An indel molecular marker related to soybean grain weight, fat content and isoflavone content and application thereof
By developing InDel molecular markers related to soybean grain weight, fat content, and isoflavone content, and utilizing PCR amplification and electrophoresis detection techniques, the challenges of identification and screening in soybean breeding have been solved, significantly improving the accuracy and efficiency of breeding.
Patent Information
- Application Number
- CN202510834032.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-20
- Publication Date
- 2026-06-12
- Estimated Expiration
- 2045-06-20
Smart Images

Figure CN120591450B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular detection technology, and in particular to an InDel molecular marker and its application related to soybean grain weight, fat content and isoflavone content. Background Technology
[0002] Soybean (Glycine max L.Merr.) is an important food and oilseed crop, and a major source of plant protein for humans and animal feed protein. Furthermore, soybean protein, oil, vitamins, and flavonoids, among other bioactive substances, play important pharmacological roles in anti-cancer, antioxidant, immune regulation, and cardiovascular disease prevention. With economic development, rising living standards, and improved dietary habits, the demand for soybeans continues to grow. Currently, the oil content of cultivated soybeans is relatively low. Therefore, increasing soybean yield and developing soybean varieties with high fat and nutrient content are urgent problems to be solved in soybean breeding.
[0003] Marker-assisted selection (MAS) technology provides a powerful tool for traditional crop genetic breeding due to its advantages of early selection, independence from environmental influences, accuracy, speed, and efficiency. This technology has been substantially utilized in various crops. This invention aims to develop novel molecular markers related to soybean grain weight, fat content, and isoflavone content to achieve accurate identification or assist in breeding based on these parameters. Summary of the Invention
[0004] The purpose of this invention is to provide an InDel molecular marker related to soybean grain weight, fat content, and isoflavone content, and its application, to solve the problems existing in the prior art. Using this InDel molecular marker, the genotype of the target locus can be detected rapidly and accurately, distinguishing soybean materials with different genetic backgrounds, thereby effectively assisting in the screening of soybean varieties with superior traits in grain weight, fat content, and isoflavone content.
[0005] To achieve the above objectives, the present invention provides the following solution:
[0006] This invention provides an InDel molecular marker related to soybean grain weight, fat content, and isoflavone content, the nucleotide sequence of which is shown in SEQ ID NO.4.
[0007] The present invention also provides the application of the above-mentioned InDel molecular marker in identifying traits such as soybean grain weight, fat content and / or isoflavone content.
[0008] The present invention also provides a primer pair for detecting the above-mentioned InDel molecular marker, comprising an upstream primer with a nucleotide sequence as shown in SEQ ID NO.5 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.6.
[0009] The present invention also provides the application of the above primer pairs in the preparation of products for identifying traits such as soybean grain weight, fat content and / or isoflavone content.
[0010] Furthermore, the product is a reagent kit.
[0011] The present invention also provides a product for identifying the characteristics of soybean grain weight, fat content and / or isoflavone content, comprising the primer pairs described above.
[0012] Furthermore, the product is a reagent kit.
[0013] The present invention also provides the application of the above-mentioned primer pairs in identifying traits such as soybean grain weight, fat content and / or isoflavone content.
[0014] The present invention also provides the application of the above-mentioned product in identifying the characteristics of soybean grain weight, fat content and / or isoflavone content.
[0015] The present invention also provides a method for identifying the characteristics of soybean grain weight, fat content and / or isoflavone content, comprising the following steps:
[0016] The DNA of the soybean material to be tested was amplified by PCR using the primers described above to obtain the PCR amplification product.
[0017] The PCR amplification products were detected by non-denaturing polyacrylamide gel electrophoresis. Genotyping and phenotypic determination were performed based on the generated electrophoretic bands.
[0018] The soybean material with a PCR amplification product of 211 bp had higher grain weight and fat content than the soybean material with a PCR amplification product of 238 bp.
[0019] The isoflavone content of soybean material with a PCR amplification product of 211bp was lower than that of soybean material with a PCR amplification product of 238bp.
[0020] The present invention discloses the following technical effects:
[0021] This invention, through genome-wide association analysis, discovered insertion / deletion variations of 16 bp and 11 bp in specific regions of soybean chromosome 13 (28,305,360 bp and 28,305,305 bp, reference genome Wm82.a2.v1), and based on this, provides an InDel molecular marker associated with soybean grain weight, fat content, and isoflavone content. Using this InDel molecular marker, the genotype of the target locus can be rapidly and accurately detected, distinguishing soybean materials from different genetic backgrounds, thereby effectively assisting in the screening of soybean varieties with superior grain weight, fat, and isoflavone content traits. Specifically, differences in PCR amplification product size (e.g., 211 bp vs. 238 bp) can reflect significant differences in grain weight, fat, and isoflavone content in soybean materials, thus achieving efficient pre-selection of target traits. This invention significantly improves the accuracy and efficiency of breeding selection, providing a powerful tool for accelerating the process of soybean genetic improvement. Attached Figure Description
[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0023] Figure 1 Polyacrylamide gel electrophoresis images of 47 soybean materials with different genetic backgrounds used to validate InDel molecular markers. Detailed Implementation
[0024] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0025] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0026] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0027] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0028] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0029] Example 1
[0030] In the course of long-term research, this invention has discovered an InDel molecular marker associated with soybean grain weight, fat content, and isoflavone content through genome-wide association analysis of traits such as 100-grain weight, fat content, and isoflavone content. Compared with the soybean reference genome (Wm82.a2.v1), deletion mutations of 16 bp (SEQ ID NO.1) and 11 bp (SEQ ID NO.2) are found in the 5'UTR region of the GmFDH gene, specifically at positions 28,305,360 bp and 28,305,305 bp on soybean chromosome 13.
[0031] InDel molecular marker detection primer pairs were designed using the Primer-BLAST function of NCBI (https: / / www.ncbi.nlm.nih.gov / ), as shown in Table 1. These InDel molecular marker detection primers amplified fragments with marker lengths of 238 bp and 211 bp, respectively. The nucleotide sequence of the 238 bp fragment is shown in SEQ ID NO.3, and the nucleotide sequence of the 211 bp fragment is shown in SEQ ID NO.4.
[0032] SEQ ID NO.1: aattttgtttcagtga.
[0033] SEQ ID NO.2: tttgtgtataa.
[0034] SEQ ID NO.3: atcctttcccaagccagccaagcgaggcatgctctcaattttgtactcttccgtctcccaatattttcttcttcttcttcttattatcatttttgtgtataaacctcaccttaatta ctctactcttctctctaattacagttttcaattttgtttcagtgaaattacttgcatagatagagcatggccatgatgaaacgtgctgcttcctcttcggttcgctcgctactttcct.
[0035] SEQ ID NO.4: atcctttcccaagccagccaagcgaggcatgctctcaattttgtactcttccgtctcccaatattttcttcttcttcttcttattatcattacctcaccttaa ttactctactcttctctctaattacagttttcaattacttgcatagatagagcatcatggccatgatgaaacgtgctgcttcctcttcggttcgctcgctactttcct.
[0036] Table 1 Primer pairs for InDel molecular marker detection
[0037] Primers Nucleotide sequence (5'-3') Serial Number upstream primer F atcctttcccaagccagcc SEQ ID NO.5 Downstream primer R aggaaagtagcgagcgaacc SEQ ID NO.6
[0038] Example 2
[0039] The correlation between the InDel molecular markers obtained in Example 1 and soybean grain weight, fat content, and isoflavone content was verified using 47 soybean materials with known 100-grain weight, fat content, and isoflavone content (Table 2). The method is as follows:
[0040] (1) The DNA of the soybean material to be tested was amplified by PCR using the InDel molecular marker detection primers designed in Table 1 of Example 1 to obtain PCR amplification products;
[0041] PCR amplification reaction procedure: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 30 seconds, 55℃ annealing for 30 seconds, 72℃ extension for 30 seconds, 35 cycles; 72℃ incubation for 5 minutes, storage at 4℃.
[0042] The PCR amplification reaction system was 10 μL, which included: 2 μL of 50 ng / μL DNA template, 0.25 μL each of 10 μmol / L upstream and downstream primers, 5 μL of 2×Taq Mix, and 2.5 μL of double-distilled water.
[0043] (2) The obtained PCR amplification products were detected by non-denaturing polyacrylamide gel electrophoresis, and genotyping was performed based on the generated electrophoretic bands (211bp or 238bp). The gel electrophoresis voltage was 180V, the current was 60mA, and the time was 60min.
[0044] The genotyping results of 47 soybean materials are shown in Table 2. Figure 1 This is an electrophoretic map showing the genotyping results of 47 soybean accessions using InDel markers. Figure 1 As shown in Table 2, among the 47 soybean samples, 20 samples had an InDel marker length of 238 bp, with average 100-seed weight, fat content, and isoflavone (glucan) content of 15.56 g, 20.17 wt%, and 2,575,841.81 g (relative content), respectively. 27 samples had an InDel marker length of 211 bp, with average 100-seed weight, fat content, and isoflavone content of 27.55 g, 21.70 wt%, and 1,238,844.15 g (relative content), respectively. The 100-seed weight and fat content of the soybean samples with the InDel marker length of 211 bp were significantly higher than those with the InDel marker length of 238 bp, while the isoflavone content of the soybean samples with the InDel marker length of 211 bp was significantly lower than that of the soybean samples with the InDel marker length of 238 bp (P < 0.001).
[0045] Table 2 Validation results of 47 soybean materials
[0046]
[0047]
[0048]
[0049] Note: NA indicates that relevant data for this variety is missing.
[0050] As can be seen from the above, the Indel molecular markers and primer pairs provided by the present invention can effectively screen soybean varieties with different grain weights, fat contents and isoflavone contents, and the screening results are accurate and reliable.
[0051] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. The application of a primer pair in identifying traits such as soybean grain weight, fat content, and / or isoflavone content, characterized in that, The primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO. 5 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO. 6; Using soybean DNA as a template, PCR amplification was performed using the primer pair. The soybean material with a PCR amplification product of 211 bp had higher grain weight and fat content than the soybean material with a PCR amplification product of 238 bp. The isoflavone content of soybean material with a PCR amplification product of 211 bp was lower than that of soybean material with a PCR amplification product of 238 bp.
2. The application of a product for identifying the characteristics of soybean grain weight, fat content, and / or isoflavone content in the identification of soybean grain weight, fat content, and / or isoflavone content; characterized in that, The product includes primer pairs; the primer pairs include an upstream primer with a nucleotide sequence as shown in SEQ ID NO.5 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.6; Using soybean DNA as a template, PCR amplification was performed using the primer pair. The soybean material with a PCR amplification product of 211 bp had higher grain weight and fat content than the soybean material with a PCR amplification product of 238 bp. The isoflavone content of soybean material with a PCR amplification product of 211 bp was lower than that of soybean material with a PCR amplification product of 238 bp.
3. The application according to claim 2, characterized in that, The product in question is a reagent kit.
4. A method for identifying the characteristics of soybean grain weight, fat content, and / or isoflavone content, characterized in that, Includes the following steps: The DNA of the soybean material to be tested was amplified by PCR using primer pairs to obtain PCR amplification products; The primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO. 5 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO. 6; The PCR amplification products were detected by non-denaturing polyacrylamide gel electrophoresis. Genotyping and phenotypic determination were performed based on the generated electrophoretic bands. The soybean material with a PCR amplification product of 211 bp had higher grain weight and fat content than the soybean material with a PCR amplification product of 238 bp. The isoflavone content of soybean material with a PCR amplification product of 211 bp was lower than that of soybean material with a PCR amplification product of 238 bp.