CRISPR-Cas13a-based crRNA sequence for detecting drug-resistant gene mexX of pseudomonas aeruginosa and application of crRNA sequence

Abstract

The invention discloses a crRNA sequence for detecting a drug-resistant gene mexX of pseudomonas aeruginosa based on CRISPR-Cas13a and an application of the crRNA sequence. A naked eye visible, sensitive and specific pseudomonas aeruginosa drug resistance gene rapid detection system based on an RPA-CRISPR / Cas13a system is established, a complex temperature control instrument is not needed in the whole reaction process of the system, isothermal amplification only needs to be performed at 39 DEG C, fluorescence detection equipment can be used for detection, a result can be directly observed by naked eyes, the LOD of the one-step method RPA-Cas13a is 10aM, and the LOD of the one-step method RPA-Cas13a is 10aM. The LOD of the two-step method RPA-Cas13a is 1aM, the two-step method RPA-Cas13a has no cross reaction with other pathogenic bacteria and is high in specificity, and the LOD of the two-step method RPA-Cas13a lateral flow reagent strip is 10fM, so that the two-step method RPA-Cas13a lateral flow reagent strip is suitable for field detection of the pseudomonas aeruginosa drug-resistant gene.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial detection, and particularly relates to a nucleic acid detection method for the Pseudomonas aeruginosa drug resistance gene mexX based on the CRISPR-Cas13a system, including the design and application of RPA primer pairs and crRNAs. Background Art

[0002] Pseudomonas aeruginosa is a conditional pathogen widely present in the natural environment, especially likely to cause severe infections such as pneumonia, urinary tract infections, and sepsis in the hospital environment. This bacterium has natural resistance to a variety of antibiotics, and its drug resistance is mainly mediated by efflux pump systems (such as the protein encoded by the mexX gene), resulting in increased clinical treatment difficulty. In addition, Pseudomonas aeruginosa is also an important foodborne pathogen, often spreading through contaminated water sources, food processing equipment, and food itself, causing foodborne diseases and posing a threat to public health safety.

[0003] Currently, the detection methods for Pseudomonas aeruginosa mainly include traditional culture methods, polymerase chain reaction (PCR), real-time fluorescence quantitative PCR (qRT-PCR), etc. However, these methods have disadvantages such as complex operations, long time consumption, and the need for expensive instrument equipment. Especially in areas with limited resources, it is difficult to achieve rapid and accurate detection. In recent years, the CRISPR system has shown great potential in the fields of gene editing and nucleic acid detection. Especially the CRISPR-Cas13a system, which has RNA-targeted cleavage activity and can be combined with isothermal amplification techniques (such as RPA) to achieve highly sensitive nucleic acid detection. Therefore, developing a detection method for Pseudomonas aeruginosa drug resistance genes based on the CRISPR-Cas13a system has important application value. Summary of the Invention

[0004] In order to obtain a Pseudomonas aeruginosa drug resistance gene detection system with simple, rapid, and suitable for on-site detection, strong specificity, high detection sensitivity, and high accuracy, the present invention provides a crRNA sequence for detecting the Pseudomonas aeruginosa drug resistance gene mexX based on CRISPR-Cas13a and its application.

[0005] To solve the above technical problems, the technical solution of the present invention is as follows:

[0006] In the first aspect, the present invention provides an RPA primer pair for amplifying the Pseudomonas aeruginosa drug resistance gene mexX using a CRISPR-Cas13a detection system, specifically including a primer pair composed of RPA-F and RPA-R, and the sequences are as shown in SEQ ID NO.1-2:

[0007] RPA-F: TAATACGACTCACTATAGGGCATCCAATGGACCGGCTCGCTGCGCGGGCT;

[0008] RPA-R: CTTCCAGGCGTCCGGGCAGCTCGCTGGTGATG.

[0009] In a second aspect, the present invention also provides a crRNA for detecting the Pseudomonas aeruginosa drug resistance gene mexX using a CRISPR-Cas13a detection system, specifically including any one of the following 10 crRNAs, and the sequences are shown in SEQ ID NO. 3-12:

[0010] crRNA1: ATCGATCCGATCTACGTGAACTT;

[0011] crRNA2: GAAGTTCACGTAGATCGGATCGA;

[0012] crRNA3: GCGACACCCTTCACCTGGCCTTC;

[0013] crRNA4: TCCACGTCTTCCACCACGCCCTG;

[0014] crRNA5: CCACGTCTTCCACCACGCCCTGT;

[0015] crRNA6: GATGATCCAGTCACGGCCCTGCA;

[0016] crRNA7: CCAGCAGGAATAGGGCGACCAGG;

[0017] crRNA8: CTGATGATCCAGTCACGGCCCTG;

[0018] crRNA9: TGATGATCCAGTCACGGCCCTGC;

[0019] crRNA10: ATGATCCAGTCACGGCCCTGCAG.

[0020] Preferably, the said crRNA, preferably crRNA7, is applied to detect the Pseudomonas aeruginosa drug resistance gene mexX.

[0021] By screening the best crRNA through the visual effect of the fluorescence signal reaction of the RPA primer pair in combination with different crRNAs, it is found that the combination of the primer pair RPA-F / R and crRNA7 has the best fluorescence signal effect, and the negative control is established.

[0022] In a third aspect, the present invention also provides the use of the above-mentioned RPA primer pair or crRNA in the preparation of a reagent for detecting the Pseudomonas aeruginosa drug resistance gene mexX.

[0023] In a fourth aspect, the present invention also provides a CRISPR-Cas13a detection kit for Pseudomonas aeruginosa drug resistance genes, specifically including: an RPA primer pair, crRNA, Cas13a protein, NTP buffer mix, T7 RNA polymerase mixture, RNase inhibitor, and RNA reporter factor.

[0024] Preferably, the Cas13a protein used in the kit is LwCas13a.

[0025] Preferably, the RNA reporter probe consists of a fluorophore and a quencher group; the fluorophore includes FAM, and the quencher group includes BHQ1 or biotin.

[0026] In a fifth aspect, the present invention provides the use of the above-mentioned kit for detecting Pseudomonas aeruginosa for non-disease diagnosis and treatment purposes.

[0027] In a sixth aspect, the present invention provides a method for detecting the Pseudomonas aeruginosa drug resistance gene mexX based on the CRISPR / Cas13a system, including the following steps:

[0028] One-step method: Simultaneously perform RPA amplification and Cas13a cleavage of the RNA reporter factor. The specific steps are as follows: Mix the test sample, RPA primer pair, Cas13a protein, crRNA, RNA reporter factor, and RPA reaction buffer in the same reaction system for reaction. While the RPA amplifies the target nucleic acid sequence, the Cas13a protein cleaves the RNA reporter factor under the guidance of crRNA; Observe the reaction result through a fluorescence detection device. The appearance of a fluorescence signal indicates the presence of the target pathogen.

[0029] Or two-step method: First perform RPA amplification and then perform Cas13a cleavage of the RNA reporter factor. The specific steps are as follows: Mix the test sample with the RPA primer pair and RPA reaction buffer for RPA amplification reaction; After mixing the RPA amplification product with Cas13a protein, crRNA, and RNA reporter factor, perform Cas13a cleavage reaction; Observe the reaction result through a fluorescence detection device or the naked eye. The appearance of a fluorescence signal or color reaction indicates the presence of the target pathogen.

[0030] Preferably, the optimal reaction conditions for the one-step method are: reaction temperature 39°C, primer concentration 0.4 μM, LwCas13 concentration 16 nM, and crRNA concentration 36 nM.

[0031] Preferably, the optimal reaction conditions for the two-step method are: reaction temperature 39°C, primer concentration 0.2 μM, LwCas13a concentration 16 nM, and crRNA concentration 24 nM.

[0032] In summary, the present invention has the following beneficial effects:

[0033] 1. The present invention has established a method for detecting the Pseudomonas aeruginosa drug resistance gene mexX based on the CRISPR-Cas13a system, which can perform isothermal detection at 39°C, is suitable for fluorescence reading, the lowest detection limit of the one-step RPA-Cas13a is 10 aM, and the lowest detection limit of the two-step RPA-Cas13a is 1 aM. It has high sensitivity and strong specificity, and has no cross-reaction with other pathogenic bacteria.

[0034] 2. The present invention has established a rapid detection system for the Pseudomonas aeruginosa drug resistance gene based on the CRISPR-Cas13a lateral flow detection system, which can visually detect the nucleic acid in the actual sample, and the lowest detection limit of this detection system is 10 fM.

[0035] 3. The present invention provides a visually observable, sensitive and specific detection system for the Pseudomonas aeruginosa drug resistance gene based on the CRISPR-Cas13a system. This system provides technical support for the early detection of the Pseudomonas aeruginosa drug resistance gene and the later epidemiological investigation, and has important guiding significance for the prevention and control of this disease. Description of the Drawings

[0036] Figure 1 It is the screening of crRNA for the RPA-Cas13a detection system. A. One-step method; B. Two-step method; Different lowercase letters represent significant differences (p < 0.05).

[0037] Figure 2 It is the optimization result of the one-step reaction conditions. A. Temperature; B. Primer concentration; C. Cas13a concentration; D. crRNA concentration; Different lowercase letters represent significant differences (p < 0.05).

[0038] Figure 3 It is the optimization result of the two-step reaction conditions. A. Temperature; B. Primer concentration; C. Cas13a concentration; D. crRNA concentration; Different lowercase letters represent significant differences (p < 0.05).

[0039] Figure 4 It is the sensitivity detection result of different detection methods. A. One-step method; B. Two-step method; C. qRT-PCR; 10<< 2 -10 -7(pM) represents the DNA concentration of the sample; NC, negative control. Different lowercase letters represent significant differences (p < 0.05).

[0040] Figure 5 are the specific detection results of different detection methods. A. One-step method; B. Two-step method; C. qRT-PCR; NC, negative control. Different lowercase letters represent significant differences (p < 0.05).

[0041] Figure 6 are the sample consistency detection results of different detection methods. A. One-step method; B. Two-step method; C. qRT-PCR; D. PCR; M: DNA Marker III (from bottom to top: 200bp, 500bp, 800bp, 1200bp, 2000bp, 3000bp, and 4500bp); NC: negative control.

[0042] Figure 7 are the sensitivity detection results of the two-step method combined with the lateral flow test strip detection method. NC = negative control; T = test line; C = control line; from left to right, the template concentrations are 100 pM, 10 pM, 1 pM, 100 fM, 10 fM, 1 fM, and NC negative control (the template is RNase-free ddH2O). Specific Embodiments

[0043] The following examples are further illustrations of the present invention, rather than limitations thereof.

[0044] The present invention will be further described below in conjunction with examples. For those not specifically noted in the following examples regarding experimental steps or conditions, unless otherwise specified, they are all carried out according to the conventional experimental steps or conditions described in the literature in this field; for the experimental reagents and consumables described in the following examples, unless otherwise specified, they are all from conventional biochemical reagent companies.

[0045] Unless otherwise stated, the embodiments of the present invention will adopt traditional technologies in the fields such as molecular biology within the capabilities of those skilled in the art.

[0046] Example 1: Construction of DNA Template

[0047] 1. Strains

[0048] Strains such as Pseudomonas aeruginosa ATCC 9027 are preserved in the laboratory of the present inventors.

[0049] 2. Preparation of Gene Fragment Standards

[0050] Extract the whole genome of Pseudomonas aeruginosa ATCC 9027 according to the instructions of the bacterial DNA extraction kit. Using the extracted genome as a template, perform PCR amplification of the gene fragment with primers mexX-F: GCGGAAGGTCAGGGTCAG and mexX-R: GTCTTCTGGGATTCCTCTTTG.

[0051] The reaction system is as follows:

[0052]

[0053] The reaction conditions are as follows:

[0054]

[0055] Perform conventional PCR amplification of the mexX gene of Pseudomonas aeruginosa using primers mexX-F and mexX-R to obtain a single band with a length of 1688 bp (the product sequence is shown in SEQ ID NO. 13). After the product is recovered and purified by gel, it is cloned and sequenced, and the result is completely consistent with the expectation. Determine the concentration of the gene fragment and use it as a standard for the CRISPR-Cas13a visual detection method, and store it at -80 °C for later use.

[0056] >SEQ ID NO:13

[0057]

[0058] Example 2: Design and Screening of RPA Primers and crRNAs

[0059] 1. Design of RPA Primers and crRNAs

[0060] The RPA primers were designed using the primer 5.0 primer design software to obtain the RPA primers (Table 1). The crRNAs were designed using the online crRNA design website (https: / / cas13design.nygenome.org / ). Through the optimization of subsequent experimental conditions, a pair of RPA primers and their corresponding crRNA were finally selected as the common primers and sequences.

[0061] Table 1 RPA Primers, crRNAs, and RNA Probes Used in the Present Invention

[0062]

[0063] Note: The underlines indicate the T7 promoter

[0064] 2. Synthesis of crRNAs

[0065] The designed crRNAs were prepared by in vitro transcription. First, during the design, the T7 promoter sequence was added to the 5' end of the primers. Preparation of the dsDNA template: 10 μM of the forward (such as mexX-crRNA1-F) and reverse (such as mexX-crRNA1-R) oligonucleotide DNAs were added in equal volumes and heated at 95 °C for 5 min, and then naturally cooled to room temperature.

[0066] In vitro transcription: The above dsDNA template was incubated with T7 RNA polymerase at 42 °C for 2 h for the transcription to generate crRNAs. The transcription reaction system is shown in Table 2. The synthesized crRNAs were treated with DNase I at 37 °C for 1 h to remove the DNA template, and then purified according to the instructions of the RNA Quick Concentration and Purification Kit. Concentration determination: The concentration of the crRNAs was measured using a NanoDrop spectrophotometer and then stored at -80 °C until use.

[0067] Table 2 Transcription Reaction System

[0068]

[0069] 3. Recombinase Polymerase Amplification (RPA)

[0070] First, operate according to the DNA isothermal rapid amplification kit system. The 50 μL RPA reaction system: 20 μL C buffer, 5 μL L buffer, 12 μL P-core, 2 μL forward primer (10 μM), 2 μL reverse primer (10 μM), 1.5 μL dNTPs (10 mM), 1 μL target DNA template, and 4 μL RNase-free ddH2O. Gently swirl to mix the reactants. Then add 2.5 μL MgOAc (280 mM), mix well, and react at 39 °C for 30 min.

[0071] 4. Cas13a protein reaction system

[0072] Use 5 μL 10× reaction buffer, 2 μL NTP mix (25 mM), 0.8 μL recombinant RNase inhibitor (40 U / μL), 1 μL crRNA (12 nM), 1 μL RNA probe (10 μM), 0.6 μL T7 RNA polymerase (50 U / μL), 0.4 μL LwCas13a (2 μM), 4 μL RPA product, add RNase-free ddH2O to 50 μL to establish a 50 μL reaction system. After mixing well, react at 39 °C for 20 min. Use QuantStudio TM Real-Time PCR program or a microplate reader to collect fluorescence signals every 1 min. Set 3 replicates for each sample.

[0073] 5. crRNA screening

[0074] To ensure the good activity of the Cas13a protein, 10 candidate crRNA sequences were obtained using the online Cas13 design tool (https: / / cas13design.nygenome.org / ). At the same time, according to the conserved sequence characteristics of the target region, appropriate RPA isothermal amplification primers were designed to match the selected crRNA. Based on the DNA samples extracted in the same batch, a CRISPR-Cas13a detection system containing different crRNAs was constructed, and its detection efficiency was tested. Record the end-point fluorescence values for comparison.

[0075] By observing Figure 1 the fluorescence signal reactor effects of the 10 crRNAs in Figure 1 to screen out the best crRNA. The results are as shown in Figure 1 in A) of the one-step method ( Figure 1 and B) of the two-step method (

[0076] Table 3 RPA primer pairs and specific crRNA sequences determined after screening and other sequences applied in the present invention

[0077]

[0078]

[0079] Example 3: Optimization of reaction conditions

[0080] Based on the RPA-Cas13a detection system, the fluorescence value was selected as the comparison index. The samples in the optimization process were DNA samples with the same initial concentration. To finely optimize the detection efficiency, a single-variable experiment was set up to optimize the following parameters: reaction temperature (37, 38, 39, 40, and 41 °C), primer concentration (0.1 - 0.6 μM), LwCas13a concentration (0 - 40 nM), and crRNA concentration (0 - 48 nM).

[0081] The detection results are as Figures 2-3 shown. For the one-step RPA-Cas13a detection method, the optimal reaction conditions are: reaction temperature 39 °C, primer concentration 0.4 μM, LwCas13 concentration 16 nM, and crRNA concentration 36 nM. For the two-step RPA-Cas13a reaction system, the optimal reaction conditions are: reaction temperature 39 °C, primer concentration 0.2 μM, LwCas13a concentration 16 nM, and crRNA concentration 24 nM.

[0082] Example 4: Sensitivity and specificity of RPA-Cas13a

[0083] To evaluate and compare the limit of detection (LOD) and specificity of the two detection methods, the nucleic acid samples extracted were used as templates. The initial DNA concentration was adjusted to 100 pM and diluted by 10-fold serial dilution. These serially diluted dsDNA samples were tested using the optimized one-step and two-step RPA-Cas13a detection techniques. At the same time, a blank control was set up, and an equal amount of RNase-free ddH2O was tested. During this process, qRT-PCR was used as a reference standard to ensure the reliability and accuracy of the detection results.

[0084] The DNA template was serially diluted 10-fold to detect the sensitivity of the method. The detection results are as Figure 4As shown, the lowest detection limit of the detection system is as follows: the LOD of one-step RPA-Cas13a is 10 aM, and the LOD of two-step RPA-Cas13a is 1 aM. At the same time, the traditional qRT-PCR method shows a higher LOD of 100 aM, indicating that the method of the present invention has high detection sensitivity for Pseudomonas aeruginosa genome.

[0085] Extract the genomic nucleic acid of Pseudomonas aeruginosa using a DNA extraction kit. Perform nucleic acid pre-amplification experiments using the above-mentioned Pseudomonas aeruginosa genome as a template and use the established detection method for CRISPR-Cas13a fluorescence detection method and lateral flow reagent strip detection. At the same time, set up negative controls to verify the specificity of the method. The detection results are as Figure 5 shown. Positive results only appear on the test strips for detecting Pseudomonas aeruginosa, and the controls for detecting other strains are all judged as negative. The results prove that the detection method established in the present invention has good specificity. The bacterial strains used in the present invention include Pseudomonas aeruginosa isolated by the laboratory itself, standard strain Staphylococcus aureus ATCC 6538P, Escherichia coli ATCC 8739, Vibrio parahaemolyticus ATCC17802, Salmonella ATCC 9115, Klebsiella pneumoniae ATCC 4352, Lactobacillus paracasei ATCC 334, Bacillus subtilis ATCC 9945, and Bacillus subtilis DSM 23778.

[0086] Example 5: Detection performance of RPA-Cas13a for actual Pseudomonas aeruginosa samples

[0087] To evaluate the effectiveness of one-step and two-step RPA-Cas13a detection methods for detecting Pseudomonas aeruginosa in actual samples, one-step and two-step RPA-Cas13a methods were used to detect actual samples of Pseudomonas aeruginosa isolated from industrial products. The detection results are as Figure 6 shown. In the detection of the mexX target gene, whether using the one-step method or the two-step method, all 38 samples showed positive results. At the same time, comparing the detection results of qRT-PCR and conventional PCR, the two showed the same results as the RPA-Cas13a detection method in the actual detection of Pseudomonas aeruginosa samples.

[0088] Example 6: Establishment of Cas13a test strip detection method

[0089] The LwCas13a protein interacts with crRNA and together they assemble to form a complex, thereby activating the function of the LwCas13a endonuclease, enabling it to efficiently cleave surrounding single-stranded RNA molecules, including the ssRNA reporter molecule we specifically designed. The 5'-end of this reporter molecule is linked to a fluorescein (FAM) reporter group, and the 3'-end is linked to a biotin group. The complete reporter molecule is denoted as 5'-FAM-20U-Biotin-3'. The principle of this detection technique is as follows: When the sample flows on the lateral flow strip, the reporter molecule 5'-FAM-Biotin-3' binds to anti-FAM gold nanoparticles. If LwCas13a does not cleave the reporter molecule, 5'-FAM-3'Biotin-anti-FAM-gold-NP will be captured by streptavidin, thereby forming the first band, namely the C line; if cleavage occurs, 5'-FAM-anti-FAM-gold-NP will bind to the secondary antibody, generating the second band, that is, the T line. Whether the C line and T line appear or not can visually determine the presence of the target gene, thereby achieving visual detection of the target gene. Generally, a negative sample will only show one C line, while a positive sample will show two bands, the T line and the C line. In order to evaluate whether the RPA-Cas13a detection method constructed in this invention can directly observe the detection results by means of a commercial lateral flow detection (LFD) technique, it is expected to develop a more practical and better visualized RPA-Cas13a-LFD detection method. For this purpose, relevant experiments were carried out to analyze the detection situation at different template concentrations. Specifically, we used the extracted nucleic acid sample as the template to conduct the experiment. The initial concentration of DNA was set at 100 pM and serially diluted 10-fold, and then the optimized two-step RPA-Cas13a detection technique was used for detection. During the detection, a FAM-biotin-labeled reporter gene was used to replace the fluorescent reporter molecule, and a blank control group was set up, using an equal amount of RNase-free ddH2O for detection. The entire reaction was carried out at 39 °C for 30 minutes, and then the lateral flow strip was inserted into the reaction tube and incubated at room temperature for 5 minutes, and finally the detection results were recorded.

[0090] The experimental results showed that when the template concentrations were 100 pM, 10 pM, 1 pM, and 100 fM respectively, double bands were presented; at a template concentration of 10 fM, relatively faint double bands appeared; while when the template concentration was 1 fM and as a negative control (template was Rnase-free ddH2O), no bands appeared ( Figure 7) Based on the above experimental data, the limit of detection (LOD) of the two-step RPA-Cas13a-LFD detection method was determined to be 10 fM. This result strongly demonstrates that the commercial LFD technology can effectively identify the detection results of RPA-Cas13a, providing an important basis for the practical application of this detection method.

[0091] In summary, the present invention discloses a CRISPR-Cas13a system for the mexX gene of Pseudomonas aeruginosa, as well as RPA primer pairs and crRNAs. Based on the designed RPA primer pairs and specific crRNAs, the present invention establishes a visual, sensitive, and specific detection system for Pseudomonas aeruginosa drug resistance genes based on a CRISPR-Cas13a diagnostic platform. Different from the previous detection techniques based on PCR technology, the detection system of the present invention does not require complex temperature control instruments throughout the reaction process. It only needs to perform isothermal detection at 39°C and can be used for fluorescence reading or visual reading. The lowest detection limit of the detection system is as follows: the LOD of one-step RPA-Cas13a is 10 aM, the LOD of two-step RPA-Cas13a is 1 aM, and there is no cross-reaction with other pathogenic bacteria, showing strong specificity. The LOD of the two-step RPA-Cas13a lateral flow reagent strip is 10 fM. The detection operation of the present invention is simple, rapid, suitable for on-site detection, with strong specificity, high detection sensitivity, high accuracy, and reliable results.

[0092] This specific embodiment is only an interpretation of the present invention and not a limitation thereof. After reading this specification, those skilled in the art can make modifications to this embodiment without creative contributions as needed, but as long as they are within the scope of the claims of the present invention, they are protected by the patent law.

Claims

1. An RPA primer pair for amplifying the Pseudomonas aeruginosa drug resistance gene mexX using a CRISPR-Cas13a detection system, characterized in that, The primer pair is RPA-F / R, and its nucleotide sequence is: RPA-F: TAATACGACTCACTATAGGGCATCCAATGGACCGGCTCGCTGCGCGGGCT; RPA-R: CTTCCAGGCGTCCGGGCAGCTCGCTGGTGATG.

2. A crRNA for detecting the drug-resistant gene mexX of Pseudomonas aeruginosa using a CRISPR-Cas13a detection system, characterized in that, The crRNA is any one of crRNA1, crRNA2, crRNA3, crRNA4, crRNA5, crRNA6, crRNA7, crRNA8, crRNA9, and crRNA10, and its nucleotide sequence is: crRNA1: ATCGATCCGATCTACGTGAACTT; crRNA2: GAAGTTCACGTAGATCGGATCGA; crRNA3: GCGACACCCTTCACCTGGCCTTC; crRNA4: TCCACGTCTTCCACCACGCCCTG; crRNA5: CCACGTCTTCCACCACGCCCTGT; crRNA6: GATGATCCAGTCACGGCCCTGCA; crRNA7: CCAGCAGGAATAGGGCGACCAGG; crRNA8: CTGATGATCCAGTCACGGCCCTG; crRNA9: TGATGATCCAGTCACGGCCCTGC; crRNA10: ATGATCCAGTCACGGCCCTGCAG.

3. Use of the RPA primer pair according to claim 1 or the crRNA according to claim 2 in the preparation of a reagent for detecting the Pseudomonas aeruginosa drug resistance gene mexX.

4. A detection kit for Pseudomonas aeruginosa drug resistance genes, characterized in that, The kit includes the RPA primer pair according to claim 1, the crRNA according to claim 2, Cas13a protein, NTP buffer mix, T7 RNA polymerase mixture, RNase inhibitor, and RNA reporter factor.

5. The detection kit according to claim 4, characterized in that, The Cas13a protein used in the kit is LwCas13a.

6. The detection kit according to claim 4, wherein The RNA reporter probe consists of a fluorophore and a quencher group; the fluorophore includes FAM, and the quencher group includes BHQ1 or biotin.

7. Use of the kit according to claim 4 for detecting Pseudomonas aeruginosa for non-disease diagnosis and treatment purposes.

8. A method for detecting the Pseudomonas aeruginosa drug resistance gene mexX based on the CRISPR / Cas13a system, characterized in that, Including the following steps: One-step method: Simultaneously perform RPA amplification and Cas13a cleavage of the RNA reporter factor. The specific steps are as follows: Mix the test sample, RPA primer pair, Cas13a protein, crRNA, RNA reporter factor, and RPA reaction buffer in the same reaction system for reaction. While RPA amplifies the target nucleic acid sequence, the Cas13a protein cleaves the RNA reporter factor under the guidance of crRNA; Observe the reaction result through a fluorescence detection device, and the appearance of a fluorescence signal indicates the presence of the target pathogen; Or the two-step method: First, perform RPA amplification and then perform Cas13a cleavage of the RNA reporter factor. The specific steps are as follows: Mix the sample to be tested with the RPA primer pair and the RPA reaction buffer for RPA amplification reaction; After mixing the RPA amplification product with Cas13a protein, crRNA, and RNA reporter factor, perform Cas13a cleavage reaction; Detect the reaction result through a fluorescence detection device or by naked eye observation. The appearance of a fluorescence signal or a color reaction indicates the presence of the target pathogen.

9. The detection method according to claim 8, wherein The optimal reaction conditions for the one-step method are: reaction temperature 39°C, primer concentration 0.4 μM, LwCas13 concentration 16 nM, and crRNA concentration 36 nM.

10. The detection method according to claim 8, characterized in that, The optimal reaction conditions for the two-step method are: reaction temperature 39°C, primer concentration 0.2 μM, LwCas13a concentration 16 nM, and crRNA concentration 24 nM.

Images