature-appropriate breeding environment with free access to food and water. Before the experiment, the initial body weight of each rat was measured and recorded using an electronic scale. Thereafter, the body weight of the rats was measured at a fixed time every day. During the measurement, the rats were gently placed on the electronic scale, and the body weight value was read and recorded after they became quiet. The changes in body weight over time were observed and recorded, and the trends of body weight changes in rats in different treatment groups were analyzed.

[0055] In this example, the changes in body weight of rats in the normal group, MCAO / R model group, and erianin treatment group were detected at different times (0, 1, 2, 4, 6, 8 days). The results are as Figure 1 shown. The body weight of the rats in the normal group gradually increased over time, from the original 300 g to approximately 375 g; the body weight of the rats in the MCAO / R model group showed a downward trend, from the original 300 g to approximately 220 g; while the body weight of the erianin treatment group had a certain upward trend, but the amplitude was smaller than that of the normal group, indicating that erianin has a certain therapeutic effect and can improve the condition of weight loss, but has not restored the body weight to the normal group level.

[0056] Example 3: Detection of relevant markers in rat brain tissue

[0057] Detection of the modified neurological severity score (mNSS): It was carried out within 24 hours after the end of the last administration. The neurological deficit scores of the rats were evaluated according to the mNSS scoring criteria. The specific operations included observing the motor ability of the rats (such as limb symmetry, spontaneous activity, forelimb extension, etc.), sensory function (such as responses to touch, pain, proprioception), balance ability (such as walking performance on the balance beam), and reflex ability (such as corneal reflex, righting reflex, etc.). A comprehensive score was made based on various performances. The full score was usually 18 points, and the higher the score, the more severe the neurological deficit.

[0058] Please participate Figure 2 , the mNSS scores of the normal group were relatively low and stable, and the score on the 8th day was approximately 6; the scores of the MCAO / R model group were relatively high, decreased over time but still remained at a relatively high level, and the score on the 8th day was approximately 12; the mNSS scores of the eupramulin treatment group were significantly lower than those of the MCAO / R model group, and the decline was greater, indicating that eupramulin was helpful in improving the neurological deficit status of rats in the ischemic stroke model.

[0059] HE staining: Rat brain tissues were taken and quickly fixed in 4% paraformaldehyde solution for 24 hours. The fixed brain tissues were subjected to conventional dehydration treatment, successively soaked in ethanol solutions with different concentration gradients (such as 70%, 80%, 90%, 95%, 100%) for 1 hour each, then made transparent with xylene 3 times, 15 minutes each time, and then embedded in paraffin. The embedded brain tissues were cut into sections with a thickness of 4 μm, deparaffinized to water, stained with hematoxylin for 5 minutes, washed, and then stained with eosin for 5 minutes. Finally, they were dehydrated, made transparent, and sealed. The morphological changes of brain tissue cells, structures, and inflammatory cell infiltration were observed under an optical microscope and photographed, and at the same time, statistical analysis of immune infiltration was carried out.

[0060] Please refer to Figure 4 , the morphological changes of brain tissues of rats in the normal group, MCAO / R model group, and eupramulin treatment group were presented through HE staining. The results showed that the brain tissue cells in the normal group were arranged neatly; the brain tissue cell structure in the MCAO / R model group was disordered, showing signs of damage; the degree of brain tissue damage in the eupramulin treatment group was relatively reduced compared with the MCAO / R model group, and the cell structure was relatively improved.

[0061] At the same time, statistical analysis was carried out based on the infiltration of immune cells, and the results were as Figure 5 shown. The immune infiltration score of the normal group was low, approximately 0.3%; the score of the MCAO / R model group increased significantly, approximately 4.7%; the score of the eupramulin treatment group was lower than that of the MCAO / R model group, approximately 2.5%, indicating that eupramulin could regulate the infiltration of immune cells in the brain tissues of rats with ischemic stroke, thereby reducing the inflammatory response.

[0062] Cerebral infarction volume: It was detected by TTC staining method. Fresh brain tissues were taken and cut into coronal sections with a thickness of about 2 mm, and immediately placed into 2% TTC solution and incubated at 37 °C for 30 minutes. Normal brain tissues were stained red, while infarcted brain tissues were white. The stained sections were photographed, and the infarct area was calculated using ImageJ image analysis software. The percentage of cerebral infarction volume was calculated according to the formula (percentage of cerebral infarction volume = total infarct area sum / total normal brain tissue area sum × 100%).

[0063] As Figure 3 shown, the cerebral infarction volume of the normal group was about 3%; the proportion of cerebral infarction volume in the MCAO / R model group was relatively large, about 55%; the percentage of cerebral infarction volume in the eupalinolide treatment group was significantly lower than that in the MCAO / R model group, about 28%, indicating that eupalinolide can effectively reduce the cerebral infarction volume of rats with ischemic stroke.

[0064] Nissl staining: Fresh brain tissues were taken and quickly fixed in 10% neutral formalin solution for 24 hours. The fixed brain tissues were subjected to routine dehydration treatment and then paraffin-embedded. The embedded brain tissues were cut into sections with a thickness of 6 μm, dewaxed to water, cut into coronal sections with a thickness of about 2 mm, and immediately stained with Toluidine Blue at a constant temperature of 55 °C for 30 min. After quickly rinsing with distilled water, dehydration was carried out successively with 70%, 95%, and 100% ethanol solutions for 10 minutes each time, then cleared with xylene for 15 minutes, and finally sealed. The morphology, quantity, and distribution of Nissl bodies in neurons were observed under an optical microscope to evaluate the degree of neuronal damage.

[0065] Please refer to Figure 6 , the Nissl staining map shows the damage of neurons in the brain tissues of rats in the normal group, MCAO / R model group, and eupalinolide treatment group. The results show that the neurons in the normal group have normal morphology and a large number; the neurons in the MCAO / R model group are damaged and the number decreases; the neuronal damage in the eupalinolide treatment group is alleviated compared with the MCAO / R model group, and the relative integrity of neurons is improved.

[0066] Based on the Nissl staining results, the data were statistically analyzed with the relative integrity percentage of neurons. Please refer to Figure 7 , the results show that the relative integrity of neurons in the normal group is high; this ratio in the MCAO / R model group is greatly reduced, about 13%; the relative integrity of neurons in the eupalinolide treatment group is higher than that in the MCAO / R model group (about 37%), indicating that eupalinolide has a certain protective effect on neurons in the brain tissues of rats with ischemic stroke.

[0067] Detection of ferroptosis-related indicators: Fresh brain tissue was collected, ground and centrifuged to obtain the supernatant, and ELISA kits were used to detect ferroptosis-related indicators, mainly including the relative contents of MDA, 4-HNE and GSH.

[0068] See also Figure 8 , ELISA experiments detected the relative content of ferroptosis markers in the brain tissue of rats in the normal group, MCAO / R model group and Erianin treatment group, mainly including MDA, 4-HNE and GSH. The results showed that the MDA and 4-HNE content of the MCAO / R model group was significantly higher than that of the normal group, and the GSH content was significantly lower than that of the normal group; the Erianin treatment group could reduce the MDA and 4-HNE content and increase the GSH content, which preliminarily indicated that ferroptosis occurred in the MCAO / R model, and the treatment with Erianin could alleviate the symptoms of the disease by significantly inhibiting the occurrence of ferroptosis.

[0069] Prussian blue test: After paraffin sections are dewaxed to water, freshly prepared Prussian blue dye (a mixture of potassium ferrocyanide and hydrochloric acid) is added and stained at room temperature for 15 minutes. After rinsing with distilled water, the sections are counterstained with nuclear fast red for 5 minutes, rinsed with distilled water again, dehydrated, transparent, and sealed. The deposition of iron ions in brain tissue is observed under an optical microscope. Iron ions react with Prussian blue dye to form a blue precipitate. The degree of iron ion deposition is judged based on the distribution and intensity of the blue precipitate.

[0070] The results are as follows Figure 9 As shown in the figure, the Prussian blue staining experiment detected the distribution of iron ions in rat brain tissue. The results showed that the normal group had less iron ions; the MCAO / R model group had increased iron ion content; the Erianin treatment group had improved iron ion content compared with the MCAO / R model group, and iron ion deposition decreased. The Prussian blue staining results were then statistically analyzed, and the results were as follows Figure 10 As shown in the figure, compared with the normal group, the iron ion level in the MCAO / R model group increased significantly (increased to about 4 times), while the relative iron ion content in the Erianin treatment group was lower than that in the MCAO / R model group (increased to about 2.5 times), which further indicated that Erianin could reduce the iron ion content in the brain tissue of rats with ischemic stroke and alleviate the damage caused by ferroptosis.

[0071] Example 4: Extraction of total mRNA from rat brain tissue and detection of GPX4 gene levels

[0072] Rat brain tissue samples were taken, ground with liquid nitrogen, and total mRNA was extracted with Trizol reagent. RNA was obtained through chloroform extraction and isopropanol precipitation, and its concentration and purity were determined. RNA was then reverse transcribed into cDNA using a reverse transcription kit. cDNA was used as a template for real-time fluorescence quantitative PCR detection of the GPX4 gene, with GAPDH as the internal reference gene and 2 -ΔΔCtThe relative expression level of the GPX4 gene was calculated by the 2−ΔΔCt method.

[0073] Please refer to Figure 11 , qPCR experiments showed that, compared with the normal group, the mRNA level of GPX4 in the MCAO / R model group was significantly decreased, and the mRNA level of GPX4 in the eupalinolide A treatment group was restored compared with that in the MCAO / R model group, indicating that eupalinolide A may reduce the damage caused by ischemic stroke to brain tissue by up−regulating the mRNA expression of GPX4 and play a role in regulating the antioxidant stress−related pathway.

[0074] Example 5 Extraction of total protein from rat brain tissue and detection of GPX4 protein level

[0075] Take rat brain tissue samples, homogenize them on ice with lysis buffer containing protease and phosphatase inhibitors, and centrifuge to obtain total protein extracts. Measure the protein concentration with a BCA kit. After the protein samples are denatured, perform SDS−PAGE gel electrophoresis, transfer the membrane to a PVDF membrane or nitrocellulose membrane, incubate with anti−GPX4 primary antibody and secondary antibody in sequence after blocking, wash, and develop color with a chemiluminescence kit, and detect and analyze the GPX4 protein expression level using a protein gel imaging system.

[0076] Please refer to Figure 12 , the protein expression level of GPX4 was detected by Western blot (WB). The results showed that, compared with the normal group, the protein expression level of GPX4 in the MCAO / R group was significantly decreased. However, with the treatment of eupalinolide A, the GPX4 protein level was restored, indicating that eupalinolide A has a certain restorative effect on the GPX4 protein level in brain tissue after ischemic stroke.

[0077] Example 6 Construction of a rat ischemic stroke cell model

[0078] In the present invention, PC12 cells were selected to induce an ischemic stroke cell model (OGD / R model). The specific operation is as follows: Select PC12 cells, inoculate the PC12 cells in a culture flask or culture plate, and use RPMI 1640 medium containing 10% fetal bovine serum and 1% double antibody (penicillin and streptomycin) to culture in an incubator at 37 °C and 5% CO2 until the cell confluence reaches 70% - 80%. Then change to serum−free RPMI 1640 medium and add CoCl2 at a concentration of 100 μM to simulate an ischemic and hypoxic environment, and continue to incubate for 24 hours.

[0079] Example 7 Detection of the change of cell viability over time after eupalinolide A treatment of rat ischemic stroke cells

[0080] After the cells were induced by oxygen-glucose deprivation (OGD), when the cell density reached about 70% in 96-well plates, the cells were evenly divided into 3 groups. The specified concentrations of erianin (0, 50, and 150 nM respectively) were added to each well, and the cells were continuously cultured. At the same time, a normal cell control group was set up. The cell viability was detected by the CCK8 method at 0 h, 12 h, 24 h, 36 h, 48 h, and 60 h respectively.

[0081] Please refer to Figure 13 , and the results showed that the cell viability of the normal group gradually increased, while the cell viability of the OGD / R model group gradually decreased over time. The cell viability of the 50 nM and 150 nM erianin treatment groups was significantly higher than that of the OGD / R model group and showed an upward trend over time, indicating that erianin could improve the cell viability of the OGD / R cell model and there was a dose-dependent relationship.

[0082] Example 8 Detection of cell viability after treating rat ischemic stroke cells with erianin or death inhibitors

[0083] After the cells were induced by OGD, when the cell density reached about 70% in 96-well plates, the cells were evenly divided into 8 groups. The specified concentrations of drugs were added to each well, specifically: DMSO treatment group, 50 nM erianin treatment group, 1 μM Fer-1 (ferroptosis inhibitor) treatment group, 100 nM Lip-1 (ferroptosis inhibitor) treatment group, 10 μM z-VAD (apoptosis inhibitor) treatment group, 5 mM 3-ME (autophagy inhibitor) treatment group, 10 μM BAY (pyroptosis inhibitor) treatment group, 5 μM NSA (necroptosis inhibitor) treatment group, and the cells were continuously cultured for 24 h. At the same time, a normal cell control group was set up. After the experiment, the cell viability of each experimental group was detected by the CCK8 method.

[0084] Please refer to Figure 14 , compared with the normal group, the cell viability of OGD / R was relatively low (about 0.3). The cell viability of the 50 nM erianin treatment group was partially restored (about 90%). Further, it was found that the effects of the erianin treatment group and the ferroptosis treatment group were comparable, while other inhibitor treatments did not obtain similar results. This indicated that erianin had an obvious inhibitory effect on ferroptosis of neuronal OGD / R cells, thus restoring cell viability.

[0085] Example 9 Detection of ferroptosis-related indicators after treating rat ischemic stroke cells with erianin

[0086] After the cells were induced by OGD, when the cell density reached about 70% in 6-well plates, the cells were evenly divided into 3 groups. The specified concentrations of erianin (0, 50, and 150 nM respectively) were added to each well, and the cells were continuously cultured. At the same time, a normal cell control group was set up. The levels of ferroptosis-related indicators were detected by ELISA method, mainly including: MDA, 4-HNE, and GSH.

[0087] Please refer to Figure 16 , the ELISA experiment showed that, compared with the cells in the normal group, the contents of MDA and 4-HNE in the cells of the OGD / R model group were higher than those in the normal group, and the content of GSH was lower than that in the normal group. With the treatment of erianin, the changes of MDA, 4-HNE and GSH could be partially restored, and the restoration level was dose-dependent, indicating that erianin could regulate the levels of ferroptosis markers, further proving that erianin could significantly inhibit the ferroptosis process of the neuronal OGD / R model.

[0088] Example 10 Detection of ROS and lipid peroxidation levels after treating rat ischemic stroke cells with erianin

[0089] Take the induced cells into a 6-well plate. When the cell density reaches about 70%, add different concentrations of erianin (0, 50 and 150 nM respectively) to each well and continue to culture for 24 h. At the same time, set a normal cell control group. After collecting the cells, use DCFH-DA to detect the level of intracellular ROS, and use C11-BODIPY to detect the level of intracellular lipid peroxidation.

[0090] Please refer to Figure 17 and 18 , compared with the normal group, the ROS fluorescence intensity of the OGD / R model group was significantly increased. After treatment with 50 nM and 150 nM erianin, it was found that the ROS fluorescence intensity was restored, and there was no significant difference between the 150 nM erianin treatment group and the normal group, indicating that erianin could inhibit the production of ROS in the neuronal OGD / R model, reduce oxidative stress, and at the same time quantitatively analyze the ROS fluorescence intensity.

[0091] Subsequently, as Figure 19 and Figure 20 shown, the lipid peroxidation fluorescence intensities of the cells in the normal group, OGD / R model group, 50 nM erianin treatment group and 150 nM erianin treatment group were detected by flow cytometry. The change trend was consistent with the ROS detection results, which further proved that erianin could significantly inhibit the ferroptosis level of neuronal cells and finally achieved the restoration of cell activity.

[0092] Example 11 Total RNA extraction from rat ischemic stroke cells treated with erianin and detection of related gene levels

[0093] When the cells after induction reached about 70% confluence in 6-well plates, different concentrations of erianin (0, 50, and 150 nM respectively) were added to each well, and the cells were cultured for another 24 h. At the same time, a normal cell control group was set up. After the experiment, the cells were collected, total RNA was extracted respectively, and the expression levels of mRNAs of various death pathways were detected by qPCR, mainly including genes in the apoptosis pathway (CASP3 and CASP8), genes in the necroptosis pathway (LC3 and P62), genes in the autophagy pathway (RIPK1, RIPK3, and MLKL), genes in the pyroptosis pathway (GSDMD, CASP1, and NLRP3), and genes in the ferroptosis pathway (SLC7A11 and GPX4). The primers used were as follows:

[0094] CASP3 (F: gagatggcttgccagaagat; R: taacgcgagtgagaatgtgc),

[0095] CASP8 (F: agtgagcagatcagaattgagg; R: gggcacagactcttttcagg),

[0096] LC3 (F: gcctgtcctggataagacca; R: ccgtcttcatccttctcc),

[0097] P62 (F: caccaatgccatctcaagtg; R: gagctacccacagagccaag),

[0098] RIPK1 (F: gtcggacgtgtacagctttg; R: gaggctgatgatctcccttg),

[0099] RIPK3 (F: ctggtgagccgtgaagaact; R: gacacgaagtcccactggag),

[0100] MLKL (F: ccccctgagttctccattgt; R: gaggaaactggagctgctga),

[0101] GSDMD (F: tgtctggtgcttgactctgg; R: caactccagctgctttgaca),

[0102] CASP1 (F: tggcattaagaaggcccata; R: tcctccaagtcacaagacca),

[0103] NLRP3 (F: agacaactgcagcctcacct; R: tcttcctggagcgcttctaa),

[0104] SLC7A11 (F: cccagatatgcatcgtcctt; R: cgtctgaaccacttgggttt),

[0105] GPX4 (F: tctcagccaaggacatcgac; R: ggccaggattcgtaaaccac),

[0106] GAPDH (F: gtgaaggtcggtgtgaacg; R: tgccgtgagtggagtcatac)

[0107] The results were as Figure 15 and Figure 21 shown. Among them, as Figure 15 shown, in the OGD / R model group, only the mRNA levels of ferroptosis genes were significantly decreased (SLC7A11 and GPX4), and with the treatment of 50 nM erianin, only the mRNA level of the GPX4 gene was significantly restored. These results indicate that erianin may affect the degree of cellular ferroptosis by regulating the level of GPX4, ultimately affecting the cell viability of the neuronal OGD / R model.

[0108] Please refer to Figure 21 , compared with the normal group, the mRNA level of GPX4 in the OGD / R model group was significantly decreased. With the treatment of erianin, the mRNA level of GPX4 was restored, and it was concentration-dependent.

[0109] Example 12 Extraction of total cellular proteins from rat ischemic stroke cells treated with erianin and detection of GPX4 protein level

[0110] Take the induced cells in a 6-well plate. When the cell density reaches about 70%, add different concentrations of erianin (0, 50, and 150 nM respectively) to each well and continue to culture for 24 h. At the same time, set up a normal cell control group. After the experiment, collect the cells, extract the total proteins respectively, and detect the expression level of GPX4 protein by WB method.

[0111] Please refer to Figure 22 , compared with the normal group, the expression level of GPX4 protein in the OGD / R group was significantly decreased, further indicating that the treatment of erianin could reverse the decrease in GPX4 protein level. Therefore, erianin has a certain promoting effect on the GPX4 protein level in ischemic stroke cells.

[0112] Example 13 Molecular docking of erianin and GPX4 protein

[0113] To evaluate the binding energy and interaction mode between erianin and GPX4 protein, we used the AutodockVina 1.2.2 protein-ligand docking software. The molecular structure of erianin was obtained from the PubChem compound database (https: / / pubchem.ncbi.nlm.nih.gov / ), and the 3D coordinates of GPX4 protein were downloaded from PDB (http: / / www.rcsb.org / ). The molecular docking analysis was performed by Autodock Vina 1.2.2 (http: / / autodock.scripps.edu / ) for visualizing the molecular docking model.

[0114] The results are as Figure 23 shown. There are hydrogen bonds and strong electrostatic interactions between the Asn81, Glu82, and Ser80 sites of GPX4 protein and erianin, and there is a low binding energy of -6.875 kcal / mol between them, indicating a highly stable binding.

[0115] Combined with the above examples, it is verified that erianin can target GPX4 protein, thereby promoting the stability of GPX4 protein, further inhibiting the occurrence of ferroptosis, and restoring the activity of neuronal cells.

[0116] In summary, this application provides the use of erianin in ischemic stroke. Through specific verification experiments, it is proved that erianin can significantly reduce the pathological damage of ischemic stroke and relieve the symptoms of ischemic stroke. At the same time, erianin can effectively inhibit the ferroptosis level of neuronal cells in in vivo and in vitro ischemic stroke models and restore cell activity. In addition, erianin can target GPX4 protein, thereby effectively regulating the ferroptosis level of cells, providing a theoretical basis for the preparation of drugs for treating ischemic stroke with erianin.

Claims

1. Use of erianin in the preparation of a drug for reversing neuronal cell damage.

2. Use of erianin according to claim 1 in the preparation of a drug for reversing neuronal cell damage, characterized in that: The erianin restores cell activity by increasing the activity of neuronal cells through inhibiting the ferroptosis pathway.

3. Use of erianin according to claim 2 in the preparation of a medicament for reversing neuronal cell damage, characterized in that: The erianin targets the GPX4 protein, thereby effectively regulating the ferroptosis level of cells.

4. Use of erianin in the preparation of a drug for preventing and treating ischemic stroke.

5. A drug for preventing and treating ischemic stroke, characterized in that: The drug contains erianin.

6. The drug for preventing and treating ischemic stroke according to claim 5, characterized in that: The drug targets the GPX4 protein to promote the stability of the GPX4 protein, further inhibits the occurrence of ferroptosis, restores the activity of neuronal cells, so as to achieve the purpose of preventing and treating ischemic stroke.