Application of a composition in the preparation of a drug for osteoarthritis
By using a combination of ingredients such as tofu glycosides, N-acetylcysteine, seaweed short peptides, and platelet-derived factors, along with a culture medium, the chondrogenic differentiation and migration capacity of chondrogenic stem cells were enhanced, solving the problem of functional decline in the treatment of osteoarthritis and achieving significant therapeutic effects.
Patent Information
- Application Number
- CN202510481937.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-17
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2045-04-17
AI Technical Summary
In the inflammatory environment of osteoarthritis, the ability of chondrogenic differentiation and migration of chondrogenic stem cells is significantly reduced, resulting in limited therapeutic effects.
Using a composition and culture medium containing ingredients such as tofu glycosides, N-acetylcysteine, seaweed short peptides and platelet-derived factors, the chondrogenic differentiation and migration abilities of chondrogenic stem cells are enhanced, and an injectable drug for osteoarthritis is prepared.
It significantly improved the functional performance of chondrocyte stem cells under inflammatory conditions, increased COL2A1 gene expression and cell migration rate, promoted cartilage regeneration and tissue repair, reduced Wakitani histological score, and improved osteoarthritis symptoms.
Smart Images

Figure CN120324467B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of arthritis technology, and particularly relates to the application of a composition in the preparation of osteoarthritis drugs. Background Technology
[0002] Osteoarthritis (OA) is a chronic degenerative disease characterized primarily by the degeneration of articular cartilage, often accompanied by subchondral bone sclerosis, synovitis, and damage to periarticular tissues. The pathogenesis of OA is complex, involving multiple factors such as mechanical stress, release of inflammatory factors, chondrocyte metabolic disorders, and cartilage matrix degradation. Currently, treatments for OA mainly include drug therapy (such as nonsteroidal anti-inflammatory drugs), physical therapy, and surgical intervention (such as joint replacement surgery). However, these methods can only relieve symptoms or temporarily improve joint function, and cannot fundamentally solve the problem of cartilage tissue regeneration. In recent years, with the development of regenerative medicine, stem cell therapy has been considered a potential breakthrough in the treatment of OA, especially the application of chondrogenic stem cells (CSCs) in cartilage repair, which has attracted widespread attention.
[0003] Chondrocyte stem cells (CSCs) are a type of mesenchymal stem cell with multipotent differentiation potential, widely distributed in cartilage tissue and its microenvironment. These cells can differentiate into chondrocytes and also secrete various growth factors and extracellular matrix, playing a crucial role in maintaining cartilage homeostasis and promoting tissue repair. Studies have shown that CSCs can effectively inhibit cartilage degeneration and promote cartilage regeneration by secreting anti-inflammatory factors (such as IL-10 and TGF-β) and synthesizing cartilage-specific matrix components (such as type II collagen and chondroitin sulfate).
[0004] Despite the immense potential of chondrocyte stem cells (CSCs) in cartilage repair, their performance often declines significantly in the inflammatory environment associated with osteoarthritis (OA). The chronic inflammatory state within the joints of OA patients leads to the release of large amounts of pro-inflammatory factors (such as IL-1β, TNF-α, and IL-6), which have multiple negative impacts on CSC function, such as reducing their differentiation potential and migration ability. In conclusion, although chondrocyte stem cells show great promise in the treatment of osteoarthritis, their diminished performance under inflammatory conditions remains a critical issue that urgently needs to be addressed. Summary of the Invention
[0005] This invention aims to provide an application of a composition in the preparation of drugs for osteoarthritis, particularly by significantly enhancing the chondrogenic differentiation and migration capabilities of chondrocyte stem cells under inflammatory conditions, thereby significantly improving their therapeutic effect on osteoarthritis. This invention also discloses an injectable drug for the highly effective treatment of osteoarthritis, a method for preparing drugs that enhance the therapeutic capacity of chondrocyte stem cells, and related culture media.
[0006] To achieve the above objectives, the present invention provides the following technical solution:
[0007] In a first aspect, the present invention provides the use of a composition in the preparation of a medicament for osteoarthritis, the composition comprising the following components:
[0008] 20-30 μg / mL tofu glycosides and 10-20 μg / mL N-acetylcysteine;
[0009] 90-100 μg / mL seaweed short peptides and 20-30 μg / mL platelet-derived factors;
[0010] The amino acid sequence of the seaweed short peptide is Pro-Asp-Asp-Val-Ala.
[0011] Preferably, the composition is used to treat osteoarthritis by enhancing the chondrogenic differentiation and migration capacity of chondrocyte stem cells under inflammatory conditions.
[0012] Preferably, the osteoarthritis is knee arthritis.
[0013] In a second aspect, the present invention provides an injectable drug for the highly effective treatment of osteoarthritis, the injectable drug being composed of cartilage stem cells with enhanced therapeutic capacity and a solvent;
[0014] The therapeutically enhanced chondrocyte stem cells were prepared by the following method:
[0015] (1) Hyaluronic cartilage was enzymatically hydrolyzed and cultured to obtain cartilage stem cells;
[0016] (2) Seed chondrocyte stem cells into a culture dish and culture until the cells are completely adherent;
[0017] (3) Remove the original culture medium, add chondrocyte stem cell enhancement culture medium and continue culturing for 24-72h to obtain the chondrocyte stem cells with enhanced therapeutic ability;
[0018] The components of the chondrocyte stem cell enhancement culture medium are as follows:
[0019] 20-30 μg / mL tofu glycosides and 10-20 μg / mL N-acetylcysteine;
[0020] 90-100 μg / mL seaweed short peptides and 20-30 μg / mL platelet-derived factors;
[0021] 10% FBS and DMEM / F12 medium;
[0022] The amino acid sequence of the seaweed short peptide is Pro-Asp-Asp-Val-Ala.
[0023] Preferably, the content of the therapeutically enhanced chondrocyte stem cells in each 50 μL of the injected drug is 1 × 10⁻⁶. 6 indivual.
[0024] Preferably, the solvent is PBS or physiological saline.
[0025] Thirdly, the present invention provides a method for preparing a treatment that enhances the therapeutic ability of chondrocyte stem cells for osteoarthritis, characterized in that the preparation method includes the following steps:
[0026] (1) Hyaluronic cartilage was enzymatically hydrolyzed and cultured to obtain cartilage stem cells;
[0027] (2) Seed chondrocyte stem cells into a culture dish and culture until the cells are completely adherent;
[0028] (3) Remove the original culture medium, add chondrocyte stem cell enhancement culture medium and continue culturing for 24-72h to obtain chondrocyte stem cells with enhanced therapeutic ability;
[0029] The components of the chondrocyte stem cell enhancement culture medium are as follows:
[0030] 20-30 μg / mL tofu glycosides and 10-20 μg / mL N-acetylcysteine;
[0031] 90-100 μg / mL seaweed short peptides and 20-30 μg / mL platelet-derived factors;
[0032] 10% FBS and DMEM / F12 medium;
[0033] The amino acid sequence of the seaweed short peptide is Pro-Asp-Asp-Val-Ala.
[0034] Preferably, the preparation method enhances the chondrogenic differentiation and migration ability of chondrocyte stem cells in an inflammatory environment, thereby improving the therapeutic effect of osteoarthritis.
[0035] Fourthly, the present invention provides a method for enhancing the chondrogenic differentiation and migration ability of chondrocyte stem cells under inflammatory conditions, characterized in that the method is consistent with the preparation method described above.
[0036] Fifthly, the present invention provides a culture medium for enhancing the chondrogenic differentiation and migration ability of chondrocyte stem cells under inflammatory conditions, the culture medium comprising the following components:
[0037] 20-30 μg / mL tofu glycosides and 10-20 μg / mL N-acetylcysteine;
[0038] 90-100 μg / mL seaweed short peptides and 20-30 μg / mL platelet-derived factors;
[0039] 10% FBS and DMEM / F12 medium;
[0040] The amino acid sequence of the seaweed short peptide is Pro-Asp-Asp-Val-Ala.
[0041] Preferably, the culture medium consists of the following components:
[0042] 20 μg / mL tofu glycosides and 20 μg / mL N-acetylcysteine;
[0043] 90 μg / mL seaweed short peptides and 30 μg / mL platelet-derived factors;
[0044] 10% FBS and DMEM / F12 medium.
[0045] The beneficial effects of this invention are as follows:
[0046] This invention provides a composition, an injectable drug, and an enhanced culture medium that significantly improves the functional performance of chondrocyte stem cells under inflammatory conditions, offering an innovative solution for the treatment of osteoarthritis. After treatment with the enhanced culture medium, the chondrogenic differentiation and migration abilities of chondrocyte stem cells are significantly enhanced, with COL2A1 gene expression levels and cell migration rates superior to cells under ordinary culture conditions, effectively promoting cartilage regeneration and tissue repair. Furthermore, the combination of drug A (tofu glycosides + NAC) and drug B (algal short peptides + PDGF) exhibits a significant synergistic effect, with a synergistic coefficient q value greater than 1.15, further optimizing the functional performance of chondrocyte stem cells.
[0047] Meanwhile, the present invention has shown excellent therapeutic effects in animal model experiments. In particular, in the SD rat knee arthritis model, the cartilage stem cells treated with enhanced culture medium significantly reduced the Wakitani histological score, from 8.83 in the model group to 2.17±0.98, indicating that it can effectively improve cartilage damage and inflammatory response. Attached Figure Description
[0048] Figure 1 The relative expression levels of the COL2A1 gene differed between different experimental and control groups under IL-1β inflammatory factor treatment.
[0049] Figure 2 The difference in cell migration rate between different experimental groups and control groups under IL-1β inflammatory factor treatment;
[0050] Figure 3 Differences in the therapeutic effects of different experimental groups in an SD rat model of knee osteoarthritis. Detailed Implementation
[0051] To better illustrate the purpose, technical solution, and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.
[0052] The source of the core components involved in this invention:
[0053] Tofu glycosides (CAS#:80154-34-3): Nanjing Qingyun Biotechnology Co., Ltd., Product No.: QY00378;
[0054] N-acetylcysteine (NAC): Merck Life Sciences, catalog number: A9165;
[0055] Seaweed short peptides: synthesized by Jier Biochemical (Shanghai) Co., Ltd.;
[0056] Platelet-derived growth factor (PDGF): Yisheng Biotechnology (Shanghai), catalog number: 91609ES10;
[0057] DMEM / F12 culture medium: Gibco, catalog number: 11320033;
[0058] Fetal bovine serum (FBS): Gibco, catalog number: 10270106.
[0059] Example 1
[0060] Obtaining rat cartilage stem cells
[0061] Five-day-old SD rats were selected and dissected under sterile conditions using sterile scissors and forceps to expose the knee joint.
[0062] Carefully separate the muscles and connective tissue around the knee joint, remove the complete knee joint, peel off the attached cartilage tissue (hyaline cartilage), and wash it in pre-cooled PBS.
[0063] Under a stereomicroscope, blood vessels, fat, and other non-cartilage tissues on the surface of the cartilage are carefully removed. The cartilage is then cut into 1-2 mm pieces using a sterile scalpel. 3 Small pieces;
[0064] Transfer the chopped cartilage tissue to a sterile centrifuge tube, add an appropriate amount of 0.25% trypsin solution, incubate at 37°C for 30 minutes, gently mix every 10 minutes to promote cell release;
[0065] After incubation, the cartilage tissue was washed twice with PBS to remove residual trypsin.
[0066] Add an appropriate amount of collagenase IV and incubate at 37°C for 4 hours, gently shaking every 30 minutes during the process. After digestion is complete, filter with a cell sieve (pore size 70μm) to remove undigested tissue fragments.
[0067] Centrifuge the filtered cell suspension at 1000 rpm for 5 minutes and discard the supernatant.
[0068] Resuspend the cell pellet in complete culture medium and adjust the cell density to an appropriate concentration (1×10⁻⁶). 6 (cells / mL), the cell suspension was seeded into a culture flask, an appropriate amount of complete culture medium was added, and the flask was placed in an incubator at 37°C and 5% CO2 for culture;
[0069] Do not change the medium on the first day to allow the cells to adhere. On the second day, change the medium to fresh medium and remove any unadhered cells and impurities. Change the medium every 2-3 days and observe the cell growth.
[0070] When the cell fusion rate reaches 80%-90%, the cells are digested with 0.25% trypsin and passaged to obtain 4th-6th generation chondrocyte stem cells for subsequent experiments.
[0071] Example 2
[0072] chondrocyte stem cell enhancement culture medium a
[0073] The components of this enhanced culture medium are:
[0074] Combination drug A: 30 μg / mL tofu glycoside and 10 μg / mL NAC (acetylcysteine);
[0075] Combination drug B: 100 μg / mL seaweed short peptide (amino acid sequence: Pro-Asp-Asp-Val-Ala) and 20 μg / mL PDGF (platelet-derived growth factor);
[0076] DMEM / F12 medium and 10% FBS.
[0077] Example 3
[0078] Cartilage stem cell enhancement culture medium b
[0079] The components of this enhanced culture medium are:
[0080] Combination drug C: 20 μg / mL tofu glycoside and 20 μg / mL NAC (acetylcysteine);
[0081] Combination drug D: 90 μg / mL seaweed short peptide (amino acid sequence: Pro-Asp-Asp-Val-Ala) and 30 μg / mL PDGF (platelet-derived growth factor);
[0082] DMEM / F12 medium and 10% FBS.
[0083] Example 4
[0084] Cartilage stem cell enhancement culture medium c
[0085] The components of this enhanced culture medium are:
[0086] Combination drug E: 30 μg / mL tofu glycoside and 30 μg / mL NAC (acetylcysteine);
[0087] Combination drug F: 80 μg / mL seaweed short peptide (amino acid sequence: Pro-Asp-Asp-Val-Ala) and 40 μg / mL PDGF (platelet-derived growth factor);
[0088] DMEM / F12 medium and 10% FBS.
[0089] Comparative Example 1
[0090] Cartilage stem cell contrast culture medium a
[0091] Combination drug A: 30 μg / mL tofu glycoside and 10 μg / mL NAC (acetylcysteine);
[0092] DMEM / F12 medium and 10% FBS.
[0093] Comparative Example 2
[0094] Cartilage stem cell contrast culture medium b
[0095] Combination drug B: 100 μg / mL seaweed short peptide (amino acid sequence: Pro-Asp-Asp-Val-Ala) and 20 μg / mL PDGF (platelet-derived growth factor);
[0096] DMEM / F12 medium and 10% FBS.
[0097] Comparative Example 3
[0098] Cartilage stem cell contrast culture medium c
[0099] Combination drug C: 20 μg / mL tofu glycoside and 20 μg / mL NAC (acetylcysteine);
[0100] DMEM / F12 medium and 10% FBS.
[0101] Comparative Example 4
[0102] chondrocyte stem cell contrast culture medium d
[0103] Combination drug D: 90 μg / mL seaweed short peptide (amino acid sequence: Pro-Asp-Asp-Val-Ala) and 30 μg / mL PDGF (platelet-derived growth factor);
[0104] DMEM / F12 medium and 10% FBS.
[0105] Comparative Example 5
[0106] Cartilage stem cell contrast culture medium e
[0107] Combination drug E: 30 μg / mL tofu glycoside and 30 μg / mL NAC (acetylcysteine);
[0108] DMEM / F12 medium and 10% FBS.
[0109] Comparative Example 6
[0110] Cartilage stem cell contrast culture medium f
[0111] Combination drug F: 80 μg / mL seaweed short peptide (amino acid sequence: Pro-Asp-Asp-Val-Ala) and 40 μg / mL PDGF (platelet-derived growth factor);
[0112] DMEM / F12 medium and 10% FBS.
[0113] Example 5
[0114] To investigate the differences in chondrogenic differentiation capacity of chondrogenic stem cells treated with different culture media under IL-1β inflammatory factor treatment.
[0115] P4 generation chondrocyte stem cells were seeded into 5-well plates. After the cells were fully adhered, the culture medium was changed as follows:
[0116] Control group: replaced with basal DMEM / F12 medium;
[0117] Model group: replaced with basic DMEM / F12 medium + 10 ng / ml IL-1β;
[0118] Experimental group a: The medium was replaced with enhanced medium a + 10 ng / ml IL-1β;
[0119] Experimental group b: Replaced with enhanced culture medium b + 10 ng / ml IL-1β;
[0120] Experimental group c: replaced with enhanced culture medium c + 10 ng / ml IL-1β;
[0121] Control group a: Replace with control culture medium a + 10 ng / ml IL-1β;
[0122] Control group b: Replace with control culture medium b + 10 ng / ml IL-1β;
[0123] Control group c: Replace with control culture medium c + 10 ng / ml IL-1β;
[0124] Control group d: Replace with control culture medium d + 10 ng / ml IL-1β;
[0125] Control group e: Replace with control culture medium e + 10 ng / ml IL-1β;
[0126] Control group f: replaced with control culture medium f + 10 ng / ml IL-1β;
[0127] After changing the culture medium and treating for 24 hours, RNA was extracted using TRIzol reagent, reverse transcribed, and then detected by PCR using the SYBR GreenMaster Mix quantitative PCR kit. The primer sequences for the COL2A1 gene are as follows:
[0128] Upstream primer: acagcattgcctacctggac;
[0129] Downstream primer: tcagggcagtgtacgtgaac;
[0130] Table 1. Differences in chondrogenic differentiation capacity of chondrocyte stem cells.
[0131]
[0132]
[0133] Combining Table 1 and Figure 1 The results show that, compared with the control group, the relative expression level of the COL2A1 gene in the model group indicates that the inflammatory environment simulated in this invention successfully reduced the chondrogenic differentiation capacity of chondrocyte stem cells.
[0134] The relative expression level of the COL2A1 gene in the experimental groups (a, b, and c) was significantly increased compared with that in the model group, indicating that the chondrogenic differentiation capacity of chondrogenic stem cells prepared by the present invention can be effectively enhanced.
[0135] The relative expression level of the COL2A1 gene in the control group (af) was higher than that in the model group, but significantly lower than that in the experimental group, indicating that the use of combination drugs alone is insufficient to fully reverse the decline in the chondrogenic differentiation capacity of chondrocyte stem cells caused by the inflammatory environment.
[0136] Further research revealed that the synergy coefficient q of experimental group a, which used a combination of drug A and drug B, was: Eab / Ea+Eb-Ea×Eb=1.49;
[0137] The synergy coefficient q of experimental group b, which used combination drugs C and D in combination, was 1.43.
[0138] The synergy coefficient q of experimental group c, which used a combination of drugs E and F, was 1.14.
[0139] It can be seen that experimental group a, which uses combination drugs A and B in a 1:3 mass ratio, and experimental group b, which uses combination drugs C and D in a 1:3 mass ratio, have synergistic effects, while experimental group c, which uses combination drugs E and F in a 1:2 mass ratio, only has an additive effect.
[0140] The above results indicate that when the combination of 20-30 μg / mL tofu glycoside and 10-20 μg / mL NAC is used in combination with the combination of 90-100 μg / mL seaweed short peptide and 20-30 μg / mL PDGF, it can significantly reverse the decline in the chondrogenic differentiation ability of chondrogenic stem cells caused by inflammatory environment, thereby effectively enhancing the chondrogenic differentiation ability of chondrogenic stem cells under inflammatory environment.
[0141] Example 6
[0142] To investigate the differences in the migration ability of chondrocyte stem cells treated with different culture media under IL-1β inflammatory factor treatment.
[0143] P4 generation chondrocyte stem cells were seeded into 6-well plates and cultured in basal DMEM / F12 medium until the cells reached 90-100% confluence.
[0144] After aspirating the culture medium from the 6-well plate and washing the cells twice with PBS, use a sterile 200 μL pipette tip to draw a straight line vertically down the center of the cell monolayer in each well.
[0145] Gently wash the well plate again with PBS to remove detached cell debris, and then process the cells as follows:
[0146] Control group: replaced with basal DMEM / F12 medium;
[0147] Model group: replaced with basic DMEM / F12 medium + 10 ng / ml IL-1β;
[0148] Experimental group a: The medium was replaced with enhanced medium a + 10 ng / ml IL-1β;
[0149] Experimental group b: Replaced with enhanced culture medium b + 10 ng / ml IL-1β;
[0150] Control group a: Replace with control culture medium a + 10 ng / ml IL-1β;
[0151] Control group b: Replace with control culture medium b + 10 ng / ml IL-1β;
[0152] Control group c: Replace with control culture medium c + 10 ng / ml IL-1β;
[0153] Control group d: Replace with control culture medium d + 10 ng / ml IL-1β;
[0154] The 6-well plate was placed in a cell culture incubator at 37°C and 5% CO2 for 24 hours.
[0155] An initial image of the scratched area was taken immediately after scratching (0 hours), and then the same area was taken again 24 hours later. The width of the scratched area was measured using the image analysis software ImageJ, and the cell migration rate was calculated.
[0156] Table 2. Differences in the migration ability of chondrocyte stem cells.
[0157]
[0158]
[0159] As can be seen from the results in Table 2, compared with the model group, the cell migration rate of experimental groups a and b was significantly increased, and the recovery rate of migration ability was significantly higher than that of control group a and b, indicating that chondrocyte stem cells treated with the enhanced culture medium a or b prepared in this invention have stronger cell migration ability under inflammatory conditions.
[0160] Further research revealed that the synergy coefficient q of experimental group a, which used a combination of drug A and drug B, was 1.28.
[0161] The synergy coefficient q of experimental group b, which uses combination drugs C and D in combination, is 1.29.
[0162] The results indicate that the combination of 20-30 μg / mL tofu glycoside and 10-20 μg / mL NAC with a combination of 90-100 μg / mL seaweed short peptide and 20-30 μg / mL PDGF can significantly reverse the decline in the migration ability of chondrocyte stem cells caused by inflammatory environment, thereby effectively enhancing the migration ability of chondrocyte stem cells under inflammatory environment.
[0163] Example 7
[0164] To investigate the therapeutic effect of chondrocyte stem cells treated with enhanced culture medium on a rat model of knee osteoarthritis.
[0165] Thirty SD rats were randomly divided into five groups: sham surgery group (the joint capsule was directly sutured and the incision was closed after only exposing the joint structure), knee arthritis model group, ordinary cartilage stem cell group (cartilage stem cells collected after 24 h of treatment with basic DMEM medium), enhanced cartilage stem cell a group (cartilage stem cells a collected after 24 h of treatment with enhanced medium a), and enhanced cartilage stem cell b group (cartilage stem cells b collected after 24 h of treatment with enhanced medium b).
[0166] Modeling steps:
[0167] SD rats were weighed, and the anesthetic dose (10% chloral hydrate, 0.3 mL / 100 g) was calculated based on body weight. The rats were anesthetized by intraperitoneal injection. After anesthesia, 80,000 units of penicillin were injected intramuscularly to prevent infection.
[0168] The rat's hind limbs were shaved and disinfected with povidone-iodine. Sterile surgical drapes were laid on the hind limbs. The skin and subcutaneous tissue were cut in the midline anterior to the knee joint of the rat's hind limbs. Part of the patellar ligament, quadriceps femoris muscle and joint capsule were cut in the medial side of the patella to fully expose the femoral trochlea and femoral condyle.
[0169] Centered on the midpoint of the femoral trochlea, a full-thickness cartilage defect was created using a 2mm diameter trephine drill to a depth of approximately 0.5mm (to avoid damaging the subchondral bone). During the drilling process, physiological saline was continuously used for cooling to protect the normal cartilage at the edge of the drill hole.
[0170] The joint cavity and wound were repeatedly rinsed with saline solution, the defect area was cleaned with sterile gauze, the knee joint was straightened and the patella was repositioned, the joint capsule, deep fascia and skin were sutured layer by layer, and the surgical incision was disinfected.
[0171] After the surgery, the rats were returned to their cages and cultured for another week.
[0172] Drug treatment:
[0173] Sham surgery group: 50 μL of PBS was injected into the defect site;
[0174] Knee osteoarthritis model group: 50 μL of PBS was injected into the defect site;
[0175] Ordinary chondrocyte stem cell group: 50 μL containing 1×10⁻⁶ cells was injected at the defect site. 6 PBS containing one chondrocyte stem cell;
[0176] Group A, which enhanced chondrocyte stem cells: 50 μL of a solution containing 1×10⁻⁶ cells was injected into the defect site. 6 PBS containing one chondrocyte stem cell a;
[0177] Group B, which enhances chondrocyte stem cell production: 50 μL of a solution containing 1×10⁻⁶ cells was injected into the defect site. 6 PBS containing one cartilage stem cell b.
[0178] The medication was administered for 12 weeks, with injections every week.
[0179] Histological score:
[0180] After the experiment, SD rats were euthanized, and femoral condyle specimens were harvested approximately 0.5-1 cm distal to the condyle. After staining, the specimens were histologically scored using the Wakitani scoring system, considering cell morphology, matrix staining, cartilage surface smoothness, thickness of newly formed cartilage, integration with surrounding tissues, and matrix-specific staining. The total score was 14 points; a lower score indicated better repair.
[0181] from Figure 3 The results clearly show significant differences in the scores among the different experimental groups. Specifically, the score of the sham-operated group was 0.33±0.52, indicating that the knee joint of the rats in this group did not suffer significant damage, hence the lower score.
[0182] The knee osteoarthritis model group scored 8.83, indicating that the knee osteoarthritis symptoms in the model group rats were more severe and there were obvious pathological changes.
[0183] The score of the conventional chondrocyte stem cell treatment group was 5.33±1.03, which showed some improvement compared with the model group, but was still at a high level, indicating that the chondrocyte stem cells cultured by conventional methods have a certain therapeutic effect, but the effect is limited.
[0184] The score of the enhanced chondrocyte stem cell group a was 3.33±1.03, while the score of the enhanced chondrocyte stem cell group b was further reduced to 2.17±0.98, indicating that both types of chondrocyte stem cells cultured in the enhanced medium of the present invention showed better effects in the treatment of knee osteoarthritis, especially the chondrocyte stem cells cultured in enhanced medium b had the most significant effect.
[0185] The above results fully demonstrate that, compared with cartilage stem cells cultured by traditional methods, cartilage stem cells cultured using the enhanced culture medium a and enhanced culture medium b of this invention can significantly improve the therapeutic effect when used to treat SD rats with a knee osteoarthritis model, thus providing a basis for the efficient treatment of knee osteoarthritis.
Claims
1. A method for preparing chondrocyte stem cells that enhance the therapeutic ability of osteoarthritis, characterized in that, The preparation method includes the following steps: (1) Hyaluronic cartilage was enzymatically hydrolyzed and cultured to obtain cartilage stem cells; (2) Seed the chondrocyte stem cells into a culture dish and culture them until the cells are completely adhered to the dish. (3) Remove the original culture medium, add chondrocyte stem cell enhancement culture medium and continue culturing for 24-72h to obtain chondrocyte stem cells with enhanced therapeutic ability; The components of the chondrocyte stem cell enhancement culture medium are as follows: 20-30 μg / mL tofu glycosides and 10-20 μg / mL N-acetylcysteine; 90-100 μg / mL seaweed short peptides and 20-30 μg / mL platelet-derived growth factor; 10% FBS and DMEM / F12 medium; The amino acid sequence of the seaweed short peptide is Pro-Asp-Asp-Val-Ala.
2. The preparation method according to claim 1 enhances the chondrogenic differentiation and migration ability of chondrocyte stem cells under inflammatory conditions, thereby improving the therapeutic effect on osteoarthritis.
3. A culture medium for enhancing the chondrogenic differentiation and migration ability of chondrocyte stem cells under inflammatory conditions, characterized in that, The culture medium consists of the following components: 20-30 μg / mL tofu glycosides and 10-20 μg / mL N-acetylcysteine; 90-100 μg / mL seaweed short peptides and 20-30 μg / mL platelet-derived growth factor; 10% FBS and DMEM / F12 medium; The amino acid sequence of the seaweed short peptide is Pro-Asp-Asp-Val-Ala.
4. The culture medium according to claim 3, characterized in that, The culture medium consists of the following components: 20 μg / mL tofu glycosides and 20 μg / mL N-acetylcysteine; 90 μg / mL seaweed short peptides and 30 μg / mL platelet-derived growth factor; 10% FBS and DMEM / F12 medium.
Citation Information
Patent Citations
Cartilage stem cell preparation, and preparation method and application thereof
CN106309493A