Bacteria secreting interleukin-10
Patent Information
- Application Number
- CN202380090519.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-01-03
- Filing Date
- 2023-12-29
- Publication Date
- 2025-08-12
AI Technical Summary
Existing tumor bacterial therapies have poor stability and safety issues, making it difficult to balance therapeutic efficacy and safety. Moreover, bacteria cannot effectively secrete interleukin-10 outside the cells, affecting their anti-tumor effects.
The fusion polypeptide is constructed by connecting the amino acid sequence of interleukin-10 with the signal peptide in prokaryotic cells, and strictly anaerobic bacteria are constructed through synthetic biology gene circuits to ensure the safety and therapeutic effect of the bacteria in the body.
Effective anti-tumor treatment of interleukin-10 secreted by bacteria has been achieved, reducing the toxic and side effects of long-term bacterial persistence in the body, and improving the safety and efficacy of treatment.
Abstract
Description
Bacteria that secrete interleukin-10 Technical Field
[0001] The present invention relates to the field of genetic engineering, and in particular to bacteria with anti-tumor activity that have been genetically modified to secrete interleukin-10 in situ, a pharmaceutical composition comprising the modified bacteria, and anti-tumor use thereof. Background Art
[0002] Cancer has become one of the most serious diseases threatening human life and health, but existing treatments (radiotherapy, chemotherapy, surgery, and targeted drugs) all have shortcomings, and there is an urgent need to develop new treatments. Traditional tumor bacterial therapy, represented by Coley toxin, has a history of 150 years, but the effect is unstable and there are safety issues. The development of genetic engineering technology has made great progress in reducing the toxicity of strains. A series of clinical trials have confirmed the safety of attenuated engineered bacteria for the treatment of human tumors, but the efficacy is poor, and it is difficult to achieve both safety and therapeutic efficacy, which cannot meet the needs of clinical tumor treatment. Further in-depth optimization of tumor bacterial therapy is imperative.
[0003] Interleukin-10 (IL-10) is a cytokine primarily produced by Th2 cells. It inhibits the production of other lymphokines and is a major anti-inflammatory factor. It has therapeutic effects on transplant rejection and inflammation. Initially, IL-10 was believed to be a B-cell-derived T-cell growth factor (B-TCGF), and its function was therefore thought to stimulate CD8+ T cell activation (MacNeil IA, et al. The Journal of Immunology, 1990). Later, researchers discovered that IL-10 can also induce the expression of CD3 and CD8 molecules on thymocytes and activate the cytotoxicity of CD8+ T cells (Chen WF, et al. The Journal of Immunology, 1991). Furthermore, IL-10 can enhance CD8+ T cell proliferation by directly stimulating T cell receptor signaling through anti-CD3 monoclonal antibodies.
[0004] The application of interleukin-10 in immunotherapy was initially discovered by the discovery that interleukin-10 knockout mice were particularly sensitive to chemically induced skin cancer. Furthermore, tumors in these mice developed more rapidly and metastasized prematurely. Intratumoral CD8+ T cells, MHC molecules, and granzymes were all suppressed in tumors of interleukin-10 knockout mice. In contrast, overexpression of interleukin-10 in transgenic mice increased the levels of the above molecules (Mumm JB, Emmerich J, Zhang X, Chan I, Wu L, Mauze S, Blaisdell S, Basham B, Dai J, Grein J, Sheppard C, Hong K, Cutler C, Turner S, LaFace D, Kleinschek M, Judo M, Ayanoglu G, Langowski J, Gu D, Paporello B, Murphy E, Sriram V, Naravula S, Desai B, Medicherla S, Seghezzi W, McClanahan T, Cannon-Carlson S, Beebe AM, Oft M. IL-10 elicits IFNγ-dependent tumor immune surveillance. Cancer Cell. 2011 December). 13;20(6):781-96.doi:10.1016 / j.ccr.2011.11.003.PMID:22172723.). Martin Oft et al. injected pegylated interleukin-10 (chemically modified interleukin-10 to extend its half-life) into tumor-bearing mice and found that the expression of IFN-γ and granzymes in the tumors was significantly increased. They also found that pegylated interleukin-10 activated the body's long-lasting immune memory against tumors, and mice were still able to resist tumor attacks 8 months after experiencing the initial tumor rejection reaction.This long-lasting tumor immunity may be due to interleukin-10 inducing phosphorylation of STAT1 and STAT3 in intratumoral CD8+ T cells, activating intratumoral CD8+ T cell-specific signaling pathways, and stimulating their secretion of the cytokine IFN-γ (Mumm JB, Emmerich J, Zhang X, Chan I, Wu L, Mauze S, Blaisdell S, Basham B, Dai J, Grein J, Sheppard C, Hong K, Cutler C, Turner S, LaFace D, Kleinschek M, Judo M, Ayanoglu G, Langowski J, Gu D, Paporello B, Murphy E, Sriram V, Naravula S, Desai B, Medicherla S, Seghezzi W, McClanahan T, Cannon-Carlson S, Beebe AM, Oft M. IL-10 elicits IFNγ-dependent tumor immune surveillance. Cancer Cell. 2011 Dec. 13;20(6):781-96.doi:10.1016 / j.ccr.2011.11.003.PMID:22172723.). However, for CD4 or CD8+ T cells derived from lymphoid organs, interleukin-10 can only induce STAT3 phosphorylation but cannot induce IFN-γ secretion (Emmerich J, Mumm JB, Chan IH, LaFace D, Truong H, McClanahan T, Gorman DM, Oft M. IL-10 directly activates and expands tumor-resident CD8(+)T cells without de novo infiltration from secondary lymphoid organs. Cancer Res. 2012 Jul 15; 72(14): 3570-81. doi: 10.1158 / 0008-5472. CAN-12-0721. Epub 2012 May 11. PMID: 22581824.).STAT1 is particularly important in the induction of IFN-γ because it induces the production of the cell-specific transcription factor T-bet, which is a transcription factor of the Th1 and Tc1 lineages of IFN-γ-producing T cells (Afkarian M, Sedy JR, Yang J, Jacobson NG, Cereb N, Yang SY, Murphy TL, Murphy KM. T-bet is a STAT1-induced regulator of IL-12R expression in IFN-γ-producing T cells. CD4+ T cells. Nat Immunol. 2002 Jun; 3(6): 549-57. doi: 10.1038 / ni794. Epub 2002 May 13. PMID: 12006974.). T-bet synergizes with the TCR-activated transcription factor NFAT to induce the production of IFN-γ and granzymes in cytotoxic T cells (Glimcher LH, Townsend MJ, Sullivan BM, Lord GM. Recent developments in the transcriptional regulation of cytolytic effector cells. Nat Rev Immunol. 2004 Nov; 4(11): 900-11. doi: 10.1038 / nri1490. PMID: 15516969.). Therefore, under the action of pegylated interleukin-10, IFN-γ, granzymes, and perforin in cytotoxic T cells increase only under TCR stimulation. Furthermore, intratumoral IFN-γ produced by CD8+ T cells participates in the induction of class I and class II MHC molecules, potentially allowing antigen presentation within the tumor. In human tumors, the expression of MHC molecules is highly correlated with improved patient prognosis (Walsh MD, Dent OF, Young JP, Wright CM, Barker MA, Leggett BA, Bokey L, Chapuis PH, Jass JR, Macdonald GA. HLA-DR expression is associated with better prognosis in sporadic Australian clinicopathological Stage C colorectal cancers. Int J Cancer. 2009 Sep1; 125(5): 1231-7. doi: 10.1002 / ijc.24484. PMID: 19462453.). In summary, interleukin-10 can improve tumor-related inflammatory responses and the lack of tumor immunity in tumor treatment, which fully demonstrates that it may represent a new and promising new approach for treating cancer patients.
[0005] Therefore, bacteria with anti-tumor activity that can secrete interleukin-10 in situ have improved efficacy in treating tumors. However, while bacteria can express IL-10, they have difficulty secreting the expressed IL-10 outside the cell. Therefore, there is a need to improve expression methods and produce bacteria with anti-tumor activity that can secrete IL-10 in situ.
[0006] Summary of the Invention
[0007] The present invention constructs a fusion polypeptide by linking the amino acid sequence of mature IL-10 with a signal peptide that directs protein secretion outside the cell in prokaryotic cells via a peptide linker containing 1-10 acidic amino acid residues. The fusion polypeptide of the present invention can be secreted outside the cell when expressed in prokaryotic cells.
[0008] The present invention also constructs strictly anaerobic bacteria through synthetic biology gene circuits. After administration to animals or humans, the bacteria show therapeutic effects on tumors and can be cleared by normal tissues and organs in a short period of time, thereby reducing the toxic side effects on the animals or humans caused by the long-term retention of bacteria in the body, and has more reliable anti-tumor efficacy and safety.
[0009] In a first aspect, the present invention provides a fusion polypeptide comprising a signal peptide, an interleukin 10 (IL-10) polypeptide, and a peptide linker connecting the signal peptide and the IL-10 polypeptide, wherein the peptide linker comprises 1-10 acidic amino acid residues, and wherein when expressed in a cell, the signal peptide directs the IL-10 polypeptide to be secreted extracellularly.
[0010] In a second aspect, the present invention provides a polynucleotide encoding the fusion polypeptide of the present invention, a vector comprising the polynucleotide, and a host cell comprising the polynucleotide and / or the vector.
[0011] In a third aspect, the present invention provides a method for prokaryotic expression of IL-10 polypeptide, comprising:
[0012] i) transforming bacterial cells with the vector of the present invention; and
[0013] ii) culturing the transformed cells under conditions where the vector is capable of expressing IL-10.
[0014] In a fourth aspect, the present invention provides a modified bacterium, wherein compared to the unmodified starting strain, the bacterium comprises one or more expression cassettes for expressing the polynucleotide of the present invention and essential genes, the expression of which is controlled by a strict hypoxia-inducible promoter, and the bacterium lacks at least one gene involved in or regulating an endogenous antioxidant stress response pathway or its functional expression product.
[0015] The present invention also provides a modified bacterium, wherein, compared to an unmodified starting strain, the bacterium comprises one or more expression cassettes for expressing a polynucleotide of the present invention and an essential gene, wherein the expression of the essential gene is controlled by a strictly hypoxia-inducible promoter, and the bacterium lacks at least one gene required for survival in macrophages or its functional expression product.
[0016] The present invention also provides a modified bacterium, wherein compared with an unmodified starting strain, the bacterium comprises one or more expression cassettes for expressing the polynucleotide of the present invention and essential genes and a pH-regulatory expression cassette, wherein the expression of the essential genes is controlled by a strictly hypoxia-inducible promoter, and the pH-regulatory expression cassette comprises a gene encoding a bacterial-derived hemolysin protein controlled by a promoter active under acidic pH conditions, and the bacterium lacks at least one gene involved in or regulating an endogenous anti-oxidative stress response pathway or its functional expression product.
[0017] The present invention also provides a modified bacterium, wherein compared to an unmodified starting strain, the bacterium comprises one or more expression cassettes for expressing the polynucleotide of the present invention and essential genes, the expression of which is controlled by a strictly hypoxia-inducible promoter, and a pH-regulatory expression cassette comprising a gene encoding a bacterial-derived hemolysin protein controlled by a promoter active under acidic pH conditions, wherein the bacterium expresses wild-type lipopolysaccharide (LPS) and the bacterium lacks at least one gene required for survival in macrophages or its functional expression product.
[0018] The present invention also provides a modified Salmonella typhimurium bacterium, wherein compared with an unmodified starting strain, the bacterium comprises one or more expression cassettes for expressing the polynucleotide of the present invention and essential genes and a pH-regulatory expression cassette, wherein the expression of the essential genes is controlled by a strictly hypoxia-inducible promoter, and the pH-regulatory expression cassette comprises a gene encoding a bacterial-derived hemolysin protein controlled by a promoter active under acidic pH conditions, and the bacterium lacks at least one gene involved in or regulating an endogenous anti-oxidative stress response pathway or its functional expression product.
[0019] The present invention also provides a modified Salmonella typhimurium bacterium, wherein compared to an unmodified starting strain, the bacterium comprises one or more expression cassettes for expressing the polynucleotide of the present invention and essential genes and a pH-regulatable expression cassette, wherein expression of the essential genes is controlled by a strictly hypoxia-inducible promoter, and the pH-regulatable expression cassette comprises a gene encoding a bacterial-derived hemolysin protein controlled by a promoter active under acidic pH conditions, wherein the bacterium expresses wild-type lipopolysaccharide (LPS) and the bacterium lacks at least one gene required for survival in macrophages or its functional expression product.
[0020] In a fifth aspect, the present invention provides a pharmaceutical composition comprising the modified bacteria of the present invention. In one embodiment, the pharmaceutical composition is used to treat a malignant tumor.
[0021] The present invention also provides a method for treating a malignant tumor, comprising administering the modified bacteria or pharmaceutical composition of the present invention to a subject suffering from the malignant tumor.
[0022] The present invention provides use of the modified bacteria of the present invention in preparing a medicament for treating malignant tumors. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 shows Western blot results showing the effects of the presence and absence of a D5 peptide linker on prokaryotic expression of IL-10. Left: Protein expression in the cell pellet, supernatant, and concentrated LB culture supernatant of the BL21(DE3)-plasmid-pET22b-pelB-D5-huil10-Amp strain. Right: Protein expression in the cell pellet, supernatant, and concentrated LB culture supernatant of the BL21(DE3)-plasmid-pET22b-pelB-huil10-Amp strain (control group without the D5 linker).
[0024] Figure 2 is a Western blot showing the effects of the presence and absence of a D5 peptide linker on prokaryotic expression of IL-10. Right: Protein expression in the cell pellet, supernatant, and concentrated LB culture supernatant of the BL21(DE3)-plasmid-pSC101-ptac-pelB-D5-huil10-KanR strain; Left: Protein expression in the cell pellet, supernatant, and concentrated LB culture supernatant of the BL21(DE3)-plasmid-pSC101-ptac-pelB-huil10-KanR strain (control group without the D5 linker).
[0025] Figure 3 is a Western Blot result showing the expression of fusion polypeptides containing different peptide linkers from inducible expression plasmids. For each fusion polypeptide, the insoluble expression product (INS), the soluble product in bacteria (S), and the secreted product (SUP) in the supernatant were detected (in order from left to right).
[0026] FIG4 is a schematic diagram of the DB-ZW1 strain construction scheme.
[0027] FIG5 shows the distribution changes of DB-ZW1 in tumors and tissues over time.
[0028] Figure 6 shows the tumor inhibitory effects of DB-ZW1 on bladder cancer, melanoma, and in situ colon cancer. Figures 6A-C show the effects of DB-ZW1 on tumor volume in subcutaneous bladder cancer, in situ melanoma, and in situ colon cancer, respectively; Figure 6D shows the effect of DB-ZW1 on tumor size in in situ colon cancer.
[0029] Figure 7 shows the expression and secretion of human interleukin 10 in Escherichia coli Nissle and Salmonella typhimurium DB-ZW1. The left panel is a Western Blot image of the expression product (INS: insoluble expression product, S: soluble product in bacteria, and SUP: secreted product in the supernatant), and the right panel is a quantitative analysis of the secreted expression product.
[0030] FIG8 shows Western Blot images of the expression and secretion of murine interleukin-10 in E. coli Nissle and Salmonella typhimurium DB-ZW1 (INS: insoluble expression product, S: soluble product in bacteria and SUP: secreted product in the supernatant).
[0031] FIG9 shows the anti-tumor effect of Escherichia coli Nissle expressing the fusion polypeptide of the present invention.
[0032] Figure 10 shows the weight changes of Escherichia coli Nissle expressing the fusion polypeptide of the present invention in tumor-bearing mice.
[0033] Embodiment 1: A fusion polypeptide comprising a signal peptide, an interleukin 10 (IL-10) polypeptide, and a peptide linker connecting the signal peptide and the IL-10 polypeptide, wherein the peptide linker comprises 1-10, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid residues, and wherein when expressed in a cell, the signal peptide directs the IL-10 polypeptide to be secreted outside the cell.
[0034] Embodiment 2: The fusion polypeptide of embodiment 1, wherein the peptide linker comprises
[0035] i) 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 acidic amino acid residues (e.g., D and / or E);
[0036] ii) 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 neutral amino acid residues (e.g., N); and / or
[0037] iii) 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 basic amino acid residues (e.g., K).
[0038] Embodiment 3: The fusion polypeptide of embodiment 1 or 2, wherein the peptide linker
[0039] consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 glutamic acid residues;
[0040] consists of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 aspartic acid residues; or
[0041] Consists of a total of 2, 3, 4, 5, 6, 7, 8, 9 or 10 glutamic acid and aspartic acid residues.
[0042] Embodiment 4: The fusion polypeptide of any one of embodiments 1-3, wherein the peptide linker comprises at least one (e.g., 1, 2, 3, 4, or 5) D segment consisting of at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, or 9) aspartic acid residues and at least one (e.g., 1, 2, 3, 4, or 5) E segment consisting of at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, or 9) glutamic acid residues, and the D segments and the E segments are arranged alternately.
[0043] Embodiment 5: The fusion polypeptide of embodiment 4, wherein the peptide linker comprises a D segment and an E segment.
[0044] Embodiment 6: The fusion polypeptide of embodiment 5, wherein the peptide linker comprises the amino acid sequence
[0045] D1E1,
[0046] D2E1、D1E2、
[0047] D3E1, D2E2, D1E3,
[0048] D4E1, D3E2, D2E3, D1E4,
[0049] D5E1, D4E2, D3E3, D2E4, D1E5,
[0050] D6E1, D5E2, D4E3, D3E4, D2E5, D1E6,
[0051] D7E1, D6E2, D5E3, D4E4, D3E5, D2E6, D1E7,
[0052] D8E1, D7E2, D6E3, D5E4, D4E5, D3E6, D2E7, D1E8,
[0053] D9E1, D8E1, D7E2, D6E3, D5E4, D4E5, D3E6, D2E7, or D1E8
[0054] E1D1,
[0055] E2D1, E1D2,
[0056] E3D1, E2D2, E1D3,
[0057] E4D1, E3D2, E2D3, E1D4,
[0058] E5D1, E4D2, E3D3, E2D4, E1D5,
[0059] E6D1, E5D2, E4D3, E3D4, E2D5, E1D6,
[0060] E7D1, E6D2, E5D3, E4D4, E3D5, E2D6, E1D7,
[0061] E8D1, E7D2, E6D3, E5D4, E4D5, E3D6, E2D7, E1D8,
[0062] E9D1, E8D1, E7D2, E6D3, E5D4, E4D5, E3D6, E2D7, or E1D8.
[0063] Embodiment 7: The fusion polypeptide of embodiment 1 or 2, wherein the peptide linker comprises a total of 2, 3, 4, 5, 6, 7, 8, 9 or 10 acidic and neutral amino acid residues.
[0064] Embodiment 8: The fusion polypeptide of embodiment 1, 2 or 7, wherein the peptide linker consists of 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid residues.
[0065] Embodiment 9: The fusion polypeptide of embodiment 1, 2, 7 or 8, wherein the peptide linker comprises at least one (e.g., 1, 2, 3, 4 or 5) X segment consisting of at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8 or 9) acidic amino acid residues and at least one (e.g., 1, 2, 3, 4 or 5) Z segment consisting of at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8 or 9) neutral amino acid residues, and the X segments and the Z segments are arranged alternately.
[0066] Embodiment 10: The fusion polypeptide of any one of Embodiments 7-9, wherein the acidic amino acid residue is D, and the neutral amino acid residue is N.
[0067] Embodiment 11: The fusion polypeptide of embodiment 10, wherein the peptide linker comprises an X segment and a Z segment.
[0068] Embodiment 12: The fusion polypeptide of embodiment 11, wherein the peptide linker comprises the amino acid sequence
[0069] D1N1,
[0070] D2N1、D1N2、
[0071] D3N1, D2N2, D1N3,
[0072] D4N1, D3N2, D2N3, D1N4,
[0073] D5N1, D4N2, D3N3, D2N4, D1N5,
[0074] D6N1, D5N2, D4N3, D3N4, D2N5, D1N6,
[0075] D7N1, D6N2, D5N3, D4N4, D3N5, D2N6, D1N7,
[0076] D8N1, D7N2, D6N3, D5N4, D4N5, D3N6, D2N7, D1N8,
[0077] D9N1, D8N1, D7N2, D6N3, D5N4, D4N5, D3N6, D2N7, or D1N8
[0078] N1D1,
[0079] N2D1、N1D2、
[0080] N3D1, N2D2, N1D3,
[0081] N4D1、N3D2、N2D3、N1D4、
[0082] N5D1, N4D2, N3D3, N2D4, N1D5,
[0083] N6D1, N5D2, N4D3, N3D4, N2D5, N1D6,
[0084] N7D1, N6D2, N5D3, N4D4, N3D5, N2D6, N1D7,
[0085] N8D1, N7D2, N6D3, N5D4, N4D5, N3D6, N2D7, N1D8,
[0086] N9D1, N8D1, N7D2, N6D3, N5D4, N4D5, N3D6, N2D7, or N1D8.
[0087] Embodiment 13: The fusion polypeptide of any one of embodiments 1 to 12, wherein the IL-10 polypeptide is a human IL-10 polypeptide or a variant thereof.
[0088] Embodiment 14: The fusion polypeptide of any one of embodiments 1-13, wherein the IL-10 polypeptide comprises the amino acid sequence of SEQ ID NO: 12, 13, 14 or 15, or an amino acid sequence that is at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 12, 13, 14 or 15, or an amino acid sequence that comprises 1-20, 1-15, 1-10 or 1-5, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more amino acid residues, substitutions, insertions, deletions and / or additions, preferably conservative substitutions, compared to SEQ ID NO: 12, 13, 14 or 15.
[0089] Embodiment 15: The fusion polypeptide of any one of embodiments 1-14, wherein the signal peptide is selected from i) a signal peptide derived from a type I secretion system (T1SS secretion system), such as HlyA; ii) a signal peptide derived from a type II secretion system (T2SS secretion system), such as pelB, ompA, ompF, ompC, ompT, PhoA, PhoE and LPP; and iii) a SicP-SptP-dependent signal peptide derived from a type III secretion system (T3SS secretion system), for example, the signal peptide is a pelB signal peptide, in particular, the signal peptide comprises an amino acid sequence of SEQ ID NO: 16 having at least 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% identity to SEQ ID NO: 16, or an amino acid sequence identical to SEQ ID NO: 16. An amino acid sequence comprising 1-10 or 1-5, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10, amino acid residue substitutions, insertions, deletions and / or additions, preferably conservative substitutions, compared to NO:16.
[0090] Embodiment 16: The fusion polypeptide of any one of embodiments 1-15, which comprises the amino acid sequence of SEQ ID NO: 17, 18, 19, 20, 21, 22, 23 or 24, or an amino acid sequence that is at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 17, 18, 19, 20, 21, 22, 23 or 24, or an amino acid sequence that comprises 1-20, 1-15, 1-10 or 1-5, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more amino acid residues, substitutions, insertions, deletions and / or additions, preferably conservative substitutions, compared to SEQ ID NO: 17, 18, 19 or 20.
[0091] Embodiment 17: A polynucleotide encoding the fusion polypeptide of any one of embodiments 1-16.
[0092] Embodiment 18: An expression cassette comprising the polynucleotide of embodiment 17 operably linked to a promoter.
[0093] Embodiment 19: An expression vector comprising the polynucleotide of embodiment 17 or the expression cassette of embodiment 18.
[0094] Embodiment 20: A host cell comprising the polynucleotide of embodiment 17 or the expression vector of embodiment 18, such as Escherichia coli such as Nissle strain and BL21 (DE3) strain, Salmonella typhimurium such as SL7207 strain, and Bacillus subtilis.
[0095] Embodiment 21: A method for prokaryotic expression of IL-10 polypeptide, comprising
[0096] i) transforming bacterial cells with the expression vector of embodiment 19; and
[0097] ii) culturing the transformed cells under conditions in which the vector is capable of expressing, and preferably, secreting, IL-10.
[0098] Embodiment 22: The method of embodiment 21, wherein the bacterial cell is selected from Escherichia coli such as Nissle strain and BL21 (DE3) strain, Salmonella typhimurium such as SL7207 strain, and Bacillus subtilis.
[0099] Implementation Method A
[0100] Embodiment A1: A modified bacterium, wherein compared to an unmodified starting strain, the bacterium comprises
[0101] i) the expression cassette of embodiment 18 and a hypoxia-regulatable essential gene expression cassette, wherein the essential gene expression cassette comprises an essential gene of the bacterium under the control of a strictly hypoxia-inducible promoter; or
[0102] ii) an expression cassette comprising the polynucleotide of embodiment 17 and / or the essential gene under the control of a strictly hypoxia-inducible promoter,
[0103] The bacteria lack at least one gene or its functional expression product that participates in or regulates an endogenous anti-oxidative stress response pathway.
[0104] Embodiment A2: The modified bacterium of embodiment A1, wherein the strictly hypoxia-inducible promoter is selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA, and Ptet-Fnr.
[0105] Embodiment A3: The modified bacterium of embodiment A1, wherein the strictly hypoxia-inducible promoter is the ssbp1 promoter.
[0106] Embodiment A4: The modified bacterium of any one of the preceding embodiments A, wherein the expression product of the essential gene is responsible for the synthesis of 2,6-diaminopimelate (DAP) in the bacterium, and when cultured under aerobic conditions, the growth of the bacterium is dependent on the additional addition of DAP or its analogues to the culture medium.
[0107] Embodiment A5. The modified bacterium of embodiment A4, wherein the essential gene is selected from the group consisting of dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof.
[0108] Embodiment A6. The modified bacterium of embodiment A4, wherein the essential gene is selected from the group consisting of dapA and dapE.
[0109] Embodiment A7: The modified bacterium of any one of the preceding embodiments A, wherein the gene involved in or regulating the endogenous anti-oxidative stress response pathway is a gene of the HtrA serine protease family.
[0110] Embodiment A8: The modified bacterium of any one of the preceding embodiments A, wherein the functional expression product of the gene involved in or regulating the endogenous anti-oxidative stress response pathway is a protein related to the HtrA serine protease family.
[0111] Embodiment A9: The modified bacterium of any preceding embodiment A, wherein the bacterium lacks HtrA serine protease activity.
[0112] Embodiment A10: The modified bacterium of any preceding embodiment A, wherein the gene involved in or regulating the endogenous antioxidant stress response pathway is htrA.
[0113] Embodiment A11. The modified bacterium of any preceding embodiment A, wherein the bacterium is deficient in htrA.
[0114] Embodiment A12: The modified bacterium of any one of embodiments A1-A11, wherein the essential gene is a gene naturally present in the chromosome of the bacterium, wherein the natural promoter of the essential gene is functionally replaced by the strict hypoxia-inducible promoter, whereby the expression of the essential gene in the bacterium is completely controlled by the strict hypoxia-inducible promoter.
[0115] Embodiment A13: The modified bacterium of any one of embodiments A1-A11, wherein the essential gene expression cassette is exogenous and the essential gene naturally present in the bacterial chromosome is deleted or functionally inactivated, whereby expression of the essential gene in the bacterium is completely controlled by the strict hypoxia-inducible promoter.
[0116] Embodiment A14: The modified bacterium of embodiment A13, wherein the exogenous essential gene expression cassette is integrated into the chromosome of the bacterium, or the expression cassette of embodiment 18 or the expression cassette comprising the polynucleotide of embodiment 17 controlled by a strict hypoxia-inducible promoter is integrated into the chromosome of the bacterium.
[0117] Embodiment A15: The modified bacterium of embodiment A13, wherein the exogenous essential gene expression cassette is located outside the chromosome of the bacterium, or the expression cassette of embodiment 18 or the expression cassette comprising the polynucleotide of embodiment 17 controlled by a strict hypoxia-inducible promoter is located outside the chromosome of the bacterium.
[0118] Embodiment A16: The modified bacterium of embodiment A15, wherein the exogenous essential gene expression cassette is present in a plasmid carried by the bacterium, or the expression cassette of embodiment 18 or the expression cassette comprising the polynucleotide of embodiment 17 controlled by a strict hypoxia-inducible promoter is located in a plasmid carried by the bacterium.
[0119] Embodiment A17: The modified bacterium of any preceding embodiment A, further comprising a pH-regulatable expression cassette comprising a gene encoding a bacterially derived hemolysin protein controlled by a promoter active under acidic pH conditions.
[0120] Embodiment A18: The modified bacterium of embodiment A17, wherein the bacterial-derived hemolysin protein is a Gram-negative bacterial hemolysin protein.
[0121] Embodiment A19: The modified bacterium of embodiment A18, wherein the gene encoding the Gram-negative bacterial hemolysin protein is hlyA or hlyE.
[0122] Embodiment A20: The modified bacterium of embodiment A19, wherein the hlyA or hlyE is from Listeria monocytogenes, Vibrio cholerae, or Escherichia coli.
[0123] Embodiment A21 . The modified bacterium of any one of embodiments A17-A20, wherein the promoter active under acidic pH conditions is active at a pH value below 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1 , 6.0, 5.9, 5.8, 5.7, 5.6, or 5.5.
[0124] Embodiment A22: The modified bacterium of any one of embodiments A17-A21, wherein the promoter active under acidic pH conditions is selected from sseA, ssrA, ssaB, ssaG, ssaM, and ssaR.
[0125] Embodiment A23: The modified bacterium of any one of Embodiments A17-A21, wherein the promoter active under acidic pH conditions is sseA.
[0126] Embodiment A24. The modified bacterium of any preceding embodiment A, wherein the unmodified starting strain is a facultative anaerobic bacterium.
[0127] Embodiment A25. The modified bacterium of any preceding Embodiment A, wherein the bacterium is an Enterobacteriaceae bacterium.
[0128] Embodiment A26: The modified bacterium of any one of the preceding embodiments A, wherein the bacterium is an Escherichia, Salmonella, Shigella, Klebsiella, Yersinia, Citrobacter, Enterobacter, Serratia, Proteus, Morganella, Providencia, Hafnia, or Pantoea bacterium.
[0129] Embodiment A27: The modified bacterium of any one of the preceding embodiments A, wherein the bacterium is selected from Escherichia coli such as Nissle strain and BL21 (DE3) strain, Escherichia blattae, Escherichia fergusonii, Escherichia hermannii, Escherichia vulneris, Salmonella enterica, Salmonella bongori, S. typhi, S. choleraesuis, S. typhimurium, S. dysenteriae, Shigella flexneri (S.flexneri), Shigella boydii (S.boydii), Shigella sonnei (S.sonnei), Klebsiella pneumoniae (K.peumoniae), Klebsiella oxytoca (K.oxytoca), Yersinia pestis (Y.pestos), Yersinia enterocolitica (Y.enterocolitica), Yersinia pseudotuberculosis (Y.pseudotuberculosis), Yersinia aldouae (Y.bercov-ieri), Yersinia frederiksenii (Y.frederiksenii), Yersinia intermedia (Y.intermedia), K Yersinia kristersenii, Yersinia mollaretti, Yersinia rohdei, Yersinia ruckeri, Citrobacter freundii, Citrobacter kaseri, Citrobacter braakii, E. aerogenes, E. cloacae, E. gergoviac, E. sakazakii, E. tavlorac, E. aminigenus, Enterobacter intermedius, Enterobacter asburiac, Enterobacter cancerogenus, Enterobacter dissolvens, Enterobacter nimipressualis, Serratia marcescens, Serratia entomophila, Serratia ficaria, Serratia fonticola, Serratia grimesii, Serratia liquefaciens, Serratia odorifera, Serratia puertoris, Serratia odorifera ...plymuthica), Serratia proteamaculans, Serratia rubidaea, Serratia ureilytica, P. mirabilis, P. vulgaris, P. myxofaciens, P. penneri, P. hauseri, M. morganii, P. alcalifaciens, P. rustigianii, P. stuartii, P. rettgeri, P. heimbochae, H. alvei, P. agglomerans, and Bacillus subtilis.
[0130] Embodiment A28. The modified bacterium of any preceding embodiment A, wherein the bacterium is Salmonella typhimurium.
[0131] Embodiment A29. The modified bacterium of embodiment A28, wherein the starting strain is Salmonella typhimurium SL7207.
[0132] Embodiment A30. The modified bacterium of any preceding embodiment A, wherein the bacterium expresses wild-type lipopolysaccharide (LPS).
[0133] Embodiment A31 : The modified bacterium of any preceding embodiment A, wherein, upon administration to a subject having a tumor, the bacterium is able to survive and proliferate in tumor tissue but is rapidly cleared from normal tissue.
[0134] Embodiment A32. The modified bacterium of any preceding embodiment A, wherein the bacterium is capable of inhibiting the growth of a malignant tumor when administered to a subject having the malignant tumor.
[0135] Embodiment A33: The modified bacterium of any preceding embodiment A, wherein the bacterium is capable of inducing an anti-tumor specific immune response when administered to a subject having a malignant tumor.
[0136] Embodiment A34. The modified bacterium of any preceding embodiment A, wherein the bacterium is capable of inducing anti-tumor immune memory when administered to a subject having a malignant tumor.
[0137] Embodiment A35: The modified bacterium of any preceding embodiment A, which does not express wild-type flagellin.
[0138] Embodiment A36: The modified bacterium of any preceding embodiment A, which lacks the fliC gene.
[0139] Embodiment A37. The modified bacterium of any preceding embodiment A, wherein the bacterium has a survival level in macrophages that is about 50% to about 30% of the survival level of the unmodified starting strain.
[0140] Embodiment A38. The modified bacterium of any one of embodiments A1-A36, wherein the bacterium has a survival level in macrophages that is about 30% to about 10% of the survival level of the unmodified starting strain.
[0141] Embodiment A39. The modified bacterium of any one of embodiments A1-A36, wherein the bacterium has a survival level in macrophages that is about 10% to about 1% of the survival level of the unmodified starting strain.
[0142] Implementation Method B
[0143] Embodiment B1: A modified bacterium, wherein compared to the unmodified starting strain, the bacterium comprises
[0144] i) the expression cassette of embodiment 18, the hypoxia-regulatable essential gene expression cassette and the pH-regulatable expression cassette, wherein the essential gene expression cassette comprises an essential gene of the bacterium under the control of a strictly hypoxia-inducible promoter, or
[0145] ii) an expression cassette comprising the polynucleotide of embodiment 17 and / or the essential gene under the control of a strictly hypoxia-inducible promoter and a pH-regulatable expression cassette,
[0146] The pH-regulatory expression cassette comprises a gene encoding a bacterial-derived hemolysin protein controlled by a promoter active under acidic pH conditions, and the bacteria lack at least one gene involved in or regulating an endogenous antioxidant stress response pathway or its functional expression product.
[0147] Embodiment B2: The modified bacterium of embodiment B1, wherein the strictly hypoxia-inducible promoter is selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA, and Ptet-Fnr.
[0148] Embodiment B3: The modified bacterium of embodiment B1, wherein the strictly hypoxia-inducible promoter is the ssbp1 promoter.
[0149] Embodiment B4: The modified bacterium of any one of the preceding embodiments B, wherein the expression product of the essential gene is responsible for the synthesis of 2,6-diaminopimelate (DAP) in the bacterium, and when cultured under aerobic conditions, the growth of the bacterium is dependent on the additional addition of DAP or its analogues to the culture medium.
[0150] Embodiment B5. The modified bacterium of embodiment B4, wherein the essential gene is selected from the group consisting of dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof.
[0151] Embodiment B6. The modified bacterium of embodiment B4, wherein the essential gene is selected from the group consisting of dapA and dapE.
[0152] Embodiment B7: The modified bacterium of any preceding embodiment B, wherein the gene involved in or regulating the endogenous anti-oxidative stress response pathway is an HtrA serine protease family gene.
[0153] Embodiment B8: The modified bacterium of any one of the preceding embodiments B, wherein the functional expression product of the gene involved in or regulating the endogenous anti-oxidative stress response pathway is an HtrA serine protease family-related protein.
[0154] Embodiment B9: The modified bacterium of any preceding embodiment B, wherein the bacterium lacks HtrA serine protease activity.
[0155] Embodiment B10: The modified bacterium of any preceding embodiment B, wherein the gene involved in or regulating the endogenous antioxidant stress response pathway is htrA.
[0156] Embodiment B11. The modified bacterium of any preceding embodiment B, wherein the bacterium is deficient in htrA.
[0157] Embodiment B12: The modified bacterium of any one of embodiments B1 to B11, wherein the essential gene is a gene naturally present in the bacterial chromosome, wherein the natural promoter of the essential gene is functionally replaced by the strict hypoxia-inducible promoter, whereby the expression of the essential gene in the bacterium is completely controlled by the strict hypoxia-inducible promoter.
[0158] Embodiment B13: The modified bacterium of any one of embodiments B1-B11, wherein the essential gene expression cassette is exogenous and the essential gene naturally present in the bacterial chromosome is deleted or functionally inactivated, whereby expression of the essential gene in the bacterium is completely controlled by the strict hypoxia-inducible promoter.
[0159] Embodiment B14: The modified bacterium of embodiment B13, wherein the exogenous essential gene expression cassette is integrated into the chromosome of the bacterium, or the expression cassette of embodiment 18 or the expression cassette comprising the polynucleotide of embodiment 17 controlled by a strict hypoxia-inducible promoter is integrated into the chromosome of the bacterium.
[0160] Embodiment B15: The modified bacterium of embodiment B13, wherein the exogenous essential gene expression cassette is located outside the chromosome of the bacterium, or the expression cassette of embodiment 18 or the expression cassette comprising the polynucleotide of embodiment 17 controlled by a strict hypoxia-inducible promoter is located outside the chromosome of the bacterium.
[0161] Embodiment B16: The modified bacterium of embodiment B15, wherein the exogenous essential gene expression cassette is present in a plasmid carried by the bacterium, or the expression cassette of embodiment 18 or the expression cassette comprising the polynucleotide of embodiment 17 controlled by a strict hypoxia-inducible promoter is located in a plasmid carried by the bacterium.
[0162] Embodiment B17: The modified bacterium of any preceding embodiment B, wherein the bacterial-derived hemolysin protein is a Gram-negative bacterial hemolysin protein.
[0163] Embodiment B18: The modified bacterium of embodiment B17, wherein the gene encoding the Gram-negative bacterial hemolysin protein is hlyA or hlyE.
[0164] Embodiment B19: The modified bacterium of embodiment B18, wherein the hlyA or hlyE is from Listeria monocytogenes, Vibrio cholerae, or Escherichia coli.
[0165] Embodiment B20: The modified bacterium of any of the preceding embodiments B, wherein the promoter active under acidic pH conditions is active at a pH of less than 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6, or 5.5.
[0166] Embodiment B21. The modified bacterium of any preceding embodiment B, wherein the promoter active under acidic pH conditions is selected from the group consisting of sseA, ssrA, ssaB, ssaG, ssaM, and ssaR.
[0167] Embodiment B22. The modified bacterium of any preceding Embodiment B, wherein the promoter active under acidic pH conditions is sseA.
[0168] Embodiment B23. The modified bacterium of any preceding Embodiment B, wherein the unmodified starting strain is a facultative anaerobic bacterium.
[0169] Embodiment B24. The modified bacterium of any preceding Embodiment B, wherein the bacterium is an Enterobacteriaceae.
[0170] Embodiment B25: The modified bacterium of any of the preceding embodiments B, wherein the bacterium is an Escherichia, Salmonella, Shigella, Klebsiella, Yersinia, Citrobacter, Enterobacter, Serratia, Proteus, Morganella, Providencia, Hafnia, or Pantoea bacterium.
[0171] Embodiment B26: The modified bacterium of any of the preceding embodiments A, wherein the bacterium is selected from Escherichia coli such as Nissle strain and BL21 (DE3) strain, Escherichia cockroaches, Escherichia fergusonii, Escherichia hermannii, Escherichia wounds, Salmonella enterica, Salmonella bongori, Salmonella typhi, Salmonella choleraesuis, Salmonella typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella bodega, Shigella sonnei, Klebsiella pneumoniae, Klebsiella oxytoca, Yersinia pestis, Yersinia enterocolitica, Yersinia pseudotuberculosis, Yersinia auverii, Yersinia burnetii, Yersinia freundii, Yersinia intermedia, Yersinia kurzewi, Yersinia moorei, Yersinia rosea, Yersinia ruckeri, Citrobacter freundii, Citrobacter kozei Acidobacterium, Citrobacter braquei, Enterobacter aerogenes, Enterobacter cloacae, Enterobacter japonensis, Enterobacter sakazakii, Enterobacter tylosus, Enterobacter riveris, Enterobacter intermedia, Enterobacter afseri, Enterobacter carcinogenes, Enterobacter lyticus, Enterobacter superpressure, Serratia marcescens, Serratia entomophila, Serratia figi, Serratia izumi, Serratia grisei, Serratia liquefaciens, Serratia aromatica, Serratia puchengensis, Serratia longyanmao, Serratia crimson, Serratia urealyticum, Proteus mirabilis, Proteus vulgaris, Proteus mucogenes, Proteus pannei, Proteus houyi, Morganella morganii, Providencia alcaligenes, Providencia ruegensis, Providencia stuartii, Providencia rettgeri, Providencia henryi, Hafnia alvei, Pantoea agglomerans and Bacillus subtilis.
[0172] Embodiment B27. The modified bacterium of any preceding Embodiment B, wherein the bacterium is Salmonella typhimurium.
[0173] Embodiment B28. The modified bacterium of embodiment B27, wherein the starting strain is Salmonella typhimurium SL7207.
[0174] Embodiment B29. The modified bacterium of any preceding Embodiment B, wherein the bacterium expresses wild-type lipopolysaccharide (LPS).
[0175] Embodiment B30: The modified bacterium of any preceding embodiment B, wherein, upon administration to a subject having a tumor, the bacterium is able to survive and proliferate in tumor tissue but is rapidly cleared from normal tissue.
[0176] Embodiment B31. The modified bacterium of any preceding embodiment B, wherein the bacterium is capable of inhibiting the growth of a malignant tumor when administered to a subject having the malignant tumor.
[0177] Embodiment B32: The modified bacterium of any preceding embodiment B, wherein the bacterium is capable of inducing an anti-tumor specific immune response when administered to a subject having a malignant tumor.
[0178] Embodiment B33. The modified bacterium of any preceding embodiment B, wherein the bacterium is capable of inducing anti-tumor immune memory when administered to a subject having a malignant tumor.
[0179] Embodiment B34: The modified bacterium of any preceding embodiment B, which does not express wild-type flagellin.
[0180] Embodiment B35: The modified bacterium of any preceding embodiment B, which lacks the fliC gene.
[0181] Embodiment B36. The modified bacterium of any preceding embodiment B, wherein the bacterium has a survival level in macrophages that is about 50% to about 30% of the survival level of the unmodified starting strain.
[0182] Embodiment B37. The modified bacterium of any one of Embodiments B1-B35, wherein the bacterium has a survival level in macrophages that is about 30% to about 10% of the survival level of the unmodified starting strain.
[0183] Embodiment B38. The modified bacterium of any one of Embodiments B1-B35, wherein the bacterium has a survival level in macrophages that is about 10% to about 1% of the survival level of the unmodified starting strain.
[0184] Implementation Method C
[0185] Embodiment C1: A modified Salmonella typhimurium bacterium, wherein the bacterium comprises, compared to the unmodified starting strain
[0186] i) the expression cassette of embodiment 18 and a hypoxia-regulatable essential gene expression cassette, wherein the essential gene expression cassette comprises an essential gene of the bacterium under the control of a strictly hypoxia-inducible promoter; or
[0187] ii) an expression cassette comprising the polynucleotide of embodiment 17 and / or the essential gene under the control of a strictly hypoxia-inducible promoter,
[0188] The bacteria lack at least one gene or its functional expression product that participates in or regulates an endogenous anti-oxidative stress response pathway.
[0189] Embodiment C2: The modified bacterium of embodiment C1, wherein the strictly hypoxia-inducible promoter is selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA, and Ptet-Fnr.
[0190] Embodiment C3: The modified bacterium of embodiment C1, wherein the strictly hypoxia-inducible promoter is the ssbp1 promoter.
[0191] Embodiment C4: The modified bacterium of any one of the preceding embodiments C, wherein the expression product of the essential gene is responsible for the synthesis of 2,6-diaminopimelate (DAP) in the bacterium, and when cultured under aerobic conditions, the growth of the bacterium is dependent on the additional addition of DAP or its analogues to the culture medium.
[0192] Embodiment C5. The modified bacterium of embodiment C4, wherein the essential gene is selected from the group consisting of dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof.
[0193] Embodiment C6. The modified bacterium of embodiment C4, wherein the essential gene is selected from the group consisting of dapA and dapE.
[0194] Embodiment C7: The modified bacterium of any one of the preceding embodiments C, wherein the gene involved in or regulating the endogenous anti-oxidative stress response pathway is an HtrA serine protease family gene.
[0195] Embodiment C8: The modified bacterium of any one of the preceding embodiments C, wherein the functional expression product of the gene involved in or regulating the endogenous anti-oxidative stress response pathway is an HtrA serine protease family-related protein.
[0196] Embodiment C9: The modified bacterium of any preceding embodiment C, wherein the bacterium lacks HtrA serine protease activity.
[0197] Embodiment C10: The modified bacterium of any preceding embodiment C, wherein the gene involved in or regulating the endogenous antioxidant stress response pathway is htrA.
[0198] Embodiment C11. The modified bacterium of any preceding embodiment C, wherein the bacterium is deficient in htrA.
[0199] Embodiment C12: The modified bacterium of any one of embodiments C1 to C11, wherein the essential gene is a gene naturally present in the chromosome of the bacterium, wherein the natural promoter of the essential gene is functionally replaced by the strict hypoxia-inducible promoter, whereby the expression of the essential gene in the bacterium is completely controlled by the strict hypoxia-inducible promoter.
[0200] Embodiment C13: The modified bacterium of any one of embodiments C1-C11, wherein the essential gene expression cassette is exogenous and the essential gene naturally occurring in the bacterial chromosome is deleted or functionally inactivated, whereby expression of the essential gene in the bacterium is fully controlled by the strict hypoxia-inducible promoter.
[0201] Embodiment C14: The modified bacterium of embodiment C13, wherein the exogenous essential gene expression cassette is integrated into the chromosome of the bacterium, or the expression cassette of embodiment 18 or the expression cassette comprising the polynucleotide of embodiment 17 under the control of a strict hypoxia-inducible promoter is integrated into the chromosome of the bacterium.
[0202] Embodiment C15: The modified bacterium of embodiment C13, wherein the exogenous essential gene expression cassette is located outside the chromosome of the bacterium, or the expression cassette of embodiment 18 or the expression cassette comprising the polynucleotide of embodiment 17 under the control of a strict hypoxia-inducible promoter is located outside the chromosome of the bacterium.
[0203] Embodiment C16: The modified bacterium of embodiment C15, wherein the exogenous essential gene expression cassette is present in a plasmid carried by the bacterium, or the expression cassette of embodiment 18 or the expression cassette comprising the polynucleotide of embodiment 17 controlled by a strict hypoxia-inducible promoter is located in a plasmid carried by the bacterium.
[0204] Embodiment C17: The modified bacterium of any preceding embodiment C, wherein the bacterial-derived hemolysin protein is a Gram-negative bacterial hemolysin protein.
[0205] Embodiment C18: The modified bacterium of embodiment C17, wherein the gene encoding the Gram-negative bacterial hemolysin protein is hlyA or hlyE.
[0206] Embodiment C19: The modified bacterium of embodiment C18, wherein the hlyA or hlyE is from Listeria monocytogenes, Vibrio cholerae, or Escherichia coli.
[0207] Embodiment C20: The modified bacterium of any preceding embodiment C, wherein the promoter active under acidic pH conditions is active at a pH value below 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6, or 5.5.
[0208] Embodiment C21. The modified bacterium of any preceding Embodiment C, wherein the promoter active under acidic pH conditions is selected from the group consisting of sseA, ssrA, ssaB, ssaG, ssaM, and ssaR.
[0209] Embodiment C22. The modified bacterium of any preceding Embodiment C, wherein the promoter active under acidic pH conditions is sseA.
[0210] Embodiment C23. The modified bacterium of any preceding Embodiment C, wherein the unmodified starting strain is facultative anaerobic Salmonella typhimurium.
[0211] Embodiment C24. The modified bacterium of any preceding Embodiment C, wherein the starting strain is Salmonella typhimurium SL7207.
[0212] Embodiment C25. The modified bacterium of any one of Embodiments C1-C24, wherein the bacterium expresses wild-type lipopolysaccharide (LPS).
[0213] Embodiment C26: The modified bacterium of any preceding embodiment C, wherein, upon administration to a subject having a tumor, the bacterium is able to survive and proliferate in tumor tissue but is rapidly cleared from normal tissue.
[0214] Embodiment C27. The modified bacterium of any preceding embodiment C, wherein the bacterium is capable of inhibiting the growth of a malignant tumor when administered to a subject having the malignant tumor.
[0215] Embodiment C28: The modified bacterium of any preceding embodiment C, wherein the bacterium is capable of inducing an anti-tumor specific immune response when administered to a subject having a malignant tumor.
[0216] Embodiment C29. The modified bacterium of any preceding embodiment C, wherein the bacterium is capable of inducing anti-tumor immune memory when administered to a subject having a malignant tumor.
[0217] Embodiment C30: The modified bacterium of any preceding embodiment C, which does not express wild-type flagellin.
[0218] Embodiment C31: The modified bacterium of any one of the preceding Embodiments C, which lacks the fliC gene.
[0219] Embodiment C32: The modified bacterium of any preceding embodiment C, wherein the bacterium has a survival level in macrophages that is about 50% to about 30% of the survival level of the unmodified starting strain.
[0220] Embodiment C33. The modified bacterium of any one of Embodiments C1-C31, wherein the bacterium has a survival level in macrophages that is about 30% to about 10% of the survival level of the unmodified starting strain.
[0221] Embodiment C34. The modified bacterium of any one of Embodiments C1-C31, wherein the bacterium has a survival level in macrophages that is about 10% to about 1% of the survival level of the unmodified starting strain.
[0222] Implementation Method D
[0223] Embodiment D1: A modified bacterium, wherein compared to the unmodified starting strain, the bacterium comprises
[0224] i) the expression cassette of embodiment 18 and a hypoxia-regulatable essential gene expression cassette, wherein the essential gene expression cassette comprises an essential gene of the bacterium under the control of a strictly hypoxia-inducible promoter; or
[0225] ii) an expression cassette comprising the polynucleotide of embodiment 17 and / or the essential gene under the control of a strictly hypoxia-inducible promoter,
[0226] The bacteria lack at least one gene required for survival in macrophages or its functional expression product.
[0227] Embodiment D2: The modified bacterium of embodiment D1, wherein the strictly hypoxia-inducible promoter is selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA, and Ptet-Fnr.
[0228] Embodiment D3: The modified bacterium of embodiment D1, wherein the strictly hypoxia-inducible promoter is the ssbp1 promoter.
[0229] Embodiment D4: The modified bacterium of any one of the preceding embodiments D, wherein the expression product of the essential gene is responsible for the synthesis of 2,6-diaminopimelate (DAP) in the bacterium, and when cultured under aerobic conditions, the growth of the bacterium is dependent on the additional addition of DAP or its analogues to the culture medium.
[0230] Embodiment D5. The modified bacterium of embodiment D4, wherein the essential gene is selected from the group consisting of dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof.
[0231] Embodiment D6. The modified bacterium of embodiment D4, wherein the essential gene is selected from the group consisting of dapA and dapE.
[0232] Embodiment D7: The modified bacterium of any preceding embodiment D, wherein the gene required for survival in macrophages is the STM3120, STM3119, slyA, sifA, SPI-2, phoP, or htrA gene.
[0233] Embodiment D8: The modified bacterium of any preceding embodiment D, wherein the functional expression product of the gene required for survival in macrophages is an HtrA serine protease family-related protein.
[0234] Embodiment D9: The modified bacterium of any preceding embodiment D, wherein the bacterium lacks HtrA serine protease activity.
[0235] Embodiment D10: The modified bacterium of any preceding embodiment D, wherein the gene required for survival in macrophages is htrA.
[0236] Embodiment D11. The modified bacterium of any preceding embodiment D, wherein the bacterium is deficient in htrA.
[0237] Embodiment D12: The modified bacterium of any one of embodiments D1 to D11, wherein the essential gene is a gene naturally present in the bacterial chromosome, wherein the natural promoter of the essential gene is functionally replaced by the strict hypoxia-inducible promoter, whereby the expression of the essential gene in the bacterium is completely controlled by the strict hypoxia-inducible promoter.
[0238] Embodiment D13: The modified bacterium of any one of embodiments D1-D11, wherein the essential gene expression cassette is exogenous and the essential gene naturally present in the bacterial chromosome is deleted or functionally inactivated, whereby the expression of the essential gene in the bacterium is completely controlled by the strict hypoxia-inducible promoter.
[0239] Embodiment D14: The modified bacterium of embodiment D13, wherein the exogenous essential gene expression cassette is integrated into the chromosome of the bacterium, or the expression cassette of embodiment 18 or the expression cassette comprising the polynucleotide of embodiment 17 controlled by a strict hypoxia-inducible promoter is integrated into the chromosome of the bacterium.
[0240] Embodiment D15: The modified bacterium of embodiment D13, wherein the exogenous essential gene expression cassette is located outside the chromosome of the bacterium, or the expression cassette of embodiment 18 or the expression cassette comprising the polynucleotide of embodiment 17 controlled by a strict hypoxia-inducible promoter is located outside the chromosome of the bacterium.
[0241] Embodiment D16: The modified bacterium of embodiment D15, wherein the exogenous essential gene expression cassette is present in a plasmid carried by the bacterium, or the expression cassette of embodiment 18 or the expression cassette comprising the polynucleotide of embodiment 17 controlled by a strict hypoxia-inducible promoter is located in a plasmid carried by the bacterium.
[0242] Embodiment D17: The modified bacterium of any one of the preceding embodiments D, further comprising a pH-regulatable expression cassette comprising a gene encoding a bacterially derived hemolysin protein controlled by a promoter active under acidic pH conditions.
[0243] Embodiment D18: The modified bacterium of embodiment D17, wherein the bacterial-derived hemolysin protein is a Gram-negative bacterial hemolysin protein.
[0244] Embodiment D19: The modified bacterium of embodiment D18, wherein the gene encoding the Gram-negative bacterial hemolysin protein is hlyA or hlyE.
[0245] Embodiment D20: The modified bacterium of embodiment D19, wherein the hlyA or hlyE is from Listeria monocytogenes, Vibrio cholerae, or Escherichia coli.
[0246] Embodiment D21 . The modified bacterium of any one of embodiments D17 to D20, wherein the promoter active under acidic pH conditions is active at a pH of less than 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1 , 6.0, 5.9, 5.8, 5.7, 5.6, or 5.5.
[0247] Embodiment D22: The modified bacterium of any one of embodiments D17-D21, wherein the promoter active under acidic pH conditions is selected from sseA, ssrA, ssaB, ssaG, ssaM, and ssaR.
[0248] Embodiment D23: The modified bacterium of any one of embodiments D17-D21, wherein the promoter active under acidic pH conditions is sseA.
[0249] Embodiment D24: The modified bacterium of any preceding embodiment D, wherein the unmodified starting strain is a facultative anaerobic bacterium.
[0250] Embodiment D25: The modified bacterium of any preceding embodiment D, wherein the bacterium is an Enterobacteriaceae.
[0251] Embodiment D26: The modified bacterium of any of the preceding embodiments D, wherein the bacterium is an Escherichia, Salmonella, Shigella, Klebsiella, Yersinia, Citrobacter, Enterobacter, Serratia, Proteus, Morganella, Providencia, Hafnia, or Pantoea bacterium.
[0252] Embodiment D27: The modified bacterium of any of the preceding embodiments D, wherein the bacterium is selected from Escherichia coli such as Nissle strain and BL21 (DE3) strain, Escherichia cockroaches, Escherichia fergusonii, Escherichia hermannii, Escherichia wounds, Salmonella enterica, Salmonella bongori, Salmonella typhi, Salmonella choleraesuis, Salmonella typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella bodega, Shigella sonnei, Klebsiella pneumoniae, Klebsiella oxytoca, Yersinia pestis, Yersinia enterocolitica, Yersinia pseudotuberculosis, Yersinia auverii, Yersinia burnetii, Yersinia freundii, Yersinia intermedia, Yersinia kurzewi, Yersinia moorei, Yersinia rosea, Yersinia ruckeri, Citrobacter freundii, Citrobacter kozei Acidobacterium, Citrobacter braquei, Enterobacter aerogenes, Enterobacter cloacae, Enterobacter japonensis, Enterobacter sakazakii, Enterobacter tylosus, Enterobacter riveris, Enterobacter intermedia, Enterobacter afseri, Enterobacter carcinogenes, Enterobacter lyticus, Enterobacter superpressure, Serratia marcescens, Serratia entomophila, Serratia figi, Serratia izumi, Serratia grisei, Serratia liquefaciens, Serratia aromatica, Serratia puchengensis, Serratia longyanmao, Serratia crimson, Serratia urealyticum, Proteus mirabilis, Proteus vulgaris, Proteus mucogenes, Proteus pannei, Proteus houyi, Morganella morganii, Providencia alcaligenes, Providencia ruegensis, Providencia stuartii, Providencia rettgeri, Providencia henryi, Hafnia alvei, Pantoea agglomerans and Bacillus subtilis.
[0253] Embodiment D28. The modified bacterium of any preceding embodiment D, wherein the bacterium is Salmonella typhimurium.
[0254] Embodiment D29. The modified bacterium of embodiment D28, wherein the starting strain is Salmonella typhimurium SL7207.
[0255] Embodiment D30: The modified bacterium of any preceding embodiment D, wherein the bacterium expresses wild-type lipopolysaccharide (LPS).
[0256] Embodiment D31: The modified bacterium of any preceding embodiment D, wherein, upon administration to a subject having a tumor, the bacterium is able to survive and proliferate in tumor tissue but is rapidly cleared from normal tissue.
[0257] Embodiment D32: The modified bacterium of any preceding embodiment D, wherein the bacterium is capable of inhibiting the growth of the malignant tumor when administered to a subject having the malignant tumor.
[0258] Embodiment D33: The modified bacterium of any preceding embodiment D, wherein the bacterium is capable of inducing an anti-tumor specific immune response when administered to a subject having a malignant tumor.
[0259] Embodiment D34: The modified bacterium of any preceding embodiment D, wherein the bacterium is capable of inducing anti-tumor immune memory when administered to a subject having a malignant tumor.
[0260] Embodiment D35: The modified bacterium of any preceding embodiment D, which does not express wild-type flagellin.
[0261] Embodiment D36: The modified bacterium of any one of the preceding embodiments D, which lacks the fliC gene.
[0262] Embodiment D37: The modified bacterium of any preceding embodiment D, wherein the bacterium has a survival level in macrophages that is about 50% to about 30% of the survival level of the unmodified starting strain.
[0263] Embodiment D38. The modified bacterium of any one of embodiments D1-D36, wherein the bacterium has a survival level in macrophages that is about 30% to about 10% of the survival level of the unmodified starting strain.
[0264] Embodiment D39: The modified bacterium of any one of embodiments D1-D36, wherein the bacterium has a survival level in macrophages that is about 10% to about 1% of the survival level of the unmodified starting strain.
[0265] Implementation Method E
[0266] Embodiment E1: A modified bacterium, wherein compared to the unmodified starting strain, the bacterium comprises
[0267] i) the expression cassette of embodiment 18, the hypoxia-regulatable essential gene expression cassette and the pH-regulatable expression cassette, wherein the essential gene expression cassette comprises an essential gene of the bacterium under the control of a strictly hypoxia-inducible promoter; or
[0268] ii) an expression cassette comprising the polynucleotide of embodiment 17 and / or the essential gene under the control of a strictly hypoxia-inducible promoter and a pH-regulatable expression cassette,
[0269] The pH-regulatable expression cassette comprises a gene encoding a bacterial-derived hemolysin protein controlled by a promoter active under acidic pH conditions, wherein the bacteria express wild-type lipopolysaccharide (LPS) and the bacteria lack at least one gene required for survival in macrophages or its functional expression product.
[0270] Embodiment E2: The modified bacterium of embodiment El, wherein the strictly hypoxia-inducible promoter is selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA, and Ptet-Fnr.
[0271] Embodiment E3: The modified bacterium of embodiment El, wherein the strictly hypoxia-inducible promoter is the ssbp1 promoter.
[0272] Embodiment E4: The modified bacterium of any one of the preceding embodiments E, wherein the expression product of the essential gene is responsible for the synthesis of 2,6-diaminopimelate (DAP) in the bacterium, and when cultured under aerobic conditions, the growth of the bacterium is dependent on the additional addition of DAP or its analogue to the culture medium.
[0273] Embodiment E5. The modified bacterium of embodiment E4, wherein the essential gene is selected from the group consisting of dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof.
[0274] Embodiment E6. The modified bacterium of embodiment E4, wherein the essential gene is selected from the group consisting of dapA and dapE.
[0275] Embodiment E7: The modified bacterium of any preceding embodiment E, wherein the gene required for survival in macrophages is the STM3120, STM3119, slyA, sifA, SPI-2, phoP, or htrA gene.
[0276] Embodiment E8: The modified bacterium of any preceding embodiment E, wherein the functional expression product of the gene required for survival in macrophages is an HtrA serine protease family-related protein.
[0277] Embodiment E9: The modified bacterium of any preceding embodiment E, wherein the bacterium lacks HtrA serine protease activity.
[0278] Embodiment E10: The modified bacterium of any preceding embodiment E, wherein the gene required for survival in macrophages is htrA.
[0279] Embodiment E11. The modified bacterium of any preceding embodiment E, wherein the bacterium is deficient in htrA.
[0280] Embodiment E12: The modified bacterium of any one of embodiments E1 to E11, wherein the essential gene is a gene naturally present in the bacterial chromosome, wherein the natural promoter of the essential gene is functionally replaced by the strict hypoxia-inducible promoter, whereby the expression of the essential gene in the bacterium is completely controlled by the strict hypoxia-inducible promoter.
[0281] Embodiment E13: The modified bacterium of any one of embodiments E1-E11, wherein the essential gene expression cassette is exogenous and the essential gene naturally present in the bacterial chromosome is deleted or functionally inactivated, whereby expression of the essential gene in the bacterium is completely controlled by the strict hypoxia-inducible promoter.
[0282] Embodiment E14: The modified bacterium of embodiment E13, wherein the exogenous essential gene expression cassette is integrated into the chromosome of the bacterium, or the expression cassette of embodiment 18 or the expression cassette comprising the polynucleotide of embodiment 17 under the control of a strict hypoxia-inducible promoter is integrated into the chromosome of the bacterium.
[0283] Embodiment E15: The modified bacterium of embodiment E13, wherein the exogenous essential gene expression cassette is located outside the chromosome of the bacterium, or the expression cassette of embodiment 18 or the expression cassette comprising the polynucleotide of embodiment 17 controlled by a strict hypoxia-inducible promoter is located outside the chromosome of the bacterium.
[0284] Embodiment E16: The modified bacterium of embodiment E15, wherein the exogenous essential gene expression cassette is present in a plasmid carried by the bacterium, or the expression cassette of embodiment 18 or the expression cassette comprising the polynucleotide of embodiment 17 controlled by a strict hypoxia-inducible promoter is located in a plasmid carried by the bacterium.
[0285] Embodiment E17: The modified bacterium of any preceding embodiment E, wherein the bacterial-derived hemolysin protein is a Gram-negative bacterial hemolysin protein.
[0286] Embodiment E18: The modified bacterium of embodiment E17, wherein the gene encoding the Gram-negative bacterial hemolysin protein is hlyA or hlyE.
[0287] Embodiment E19: The modified bacterium of embodiment E18, wherein the hlyA or hlyE is from Listeria monocytogenes, Vibrio cholerae, or Escherichia coli.
[0288] Embodiment E20. The modified bacterium of any preceding embodiment E, wherein the promoter active under acidic pH conditions is active at a pH of less than 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6, or 5.5.
[0289] Embodiment E21. The modified bacterium of any preceding Embodiment E, wherein the promoter active under acidic pH conditions is selected from the group consisting of sseA, ssrA, ssaB, ssaG, ssaM, and ssaR.
[0290] Embodiment E22. The modified bacterium of any preceding Embodiment E, wherein the promoter active under acidic pH conditions is sseA.
[0291] Embodiment E23: The modified bacterium of any preceding Embodiment E, wherein the unmodified starting strain is a facultative anaerobic bacterium.
[0292] Embodiment E24: The modified bacterium of any preceding Embodiment E, wherein the bacterium is an Enterobacteriaceae.
[0293] Embodiment E25: The modified bacterium of any one of the preceding embodiments E, wherein the bacterium is an Escherichia, Salmonella, Shigella, Klebsiella, Yersinia, Citrobacter, Enterobacter, Serratia, Proteus, Morganella, Providencia, Hafnia, or Pantoea bacterium.
[0294] Embodiment E26: The modified bacterium of any one of the preceding embodiments E, wherein the bacterium is selected from Escherichia coli such as Nissle strain and BL21 (DE3) strain, Escherichia cockroaches, Escherichia fergusonii, Escherichia hermannii, Escherichia wounds, Salmonella enterica, Salmonella bongori, Salmonella typhi, Salmonella choleraesuis, Salmonella typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella bodega, Shigella sonnei, Klebsiella pneumoniae, Klebsiella oxytoca, Yersinia pestis, Yersinia enterocolitica, Yersinia pseudotuberculosis, Yersinia auverii, Yersinia burnetii, Yersinia freundii, Yersinia intermedia, Yersinia kurzewi, Yersinia moorei, Yersinia rosea, Yersinia ruckeri, Citrobacter freundii, Citrobacter kozei Acidobacterium, Citrobacter braquei, Enterobacter aerogenes, Enterobacter cloacae, Enterobacter japonensis, Enterobacter sakazakii, Enterobacter tylosus, Enterobacter riveris, Enterobacter intermedia, Enterobacter afseri, Enterobacter carcinogenes, Enterobacter lyticus, Enterobacter superpressure, Serratia marcescens, Serratia entomophila, Serratia figi, Serratia izumi, Serratia grisei, Serratia liquefaciens, Serratia aromatica, Serratia puchengensis, Serratia longyanmao, Serratia crimson, Serratia urealyticum, Proteus mirabilis, Proteus vulgaris, Proteus mucogenes, Proteus pannei, Proteus houyi, Morganella morganii, Providencia alcaligenes, Providencia ruegensis, Providencia stuartii, Providencia rettgeri, Providencia henryi, Hafnia alvei, Pantoea agglomerans and Bacillus subtilis.
[0295] Embodiment E27. The modified bacterium of any preceding Embodiment E, wherein the bacterium is Salmonella typhimurium.
[0296] Embodiment E28. The modified bacterium of Embodiment E27, wherein the starting strain is Salmonella typhimurium SL7207.
[0297] Embodiment E29: The modified bacterium of any preceding embodiment E, wherein, upon administration to a subject having a tumor, the bacterium is able to survive and proliferate in tumor tissue but is rapidly cleared from normal tissue.
[0298] Embodiment E30. The modified bacterium of any preceding embodiment E, wherein the bacterium is capable of inhibiting the growth of the malignant tumor when administered to a subject having the malignant tumor.
[0299] Embodiment E31 . The modified bacterium of any preceding embodiment E, wherein the bacterium is capable of inducing an anti-tumor specific immune response when administered to a subject having a malignant tumor.
[0300] Embodiment E32: The modified bacterium of any preceding embodiment E, wherein the bacterium is capable of inducing anti-tumor immune memory when administered to a subject having a malignant tumor.
[0301] Embodiment E33: The modified bacterium of any preceding Embodiment E, which does not express wild-type flagellin.
[0302] Embodiment E34: The modified bacterium of any preceding Embodiment E, which lacks the fliC gene.
[0303] Embodiment E35. The modified bacterium of any preceding embodiment E, wherein the bacterium has a survival level in macrophages that is about 50% to about 30% of the survival level of the unmodified starting strain.
[0304] Embodiment E36. The modified bacterium of any one of Embodiments E1-E34, wherein the bacterium has a survival level in macrophages that is about 30% to about 10% of the survival level of the unmodified starting strain.
[0305] Embodiment E37. The modified bacterium of any one of Embodiments E1-E34, wherein the bacterium has a survival level in macrophages that is about 10% to about 1% of the survival level of the unmodified starting strain.
[0306] Implementation Method F
[0307] Embodiment F1: A modified Salmonella typhimurium bacterium, wherein, compared to an unmodified starting strain, the bacterium comprises
[0308] i) the expression cassette of embodiment 18, the hypoxia-regulatable essential gene expression cassette and the pH-regulatable expression cassette, wherein the essential gene expression cassette comprises an essential gene of the bacterium under the control of a strictly hypoxia-inducible promoter; or
[0309] ii) an expression cassette comprising the polynucleotide of embodiment 17 and / or the essential gene under the control of a strictly hypoxia-inducible promoter and a pH-regulatable expression cassette,
[0310] The pH-regulatable expression cassette comprises a gene encoding a bacterial-derived hemolysin protein controlled by a promoter active under acidic pH conditions, wherein the bacteria express wild-type lipopolysaccharide (LPS) and the bacteria lack at least one gene required for survival in macrophages or its functional expression product.
[0311] Embodiment F2: The modified bacterium of embodiment F1, wherein the strictly hypoxia-inducible promoter is selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA, and Ptet-Fnr.
[0312] Embodiment F3: The modified bacterium of embodiment F1, wherein the strictly hypoxia-inducible promoter is the ssbp1 promoter.
[0313] Embodiment F4: The modified bacterium of any one of the preceding embodiments F, wherein the expression product of the essential gene is responsible for the synthesis of 2,6-diaminopimelate (DAP) in the bacterium, and when cultured under aerobic conditions, the growth of the bacterium is dependent on the additional addition of DAP or an analog thereof to the culture medium.
[0314] Embodiment F5. The modified bacterium of embodiment F4, wherein the essential gene is selected from the group consisting of dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof.
[0315] Embodiment F6. The modified bacterium of embodiment F4, wherein the essential gene is selected from the group consisting of dapA and dapE.
[0316] Embodiment F7: The modified bacterium of any preceding embodiment F, wherein the gene required for survival in macrophages is the STM3120, STM3119, slyA, sifA, SPI-2, phoP, or htrA gene.
[0317] Embodiment F8: The modified bacterium of any preceding embodiment F, wherein the gene required for survival in macrophages is a gene involved in or regulating an endogenous anti-oxidative stress response pathway.
[0318] Embodiment F9: The modified bacterium of embodiment F8, wherein the gene involved in or regulating the endogenous anti-oxidative stress response pathway is an HtrA serine protease family gene.
[0319] Embodiment F10: The modified bacterium of embodiment F9, wherein the functional expression product of the gene involved in or regulating the endogenous anti-oxidative stress response pathway is an HtrA serine protease family-related protein.
[0320] Embodiment F11. The modified bacterium of embodiment F9, wherein the bacterium lacks HtrA serine protease activity.
[0321] Embodiment F12: The modified bacterium of embodiment F9, wherein the gene involved in or regulating the endogenous antioxidant stress response pathway is htrA.
[0322] Embodiment F13. The modified bacterium of embodiment F9, wherein the bacterium is deficient in htrA.
[0323] Embodiment F14: The modified bacterium of any one of embodiments F1 to F13, wherein the essential gene is a gene naturally present in the chromosome of the bacterium, wherein the natural promoter of the essential gene is functionally replaced by the strict hypoxia-inducible promoter, whereby the expression of the essential gene in the bacterium is completely controlled by the strict hypoxia-inducible promoter.
[0324] Embodiment F15: The modified bacterium of any one of embodiments F1-F13, wherein the essential gene expression cassette is exogenous and the essential gene naturally occurring in the bacterial chromosome is deleted or functionally inactivated, whereby expression of the essential gene in the bacterium is fully controlled by the strict hypoxia-inducible promoter.
[0325] Embodiment F16: The modified bacterium of embodiment F15, wherein the exogenous essential gene expression cassette is integrated into the chromosome of the bacterium, or the expression cassette of embodiment 18 or the expression cassette comprising the polynucleotide of embodiment 17 under the control of a strict hypoxia-inducible promoter is integrated into the chromosome of the bacterium.
[0326] Embodiment F17: The modified bacterium of embodiment F15, wherein the exogenous essential gene expression cassette is located outside the chromosome of the bacterium, or the expression cassette of embodiment 18 or the expression cassette comprising the polynucleotide of embodiment 17 under the control of a strict hypoxia-inducible promoter is located outside the chromosome of the bacterium.
[0327] Embodiment F18: The modified bacterium of embodiment F17, wherein the exogenous essential gene expression cassette is present in a plasmid carried by the bacterium, or the expression cassette of embodiment 18 or the expression cassette comprising the polynucleotide of embodiment 17 controlled by a strict hypoxia-inducible promoter is located in a plasmid carried by the bacterium.
[0328] Embodiment F19: The modified bacterium of any preceding embodiment F, wherein the bacterial-derived hemolysin protein is a Gram-negative bacterial hemolysin protein.
[0329] Embodiment F20: The modified bacterium of embodiment F19, wherein the gene encoding the Gram-negative bacterial hemolysin protein is hlyA or hlyE.
[0330] Embodiment F21. The modified bacterium of Embodiment F20, wherein the hlyA or hlyE is from Listeria monocytogenes, Vibrio cholerae, or Escherichia coli.
[0331] Embodiment F22. The modified bacterium of any preceding embodiment F, wherein the promoter active under acidic pH conditions is active at a pH of less than 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6, or 5.5.
[0332] Embodiment F23. The modified bacterium of any preceding embodiment F, wherein the promoter active under acidic pH conditions is selected from the group consisting of sseA, ssrA, ssaB, ssaG, ssaM, and ssaR.
[0333] Embodiment F24: The modified bacterium of any preceding Embodiment F, wherein the promoter active under acidic pH conditions is sseA.
[0334] Embodiment F25. The modified bacterium of any preceding embodiment F, wherein the starting strain is Salmonella typhimurium SL7207.
[0335] Embodiment F26: The modified bacterium of any preceding embodiment F, wherein, when administered to a subject having a tumor, the bacterium is able to survive and proliferate in tumor tissue but is rapidly cleared from normal tissue.
[0336] Embodiment F27: The modified bacterium of any preceding embodiment F, wherein the bacterium is capable of inhibiting the growth of the malignant tumor when administered to a subject having the malignant tumor.
[0337] Embodiment F28: The modified bacterium of any preceding embodiment F, wherein the bacterium is capable of inducing an anti-tumor specific immune response when administered to a subject having a malignant tumor.
[0338] Embodiment F29: The modified bacterium of any preceding embodiment F, wherein the bacterium is capable of inducing anti-tumor immune memory when administered to a subject having a malignant tumor.
[0339] Embodiment F30: The modified bacterium of any preceding embodiment F, which does not express wild-type flagellin.
[0340] Embodiment F31: The modified bacterium of any preceding embodiment F, which lacks the fliC gene.
[0341] Embodiment F32: The modified bacterium of any preceding embodiment F, wherein the bacterium has a survival level in macrophages that is about 50% to about 30% of the survival level of the unmodified starting strain.
[0342] Embodiment F33. The modified bacterium of any one of Embodiments F1-F31, wherein the bacterium has a survival level in macrophages that is about 30% to about 10% of the survival level of the unmodified starting strain.
[0343] Embodiment F34. The modified bacterium of any one of Embodiments F1-F31, wherein the bacterium has a level of survival in macrophages that is about 10% to about 1% of the level of survival of the unmodified starting strain.
[0344] Implementation Method K
[0345] Embodiment K1: A pharmaceutical composition comprising an effective amount of the modified bacterium of any one of Embodiments A, B, C, D, E, or F above.
[0346] Embodiment K2: The pharmaceutical composition of embodiment K1, which is used for treating malignant tumors.
[0347] Embodiment K3: The pharmaceutical composition of embodiment K1, for inducing an anti-tumor specific immune response in a subject suffering from a malignant tumor.
[0348] Embodiment K4: The pharmaceutical composition of embodiment K1, for inducing anti-tumor immune memory in a subject suffering from a malignant tumor.
[0349] Embodiment K5: The pharmaceutical composition of embodiment K1, which is used for preventing or treating metastasis or recurrence of malignant tumors.
[0350] Embodiment K6: The pharmaceutical composition of embodiment K1, which is used to treat malignant tumors that are resistant to or have failed to respond to previous anti-tumor therapies.
[0351] Embodiment K7: The pharmaceutical composition of Embodiments K1-K6, wherein the modified bacterium is a live bacterium.
[0352] Implementation Method L
[0353] Embodiment L1: A method for treating a malignant tumor, comprising administering to a subject suffering from a malignant tumor an effective amount of the modified bacteria of any one of the aforementioned embodiments A, B, C, D, E, or F, or the pharmaceutical composition of any one of the embodiments G.
[0354] Embodiment L2: A method for inducing an anti-tumor specific immune response in a subject suffering from a malignant tumor, comprising administering to the subject an effective amount of the modified bacteria of any of the aforementioned embodiments A, B, C, D, E, or F, or the pharmaceutical composition of any of the embodiments G.
[0355] Embodiment L3: A method for inducing anti-tumor immune memory in a subject suffering from a malignant tumor, comprising administering to the subject an effective amount of a modified bacterium of any of the foregoing embodiments A, B, C, D, E, or F, or a pharmaceutical composition of any of the foregoing embodiments G.
[0356] Embodiment L4: A method for preventing or treating metastasis or recurrence of a malignant tumor, comprising administering to a subject suffering from a malignant tumor an effective amount of the modified bacteria of any of the aforementioned embodiments A, B, C, D, E, or F, or the pharmaceutical composition of any of the embodiments G.
[0357] Embodiment L5: A method for preventing or treating metastasis or recurrence of a malignant tumor, comprising administering an effective amount of the modified bacteria of any of the aforementioned embodiments A, B, C, D, E, or F, or the pharmaceutical composition of any of the embodiments G, to a subject suffering from metastasis or recurrence of a malignant tumor or a subject at high risk of metastasis or recurrence of a malignant tumor.
[0358] Embodiment L6: A method for treating a malignant tumor that has become resistant to or has failed previous anti-tumor therapy, comprising administering an effective amount of the modified bacteria of any of the aforementioned embodiments A, B, C, D, E, or F, or the pharmaceutical composition of any of the embodiments G to a subject suffering from a malignant tumor that has become resistant to or has failed previous anti-tumor therapy.
[0359] Embodiment L7. The method of Embodiments L1-L6, wherein the modified bacterium is viable.
[0360] Implementation Method M
[0361] Embodiment M1: Use of the modified bacterium according to any one of the aforementioned embodiments A, B, C, D, E, or F in the preparation of a medicament for treating a malignant tumor.
[0362] Embodiment M2: Use of the modified bacterium of any of the aforementioned embodiments A, B, C, D, E, or F in the preparation of a medicament for inducing an anti-tumor specific immune response in a subject suffering from a malignant tumor.
[0363] Embodiment M3: Use of the modified bacteria of any of the aforementioned embodiments A, B, C, D, E, or F in the preparation of a medicament for inducing anti-tumor immune memory in a subject suffering from a malignant tumor.
[0364] Embodiment M4: Use of the modified bacterium of any one of the aforementioned embodiments A, B, C, D, E, or F in the preparation of a medicament for preventing or treating metastasis or recurrence of a malignant tumor.
[0365] Embodiment M5: Use of the modified bacterium of any one of the aforementioned embodiments A, B, C, D, E, or F in the preparation of a medicament for treating a malignant tumor that is resistant to or has failed previous anti-tumor therapy.
[0366] Embodiment M6: The use of embodiments M1-M5, wherein the modified bacterium is viable.
[0367] Implementation Method N
[0368] Embodiment N1: The pharmaceutical composition of any one of Embodiments K, the method of any one of Embodiments L, or the use of any one of Embodiments M, wherein the malignant tumor is a malignant tumor of the nervous system, respiratory system, digestive system, urinary system, reproductive system, hematopoietic system, lymphatic system, endocrine system, or skin and mucosa.
[0369] Embodiment N2: The pharmaceutical composition of any one of Embodiments K, the method of any one of Embodiments L, or the use of any one of Embodiments M, wherein the malignancy is a sarcoma or a carcinoma.
[0370] Embodiment N3: The pharmaceutical composition of any one of Embodiments K, the method of any one of Embodiments L, or the use of any one of Embodiments M, wherein the malignant tumor is a solid tumor.
[0371] Embodiment N4: The pharmaceutical composition of any one of Embodiments K, the method of any one of Embodiments L, or the use of any one of Embodiments M, wherein the malignant tumor is selected from glioma, neuroblastoma, retinoblastoma, nasopharyngeal cancer, oral cancer, tongue cancer, laryngeal cancer, head and neck cancer, melanoma, bronchial cancer, lung cancer, pleural cancer, esophageal cancer, gastric cancer, liver cancer, pancreatic cancer, bile duct cancer, colon cancer, rectal cancer, renal cell carcinoma, bladder cancer, prostate cancer, adrenal tumor, thyroid cancer, parathyroid cancer, pituitary tumor, Hodgkin's disease, non-Hodgkin's lymphoma, multiple myeloma, cervical cancer, ovarian cancer, endometrial cancer, breast cancer, bone cancer, and osteosarcoma.
[0372] Embodiment N5: The pharmaceutical composition of any of Embodiments K, the method of any of Embodiments L, or the use of any of Embodiments M, wherein the bacteria, drug, or pharmaceutical composition is administered intravenously, intratumorally, intramuscularly, subcutaneously, intraperitoneally, intracerebrally, gastrointestinally, topically, orally, nasally, rectally, or vaginally.
[0373] definition
[0374] "Polypeptide," "peptide," and "protein" are used interchangeably herein to refer to polymers of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residues is an artificial chemical analog of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. The terms "polypeptide," "peptide," "amino acid sequence," and "protein" may also include modified forms, including but not limited to glycosylation, lipid attachment, sulfation, gamma carboxylation of glutamic acid residues, hydroxylation, and ADP-ribosylation. Such modifications also include modifications to the polypeptide sequence, including but not limited to substitutions, deletions, insertions, and / or additions of one or more amino acids.
[0375] The term "amino acid" includes naturally occurring amino acids and non-natural amino acids in proteins. The single-letter and three-letter names for naturally occurring amino acids in proteins are those commonly used in the art and can be found in Sambrook.
[0376] For the present invention, in order to determine the percentage of identity between two amino acid sequences or two nucleic acid sequences, the sequences are aligned for the purpose of optimal comparison (for example, a gap may be introduced in the first amino acid or nucleic acid sequence for optimal alignment with the second amino acid or nucleic acid sequence). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide at the corresponding position in the second sequence, the molecules are identical at this position. The percentage of identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., percentage of identity = number of identical positions / total number of positions (i.e., overlapping positions) × 100). Preferably, the two sequences are of the same length.
[0377] Those skilled in the art are aware that various computer programs can be used to determine the identity between two sequences.
[0378] "Percent amino acid identity" or "percent amino acid sequence identity" means that when the amino acids of two polypeptides are compared, the two polypeptides, when optimally aligned, have approximately the specified percentage of identical amino acids. For example, "95% amino acid identity" means that when the amino acids of two polypeptides are compared, the two polypeptides, when optimally aligned, have 95% of the same amino acids.
[0379] The term "conservative substitution", also referred to as substitution by a "homologous" amino acid residue, refers to substitutions in which the amino acid residue is replaced by an amino acid residue having a similar side chain, for example, amino acids with basic side chains (also referred to as basic amino acids, such as lysine, arginine and histidine), amino acids with acidic side chains (also referred to as acidic amino acids, such as aspartic acid, glutamic acid), non-charged polar side chain amino acids (also referred to herein as neutral amino acids, such as glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chain amino acids (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chain amino acids (e.g., threonine, valine, isoleucine) and aromatic side chain amino acids (e.g., tyrosine, phenylalanine, tryptophan, histidine).
[0380] As used herein, the term "hypoxia regulated essential gene expression cassette" refers to a segment of DNA capable of initiating expression of an essential gene under hypoxic conditions, which contains an essential gene controlled by a hypoxia-inducible promoter and, if necessary, may further contain other regulatory elements required for expression of the essential gene.
[0381] As used herein, an "essential gene" refers to a gene that plays a decisive role in the growth and / or survival of bacteria. If the bacteria lack this gene or its functional expression product, they will not be able to survive, divide, and / or grow normally. Typical examples of bacteria lacking essential genes or their functional expression products are auxotrophic strains, which, in the absence of specific exogenous supplements, cannot survive, divide, and / or grow normally under in vitro culture conditions or in vivo environments. Essential genes are typically present in a single copy on the bacterial chromosome.
[0382] As used herein, a "strictly hypoxia inducible promoter" refers to a promoter that can initiate transcription of a specific gene under anaerobic conditions but can hardly be activated and produce transcripts under aerobic conditions.
[0383] A "strictly hypoxia-inducible promoter" useful in the present invention can be identified by the following experiment:
[0384] Construct an expression strain containing the essential gene (e.g., dapA / dapE) under the control of the promoter to be tested. Streak a Luria-Bertani (LB) plate in an anaerobic incubator at 37°C for 24 hours. Under anaerobic conditions, pick a single colony and resuspend it in 20 μl of LB liquid medium. Add 20 μl of the resuspended single colony to each of the following four tubes: ABCD. Add 5 μl to each tube:
[0385] A. 2 ml LB liquid medium,
[0386] B. 2 ml LB liquid medium,
[0387] C.2ml LB liquid medium + DAP,
[0388] D. 2 ml LB liquid medium + DAP.
[0389] Incubate tubes AC at 37°C in an anaerobic incubator for 24 hours, and incubate tubes BD in an aerobic shaker at 37°C for 24 hours. If bacteria can grow in tubes ACD but not in tube B (OD600 value less than 0.05), the promoter is considered to be strictly hypoxia-inducible.
[0390] Table 1 lists exemplary strictly hypoxia-inducible promoters identified in the above experiments that can be used in the present invention.
[0391] As used herein, "gene involved in or regulating the endogenous anti-oxidative stress response pathway" refers to a gene that participates in the resistance of bacteria (e.g., intracellular bacteria, such as Salmonella) to the killing effects of reactive oxygen species (ROS) in vivo or in vitro environments.
[0392] As used herein, "genes required for survival in macrophages" refer to genes involved in maintaining or enhancing the ability of intracellular bacteria to survive in macrophages. The functions of these gene products are related to resisting the killing effect of macrophages on microorganisms. Therefore, the deletion of these genes or their functional expression products can reduce the ability of bacteria (e.g., intracellular bacteria, such as Salmonella) to survive in macrophages.
[0393] In this article, "functional expression products" include RNA and protein, etc.
[0394] As used herein, "facultative anaerobic bacteria" refers to bacteria that can survive both in the presence and absence of oxygen.
[0395] As used herein, "pH regulated expression cassette" refers to a group of gene expression elements whose expression of related genes is regulated by the environmental pH.
[0396] As used herein, "a promoter that is active under acid pH conditions" refers to a promoter that can be activated under acidic pH conditions and regulates the expression of a related gene. In some embodiments, the promoter that is active under acidic pH conditions of the present invention can be activated or still has promoter activity when the pH value is lower than 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6 or 5.5. In some embodiments, the promoter that is active under acidic pH conditions also has promoter activity at neutral pH values (e.g., pH 7.0-7.4). Example
[0397] Example 1: Construction of IPTG-inducible plasmid expressing human interleukin-10 protein
[0398] 1.1 The target fragments were obtained by PCR amplification using pET22b-pelB-Amp (SEQ ID NO: 1) plasmid and pSC101-huil10-Amp (SEQ ID NO: 2) plasmid as templates, respectively.
[0399] For pET22b-pelB-Amp, the following primer sequences were used to amplify fragment 1 (pET22b-pelB-Amp):
[0400] Forward primer CACCACCACCACCACCACTGAGATCCG (SEQ ID NO: 35); and
[0401] Reverse primer ATCATCATCATCATCGGCCATCGCCGGCTGGGC (SEQ ID NO: 36).
[0402] For pSC101-huil10-Amp, the following primer sequences were used to amplify fragment 2 (D5linker-huil10):
[0403] Forward primer TGGCCGATGATGATGATGATAGCCCGGGTCAGGGTACGCA (SEQ ID NO: 37); and
[0404] Reverse primer TCATGGTGGTGGGTGGTGGTGATTACGGATTTTCATGGTCATATATGC (SEQ ID NO: 38).
[0405] For pSC101-huil10-Amp, the following primer sequences were used to amplify the control fragment 3 (huil10):
[0406] Forward primer TGGCCAGCCCGGGTCAGGGTACGCA (SEQ ID NO: 39); and
[0407] Reverse primer TCATGGTGGTGGGTGGTGGTGATTACGGATTTTCATGGTCATATATGC (SEQ ID NO: 40)
[0408] PCR amplification was performed using PrimeSTAR Max DNA Polymerase (Takara #R054A) in the following system.
[0409] PCR reaction system
[0410] The PCR reaction conditions were as follows: denaturation at 98°C for 10 sec, annealing at 55°C for 10 sec, and extension at 72°C for 5 sec / kb, with a total of 30 cycles of denaturation-annealing-extension.
[0411] 1.2 Fragments 1 and 2 were recombined, and fragments 1 and 3 were recombined, respectively, using the ClonExpress II One Step Cloning Kit (Vazyme #C112) according to the manufacturer's instructions. The recombinant plasmids were chemically transformed into cloning competent cells (DH5α Competent E. coli Strain, Vazyme #C502). The recombinant plasmids were named plasmid-pET22b-pelB-D5-huil10-Amp (SEQ ID NO: 3) and plasmid-pET22b-pelB-huil10-Amp (SEQ ID NO: 4).
[0412] The gene sequence of interleukin-10 with the N-terminal fusion of the prokaryotic signal peptide pelB and the polar negatively charged aspartic acid Asp connecting peptide is shown in the Appendix (SEQ ID NO: 5), and the connecting peptide is shown in bold.
[0413] 1.3 PCR reaction identification was performed on the cloned competent cells DH5α carrying the recombinant plasmids plasmid-pET22b-pelB-D5-huil10-Amp and plasmid-pET22b-pelB-huil10-Amp using the following identification primers: forward identification primer 1F sequence: CTCGACGCTCTCCCTTATG (SEQ ID NO: 41), reverse identification primer 1R sequence: CTGACATGGCTTTATAGATACCT (SEQ ID NO: 42).
[0414] Positive clones were cultured in LB liquid medium containing penicillin (Amp, 100 mg / L) and plasmids were extracted (Plasmid Mini Kit I OMEGA #D6943-03).
[0415] Example 2: Construction of Escherichia coli strain BL21 (DE3) expressing human interleukin-10 protein induced by IPTG
[0416] The recombinant plasmid was transformed into the recombinant protein expression strain BL21 (DE3) (BL21 (DE3) Competent E. coli Strain, Vazyme # C504-03) by chemical transformation. Specifically, thaw the competent cells on ice, mix 100 ng of the recombinant plasmid with the competent cells, and let it stand on ice for 30 minutes. After heat shock in a 42°C water bath for 45 seconds, immediately place it on ice for 3 minutes. Add 900 μL of LB medium (without antibiotics), shake at 37°C for 1 hour (speed 200-250 rpm), centrifuge at 5,000 rpm for 5 minutes, discard 900 μL of supernatant, resuspend the cells in the remaining medium, and gently spread them evenly on an LB plate containing penicillin (Amp, 100 mg / L) using a sterile spreader. Invert the plate and culture in a 37°C incubator overnight.
[0417] The BL21(DE3)-plasmid-pET22b-pelB-D5-huil10-Amp and BL21(DE3)-plasmid-pET22b-pelB-huil10-Amp strains were successfully constructed by PCR and electrophoresis. The identification primers were the identification primers 1F / 1R described in 1.3 above.
[0418] Example 3: Expression and secretion of interleukin-10 by strain BL21(DE3)-plasmid-pET22b-pelB-D5-huil10-Amp
[0419] 3.1 Remove the frozen strain (the strain constructed in Example 2) from -80°C, place on ice until thawed, and streak the strain onto an LB plate containing penicillin (Amp, 100 mg / L). Place the plate in a 37°C incubator and incubate overnight. The next day, pick a single, vigorous, and solitary colony and inoculate it into a sterile culture tube containing 4 mL of LB medium containing penicillin (Amp, 100 mg / L) and incubate at 37°C. When the culture reaches an OD of 0.4-0.5, add IPTG to a final concentration of 0.1 mM and induce overnight in a shaker at 16°C (14-16 hours, 200-250 rpm). Remove the culture and place it on ice.
[0420] 3.2 Centrifuge the culture at 4,200 rpm at 4°C for 10 min, and collect the bacterial pellet and LB culture supernatant. Place the LB culture supernatant in an ultrafiltration tube (Amicon Ultra, #UFC901096) and centrifuge at 2,500 rpm at 4°C for 2 h. Collect the concentrated LB culture supernatant, which contains the secreted IL-10.
[0421] 3.3 Add lysis buffer (Qiagen, Qproteome Bacterial Protein Prep Kit #37900, refer to the experimental manual Qproteome Bacterial Protein Preparation Handbook, www.qiagen.com) to the bacterial pellet and place on ice for 30 minutes. Then centrifuge at 14,000 rpm at 4°C for 30 minutes to collect the bacterial debris pellet and lysis buffer supernatant. The bacterial debris pellet contains functional inclusion body proteins, and the lysis supernatant contains the expressed, unsecreted soluble protein.
[0422] 3.4 Characterization of expressed and secreted interleukin-10
[0423] 3.4.1 Add 5× SDS loading buffer (Biyuntian, #P0015) to the collected samples (concentrated LB culture supernatant, bacterial fragment pellet, and lysate supernatant) and incubate at 100°C in a metal bath for 5 min. Then perform SDS-PAGE: electrophoresis at 80 V for 20 min. After the sample is transferred to the interface of the separating gel and the stacking gel, increase the voltage to 120 V and continue until the dye completely leaves the gel.
[0424] 3.4.2 According to the instructions, use the Pyxis transfection transfer membrane (PVDF membrane) and transfection instrument to transfer the membrane. After transfer, the membrane was washed with TBS buffer and TBST buffer in sequence; the PVDF membrane was blocked with 5% skim milk (dissolved in TBST buffer) at room temperature for 1 h; the primary antibody (6*his, his-tag monoclonal antibody, Proteintech, #66005-1-lg) was diluted at a ratio of 1:10000 in 5% skim milk and incubated overnight at 4°C; the PVDF membrane after overnight incubation was washed several times with TBST buffer to remove the antibodies on the membrane surface; the secondary antibody (HRP-conjugated Affinipure Goat Anti-Rabbit IgG (H+L), Proteintech, #SA00001-2-100UL) was diluted at a ratio of 1:5000 in 5% skim milk and incubated at room temperature for 1 h; the incubated PVDF membrane was washed several times with TBST buffer to remove unbound antibodies on the membrane surface, and finally the membrane was immersed in TBS. The prepared developing AB solution was mixed in a 1:1 ratio, the membrane was placed in a tray, the AB solution was poured in, and the exposure reaction was performed for 5 minutes and imaging was performed using a Jena multifunctional imager (Thermo Fisher, SuperSignal TM West Pico PLUS Chemiluminescent Substrate).
[0425] As shown in Figure 1, when the D5 peptide linker is present in the fusion polypeptide, Escherichia coli can be induced by IPTG to express and secrete IL-10, while in the absence of the D5 peptide linker, Escherichia coli can be induced by IPTG to express IL-10, but the expressed IL-10 cannot be secreted extracellularly.
[0426] Example 4: Construction of a plasmid constitutively expressing human interleukin-10 protein
[0427] 4.1 The target fragment was obtained by PCR amplification using plasmid-pET22b-pelB-D5-huil10-Amp (SEQ ID NO: 3) and pSC101-ptac-sfGFP-KanR (SEQ ID NO: 6) as templates, respectively.
[0428] For pSC101-ptac-sfGFP-KanR (SEQ ID NO: 6), the following primer sequences were used to amplify fragment 4 (pSC101-ptac-KanR):
[0429] Forward primer CTGCTAACAAAGCCCGAAAG (SEQ ID NO: 43); and
[0430] Reverse primer CTTTCCTGTGTGAATTATTTCTAGAGG (SEQ ID NO: 44).
[0431] For plasmid-pET22b-pelB-D5-huil10-Amp (SEQ ID NO: 3), the following primer sequences were used to amplify fragment 5 (pelB-D5linker-huil10):
[0432] Forward primer
[0433] AAATAATTCACACAGGAAAGtataCACATCATGAAATACCTGCTGCCG (SEQ ID NO: 45); and
[0434] Reverse primer
[0435] CTTTCGGGCTTTGTTAGCAGCCTTTCGGGCTTTGTTAGCA (SEQ ID NO: 46), annealing temperature 55°C.
[0436] For plasmid-pET22b-pelB-huil10-Amp (SEQ ID NO: 4), the following primer sequences were used to amplify fragment 6 (pelB-huil10):
[0437] Forward primer
[0438] AAATAATTCACACAGGAAAGtataCACATCATGAAATACCTGCTGCCG (SEQ ID NO: 45); and
[0439] Reverse primer
[0440] CTTTCGGGCTTTGTTAGCAGCCTTTCGGGCTTTGTTAGCA (SEQ ID NO: 46), annealing temperature 55°C.
[0441] 4.2 Fragments 4 and 5 were recombined, and fragments 4 and 6 were recombined using the ClonExpressⅡ One Step Cloning Kit (Vazyme#C112). The recombinant plasmids were chemically transformed into cloning competent cells (DH5α Competent E. coli Strain, Vazyme#C502) and named plasmid-pSC101-ptac-pelB-D5-huil10-KanR (SEQ ID NO: 7) and plasmid-pSC101-ptac-pelB-huil10-KanR (SEQ ID NO: 8).
[0442] 4.3 PCR reaction identification was performed on the cloned competent cells DH5α carrying the recombinant plasmids plasmid-pSC101-ptac-pelB-D5-huil10-KanR and plasmid-pSC101-ptac-pelB-huil10-KanR using the following identification primers: forward identification primer 2F sequence: CCGTCTTACTGTCAAGAGGAC (SEQ ID NO: 47), reverse identification primer 2R sequence: CTGACATGGCTTTATAGATACCT (SEQ ID NO: 48).
[0443] Positive clones were cultured in LB liquid medium containing kanamycin (50 mg / L) and plasmids were extracted (Plasmid Mini Kit I OMEGA #D6943-03).
[0444] Example 5: Construction of Escherichia coli strain BL21 (DE3) constitutively expressing human interleukin-10 protein
[0445] According to a method similar to Example 2 (except using LB plates containing 50 mg / L kanamycin), plasmids plasmid-pSC101-ptac-pelB-D5-huil10-KanR and plasmid-pSC101-ptac-pelB-huil10-KanR were chemically transformed into the recombinant protein expression strain BL21 (DE3) (Shanghai Sangon Biotech Co., Ltd., B528419, for chemical transformation methods, refer to the product manual https: / / store.sangon.com / product).
[0446] The BL21(DE3)-plasmid-pSC101-ptac-pelB-D5-huil10-KanR and BL21(DE3)-plasmid-pSC101-ptac-pelB-huil10-KanR strains were successfully constructed by PCR electrophoresis using the aforementioned primers 2F / 2R.
[0447] Example 6: Expression and secretion of interleukin-10 by strain BL21(DE3)-plasmid-pSC101-ptac-pelB-D5-huil10-KanR
[0448] 6.1 Remove the frozen strain (the strain constructed in Example 5) from -80°C, place on ice until thawed, and streak the strain onto an LB plate containing 50 mg / L kanamycin. Place the plate in a 37°C incubator and incubate overnight. The next day, select a single, actively growing colony and inoculate it into a sterile culture tube containing 4 mL of LB liquid medium containing 50 mg / L kanamycin. Incubate overnight, then remove the culture and place it on ice.
[0449] 6.2 Centrifuge the culture at 4,200 rpm for 10 minutes, and collect the bacterial pellet and LB culture supernatant. Place the LB culture supernatant in an ultrafiltration tube (Amicon Ultra, #UFC901096) and centrifuge at 2,500 rpm at 4°C for 2 hours. Collect the concentrated LB culture supernatant, which contains the secreted IL-10.
[0450] 6.3 Add lysis buffer (Qiagen, #37900) to the bacterial pellet and place on ice for 30 minutes. Then centrifuge at 14,000 rpm at 4°C for 30 minutes to collect the bacterial debris pellet and lysis buffer supernatant. The bacterial debris pellet contains functional inclusion body proteins, while the lysis buffer supernatant contains the expressed, unsecreted soluble protein.
[0451] 6.4 Western Blot Analysis of Expressed and Secreted IL-10
[0452] As described in Example 3.4, IL-10 in each sample was analyzed by Western blot. The experimental results, shown in Figure 2, show that in the presence of a D5 peptide linker in the fusion polypeptide, E. coli can express and secrete IL-10 via the ptac constitutive promoter. However, in the absence of the D5 peptide linker, the IL-10 expressed by E. coli is not secreted extracellularly.
[0453] Example 7: Effect of peptide linkers on IL-10 secretion
[0454] The purpose of this example is to identify the effects of different peptide linkers on the expression and secretion of IL-10 in bacteria.
[0455] To this end, the inventors constructed peptide linkers as shown in Table 2 based on the acidity and polarity of amino acids, the types of uncharged amino acids, and the number of amino acids.
[0456] Table 2. Peptide linkers and their encoding nucleotide sequences
[0457] The nucleotide sequences encoding the peptide linkers in Table 2 were respectively inserted between the nucleotide sequence encoding the signal peptide and the nucleotide sequence encoding huIL10 in the plasmid plasmid-pET22b-pelB-huil10-Amp (SEQ ID NO: 4) using the ClonExpressⅡ One Step Cloning Kit (Vazyme#C112) to obtain plasmids plasmid-pET22b-pelB-peptide linker-huil10-Amp encoding different pelB+peptide linker+huil10 fusion polypeptides, wherein plasmid-pET22b-pelB-D5-huil10-Amp was prepared as in Example 1.
[0458] As described in Examples 2 and 3, the prepared plasmids were transformed into E. coli and the expression of the fusion polypeptides was tested. As shown in Figure 3, fusion polypeptides containing peptide linkers D4 and D5 were expressed and secreted from E. coli into the culture supernatant, while fusion polypeptides containing other peptide linkers were expressed but no secretion from E. coli into the culture supernatant was detected.
[0459] Example 8: Plasmids for constitutively overexpressing and secreting human / murine interleukin-10
[0460] The purpose of this example is to construct a plasmid that constitutively overexpresses and secretes human / murine interleukin-10 and to test the secretion effect of a fusion polypeptide (pelB-D5-huil10) containing the peptide linker D5 on different bacterial chassis and plasmids with different copy numbers.
[0461] 8.1. Construction of a plasmid for constitutive high expression and secretion of human interleukin-10
[0462] The pelB-D5-huil10 DNA fragment was amplified by PCR using the plasmid-pET22b-pelB-D5-huil10-Amp (SEQ ID NO: 3) as a template; the linear fragment was amplified by PCR using the plasmid pUC-ptac-bba0032-KanR (SEQ ID NO: 50) as a template.
[0463] The forward primer for amplifying pelB-D5-huil10 is:
[0464] AAATAATTCACACAGGAAAGtataCACATCATGAAATACCTGCTGCCG (SEQ ID NO: 45);
[0465] The reverse primer is:
[0466] CTTTCGGGCTTTGTTAGCAGCCTTTCGGGCTTTGTTAGCA (SEQ ID NO: 46), annealing temperature 55°C.
[0467] The forward primer for amplifying pUC-ptac-bba0032-KanR is as follows:
[0468] CTTTCCTGTGTGAattatttctagagg(SEQ ID NO:44)
[0469] The reverse primer was caccgctgagcaataactag (SEQ ID NO: 49), with an annealing temperature of 55°C.
[0470] The fragments were recombined using the ClonExpressⅡ One Step Cloning Kit (Vazyme#C112) and chemically transformed into cloning competent cells (DH5α Competent E. coli Strain, Vazyme#C502). The recombinant plasmid was named plasmid-pUC-ptac-pelB-D5-huil10-KanR (SEQ ID NO: 51).
[0471] Transformed clones were identified using the following primers:
[0472] iden-bb-F:ctgattctgtggACAAGAGG; and
[0473] iden-huil10-R:CAGGATCCTGATTTTCTGCC.
[0474] 8.2. Construction of a plasmid for constitutive high expression and secretion of mouse interleukin-10
[0475] Plasmid plasmid-pET22b-pelB-D5-mil10-Amp containing the nucleotide sequence encoding mouse interleukin 10 was synthesized as a template, pelB-D5-mil10 was amplified as described above, and recombined with the pUC-ptac-bba0032-KanR plasmid backbone using the Novigene one-step cloning kit to obtain a recombinant plasmid constitutively expressing mouse interleukin 10, named plasmid-pUC-ptac-pelB-D5-mil10-KanR (SEQ ID NO: 52).
[0476] The primers for amplifying pelB-D5-mil10 are consistent with the primers for constructing human interleukin plasmid mentioned above.
[0477] The forward primer is:
[0478] AAATAATTCACACAGGAAAGtataCACATCATGAAATACCTGCTGCCG (SEQ ID NO: 45);
[0479] The reverse primer is:
[0480] CTTTCGGGCTTTGTTAGCAGCCTTTCGGGCTTTGTTAGCA (SEQ ID NO: 46), annealing temperature 55°C.
[0481] The forward primer for amplifying pUC-ptac-bba0032-KanR was CTTTCCTGTGTGAattatttctagagg (SEQ ID NO: 44); the reverse primer was caccgctgagcaataactag (SEQ ID NO: 49), and the annealing temperature was 55°C.
[0482] The fragments were recombined using the ClonExpressⅡOne Step Cloning Kit (Vazyme#C112) and chemically transformed into cloning competent cells (DH5αCompetent E.coli Strain, Vazyme#C502). The recombinant plasmid was named plasmid-pUC-ptac-pelB-D5-mil10-KanR (SEQ ID NO: 52).
[0483] Transformed clones were identified using the following primers:
[0484] iden-bb-F:ctgattctgtggACAAGAGG; and
[0485] iden-huil10-R:CAGGATCCTGATTTTCTGCC.
[0486] Example 9: Construction of variant strains of Salmonella typhimurium SL7207
[0487] 9.1 Target fragments were amplified by PCR using the PsseA-hlyA-loxp-KnaR-loxp plasmid (SEQ ID NO:55) and the Pssbp1-dapE-Cm plasmid (SEQ ID NO:56) as templates. For PsseA-hlyA-loxp-KnaR-loxp, the following primer sequences were used: forward primer (SEQ ID NO:57) and reverse primer (SEQ ID NO:58); for Pssbp1-dapE-Cm, the following primer sequences were used: forward primer (SEQ ID NO:59) and reverse primer (SEQ ID NO:60). The annealing temperature was 55°C. Target fragment 1 was PsseA-hlyA-loxp-KnaR-loxp (SEQ ID NO:53), and target fragment 2 was Pssbp1-dapE-Cm (SEQ ID NO:54).
[0488] 9.2 The pSim6 plasmid containing λ phage Red recombinase (BioVector NTCC Inc.: 3574840) was introduced into the facultative anaerobic Salmonella enterica serovar SL7207 strain (NCBI: ASM1320710v1) to prepare electroporation competent cells SL7207 (pSim6) containing the pSim6 plasmid.
[0489] 9.3 Introduce target fragment 1 into SL7207 (pSim6) competent cells via electroporation (E = 18 kV / cm). Utilize λ-red homologous recombination technology to replace the dapE gene (which regulates the synthesis of diaminopimelane, essential for cell wall synthesis) in the SL7207 genome with target fragment 1. Specifically, the target strain containing the pSim6 plasmid was cultured at 30°C and the recombinase expression conditions were 42°C for 15 minutes. Homologous arms containing 50 bp upstream and downstream of the target gene locus were added to the PCR primers. Under the action of the homologous recombinase, the homologous recombination process was completed, resulting in the SL7207 (ΔdapE::PsseA-hlyA-KnaR) strain.
[0490] 9.4 The Cre plasmid containing the P1 phage Cre recombinase (Gene Bridges: A112) was introduced into the SL7207 (ΔdapE::PsseA-hlyA-KnaR) strain to remove kanamycin resistance by recombination, thereby obtaining the SL7207 (ΔdapE::PsseA-hlyA) strain.
[0491] 9.5 Introduce the pSim6 plasmid into the SL7207 (ΔdapE::PsseA-hlyA) strain; prepare SL7207 (ΔdapE::PsseA-hlyA) (pSim6) electroporation competent cells.
[0492] 9.6 Target fragment 2 was introduced into SL7207(ΔdapE::PsseA-hlyA)(pSim6) competent cells by electroporation (E=18 kV / cm). Lambda-red homologous recombination was used to replace the htrA gene (encoding a serine protease) in the SL7207(ΔdapE::PsseA-hlyA) genome with target fragment 2, generating the DB-ZW1 strain, an SL7207 strain lacking the htrA gene and possessing the hlyA gene under the control of PsseA and the dapE gene under the strict hypoxia-inducible promoter Pssbp1 (ΔdapE::PsseA-hlyA; ΔhtrA::Pssbp1-dapE-Cm).
[0493] The strain construction scheme is shown in Figure 4.
[0494] Example 10: DB-ZW1 has tumor inhibitory effects on various tumor models
[0495] 10.1 Establishment of tumor model
[0496] C57BL / 6 mice (purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd., weighing about 18 g, raised in an SPF environment) were subcutaneously inoculated with 1×10 6 MB49 mouse bladder cancer cells (Merck SCC148) / B16 melanoma cells (ATCC: CRL-6475) were used to establish a mouse bladder cancer / melanoma subcutaneous tumor model. Experiments were conducted 14-18 days after inoculation, when the tumor volume reached approximately 100 mm3. An in situ colorectal cancer model was induced using DSS / AOM: a single intraperitoneal injection of 10 mg / kg AOM was administered, followed by feeding the mouse with 2.5% DSS in drinking water for 7 days one week, followed by normal drinking water for 14 days. This constituted one cycle of DSS treatment. Three additional cycles of DSS treatment were performed to establish a mouse model with colorectal cancer.
[0497] 10.2 Distribution of DB-ZW1 in Tumors and Different Organs
[0498] 1×10 7CFU, a volume of 125 μL of DB-ZW1 was injected into MB49 bladder cancer-bearing mice via the tail vein, with 3 mice per group. It was observed that approximately 90% of the DB-ZW1 in the mice resided in the tumor 1 day after injection (1 dpi). Over the next 2 days, the density of DB-ZW1 in the tumor increased further by 100-fold (reaching 108 CFU / g) and remained at a high level for the next two weeks. In contrast, the density of DB-ZW1 in normal organs steadily decreased to <10 within two weeks. 2 CFU / g (Figure 5A).
[0499] To further determine whether DB-ZW1 preferentially proliferates in tumors, 1×10 7 Within 24 hours after injection of 125 μL of DB-ZW1 bacteria (CFU), the number of DB-ZW1 cells distributed in different organs was measured, with three mice per group (Figure 5B). The results showed that DB-ZW1 rapidly disseminated throughout the mice within 30 minutes after injection, with the vast majority of DB-ZW1 cells (approximately 99.9%) distributed in the liver, spleen, and blood. However, within 4 hours after injection, their number decreased significantly, with the total number of DB-ZW1 cells reduced by approximately 90%. Subsequently, DB-ZW1 cells in the tumor proliferated exponentially at a growth rate of ~0.7 h⁻¹, reaching saturation within 3 days. In contrast, the number of DB-ZW1 cells in normal organs steadily decreased. This unique tumor growth characteristic of DB-ZW1 is key to the validity of the following research results.
[0500] 10.3DB-ZW1's tumor inhibitory effect on bladder cancer, melanoma, and colon cancer
[0501] DB-ZW1 was used to treat mice with subcutaneous bladder cancer, orthotopic melanoma, and subcutaneous and orthotopic colon cancer. 1×10 7 CFU, 125 μL of DB-ZW1 was injected into tumor-bearing mice via the tail vein, with five mice per group. As shown in Figures 6A-C, DB-ZW1 significantly reduced tumor volume. Furthermore, treatment of mice with orthotopic colon cancer with DB-ZW1 significantly reduced the number of tumors in the colon (Figure 6D).
[0502] Example 11: Construction and characterization of bacteria that constitutively express and secrete IL-10
[0503] The purpose of this example is to detect the effects of constitutive expression and secretion of the fusion polypeptide of the present invention in different bacteria.
[0504] The plasmid obtained in Example 8 was electroporated into Escherichia coli Nissle and Salmonella typhimurium DB-ZW1 (see Example 9) to obtain strains Nissle-pelB-D5-huIL10, Nissle-pelB-D5-mIL10, DB-ZW1-pelB-D5-huIL10 and DB-ZW1 (Salmonella)-pelB-D5-mIL10.
[0505] Bacteria were cultured to express the fusion polypeptides (pelB-D5-huil10 and pelB-D5-mil10) and Western Blot analysis was performed as described in Example 6. Protein was quantified by analyzing Western Blot images using ImageJ.
[0506] As shown in Figure 7 , the fusion polypeptide of the present invention can also be expressed in E. coli Nissle and the anti-tumor Salmonella typhimurium DB-ZW1, and is efficiently secreted outside the bacterial cells. Specifically, the fusion polypeptide of the present invention is secreted from E. coli Nissle and Salmonella typhimurium with efficiencies of approximately 80% and 70%, respectively.
[0507] As shown in FIG8 , the fusion polypeptide of the present invention can also be expressed in the Nissle strain of Escherichia coli and the anti-tumor Salmonella typhimurium DB-ZW1, and can be efficiently secreted outside the bacterial cells.
[0508] Example 12: Anti-tumor effect of bacteria secreting interleukin-10
[0509] The purpose of this example is to verify the anti-tumor effect of anti-tumor bacteria expressing and secreting interleukin-10 through in vivo experiments.
[0510] As described in Example 10.1, a mouse MB49 bladder cancer subcutaneous tumor model was established.
[0511] 12.1 Tumor-bearing mice (n=6) were administered (1×10 7 CFU (125 μL) of E. coli strain Nissle-pelB-D5-IL10, E. coli strain Nissle (control), and PBS (blank control). Tumor growth in tumor-bearing mice was recorded using a vernier micrometer on the day of bacterial injection and on days 0, 2, 4, 6, 8, 10, 12, and 14 after injection.
[0512] Use a vernier micrometer to accurately measure the longest diameter (a) and the maximum vertical transverse diameter (b) of the mouse tumor. The tumor volume (V) is calculated according to the formula: V = a × b 2 (Unit: mm 3 ). When the tumor volume is greater than 2000mm 3If the ethical value is exceeded, the mouse is considered dead. In addition, the body weight of tumor-bearing mice was measured on days 0, 2, 4, 6, 8, 10, 12, and 14 after bacterial injection to assess the biosafety of the bacteria.
[0513] As shown in Figure 9, the tumor size in mice injected with Nissle-pelB-D5-IL10 was significantly reduced compared with that in mice injected with Nissle and PBS (P<0.005), demonstrating that interleukin 10 expressed and secreted by bacteria has biological functions and tumor therapeutic effects.
[0514] As shown in Figure 10, the body weight of mice injected with Nissle-pelB-D5-IL10 and the Nissle control group slowly recovered to normal levels over the course of the day following bacterial injection. Furthermore, on day 14 after bacterial injection, there was no statistically significant difference in body weight between the mice and those in the PBS group, demonstrating the biosafety of interleukin-10 expressed and secreted by the bacteria.
[0515] 12.2 Tumor-bearing mice (n=6) were administered (1×10 7 CFU (125 μL) of DB-ZW1-pelB-D5-IL10, DB-ZW1 (control), and PBS (blank control). Tumor growth was recorded with a vernier micrometer and body weights were measured on the day of bacterial injection and on days 2, 4, 6, and 8 after injection.
[0516] Use a vernier micrometer to accurately measure the longest diameter (a) and the maximum vertical transverse diameter (b) of the mouse tumor. The tumor volume (V) is calculated according to the formula: V = a × b 2 (Unit: mm 3 ). When the tumor volume is greater than 2000mm 3 When the ethical value is exceeded, the mouse is considered dead.
[0517] Example 13: Determination of the expression level of interleukin-10 secreting bacteria in tumor-bearing mice
[0518] The purpose of this example is to verify that the anti-tumor bacteria successfully express and secrete interleukin 10 in mice and produce a positive anti-tumor effect by detecting the expression level of interleukin 10 in the liver, spleen, and tumor of tumor-bearing mice.
[0519] As described in Example 10.1, a mouse MB49 bladder cancer subcutaneous tumor model was established, and mice were injected with E. coli strain Nissle-pelB-D5-IL10, E. coli strain Nissle (control) and PBS (blank control) as described in Example 12.1.
[0520] On the third day after injection, mice were dissected, and spleen, liver, and tumor tissues were removed and weighed. Tissue samples were thoroughly lysed on ice using RIPA Lysis Buffer (Medium) (Beyotime #P0013C) according to the product instructions (see https: / / m.beyotime.com / mobilegoods.do?method=code&code=P0013C for details).
[0521] Interleukin-10 ELISA kit (Biolegend ELISA MAX TM Deluxe Set IL-10 #430604\#431414) was used to quantitatively detect the interleukin-10 expression concentration of each tissue sample according to the product instructions (see https: / / www.biolegend.com / en-us / products for details).
[0522] Sequence Listing
[0523] SEQ ID NO: 1: pET22b-pelB-Amp
[0524] SEQ ID NO: 2: pSC101-huil10-Amp
[0525] SEQ ID NO: 3: plasmid-pET22b-pelB-D5-huil10-Amp
[0526] SEQ ID NO: 4: plasmid-pET22b-pelB-huil10-Amp
[0527] SEQ ID NO: 5: pelB-D5-huil10
[0528] SEQ ID NO: 6: pSC101-ptac-sfGFP-KanR
[0529] SEQ ID NO: 7: plasmid-pSC101-ptac-pelB-D5-huil10-KanR
[0530] SEQ ID NO: 8: plasmid-pSC101-ptac-pelB-huil10-KanR
[0531] SEQ ID NO: 9: pelB-D5-huil10-monomer
[0532] SEQ ID NO: 10: pelB-D5-super-huil10
[0533] SEQ ID NO: 11: pelB-D5-super-huil10-monomer
[0534] SEQ ID NO: 12: huIL-10
[0535] SEQ ID NO: 13: huIL-10 monomer
[0536] SEQ ID NO:14:super-huIL-10
[0537] SEQ ID NO:15:super-huIL-10-monomer
[0538] SEQ ID NO:16: pelB signal peptide
[0539] SEQ ID NO:17: pelB-D5-huIL-10
[0540] SEQ ID NO:18: pelB-D5-huIL-10monomer
[0541] SEQ ID NO:19: pelB-D5-super-huIL-10
[0542] SEQ ID NO:20: pelB-D5-super-huIL-10-monomer
[0543] SEQ ID NO: 21: pelB-D4-huIL-10
[0544] SEQ ID NO: 22: pelB-D4-huIL-10 monomer
[0545] SEQ ID NO: 23: pelB-D4-super-huIL-10
[0546] SEQ ID NO: 24: pelB-D4-super-huIL-10-monomer
[0547] SEQ ID NO: 50 pUC-ptac-bba0032-KanR
[0548] SEQ ID NO: 51 plasmid-pUC-ptac-pelB-D5-huil10-KanR
[0549] SEQ ID NO: 52 plasmid-pUC-ptac-pelB-D5-mil10-KanR
[0550] SEQ ID NO: 53: Ps seA-hlyA-loxp-KnaR-loxp
[0551] SEQ ID NO: 54: Ps sbp1-dapE-Cm
[0552] SEQ ID NO:55: PsseA-hlyA-loxp-KnaR-loxp plasmid
[0553] SEQ ID NO:56: Pssbp1-dapE-Cm plasmid
[0554] SEQ ID NO: 57: PsseA-hlyA-loxp-KnaR-loxp forward primer
[0555] SEQ ID NO: 58: PsseA-hlyA-loxp-KnaR-loxp reverse primer
[0556] SEQ ID NO:59: Pssbp1-dapE-Cm forward primer
[0557] SEQ ID NO:60: Pssbp1-dapE-Cm reverse primer
Claims
1. A modified bacterium comprising a polynucleotide or an expression vector encoding a fusion polypeptide, wherein the fusion polypeptide comprises a signal peptide, an interleukin 10 (IL-10) polypeptide, and a peptide linker connecting the signal peptide and the IL-10 polypeptide, wherein the peptide linker consists of 4 or 5 aspartic acid residues, and wherein the modified bacterium is capable of expressing and secreting the IL-10 polypeptide.
2. The modified bacterium of claim 1, wherein the IL-10 polypeptide is a human IL-10 polypeptide or a variant thereof.
3. The modified bacterium of claim 1 or 2, wherein the IL-10 polypeptide comprises the amino acid sequence of SEQ ID NO: 12, 13, 14 or 15.
4. The modified bacterium of any one of claims 1 to 3, wherein the signal peptide comprises the amino acid sequence of SEQ ID NO:
16.
5. The modified bacterium of any one of claims 1-4, wherein the fusion polypeptide comprises the amino acid sequence of SEQ ID NO: 17, 18, 19, 20, 21, 22, 23 or 24.
6. The modified bacterium of any one of claims 1 to 5, wherein the bacterium further comprises one or more expression cassettes for expressing essential genes compared to the unmodified starting strain, wherein the expression of the essential genes is controlled by a strict hypoxia-inducible promoter, and the bacterium lacks at least one gene involved in or regulating an endogenous antioxidant stress response pathway or a functional expression product thereof.
7. The modified bacterium of claim 6, wherein the strictly hypoxia-inducible promoter is the ssbp1 promoter.
8. The modified bacterium of claim 6 or 7, wherein the expression product of the essential gene is responsible for the synthesis of 2,6-diaminopimelate (DAP) in the bacterium, and when cultured under aerobic conditions, the growth of the bacterium is dependent on the additional addition of DAP or its analogue in the culture medium.
9. The modified bacterium of claim 8, wherein the essential gene is selected from the group consisting of dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof.
10. The modified bacterium of claim 8, wherein the essential gene is selected from the group consisting of dapA and dapE.
11. The modified bacterium of any one of claims 6 to 10, wherein the gene involved in or regulating the endogenous anti-oxidative stress response pathway is a HtrA serine protease family gene.
12. The modified bacterium of any one of claims 6 to 11, wherein the essential gene is a gene naturally present in the bacterial chromosome, wherein the natural promoter of the essential gene is functionally replaced by the strict hypoxia-inducible promoter, whereby the expression of the essential gene in the bacterium is completely controlled by the strict hypoxia-inducible promoter.
13. The modified bacterium of any one of claims 6 to 11, wherein the essential gene expression cassette is exogenous and the essential gene naturally present in the bacterial chromosome is deleted or functionally inactivated, whereby the expression of the essential gene in the bacterium is completely controlled by the strict hypoxia inducible promoter.
14. The modified bacterium according to any one of claims 6 to 13, further comprising a pH-regulatory expression cassette comprising a gene hlyA or hlyE encoding a bacterial-derived hemolysin protein controlled by a promoter active under acidic pH conditions.
15. The modified bacterium of claim 14, wherein the hlyA or hlyE is from Listeria monocytogenes, Vibrio cholerae, or Escherichia coli.
16. The modified bacterium of claim 14 or 15, wherein the promoter active under acidic pH conditions is sseA.
17. The modified bacterium of any one of claims 1-16, wherein the unmodified starting strain is a facultative anaerobic bacterium.
18. The modified bacterium of any one of claims 1 to 17, wherein the bacterium is an Enterobacteriaceae bacterium.
19. The modified bacterium of any one of claims 1 to 18, wherein the bacterium is Escherichia coli or Salmonella typhimurium.
20. The modified bacterium of claim 19, wherein the starting strain is Escherichia coli Nissle strain or Salmonella typhimurium SL7207 strain.
21. A pharmaceutical composition for treating malignant tumors, comprising the modified bacterium according to any one of claims 1 to 20.
22. A method for treating a malignant tumor, comprising administering an effective amount of the modified bacterium according to any one of claims 1 to 20 or the pharmaceutical composition according to claim 21 to a subject suffering from a malignant tumor.
23. Use of the modified bacteria of claims 1 to 20 or the pharmaceutical composition of claim 21 in the preparation of a medicament for treating a malignant tumor.