Visual detection kit for specific diagnosis of cattle theileria annulata under constant temperature condition
By designing specific crRNA and constructing CRISPR/Cas13a detection system, the low sensitivity and equipment dependence of bovine ring Taylorworm detection are solved, and fast and accurate visual detection is achieved.
Patent Information
- Application Number
- CN202410069133.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-17
- Publication Date
- 2025-07-18
- Estimated Expiration
- 2044-01-17
AI Technical Summary
The existing cattle ring-shaped Taylorworm detection methods have low sensitivity, require professional equipment and operators, and have a risk of missed detection. There is a lack of CRISPR/Cas13a detection system for cattle ring-shaped Taylorworm.
CrRNA specifically targeting the surface antigen of the bovine circular Taylor worm spores was designed, and combined with RPA reaction products, Cas13a protein, RNase inhibitors, reporter molecules, T7RNA polymerase, NTP, etc., a CRISPR/Cas13a detection system was constructed, and visual detection was achieved through isothermal incubation and test strip detection.
The high sensitivity and specific detection of bovine ring Taylorworms is achieved, which can quickly and accurately identify bovine ring Taylorworms under constant temperature conditions and reduce the risk of missed detection.
Smart Images

Figure CN120330182A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of in vitro diagnostic products, and particularly relates to a visual detection kit for specifically diagnosing Theileria annulata under constant temperature conditions. Background Art
[0002] Bovine theileriosis is caused by the parasitism of Theileria spp. in the family Theileriidae in bovine red blood cells and mononuclear phagocyte system cells. The transmission vector of this disease is Hyalomma anatolicum anatolicum, and there is a sexual reproduction process in the tick. Bovine theileriosis in China is mainly caused by Theileria annulata. Theileria annulata disease is distributed in many countries in the world, and there are reports in many provinces in China. This disease has caused serious economic losses to the cattle industry, so the prevention and control of this disease is still important and necessary.
[0003] The traditional diagnostic method for Theileria annulata is to observe the parasites in red blood cells and the parasites in lymph node puncture fluid through a microscope. However, when the infection rate of cattle is low, the microscope cannot directly observe them, which is prone to missed detection. With the development of science and technology, molecular detection techniques such as polymerase chain reaction (PCR), reverse line blot (RLB), loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification technology (RPA), and fluorescence quantitative PCR (qPCR) technology, as well as the serological enzyme-linked immunosorbent assay (ELISA) have been successfully established for the detection of Theileria annulata. Among them, the recombinase polymerase amplification technology (RPA) and the enzyme-linked immunosorbent assay (ELISA) have been combined with immunochromatographic test strips to achieve visual detection. However, all of the above detection methods have their own limitations. Microscopic examination and molecular detection require special instrument equipment and professional operators, and the established visual detection methods have low sensitivity, and there is also a risk of missed detection in actual applications.
[0004] The clustered regularly interspaced short palindromic repeat (CRISPR) system is a repetitive palindromic sequence existing in bacteria, which has the function of capturing invading exogenous DNA genes. When exogenous genes invade bacteria, CRISPR-related proteins, namely Cas series proteins, can integrate the obtained specific exogenous genes into the spacer sequence of the CRISPR structure. When the exogenous gene invades again, it can quickly recognize the exogenous gene and play the role of an endonuclease to destroy the exogenous gene. CRISPR and Cas are simply referred to as the CRISPR-Cas system, and the technology modified therefrom is currently widely used in gene editing, molecular diagnosis and other aspects.
[0005] There are currently three subclasses of the Cas family that have been developed: Cas9, Cas12, and Cas13. The Cas9 technology is mainly applied to gene editing and targeted elimination at the DNA level. Cas13a has the characteristic of specifically recognizing and cleaving RNA. With the development of technology, the CRISPR / Cas13a system combined with RPA and other methods has been widely applied to the specific high-sensitivity enzymatic reporter unlocking (SHERLOCK) platform for molecular detection, which is currently widely used for the detection of various pathogens and has the characteristics of isothermal, rapid, high sensitivity, and high specificity. However, for the detection of different pathogens, the selection of crRNA in the CRISPR / Cas13a detection system and the preparation of RPA reaction products have a greater impact on the detection results. Therefore, for the detection of different pathogens, it is necessary to consider the selection of crRNA, the preparation of RPA reaction products, the selection of probes, and the CRISPR / Cas13a detection system. Currently, there is no CRISPR / Cas13a detection method for the specific detection of Theileria annulata in cattle. Summary of the Invention
[0006] Aiming at the above technical problems, the purpose of the present invention is to provide a kit and a visualization detection method for the differential diagnosis of Theileria annulata in cattle under isothermal conditions, realizing the highly sensitive and highly specific detection of Theileria annulata in cattle. Specifically, it includes the following contents:
[0007] In the first aspect, the present invention provides a crRNA that specifically targets the surface antigen of Theileria annulata sporozoites for the CRISPR-Cas13a system, and the sequence of the crRNA is shown as SEQ ID NO.1.
[0008] In the second aspect, the present invention provides a primer pair for amplifying the crRNA described in the first aspect. The primer pair includes a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown as SEQ ID NO.2; the nucleotide sequence of the reverse primer is shown as SEQ ID NO.3.
[0009] In the third aspect, the present invention provides a kit for the differential diagnosis of Theileria annulata in cattle under isothermal conditions. The kit includes an RPA reaction product, the crRNA described in the first aspect, Cas13a protein, RNase inhibitor, reporter molecule, T7 RNA polymerase, NTP, and NTT; the RPA reaction product is amplified by the upstream and downstream primer pairs shown as SEQ ID NO.4 and 5.
[0010] Preferably, the RPA reaction system and procedure are as follows:
[0011] Upstream primer shown in SEQ ID NO.4 (10 μM), 2.4 μl;
[0012] Downstream primer shown in SEQ ID NO.5 (10 μM), 2.4 μl;
[0013] Primer Free Rehydration Buffer, 29.5 μl;
[0014] Genomic DNA, 1 μl;
[0015] Make up to 47.5 μl with enzyme-free water;
[0016] Add the above substances into the dry powder tube provided with the RPA kit, mix well, then add 2.5 μL of 280 mM MgOAc to the tube cap, and immediately react at 37 °C for 20 min after centrifugation.
[0017] Preferably, the reporter molecule is a single-stranded RNA containing at least 2 consecutive bases U, a fluorophore and a quencher.
[0018] Preferably, the sequence of the reporter molecule is 5'-6-FAM-UUUUUUUUUUUUUU-Biotin-3'.
[0019] Fourthly, the present invention provides the application of the kit described in the third aspect above in the detection of Babesia annulata for non-diagnostic and therapeutic purposes.
[0020] Fifthly, the present invention provides a method for detecting Babesia annulata for non-diagnostic and therapeutic purposes, the method comprising: incubating the RPA reaction product, the crRNA described in the first aspect above, Cas13a protein, RNase inhibitor, reporter molecule, T7 RNA polymerase, NTP, and NTT isothermally; transferring the incubation product into a detection buffer, inserting a test strip, and observing the result after incubation; the RPA reaction product is amplified by the primer pair shown in SEQ ID NO.4 and 5.
[0021] Preferably, the reporter molecule is a single-stranded RNA containing at least 2 consecutive bases U, a fluorophore and a quencher.
[0022] Preferably, the reporter molecule is LF-PolyU, and its sequence is 5'-6-FAM-UUUUUUUUUUUUUU-Biotin-3'.
[0023] Preferably, the conditions for the isothermal incubation are:
[0024] Detection system: 5 μL of RPA reaction product; 1 μL of 10 μM crRNA; 1 μL of 166 μg / ml Cas13a protein; 2 μL of RNase inhibitor; 2 μL of LF-PolyU; 0.6 μL of T7 RNA polymerase Mix; 2.5 μL of NTP Buffer Mix; 2 μL of DTT (0.1 M); 33.9 μL of enzyme-free water;
[0025] Incubate the prepared system at 37 °C for 1 h.
[0026] Preferably, the crRNA is obtained by annealing and purifying the forward primer shown in SEQ ID NO.2 and the reverse primer shown in SEQ ID NO.3.
[0027] Preferably, the preparation method of the crRNA is as follows:
[0028] Dilute the forward primer shown in SEQ ID NO.2 and the reverse primer shown in SEQ ID NO.3 to 50 μM with enzyme-free sterile water. Operate according to the following annealing reaction system:
[0029] Enzyme-free water, 40 μL; DNA oligonucleotide annealing buffer (5×), 20 μL; forward primer (50 μM), 20 μL; reverse primer (50 μM), 20 μL;
[0030] According to the following annealing conditions of the PCR instrument:
[0031] Fully denature the oligo at 95 °C for 2 min; decrease by 0.1 °C every 8 s until it reaches 25 °C; briefly store at 4 °C;
[0032] Use 2% agarose nucleic acid gel electrophoresis, cut and recover the position with the brightest band;
[0033] Use the T7 transcription kit to transcribe the annealed DNA double strand into RNA, and prepare according to the following system:
[0034] Enzyme-free water, make up to 30 μL; NTP Buffer Mix, 10 μL; DNA template, 1 μg; DTT (0.1 M), 1.5 μL; T7 RNA Polymerase Mix, 2 μL;
[0035] Put the prepared system into a 37 °C constant temperature incubator and incubate overnight for 16 h;
[0036] Use DNase Ⅰ (from the T7 transcription kit) to remove the DNA template: add 30 μL of enzyme-free water to every 20 μL of the reaction, then add 2 μL of DNase Ⅰ and mix, incubate at 37 °C for 15 min;
[0037] Use an RNA purification kit to purify the RNA product according to the instructions, determine the concentration and place it at -80°C for later use.
[0038] The beneficial effects of the present invention are as follows: the present invention first provides a kit for differential diagnosis of bovine annular Theileria under constant temperature conditions; the kit includes RPA reaction product, crRNA, Cas13a protein, RNase inhibitor, reporter molecule, T7RNA polymerase, NTP, NTT, the RPA reaction product is amplified by the primer pair shown in SEQ ID NO.4 and 5, and the crRNA sequence is shown in SEQ ID NO.1; secondly, the present invention provides a visual detection method for differential diagnosis of bovine annular Theileria under constant temperature conditions, the method is: RPA reaction product, crRNA, Cas13a protein, RNase inhibitor, reporter molecule, T7RNA polymerase, NTP, NTT mixed isothermal incubation; the incubation product is transferred to the detection buffer, the test strip is inserted, and the result is observed after incubation. Among them, the present invention designs multiple groups of crRNA for the surface antigen of bovine annular Theileria sporozoites, of which only one group (shown in SEQ ID NO.1) of crRNA sequences is applied to the CRISPR / Cas13a detection system, which can be used for the specific detection of bovine annular Theileria. In summary, the detection method of the present invention is highly sensitive and highly specific, and can be used for the specific detection of Theileria annularis in cattle. BRIEF DESCRIPTION OF THE DRAWINGS
[0039] Figure 1 Test strip instructions;
[0040] Figure 2 Theileria annularis CRISPR / Cas13a specificity test results;
[0041] Figure 3 The CRISPR / Cas13a sensitivity test results of Theileria annularis, where 1 is the positive control of Theileria annularis; 2-12 are pET30a(+)-SPAG 1.42×10 9 -1.42×10 -1 ; 13 is the negative control. DETAILED DESCRIPTION
[0042] The present invention is described in detail below through specific embodiments, but the protection scope of the present invention is not limited to the following embodiments, and any technical solutions that can be thought of by any technician in the field based on the present invention and combined with the common knowledge in the field belong to the protection scope of the present invention.
[0043] The reagents used in the present invention include:
[0044] Reagents for expressing LwCas13a protein: Rosetta competent cells (TaKaRa); ampicillin 20 mg / ml; LB medium; IPTG 1 M / L; sterilized PBS (Boster Biological Technology); Binging Buffer (20 mM Tris-HCL, 500 mM NaCl, 10 mM imidazole); Eluent Buffer (20 mM Tris-HCL, 500 mM NaCl, 500 mM imidazole); Storage Buffer (50 mM Tris-HCL, 600 mM NaCl, 5% glycerol); dialysis bag (Solarbio); SUMO buffer (20 mM Tris-HCL, 500 mM NaCl, 0.15% IGEPAL CA-630, Sigma); SUMO enzyme (APE); 30 kDa ultrafiltration tube (Merck); BCA protein quantification kit (ThermoFisher); 10% SDS-PAGE Color Preparation kit (Sangon Biotech).
[0045] Reagents for preparing crRNA: DNA oligonucleotide annealing buffer (Beyotime); RNA purification kit (Sangon Biotech); enzyme-free and sterile water (Solarbio); agarose (Juhongmei); DL2000 Marker (TaKaRa); dithiothreitol (DTT) 0.1 M.
[0046] Construction of SPAG positive plasmid: pET30a(+).
[0047] Reagents required for RPA reaction: RPA Kit (TwistAMP).
[0048] Reagents required for CRISPR / Cas13a reaction: HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs); RNase inhibitor (mouse-derived, New England Biolabs); Milenia HybriDetect1 (TwistAMP).
[0049] Genomic extraction: M5 blood genomic extraction kit (Juhongmei); absolute ethanol (commercially available).
[0050] Example 1 Visual detection method for differential diagnosis of Theileria annulata in cattle under constant temperature conditions
[0051] 1. Obtaining of Lwcas13a protein
[0052] The Lwcas13a plasmid was transferred into Rosetta competent cells. After overnight culture at 37°C, the cells were inoculated into 400 ml of LB medium with ampicillin resistance at a ratio of 1:1000 and cultured at a constant temperature of 37°C. When the OD600 reached between 0.4 and 0.6, IPTG with a final concentration of 500 nM was added, and the cells were cultured at 18°C and 160 rpm for 20 h. Then, the cells were collected by centrifugation at 12,000 rpm for 10 min using a 4°C centrifuge. The cells were resuspended and washed twice with PBS, and then suspended with Binding Buffer. After ultrasonic disruption, the cells were centrifuged at 12,000 rpm for 30 min at 4°C, and the supernatant was collected. The supernatant was filtered through a 0.22 μm filter and bound to a nickel column overnight. After washing with Binding Buffer to remove impurities, the target protein was eluted with 300 mM Eluent Buffer. After determining that the eluate was the target protein by WB, the protein was dialyzed three times in SUMO enzyme buffer for 1 h each time, with 330 ml of buffer used each time. Then, the dialyzed protein was digested with SUMO enzyme overnight. Next, a 30 kDa ultrafiltration tube was used, and the centrifuge was pre-cooled to 4°C and 3500 rpm. When the volume was concentrated to approximately 200 μL, 500 μL of Storage Buffer was added, and the volume was concentrated to 200 μL again. The protein was aliquoted and stored in an -80°C refrigerator, and the protein concentration was determined using BCA.
[0053] 2. Extract genomic DNA from blood
[0054] Operate according to the instructions, and the extracted genomic DNA is stored at -20°C for later use.
[0055] 3. Design and synthesize specific primers based on the nucleotide sequence of Theileria annulata sporozoite surface antigen (SPAG)
[0056] Theileria annulata upstream primer (SPAG-RPA-F): 5’- TAATACGACTCACTATAGGG ATTTAATTCAATAGGGTTAGGTTTCAAAATAGC-3’ (the underlined part is the T7 promoter), as shown in SEQ ID NO.4;
[0057] Theileria annulata downstream primer (SPAG-RPA-R): 5’-TGATTATTTCTGAGATTTTGACTATAAATGCTG-3’, as shown in SEQ ID NO.5;
[0058] crRNA (SPAG-crRNA): 5'-GAAAUUAAUACGACUCACUAUAGGG (T7 promoter) GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC (Cas13a protein anchoring sequence) AAAUCAUCUCCAAAAUUCUUUAGUUUUAUCAGG (target sequence)-3', as shown in SEQ ID NO.1;
[0059] crRNA upstream primer (SPAG-crRNA-F): 5'- GAAATTAATACGACTCACTATAGGG GATTTAGACTACCCCAAAAACGAAGGGGACTAAAACAAATCATCTCCAAAATTCTTTAGTTTTATCAGG-3' (underlined is the T7 promoter), as shown in SEQ ID NO.2;
[0060] crRNA downstream primer (SPAG-crRNA-R): 5'-CCTGATAAAACTAAAGAATTTTGGAGATGATTTGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC-3', as shown in SQE ID NO.3;
[0061] Reporter molecule (LF-PolyU): 5'-6-FAM-UUUUUUUUUUUUUU-Biotin-3'.
[0062] 4. The preparation method of crRNA is as follows:
[0063] (1) Dilute the crRNA upstream primer and the crRNA downstream primer with enzyme-free and sterile water to 50 μM;
[0064] (2) Operate according to the following annealing reaction system:
[0065] Enzyme-free water, 40 μL;
[0066] DNA oligonucleotide annealing buffer (5×), 20 μL;
[0067] Forward primer (50 μM), 20 μL;
[0068] Reverse primer (50 μM), 20 μL;
[0069] (3) According to the following annealing conditions of the PCR instrument:
[0070] 95°C for 2 min for full denaturation of Oligo;
[0071] Decrease by 0.1 °C every 8 s until it reaches 25 °C;
[0072] Store briefly at 4 °C;
[0073] (4) Use 2% agarose nucleic acid gel electrophoresis and cut and recover the brightest band position;
[0074] (5) Use the T7 transcription kit to transcribe the annealed DNA double strand into RNA and prepare the system as follows:
[0075] Nuclease-free water to make up to 30 μL;
[0076] NTP Buffer Mix, 10 μL;
[0077] DNA template, 1 μg;
[0078] DTT (0.1 M), 1.5 μL;
[0079] T7 RNAPolymerase Mix, 2 μL;
[0080] Put the prepared system into a 37 °C constant temperature incubator and incubate overnight for 16 h;
[0081] (6) Use DNase Ⅰ (from the T7 transcription kit) to remove the DNA template: Add 30 μL of nuclease-free water to every 20 μL of reaction, then add 2 μL of DNase Ⅰ and mix, incubate at 37 °C for 15 min;
[0082] (7) Use the RNA purification kit to purify the RNA product according to the instructions in the manual, measure the concentration and store it at -80 °C for later use.
[0083] 5. Preparation of the RPA reaction product
[0084] The RPA reaction system and procedure are as follows:
[0085] Upstream primer of Theileria annulata (10 μM), 2.4 μl;
[0086] Downstream primer of Theileria annulata (10 μM), 2.4 μl;
[0087] Primer Free Rehydration Buffer, 29.5 μl;
[0088] Genomic DNA, 1 μl;
[0089] Make up to 47.5 μl with nuclease-free water;
[0090] Add the above substances into the dry powder tube provided with the RPA kit, mix well, then add 2.5 μL of 280 mM MgOAc to the tube cap, and react immediately at 37 °C for 20 min after centrifugation.
[0091] 6. CRISPR / Cas13a Detection Method
[0092] Detection system: 5 μL of RPA reaction product; 1 μL of crRNA 10 μM; 1 μL of Cas13a protein 166 μg / ml; 2 μL of RNase inhibitor; 2 μL of LF-PolyU; 0.6 μL of T7 RNA polymerase Mix; 2.5 μL of NTP Buffer Mix; 2 μL of DTT (0.1 M); 33.9 μL of enzyme-free water;
[0093] Incubate the prepared system at 37 °C for 1 h.
[0094] 7. Observe the results on the strip (using Milenia HybriDetect 1):
[0095] Transfer 20 μL of the reaction product, add it to 100 μL of Dipstick Assay Buffer, insert the test strip and incubate for 3 - 5 min to observe the results. Among them, the instructions for the test strip are as Figure 1 shown.
[0096] 8. Specificity test
[0097] Use the above-established system to amplify the genomes of Theileria annulata, Theileria sergenti, Theileria sinensis, Babesia bovis, Babesia bigemina, and negative bovine blood. The results are as Figure 2 shown. Except for Theileria annulata, no positive bands appeared in the genomes of Theileria sergenti, Theileria sinensis, Babesia bovis, Babesia bigemina, and negative bovine blood, indicating that the method described in this application can specifically detect Theileria annulata in cattle.
[0098] 9. Sensitivity test
[0099] After measuring the concentration of the constructed pET30a(+)-SPAG plasmid, the copy number was calculated to be 1.42×10 10 copies / μL and diluted 10-fold to 1.42×10 -1 copies / μL. Use the established CRISPR / Cas13a visual detection method to measure the sensitivity of this method. The results are as Figure 3 shown. The visually observed detection limit is 1.42×10 0 copies / μL.
[0100] 10. Sample detection
[0101] The established CRISPR / Cas13a visualization detection method was used to detect 30 collected blood samples, and 76.67% (23 / 30) of the samples were positive.
[0102] Twenty (20 / 30) positive samples were detected by the national standard PCR method, and the detection rate was 66.67%.
[0103] In summary, the present invention designed multiple groups of crRNAs for the surface antigen of Theileria annulata sporozoites. Only one group of crRNA sequences (shown in SEQ ID NO.1) was applied to the CRISPR / Cas13a detection system, which can be used for the specific detection of Theileria annulata, with high sensitivity and high specificity, and can be used for the specific detection of Theileria annulata.
[0104] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.
Claims
1. A crRNA specifically targeting the surface antigen of Theileria annulata sporozoites for the CRISPR-Cas13a system, characterized in that, The crRNA sequence is as shown in SEQ ID NO.
1.
2. A primer pair for amplifying the crRNA described in claim 1, characterized in that, The primer pair includes a forward primer and a reverse primer. The nucleotide sequence of the forward primer is as shown in SEQ ID NO.2; the nucleotide sequence of the reverse primer is as shown in SEQ ID NO.
3.
3. A kit for differential diagnosis of Theileria annulata in cattle under constant temperature conditions, characterized in that, The kit includes an RPA reaction product, the crRNA described in claim 1, Cas13a protein, RNase inhibitor, reporter molecule, T7 RNA polymerase, NTP, NTT; the RPA reaction product is obtained by amplification with the primer pair shown in SEQ ID NO.4 and 5.
4. The kit according to claim 3, wherein The reporter molecule is a single-stranded RNA containing at least 2 consecutive bases U, a fluorescent group, and a quenching group.
5. The kit according to claim 4, wherein The sequence of the reporter molecule is 5’-6-FAM-UUUUUUUUUUUUUU-Biotin-3’.
6. Use of the kit according to any one of claims 3-4 in the detection of Babesia annulata for non-diagnostic and therapeutic purposes.
7. A detection method for Theileria annulata of non-diagnostic and therapeutic purposes, characterized in that, The method includes: mixing and incubating isothermally the RPA reaction product, the crRNA described in claim 1, Cas13a protein, RNase inhibitor, reporter molecule, T7 RNA polymerase, NTP, NTT; transferring the incubation product into a detection buffer, inserting a test strip, and observing the result after incubation; the RPA reaction product is obtained by amplification with the primer pair shown in SEQ ID NO.4 and 5.
8. The detection method according to claim 7, wherein The reporter molecule is LF-PolyU, and its sequence is 5’-6-FAM-UUUUUUUUUUUUUU-Biotin-3’.
9. The detection method according to claim 8, characterized in that The conditions for the isothermal incubation are as follows: Detection system: RPA reaction product, 5 μL; crRNA 10 μM, 1 μL; Cas13a protein 166 μg / ml, 1 μL; RNase inhibitor, 2 μL; LF-PolyU, 2 μL; T7 RNA polymerase Mix, 0.6 μL; NTP Buffer Mix, 2.5 μL; DTT (0.1 M), 2 μL; enzyme-free water, 33.9 μL; incubate the prepared system at 37 °C for 1 h.
10. The detection method according to claim 9, characterized in that, The crRNA is obtained by annealing and purification with the forward primer shown in SEQ ID NO.2 and the reverse primer shown in SEQ ID NO.3.
Citation Information
Patent Citations
Kit and method for identifying and diagnosing bovine theileria annulata
CN101974639A
On-site visual kit for detecting listeria monocytogenes based on SHERLOCK and application
CN114075607A
Kit and method for visually detecting trichomonas vaginalis based on RPA-CRISPR-Cas12a system
CN114774565A
Optimized SHERLOCK nucleic acid detection technology and application of optimized SHERLOCK nucleic acid detection technology in influenza A H1N1 virus detection
CN116004908A
Method for detecting grass carp reovirus by using test strip, CRISPR-Cas13a system and application of CRISPR-Cas13a system
CN116426695A