Universal multi-gene CRISPR / Cas9 editing system for filamentous fungi and application thereof

Abstract

The invention discloses a general multi-gene CRISPR / Cas9 editing system for filamentous fungi and application thereof, and relates to the technical field of gene editing, the general multi-gene CRISPR / Cas9 editing system for filamentous fungi comprises a multi-sgRNA synthesis module with tRNA connected in series, a 5SrRNA promoter, a codon optimized Cas9 gene, an autonomous replication sequence, a dominant selection marker gene and a regulatory element. According to the system provided by the invention, homologous donor DNA does not need to be added, NHEJ defective strains do not need to be generated, and the knockout receptors do not need to be forcibly recovered for multi-gene targeting, so that the gene targeting process is remarkably simplified and accelerated, and the system has considerable efficient conversion and gene targeting efficiency.

Description

Technical Field

[0001] The present invention relates to the field of gene editing technology, and more specifically, to a universal multi-gene CRISPR / Cas9 editing system for filamentous fungi and its application. Background Art

[0002] Gene editing technology is of great significance in life science research. For over a decade, successful gene knockout efforts have relied almost exclusively on forced double crossover recombination of homologous sequences using receptors deficient in the non-homologous end joining pathway (NHEJ). The CRISPR / Cas9 (clustered regularly interspaced short palindromic repeats-CRISPR-associated protein 9) system is an emerging genome editing tool. In this approach, a single guide RNA (sgRNA) is generated to recognize the target DNA sequence and direct the expressed Cas9 to perform the editing.

[0003] CRISPR / Cas9 genome editing systems have been developed for use in many filamentous fungi. Current systems include (i) conventional plasmid vectors containing Cas9 and / or sgRNA expression cassettes and (ii) synthetic methods that deliver ribonucleoprotein (RNP) complexes, Cas9, and sgRNA directly into fungal protoplasts. The gene targeting efficiency of existing technologies varies widely, depending on the delivery method, the repair mechanism of the induced double-strand breaks, the selection marker, and the genetic background of the transformed recipient strain. They are also mostly strain-specific or species-specific; cross-fungal species systems have been reported, but are uncommon.

[0004] The current CRISPR / Cas9 editing system for filamentous fungi still has many problems, which seriously limit its scope of application and effectiveness. At the level of single-gene editing, the editing efficiency of existing systems varies. In some filamentous fungi, due to the low transcription efficiency of the promoter for sgRNA, the Cas9 protein cannot accurately locate and cut the target gene, making it difficult to achieve the ideal level of single-gene editing efficiency. On the other hand, in terms of multi-gene editing, it relies on NHEJ-deficient strains, requires the additional construction of repair mechanism-deficient receptors, prolongs the experimental cycle, and requires multiple transformations or co-transformations of multiple sgRNAs in a single vector, which is cumbersome and inefficient. Summary of the Invention

[0005] In response to the shortcomings of the existing technology, the first object of the present invention is to provide a universal multi-gene CRISPR / Cas9 editing system for filamentous fungi, including: a multi-sgRNA synthesis module with tRNA in tandem, a 5SrRNA promoter, a codon-optimized Cas9 gene, an autonomously replicating sequence, a dominant selection marker gene and regulatory elements.

[0006] Furthermore, the autonomously replicating sequence is the Aspergillus nidulans AMA1 autonomously replicating sequence.

[0007] Furthermore, the dominant selection marker gene is the Aspergillus oryzae ptrA gene.

[0008] Furthermore, the 5SrRNA promoter sequence is 116 bp in length, and its nucleotide sequence is shown in SEQ ID NO.6.

[0009] Furthermore, the tRNA-tandem multi-sgRNA synthesis module includes any of the following: tRNA Gly -protospacer(wA)-scaffold-tRNA Gly -protospacer(pyrG)-scaffold-tRNA Gly ,

[0010] Its sequence is shown in SEQ ID NO.10;

[0011] tRNA Ile -protospacer(wA)-scaffold-tRNA Ile -protospacer(pyrG)-scaffold-tRNA Ile , whose sequence is shown in SEQ ID NO.11;

[0012] tRNA Arg -protospacer(wA)-scaffold-tRNA Arg -protospacer(pyrG)-scaffold-tRNA Arg ,

[0013] Its sequence is shown in SEQ ID NO.12;

[0014] tRNA Gly -protospacer(wA)-scaffold-tRNA Arg -protospacer(pyrG)-scaffold-tRNA Ile , whose sequence is shown in SEQ ID NO.13.

[0015] The present invention also provides a vector, which includes the above-mentioned universal multi-gene CRISPR / Cas9 editing system for filamentous fungi.

[0016] The present invention also provides the use of the above-mentioned universal multi-gene CRISPR / Cas9 editing system or vector for filamentous fungi in gene editing.

[0017] Furthermore, the gene editing includes but is not limited to gene knockout, gene insertion, and gene replacement.

[0018] The present invention also provides a method for gene editing using the above system, comprising the following steps:

[0019] S1. Preparation of protoplasts;

[0020] S2. Vector construction: pAf-CRISPR-yA was used to construct the Cas9 expression plasmid;

[0021] S3. Protoplast transformation: Protoplasts and Cas9 expression plasmids are mixed and transformed, followed by resistance screening.

[0022] The above-mentioned filamentous fungi include but are not limited to Aspergillus flavus and Aspergillus oryzae.

[0023] In summary, the present invention has the following beneficial effects:

[0024] The present invention effectively achieves multiple gene knockout in filamentous fungi through sequential or co-transformation of a single sgRNA vector. It is readily applicable to other filamentous fungal species and does not require the addition of homologous donor DNA, the generation of NHEJ-deficient strains, or the forced recovery of knockout receptors for multi-gene targeting. This significantly simplifies and accelerates the gene targeting process, enabling the knockout of multiple genes to be achieved in a very short time with comparable high transformation and gene targeting efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 A map of the construction of a 5S rRNA promoter-driven genome editing plasmid;

[0026] Figure 2 The phenotypes of ΔwA (white conidia) and ΔyA (yellow conidia) mutants generated by expressing sgRNA using different promoters;

[0027] Figure 3 The editing efficiency of 5SrRNA-Cas9 genome editing plasmids;

[0028] Figure 4 Provides a map for the construction of genome editing plasmids based on the tRNA-gRNA tandem array system;

[0029] Figure 5 Schematic diagram of the mechanism of action of the tRNA-gRNA tandem array system;

[0030] Figure 6Schematic diagram of the structural design of the tandem array system mediated by glycine tRNA, arginine tRNA, and isoleucine tRNA;

[0031] Figure 7 The phenotypes of the ΔwA / pyrG multigene mutant grown on plates with and without uracil added are shown;

[0032] Figure 8 Editing efficiency of mtRNA-Cas9 genome editing plasmids;

[0033] Figure 9 The phenotype of the ΔpyrG Aspergillus oryzae mutant grown on plates with and without uracil added is shown. DETAILED DESCRIPTION

[0034] The present invention is further described in detail below with reference to the examples.

[0035] Unless otherwise specified, the materials and reagents used in the following examples can be obtained commercially.

[0036] The culture medium and its composition are as follows:

[0037] PDA medium: 200 g peeled potatoes, 20 g glucose, 15-20 g agar, add water to make up to 1 L.

[0038] LB medium: 10 g peptone, 5 g yeast powder, 10 g NaCl, add water to 1 L.

[0039] The strains used in the examples of the present invention are Aspergillus flavus NRRL3357 and Aspergillus oryzae RIB40, both of which are deposited in Ocean University of China.

[0040] The plasmids used in the examples of the present invention are as follows:

[0041] Plasmid pAf-CRISPR-yA was purchased from Addgene (Plasmid#191015). Reference: Chang et al Microbiol Spectr. 2023 Feb 14; 11(1): e0464822. doi: 10.1128 / spectrum.04648-22. Epub 2023 Jan 18.

[0042] The 5S rRNA gene sequence was obtained from the 5S rRNA database (https: / / rnacentral.org / ). 5S rRNA promoters, U3 promoters, and U6 promoters of varying lengths were synthesized by Sangon Biotech, including 5S rRNA (-X) sequences of varying lengths upstream of the 5S rRNA gene, 5S rRNA gene sequences, and a protospacer region; as well as a tandemly arranged tRNA-sgRNAwA-tRNA-sgRNApyrG-tRNA sequence and a 116-bp 5S rRNA gene sequence. Cas-Designer (http: / / www.rgenome.net / cas-designer / ) was used to design sgRNA sequences targeting the wA and yA genes, as well as sgRNA sequences targeting the wA and pryG genes. The sgRNA sequences targeting the wA and yA genes include:

[0043] wA: TGGATCTACTGGCGCGTCACCGG,

[0044] yA: CGCCAAATGATTCTCACTAATGG;

[0045] sgRNA sequences targeting the wA and pryG genes include:

[0046] wA:TGGATCTACTGGCGCGTCACCGG

[0047] pryG:GTGGATTATATAACAGGACTCGG.

[0048] In this study, sgRNA sequences from different promoters, including PU6(-500), PU3(-500), P5S rRNA(-500), P5S rRNA(-350), and P5S rRNA, as well as target sites wa and ya, were cloned into the pAf-CRISPR-yA plasmid, which had been double-digested with Kpn I and Pst I. Single-gene editing plasmids were generated. wA and yA genes were selected, and the number of transformants was quantitatively analyzed in transformation experiments.

[0049] The tandemly arranged tRNA-sgRNAwA-tRNA-sgRNApyrG-tRNA sequence and a 116-bp 5S rRNA gene sequence were cloned into the pAf-CRISPR-yA plasmid, which had been double-digested with Kpn I and Pst I. The multi-gene editing plasmid mtRNACas9 was generated. The editing efficiency of different tRNA-gRNA arrays was evaluated in transformation experiments targeting the wA and pyrG genes.

[0050] The universal multi-gene CRISPR / Cas9 editing system of the present invention includes: a minimal Aspergillus nidulans AMA1 autonomously replicating sequence, an Aspergillus oryzae ptrA gene, a codon-optimized Cas9 gene and its promoter and terminator, a 116bp 5SrRNA promoter, and a tRNA-tandem multi-sgRNA synthesis module.

[0051] The minimal autonomously replicating sequence of Aspergillus nidulans AMA1 is shown in SEQ ID NO. 1;

[0052] The Aspergillus oryzae ptrA gene sequence is shown in SEQ ID NO. 2;

[0053] The codon-optimized Cas9 gene sequence is shown in SEQ ID NO.3.

[0054] Among them, the Cas9 gene promoter is the Aspergillus nidulans gpdA promoter, and the Cas9 gene terminator is the Aspergillus nidulans trpC terminator.

[0055] Among them, sgRNA expression vectors were constructed using tRNAs containing three amino acids with high content of glycine, isoleucine and arginine.

[0056] In the present invention, in order to improve the genetic transformation efficiency of filamentous fungi, a high-efficiency transformation system based on protoplasts is established as a filamentous fungus transformation system.

[0057] In the present invention, a method for performing gene editing in filamentous fungi using a universal multi-gene CRISPR / Cas9 editing system comprises the following steps:

[0058] S1. Protoplast preparation: Fresh Aspergillus flavus hyphae cultured overnight for 12-20 hours were mixed in a ratio of 1.0 g wet hyphae to 2.0 g Vinotaste, and enzymatically hydrolyzed at 30°C for 2-3 hours under shaking to obtain protoplasts;

[0059] S2. Vector construction: pAf-CRISPR-yA was used to construct the Cas9 expression plasmid;

[0060] S3, protoplast transformation: 2×10 6 Protoplasts were mixed with 3 μg of Cas9 expression plasmid and transformed using polyethylene glycol. Resistance selection was performed using 0.1 μg / mL pyrithiamine.

[0061] Example 1 Construction of genome editing plasmids driven by different promoters

[0062] This example provides a method for constructing CRISPR / Cas9 genome editing plasmids driven by different promoters in filamentous fungi.

[0063] 5S rRNA promoter, U3 promoter, and U6 promoter genes of different lengths, including 5S rRNA (-X) sequences of different lengths upstream of the 5S rRNA gene and 5S rRNA gene sequences, as well as protospacers, were synthesized by Sangon Biotechnology Co., Ltd. Different types of promoters, including PU6 (-500), PU3 (-500), P5S rRNA (-500), P5S rRNA (-350), P5SrRNA, and sgRNA sequence fragments of target sites wa and ya, were cloned into the pAf-CRISPR-yA plasmid double-digested with KpnⅠ and PstⅠ to obtain the corresponding single-gene editing plasmid.

[0064] The 5S rRNA gene and its upstream 500 bp sequence are shown in SEQ ID NO. 4;

[0065] The 5S rRNA gene and its upstream 350 bp sequence are shown in SEQ ID NO. 5;

[0066] The 5S rRNA gene sequence is shown in SEQ ID NO. 6;

[0067] The gene sequences of U3 promoter and U6 promoter are shown in SEQ ID NO.7 and SEQ ID NO.8 respectively.

[0068] Example 2 Functional verification of CRISPR / Cas9 genome editing plasmids driven by different promoters in filamentous fungi

[0069] This example provides a technical solution for using CRISPR / Cas9 genome editing plasmids driven by different promoters in filamentous fungi to target different genes in Aspergillus flavus.

[0070] In the filamentous fungus protoplast transformation experiment of the present invention, 2×10 6 Protoplasts and 3 μg of genome-editing plasmid were added to 150 mL of molten Czapek-Dox regeneration agar medium supplemented with pyrithiamine (0.1 μg / mL) and plated onto six plates. Small resistant colonies typically began to form within 2 to 3 days at 30°C. Positive transformants were initially screened by morphological observation and sequenced.

[0071] like Figure 2 As shown, after transformation, transformants with the expected phenotype were obtained, yellow and white conidia were formed, and the plasmid containing the AMA1 sequence was lost after two passages on antibiotic-free plates. Figure 3As shown, 5S rRNA promoters of different lengths, U3 promoter, and U6 promoter all achieved satisfactory editing efficiencies. Although the U6 promoter is the standard choice for sgRNA expression in many organisms, the 5S rRNA sequence more effectively stimulated the production of sgRNA. A 5S rRNA of only 116 bp in length can well initiate the expression of sgRNA, with editing efficiencies of 95.33% and 93.27% for wA and yA, respectively.

[0072] Single gene mutants targeting cdc42 and racA were constructed using the s5SrnaCas9 plasmid:

[0073] cdc42:CACAACAAACAAGTTCCCCTCGG

[0074] racA:CAAAGATTGGGTAGCGGGACCGG

[0075] After transformation, the single gene editing efficiencies of cdc42 and racA reached 88.89% and 75% respectively.

[0076] Table 1 Constructed single mutants

[0077]

[0078] Example 3 Construction of genome editing plasmid mtRNA-Cas9 based on tRNA-gRNA tandem array system

[0079] This example provides a method for constructing a CRISPR / Cas9 genome editing plasmid driven by different tRNA tandem array systems in filamentous fungi.

[0080] Three amino acids with higher content were selected: glycine, isoleucine and arginine. The above amino acid sequence was combined with a 76 bp scaffold sequence (sequence shown in SEQ ID NO. 9) to construct an sgRNA expression vector.

[0081] The tandemly arranged tRNA-sgRNAwA-tRNA-sgRNApyrG-tRNA sequence and 116bp 5SrRNA gene sequence were cloned into the pAf-CRISPR-yA plasmid double-digested with KpnⅠ and PstⅠ to obtain the multi-gene editing plasmid mtRNACas9.

[0082] Among them, the tRNA-gRNA tandem array sequence using glycine is:

[0083] tRNA Gly -protospacer(wA)-scaffold-tRNA Gly-protospacer(pyrG)-scaffold-tRNA Gly , whose sequence is shown in SEQ ID NO.10;

[0084] The sequence of the tRNA-gRNA tandem array using isoleucine is:

[0085] tRNA Ile -protospacer(wA)-scaffold-tRNA Ile -protospacer(pyrG)-scaffold-tRNA Ile , whose sequence is shown in SEQ ID NO.11;

[0086] The sequence of the tRNA-gRNA tandem array using arginine is:

[0087] tRNA Arg -protospacer(wA)-scaffold-tRNA Arg -protospacer(pyrG)-scaffold-tRNA Arg , whose sequence is shown in SEQ ID NO.12;

[0088] The sequence of the tRNA-gRNA tandem array using glycine, isoleucine, and arginine is: tRNA Gly -protospacer(wA)-scaffold-tRNA Arg -protospacer(pyrG)-scaffold-tRNA Ile , its sequence is shown as SEQ ID NO.13.

[0089] Example 4 Functional verification of CRISPR / Cas9 genome editing plasmids driven by different promoters in filamentous fungi

[0090] This example provides a technical solution for the CRISPR / Cas9 genome editing plasmid driven by different tRNA tandem array systems in filamentous fungi in Aspergillus flavus.

[0091] In the filamentous fungus protoplast transformation experiment of the present invention, 2×10 6 Protoplasts and 3 μg of genome-editing plasmid were added to 150 mL of molten Czapek-Dox regeneration agar medium supplemented with 0.1 μg / mL of pyrithiamine and plated onto six plates. Small resistant colonies typically began to form within 2 to 3 days at 30°C. Positive transformants were initially screened by morphological observation and sequenced.

[0092] Table 2 Multi-gene editing mutants constructed in this example

[0093]

[0094] a The number of ΔwA mutants in transformants.

[0095] b The number of multigenic mutants in transformants.

[0096] In this example, a plasmid targeting both the wA and pyrG genes was constructed to test the efficiency of the system. Figure 7 As shown, white transformants formed by the deletion of the wA gene can be observed on the primary transformation plate. In subsequent tests, multi-gene mutants were unable to grow on uracil-deficient plates. Due to the inherent high efficiency of the wA gene target site, its editing efficiency has remained at around 95%. For multiple gene knockouts, the system editing efficiency mediated by glycine and isoleucine tRNA was higher, at 76.95% and 75.51%, respectively, while the editing efficiency of arginine tRNA was the lowest, at only 66.47%. Sequencing analysis found that there were insertions or deletions at the pyrG target site. In order to avoid the instability of the sgRNA expression cassette that may result from the use of the same tRNA sequence, we arranged the tRNAs for these three amino acids in series to enhance the stability of the plasmid. As Figure 8 As shown, the single-gene editing efficiency reached 95.69% and the multi-gene editing efficiency reached 77.59%. The present invention can deliver Cas9 and multiple sgRNAs based on the polymerase III promoter and tRNA spacer, which can introduce multiple mutations with very high efficiency in a single transformation experiment, making it compatible with future high-throughput gene editing experiments.

[0097] Example 5 Functional Verification of Single-Gene Editing Plasmid 5SrRNA-Cas9 and Multi-Genome Editing Plasmid mtRNA-Cas9 in Aspergillus oryzae

[0098] This example provides the technical effects of a filamentous fungus single-gene 5SrRNA-Cas9 editing plasmid and a multi-genome mtRNA-Cas9 editing plasmid in Aspergillus oryzae.

[0099] In the filamentous fungus protoplast transformation experiment of this example, 2×10 6 Protoplasts and 3 μg genome editing plasmid. The transformation mixture was added to 150 mL of molten Czapek-Dox regeneration agar medium supplemented with pyrithiamine (0.1 μg / mL) and poured into 6 plates. At 30°C, small resistant colonies usually began to form within 2 to 3 days. Positive transformants were initially screened by morphological observation, such as Figure 9As shown, sequencing detection was performed and the editing efficiency of 5SrRNA-Cas9 single-gene plasmid reached 94.11%, and the editing efficiency of mtRNA-Cas9 multi-gene plasmid reached 72.22%.

[0100] Table 3 Target genes and target sequences

[0101]

[0102] The present invention effectively achieves multiple gene knockout in filamentous fungi through sequential or co-transformation of a single sgRNA vector. It is readily applicable to other filamentous fungal species and does not require the addition of homologous donor DNA, the generation of NHEJ-deficient strains, or the forced recovery of knockout receptors for multi-gene targeting. This significantly simplifies and accelerates the gene targeting process, enabling the knockout of multiple genes to be achieved in a very short time with comparable high transformation and gene targeting efficiency.

[0103] The above specific embodiments are merely explanations of the present invention and are not limitations of the present invention. After reading this specification, those skilled in the art may make non-creative modifications to the embodiments as needed. However, as long as they are within the scope of the claims of the present invention, they are protected by patent law.

Claims

1. A universal multi-gene CRISPR / Cas9 editing system for filamentous fungi, characterized in that: include: tRNA-tandem multi-sgRNA synthesis module, 5SrRNA promoter, codon-optimized Cas9 gene, autonomous replication sequence, dominant selection marker gene and regulatory elements.

2. A universal multi-gene CRISPR / Cas9 editing system for filamentous fungi according to claim 1, characterized in that The autonomously replicating sequence is the Aspergillus nidulans AMA1 autonomously replicating sequence.

3. A universal multi-gene CRISPR / Cas9 editing system for filamentous fungi according to claim 1, characterized in that The dominant selection marker gene is the Aspergillus oryzae ptrA gene.

4. A universal multi-gene CRISPR / Cas9 editing system for filamentous fungi according to claim 1, characterized in that The 5SrRNA promoter sequence is 116 bp in length, and its nucleotide sequence is shown in SEQ ID NO.

6.

5. A universal multi-gene CRISPR / Cas9 editing system for filamentous fungi according to claim 1, characterized in that The tRNA-tandem multi-sgRNA synthesis module includes any of the following: tRNA Gly -protospacer(wA)-scaffold-tRNA Gly -protospacer(pyrG)-scaffold-tRNA Gly , whose sequence is shown in SEQ ID NO.10; tRNA Ile -protospacer(wA)-scaffold-tRNA Ile -protospacer(pyrG)-scaffold-tRNA Ile , whose sequence is shown in SEQ ID NO.11; tRNA Arg -protospacer(wA)-scaffold-tRNA Arg -protospacer(pyrG)-scaffold-tRNA Arg , whose sequence is shown in SEQ ID NO.12; tRNA Gly -protospacer(wA)-scaffold-tRNA Arg -protospacer(pyrG)-scaffold-tRNA Ile , whose sequence is shown in SEQ ID NO.

13.

6. A carrier, characterized in that The vector includes the universal multi-gene CRISPR / Cas9 editing system for filamentous fungi as described in any one of claims 1-5.

7. Use of the universal multi-gene CRISPR / Cas9 editing system for filamentous fungi as described in any one of claims 1 to 5 or the vector as described in claim 6 in gene editing.

8. The use according to claim 7, characterized in that The gene editing includes but is not limited to gene knockout, gene insertion, and gene replacement.

9. A method for gene editing using the universal multi-gene CRISPR / Cas9 editing system for filamentous fungi according to any one of claims 1 to 5, characterized in that: The following steps are involved: S1. Preparation of protoplasts; S2. Vector construction: pAf-CRISPR-yA was used to construct the Cas9 expression plasmid; S3. Protoplast transformation: Protoplasts and Cas9 expression plasmids are mixed and transformed, followed by resistance screening.

10. The universal multi-gene CRISPR / Cas9 editing system for filamentous fungi according to any one of claims 1 to 5, characterized in that: The filamentous fungi include but are not limited to Aspergillus flavus and Aspergillus oryzae.

Images