CRISPR solid-phase shear interception type nucleic acid test strip and application method thereof
By using nucleic acid base complementary hybridization capture probes in CRISPR nucleic acid detection test strips, combined with solid-phase microsphere carriers and lateral flow chromatography test strips, the high cost and easy inactivation problems caused by antibody dependence are solved, and low-cost, high-specificity and high-sensitivity nucleic acid detection is achieved.
Patent Information
- Application Number
- CN202410428768.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-04-10
- Publication Date
- 2025-10-17
AI Technical Summary
Existing CRISPR-based nucleic acid detection test strips rely on antibody capture, which leads to high detection costs and easy inactivation of antibodies, affecting the storage and application of the test strips.
Using nucleic acid base complementary hybridization capture probes, CRISPR/Cas protein binds to crRNA to cleave the target nucleic acid, and the specific sequence design of the enzyme-cleaved substrate probe is used, combined with solid-phase microsphere carriers and lateral flow chromatography test paper to achieve specific detection of the target nucleic acid.
The detection cost is reduced, the specificity and sensitivity of the detection are improved, false positive results are avoided, the results are easy to read and the detection time is short.
Smart Images

Figure CN120796444A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application designs a CRISPR solid-phase cleavage-trapping nucleic acid detection test strip and an application method thereof. BACKGROUND
[0002] Fast, sensitive, accurate and portable nucleic acid detection is crucial for human and animal disease detection, environmental monitoring, food safety and other fields. Quantitative PCR technology is the gold standard for nucleic acid detection and has been widely used. However, the technology is complicated, time-consuming, dependent on some high-precision instruments, and requires a high level of technical skills for the operator. It is not suitable for resource-limited areas or situations requiring instant detection. Therefore, it is of great significance to develop a fast, sensitive, low-cost, high-specificity and widely applicable nucleic acid detection method.
[0003] CRISPR (Clustered regularly interspaced short palindromic repeats) gene editing technology has developed rapidly and plays an important role in nucleic acid detection. In the CRISPR technology, CRISPR / Cas12 can specifically recognize target DNA and activate its trans cleavage activity to cut the nearby single-stranded DNA, and CRISPR / Cas13 can specifically recognize target RNA and activate its trans cleavage activity to cut the nearby single-stranded RNA. In recent years, a series of nucleic acid detection technologies have been developed using the high specificity recognition and unique trans cleavage activity of CRISPR / Cas12 and CRISPR / Cas13, which have shown excellent nucleic acid detection performance.
[0004] The most commonly used nucleic acid detection method is to use Cas12 / Cas13 to recognize target nucleic acid, activate the trans cleavage activity of Cas12 / Cas13, cut the probe marked with a fluorescent group and a quencher group, and analyze the fluorescence value after cutting to achieve the purpose of detection. However, this method requires additional equipment to collect the fluorescence signal, which is not conducive to popularization and application in basic areas. The combination of CRISPR technology and gold nanometer lateral flow chromatography test paper is more suitable for instant pathogen detection, which can directly observe whether there is a band on the detection line to judge whether there is a target. In the current CRISPR cleavage-based nucleic acid detection test paper, the quality control line of the lateral flow chromatography test paper is marked with avidin, the detection line is marked with anti-FAM antibody, and the gold nanometer probe is marked with FAM antibody. When the Cas12 / Cas13 protein is activated to recognize the target, it will cut the DNA / RNA probe marked with biotin and FAM group. The uncut probe will be captured by the avidin on the quality control line through the streptavidin-biotin interaction. The cut probe can be combined with the gold nanometer through the antigen-antibody interaction, and then flows to the detection line, which is captured by the anti-FAM antibody on the detection line through the antigen-antibody interaction, so that a red band is displayed on the detection line.
[0005] Although the existing CRISPR cleavage-based nucleic acid detection test paper can judge whether the target exists or not by detecting whether there is a band on the detection line, the current method uses an antigen-antibody capture method to achieve the detection purpose, and needs antibodies such as FAM antibody and anti-FAM antibody. The use of these antibodies not only makes the detection cost very high, but also makes the gold nanometer modified by the antibody and the test paper not resistant to storage due to the characteristics of the antibody. SUMMARY
[0006] The purpose of the present application is to solve the above-mentioned shortcomings and deficiencies of the prior art, and to develop a CRISPR solid-phase cleavage and interception type nucleic acid rapid detection test paper. The use of nucleic acid base complementary hybridization to capture the probe makes the result more accurate and the cost more low, and it can be applied to the rapid detection of various pathogen nucleic acids.
[0007] The present application is realized by the following technical solutions:
[0008] A CRISPR solid-phase cleavage and interception type nucleic acid rapid detection test paper, the test paper comprises a lateral flow chromatography test paper, a Cas protein, a crRNA, and an enzyme cutting substrate probe, the enzyme cutting substrate probe is fixed on a solid-phase microsphere carrier and embedded in the lateral flow chromatography test paper, and the nucleic acid sequence of the enzyme cutting substrate probe comprises a first sequence that cannot be cut by the activated Cas protein and a second sequence that can be cut by the activated Cas protein.
[0009] The Cas protein and the crRNA can bind and cleave the target nucleic acid and activate the transcleavage property to cleave other nucleic acids. The Cas protein includes a Cas12a protein or a Cas13a protein, and the Cas protein and the crRNA can be loaded into a Cas12a / crRNA or a Cas13a / crRNA complex, or each can be packaged separately.
[0010] The activation refers to that after the Cas protein and the crRNA bind and cleave the target nucleic acid, the transcleavage property is activated to cleave other nucleic acids. In the present application, after the Cas protein and the crRNA bind and cleave the target nucleic acid, the transcleavage property is activated to cleave the second sequence in the enzyme digestion substrate probe, but cannot cleave the first sequence.
[0011] The enzyme digestion substrate probe includes a CRISPR / Cas12a enzyme digestion substrate probe or a CRISPR / Cas13a enzyme digestion substrate probe.
[0012] The CRISPR / Cas12a enzyme digestion substrate probe includes a first sequence that cannot be cleaved by the activated Cas12a protein and a second sequence that can be cleaved by the activated Cas12a protein. Specifically, the sequence of the preferred CRISPR / Cas12a enzyme digestion substrate probe is represented as 5’-(A)n-(B)m-3’, wherein A is a nucleic acid sequence that cannot be degraded by Cas12a / crRNA, B represents a DNA sequence that can be degraded by Cas12a / crRNA, n represents the number of bases in the A sequence, and m represents the number of bases in the B sequence. n is an integer greater than or equal to 16, and m is an integer greater than or equal to 2.
[0013] Further, the nucleic acid sequence that cannot be degraded by Cas12a / crRNA can be an RNA sequence or a chemically modified DNA or RNA sequence, and the chemical modification includes but is not limited to phosphorothioation, peptide nucleic acid, methoxy modification, etc., as long as it can not be degraded by Cas12a / crRNA. Generally, RNA sequences cannot be degraded by Cas12a / crRNA, but considering that there may be RNases in the environment that can degrade RNA sequences, it is preferred that the nucleic acid sequence that cannot be degraded by Cas12a / crRNA is a chemically modified DNA or RNA sequence, such as a methoxy-modified RNA sequence.
[0014] The CRISPR / Cas13a enzyme cutting substrate probe comprises a first sequence that cannot be cut by the activated Cas13a protein and a second sequence that can be cut by the activated Cas13a protein, and the specific preferred sequence of the CRISPR / Cas13a enzyme cutting substrate probe is represented as: 5'-(C)p-(D)q-3', wherein C is a nucleic acid sequence that cannot be degraded by Cas13a / crRNA, D represents an RNA sequence that can be degraded by Cas12a / crRNA, p represents the number of bases in the C sequence, and q represents the number of bases in the D sequence. p is an integer greater than or equal to 16, and q is an integer greater than or equal to 2.
[0015] Further, the nucleic acid sequence that cannot be degraded by Cas13a / crRNA can be a DNA sequence or a chemically modified DNA or RNA sequence, and the chemical modification includes but is not limited to phosphorothioate modification, peptide nucleic acid, methoxy modification, etc. All types of DNA (modified DNA and unmodified DNA) cannot be degraded by Cas13a / crRNA, so the nucleic acid sequence that cannot be degraded by Cas13a / crRNA is preferably a DNA sequence.
[0016] Further, the enzyme cutting substrate probe is embedded in the lateral flow chromatography test paper.
[0017] Further, the enzyme cutting substrate probe is fixed on a solid-phase microsphere carrier, which includes but is not limited to Fe3O4 microspheres or polystyrene microspheres.
[0018] The connection mode of the enzyme cutting substrate probe and the solid-phase microsphere carrier includes but is not limited to biotin-avidin interaction, amino-carboxyl compound reaction.
[0019] Further, the connection sequence of the enzyme cutting substrate probe and the solid-phase microsphere carrier is solid-phase microsphere carrier-second sequence-first sequence, and the first sequence is located at the end away from the solid-phase microsphere carrier.
[0020] For the CRISPR / Cas12a enzyme cutting substrate probe 5'-(A)n-(B)m-3' or the CRISPR / Cas13a enzyme cutting substrate probe 5'-(C)p-(D)q-3', preferably, biotin is modified at the 3' end, and the solid-phase microsphere carrier modified with streptavidin is connected.
[0021] When the Cas protein and the crRNA are combined and cut the target nucleic acid, the trans-cleavage property is activated, the second sequence in the enzyme cutting substrate probe is cut and degraded, and the first sequence that cannot be cut and degraded is released from the solid-phase microsphere carrier.
[0022] If there is no target nucleic acid, the trans-cleavage property cannot be activated, and the enzyme cutting substrate probe is fixed on the solid-phase microsphere carrier and cannot be released.
[0023] Further, the test strip comprises a nano-gold labeled probe, which is prepared by labeling the labeled probe with colloidal gold, and the labeled probe comprises a third sequence complementary to part of the first sequence in the enzyme cutting substrate probe.
[0024] Further, the third sequence can be complementary to part of the A sequence in the CRISPR / Cas12a enzyme cutting substrate probe, or can be complementary to part of the C sequence in the CRISPR / Cas13a enzyme cutting substrate probe.
[0025] The labeled probe is labeled on colloidal gold, and the labeling can be performed by a heating drying method.
[0026] Further, the labeled probe can be a thiol-modified probe, or can be an ordinary unmodified probe. The ordinary unmodified probe further comprises a fourth sequence not complementary to the first sequence and a fifth sequence not complementary to the first sequence.
[0027] The fourth sequence is preferably PolyA, which can be adsorbed on the surface of colloidal gold particles with extremely high affinity, so as to realize labeling and modification of the labeled probe and colloidal gold. The fifth sequence is preferably polyT, which can form a protective shell on the surface of nano-gold, so that the nano-particles are more stable during labeling.
[0028] Further, in an embodiment of the present application, the nano-gold labeled probe is composed of AAAAA-third sequence-TTTTT.
[0029] AAAAA and TTTTT are not complementary to the first sequence.
[0030] Further, the lateral flow chromatography test paper comprises a reaction pad, a gold label pad, a nitrocellulose membrane and a water absorption pad.
[0031] The enzyme cutting substrate probe is fixed on a solid-phase microsphere carrier and embedded in the reaction pad.
[0032] The nano-gold labeled probe is embedded in the gold label pad.
[0033] The reaction pad and the gold label pad are generally made of glass cellulose membrane.
[0034] The gold label pad, the nitrocellulose membrane and the water absorption pad are arranged in sequence, and each adjacent part is provided with an overlap.
[0035] Further, the gold label pad, the nitrocellulose membrane and the water absorption pad are sequentially pasted on the PVC plate in sequence, and the adjacent parts are provided with an overlap.
[0036] The reaction pad is independently movable,
[0037] The particle size of the solid-phase microsphere carrier for fixing the enzyme cutting substrate probe is larger than the pore size of the nitrocellulose membrane. In this way, the enzyme cutting substrate probe can be prevented from flowing to the detection line by capillary action, and false positive results can be avoided.
[0038] Preferably, the pore size of the nitrocellulose membrane is 8 μm, and the diameter of the solid-phase microsphere carrier is 10 μm.
[0039] The nitrocellulose membrane is sequentially provided with a detection line and a quality control line, the detection line is connected with a detection line capture probe, and the quality control line is connected with a quality control line capture probe. Specifically, the detection line and the quality control line are sequentially provided in the sample flow direction, the detection line is in the direction close to the gold mark pad, and the quality control line is in the direction away from the gold mark pad.
[0040] Further, the detection line capture probe is connected to the detection line by biotin-avidin interaction.
[0041] Further, the quality control line capture probe is connected to the quality control line by biotin-avidin interaction.
[0042] The detection line capture probe includes a sixth sequence complementary to part of the first sequence of the enzyme cutting substrate probe.
[0043] That is, part of the first sequence of the enzyme cutting substrate probe and the third sequence of the marker probe are complementary and hybridized, and the remaining part of the base and the sixth sequence of the detection line capture probe are complementary and hybridized.
[0044] Further, the sixth sequence can be complementary to part of the A sequence in the CRISPR / Cas12a enzyme cutting substrate probe, or can be complementary to part of the C sequence in the CRISPR / Cas13a enzyme cutting substrate probe.
[0045] Further, the A sequence includes an A1 sequence and an A2 sequence, the A2 sequence and the third sequence of the marker probe are base complementary, and the A1 sequence and the sixth sequence of the detection line capture probe are base complementary.
[0046] The C sequence includes a C1 sequence and a C2 sequence, the C2 sequence and the third sequence of the marker probe are base complementary, and the C1 sequence and the sixth sequence of the detection line capture probe are base complementary.
[0047] The quality control line capture probe includes a seventh sequence complementary to part of the base of the marker probe.
[0048] Further, the seventh sequence and the third sequence of the marker probe are base complementary.
[0049] The Cas protein and the crRNA can be loaded on the reaction pad or packaged separately.
[0050] In the present application, the crRNA is designed according to the recognition mechanism of the Cas12a protein and the Cas13a protein. If the target is DNA, the crRNA is designed according to the Cas12a protein, and if the target is RNA, the crRNA is designed according to the Cas13a protein. The crRNA is assembled with the corresponding Cas protein to form a Cas12a / crRNA and a Cas13a / crRNA complex, or is packaged separately.
[0051] The sequence of the crRNA can be specifically designed according to the nucleic acid target of the pathogen to be detected.
[0052] The present application also provides the application of the CRISPR solid-phase cleavage-trapped nucleic acid rapid detection test strip in detecting pathogen nucleic acid.
[0053] The present application also provides a method for detecting pathogen nucleic acid using the CRISPR solid-phase cleavage-trapped nucleic acid rapid detection test strip, wherein the pathogen includes but is not limited to bacteria, viruses, mycoplasma, fungi, parasites, etc., and the method comprises the following steps:
[0054] (1) Extracting nucleic acid from the sample to be detected, and obtaining the sample to be detected by amplification;
[0055] Commercially available or self-made nucleic acid extraction reagents or nucleic acid extraction kits can be used to extract the nucleic acid of the sample to be detected, and the conventional method for extracting nucleic acid can be used.
[0056] The amplification method of the nucleic acid also uses conventional means, and the amplification method includes but is not limited to PCR, isothermal amplification, etc. Conventional or novel amplification methods, primers, systems, procedures, etc. can be used in the present application as long as the purpose of nucleic acid amplification can be achieved. The present application does not limit the method for extracting nucleic acid and the method for amplifying nucleic acid.
[0057] (2) Adding Cas12a or Cas13a protein and crRNA, or adding Cas12a / crRNA or Cas13a / crRNA complex into the sample to be detected, adding the obtained reaction liquid drop to the reaction pad, incubating at 37°C for 10-60 minutes, and then overlapping the reaction pad with the gold label pad at one end away from the detection line. Add the flow buffer on the reaction pad, and observe the detection line and the quality control line on the test strip: the appearance of a red band on the detection line indicates a positive result, and the target exists. The absence of a red band on the detection line indicates a negative result, and the target does not exist. The reaction pad cannot contact the nitrocellulose membrane, especially the detection line on the nitrocellulose membrane,
[0058] The absence of a red band on the quality control line represents an invalid detection.
[0059] If the nucleic acid sample to be detected is DNA, Cas12a and crRNA are added, or Cas12a / crRNA complex is directly added; if the sample to be detected is RNA, Cas13a and crRNA are added, or Cas13a / crRNA complex is directly added.
[0060] The flow buffer is a flow buffer of a lateral flow test paper, which is used to carry a sample and promote the migration of a reagent of a reaction solution along the lateral flow test paper.
[0061] The dropwise addition amount of the flow buffer is 50-200 μL, preferably 100 μL.
[0062] Further, the flow buffer comprises a nucleic acid hybridization buffer, such as SSC buffer (Saline Sodium Citrate), which contains sodium chloride and sodium citrate, and can maintain a constant ionic strength and pH value during nucleic acid hybridization, so as to promote the stability and affinity binding of nucleic acids.
[0063] The flow buffer contains high-concentration salt ions, which can not only make the reaction solution fully migrate, but also make the base complementary pairing force of each sequence stronger, so that the detection line capture probe and the control line capture probe can better capture the probes complementary to them.
[0064] Further, the flow buffer comprises 600 mM NaCl and 60 mM sodium citrate, and has a pH value of 6.8-7.2 (preferably pH 7.0).
[0065] Further, the flow buffer further comprises 0.05% Tween-20, 1% BSA and 1X PBS buffer. The functions of BSA and Tween-20 are to reduce the non-specific adsorption of nucleic acids and gold nanoparticle probes during the flow process of the test paper strip.
[0066] The crRNA in step (2) can be designed according to the nucleic acid of the pathogen to be detected and obtained by means known to those skilled in the art. The crRNA of any pathogen nucleic acid reported in the prior art and the self-designed crRNA can be used in the present application.
[0067] The present application also provides a CRISPR solid-phase cleavage and capture nucleic acid rapid detection kit, which comprises the CRISPR solid-phase cleavage and capture nucleic acid rapid detection test strip.
[0068] The kit further comprises a nucleic acid extraction reagent, a nucleic acid amplification reagent and a flow buffer.
[0069] The nucleic acid extraction reagent can be a commercially available nucleic acid extraction kit and a commonly used nucleic acid extraction reagent.
[0070] The nucleic acid amplification reagent can be selected according to the nucleic acid of the sample to be detected, and the nucleic acid amplification method includes but is not limited to PCR, isothermal amplification and the like, and various amplification methods and amplification kits can be used in the application as long as the purpose of nucleic acid amplification can be achieved.
[0071] The detection principle of the application is as follows:
[0072] When the target nucleic acid exists, the Cas protein / crRNA complex can bind to it (the DNA target can be bound by the Cas12a protein / crRNA complex, and the RNA target can be bound by the Cas13a protein / crRNA complex), the cis cleavage activity of the Cas protein is triggered, the target nucleic acid is cleaved, at the same time, the trans cleavage activity of the Cas protein is triggered, the second sequence in the enzyme cutting substrate probe fixed on the reaction pad is cut, the Cas12a protein cuts the DNA base in the enzyme cutting substrate probe, the first sequence such as the RNA base and other chemically modified bases in the enzyme cutting substrate probe are not cut by the Cas12a protein, the Cas13a protein cuts the RNA base in the enzyme cutting substrate probe, the first sequence such as the DNA base and other chemically modified bases in the enzyme cutting substrate probe are not cut by the Cas13a protein, the second sequence is cut, the first sequence is released, the cut substrate probe (first sequence) can flow through the gold label pad by capillary force, part of the bases in the first sequence can hybridize with the third sequence of the nanogold probe on the gold label pad by base complementary pairing, the remaining bases of the first sequence hybridize with the sixth sequence of the capture probe on the detection line by base complementary pairing when flowing through the detection line, and are captured by the capture probe on the detection line, so that a red band appears on the detection line. The uncut substrate probe is still connected to the fixed carrier microsphere, the diameter of the microsphere is larger than the pore size of the nitrocellulose membrane, so it cannot flow to the detection line by capillary action; when the target does not exist, the Cas protein / crRNA complex cannot bind to it, the subsequent cis cleavage activity and trans cleavage activity of the Cas protein cannot be triggered, the substrate probe cannot be cut and separated from the surface of the microsphere, and the substrate probe fixed on the solid-phase microsphere carrier cannot flow to the detection line by capillary action because the diameter of the microsphere is larger than the pore size of the nitrocellulose membrane. Therefore, when the target does not exist, no red band appears on the detection line. The nanogold probe can always flow on the test paper with the liquid, the third sequence on the nanogold probe hybridizes with the seventh sequence of the capture probe on the quality control line by base complementary pairing, and the nanogold probe can make a red band appear on the quality control line.
[0073] Compared with the prior art, the application has the beneficial effects that:
[0074] 1. The application provides a CRISPR solid-phase cleavage-trapped nucleic acid rapid detection test strip, a novel CRISPR / Cas enzyme cutting substrate probe is designed, the enzyme cutting substrate after cutting, the nanogold probe and the capture probe on the detection line are combined by the complementary hybridization between nucleic acids, and compared with the combination of the antigen-antibody effect of the traditional CRISPR test paper, the combination is more specific, and the detection cost is more low.
[0075] 2. The CRISPR solid-phase cleavage-trapped nucleic acid rapid detection test strip provided by the application connects the enzyme cutting substrate probe on the solid-phase microsphere carrier, releases the substrate probe through the cleavage of CRISPR, and intercepts the microspheres and the uncut probes by the pore size characteristics of the lateral flow chromatography test paper, so that the uncut probes are more completely intercepted by the pore size, and the deficiency of the traditional CRSIPR test paper that false positives are prone to occur is made up.
[0076] 3. The CRISPR solid-phase cleavage-trapped nucleic acid rapid detection test strip provided by the application has the characteristics of easy reading of detection results, short detection time, high specificity and strong sensitivity. BRIEF DESCRIPTION OF DRAWINGS
[0077] Figure 1 is a structure schematic diagram of the CRISPR solid-phase cleavage-trapped nucleic acid rapid detection test strip in Example 1.
[0078] Figure 2 is a detection principle schematic diagram of the CRISPR solid-phase cleavage-trapped nucleic acid rapid detection test strip in Example 1.
[0079] Figure 3 is a sensitivity detection result diagram of the CRISPR solid-phase cleavage-trapped nucleic acid rapid detection test strip in Example 3 for detecting herpes simplex virus nucleic acid.
[0080] Figure 4 is a specificity evaluation result diagram of the CRISPR solid-phase cleavage-trapped nucleic acid rapid detection test strip in Example 4 for detecting herpes simplex virus nucleic acid.
[0081] Figure 5 is a herpes simplex virus nucleic acid detection result diagram in a clinical tear sample in Example 5. DETAILED DESCRIPTION
[0082] Following specific embodiments are used to illustrate the implementation of the present application, and other advantages and effects of the present application can be easily understood by those skilled in the art from the disclosure of the present specification. The present application can also be implemented or applied by other different embodiments, and various modifications or changes can be made to the details in the present specification based on different views and applications without departing from the spirit of the present application. It should be noted that the following embodiments and features in the embodiments can be combined with each other without conflict. The methods used in the embodiments of the present application are conventional methods unless otherwise specified, and the reagents used can be obtained from commercial channels.
[0083] Embodiment 1
[0084] A CRISPR solid-phase cleavage-trapping nucleic acid rapid detection test strip
[0085] (1) Design and purification of crRNA:
[0086] The crRNA is designed according to the type of target. If the target is DNA, Cas12a / crRNA is used to recognize the target, and the crRNA is designed as UAAUUUCUACUAAGUGUAGAU. NNNNNNNNNNNNNNNNNNNNN (The underlined part is the target gene recognition region, which is designed according to the target gene, and the length can be changed); if the target is RNA, Cas13a / crRNA is used to recognize the target, and the crRNA is designed as
[0087] GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC NNNNNNNNNNNN NNNNNNNNN (The underlined part is the target gene recognition region, which is designed according to the target gene, and the length can be changed)
[0088] The crRNA is assembled into Cas12a / crRNA and Cas13a / crRNA complex with the corresponding Cas protein, or is stored separately.
[0089] (2) Labeling of gold nanoparticle probe:
[0090] In this embodiment, colloidal gold is prepared by sodium citrate reduction method: 100 mL of 1 mM HAuCl4 is heated to boiling, and after boiling is stable, 10 mL of 38.8 mM sodium citrate solution is added under rapid stirring. Within two minutes, the solution color changes from golden yellow → colorless → black → deep purple → wine red → transparent red. Continue to stir for 15-30 minutes, continue to stir after stopping heating, and cool to room temperature. The colloidal gold solution is obtained, and the colloidal gold particle size is about 13 nm.
[0091] The labeling probe used in this embodiment is PolyA5-T5: AAAAATGGTATTTGTTTTT.
[0092] The labeling method of the probe in this embodiment is microwave heat drying method. The specific steps are as follows: 20 μL of the labeled probe with a concentration of 100 μM is mixed with 400 μL of colloidal gold, and then the mixture is added to a glass bottle. The glass bottle is placed in a household microwave oven, and the medium-high fire mode is adjusted to heat for 3 min. At this time, the mixed solution in the glass bottle has been completely dried. Then, 400 μL of triple distilled water is added to the glass bottle after heating and drying, and the mixture is mixed gently by blowing with a pipette gun. The solution in the glass bottle is transferred to an EP tube, and then centrifuged at 25°C and 12000 rpm / min for 20 min. After the supernatant is removed, the resuspension buffer (0.3M NaCl, 0.01M phosphate buffer, pH 7.4) is used for resuspension, and then centrifuged at 25°C and 12000 rpm / min for 20 min. After the supernatant is removed, 300 μL of the resuspension buffer (1M NaCl, 20mM Na3PO4, 5% BSA, 0.25% Tween-20, and 10% sucrose) is used for resuspension, and the nanogold-labeled probe is obtained.
[0093] (3) Design of enzyme-cutting substrate probe
[0094] The CRISPR / Cas12a enzyme-cutting substrate probe in this embodiment is composed of DNA bases and nucleic acids that are not degraded by Cas12a / crRNA, and is represented as: AGGGUAAACCAAAUACCA CCCCCCCCCC, wherein the hatched part is a methoxy-modified RNA base, so that it will not be degraded by CRISPR / Cas12a.
[0095] The CRISPR / Cas13a enzyme-cutting substrate probe in this embodiment is composed of RNA bases and DNA that is not degraded by Cas13a / crRNA, and is represented as:
[0096] AGGGTAAACCAAATACCA UUUUUUUUUU , wherein the hatched part is an RNA base.
[0097] (4) Assembly of lateral flow chromatographic test strip
[0098] The nucleic acid detection test strip is composed of four parts: a reaction pad, a gold-labeled pad, a nitrocellulose membrane, and a water-absorbing pad. The assembly steps are as follows:
[0099] a) Reaction pad: The reaction pad was made of glass fiber membrane and cut into appropriate size. 10 μΐ of the biotin-modified enzyme digestion substrate probe described in step (3) was mixed with streptavidin microspheres, incubated at 37 °C for 30 min, and then washed with 1X PBS solution for 3 times. 10 μΐ of the enzyme digestion substrate probe immobilized on the microspheres after washing was dropped onto the reaction pad, and dried at 37 °C for standby. Streptavidin-modified F3O4 magnetic microspheres with a diameter of 10 μm were used in this example, and the pore size of the nitrocellulose membrane was 8 μm.
[0100] b) Gold label pad treatment: The gold label pad was made of glass fiber membrane, and 15 μΐ of the gold nanoparticle-labeled probe obtained in step (2) was dropped onto the glass fiber membrane, and dried at room temperature for standby.
[0101] c) Treatment of nitrocellulose membrane: The biotin-modified quality control line capture probe and the biotin-modified detection line capture probe were incubated with streptavidin (1 mg / mL) respectively, and then drawn on the nitrocellulose membrane at different positions by ZX two-dimensional membrane drawing gold spraying instrument (HM3020) as the detection line and the quality control line respectively, with a distance of about 3 mm. Dry naturally at room temperature for standby.
[0102] The sequence of the quality control line capture probe was TTTTTCAAATACCA
[0103] The sequence of the detection line capture probe was GTTTACCCTTTTTT.
[0104] d) Treatment of water absorption pad: The water absorption pad was cut into appropriate size with a paper cutter to provide capillary force for the flow of the sample to be tested.
[0105] e) Assembly of test strip: As shown in Figure 1 , the nucleic acid test strip was composed of four parts: reaction pad, gold label pad, nitrocellulose membrane, and water absorption pad. The gold label pad, nitrocellulose membrane, and water absorption pad were pasted on the PVC plate in order, with an overlap of 2 mm between adjacent parts, and then cut into 4 mm wide strips with a rolling paper cutter, and dried at room temperature for standby. The detection line on the nitrocellulose membrane was located close to the gold label pad, and the quality control line was located away from the gold label pad.
[0106] (5) CRISPR / Cas system cleavage reaction:
[0107] Mix the nucleic acid to be tested with Cas12a or Cas13a protein and crRNA, or add Cas12a / crRNA or Cas13a / crRNA complex mixture (20 μl volume), drop to the reaction pad obtained in step 4a, and incubate the reaction pad at 37°C for 10-60 minutes; if the target nucleic acid is DNA, add Cas12a and crRNA or Cas12a / crRNA complex, the concentration is 10-1000 nM; if the target nucleic acid is RNA, add Cas12a and crRNA or Cas13a / crRNA complex, the concentration is 10-1000 nM.
[0108] (6) Color development of lateral flow chromatographic test strip and result reading
[0109] After the reaction in step (5) is completed, overlap the reaction pad with the gold label pad at the end away from the detection line, and the reaction pad should not contact the nitrocellulose membrane. Then drop 100 μl of flow buffer (4×SSC, 0.05% Tween-20, 1×PBS, 1% BSA) on the reaction pad, and observe the detection line band and the quality control line band on the lateral flow chromatographic test strip after standing for 5 minutes. Whether there is a band on the detection line can be used to determine the presence or absence of the target.
[0110] If a red band appears on the detection line, it indicates a positive result, and the target exists. If there is no red band on the detection line, it indicates a negative result, and the target does not exist.
[0111] If the quality control line is a red band, it means the detection is valid. If there is no red band on the quality control line, it means the detection is invalid.
[0112] The detection principle is as follows Figure 2As shown, there are magnetic bead substrate probes on the reaction pad. When the target nucleic acid exists, the Cas protein / crRNA complex can bind to it (the DNA target can be bound by the Cas12a protein / crRNA complex, and the RNA target can be bound by the Cas13a protein / crRNA complex), the cis cleavage activity of the Cas protein is triggered, the target nucleic acid is cleaved, at the same time, the trans cleavage activity of the Cas protein is triggered, the magnetic bead substrate probe on the reaction pad is cleaved, the DNA base in the substrate probe is cleaved by the Cas12a protein, the RNA base in the substrate probe and other chemically modified bases are not cleaved by the Cas12a protein, the RNA base in the substrate probe is cleaved by the Cas13a protein, the DNA base in the substrate probe and other chemically modified bases are not cleaved by the Cas13a protein, the cleaved substrate probe can be separated from the solid-phase microsphere carrier, leave the reaction pad by capillary force, flow through the gold label pad and hybridize with the gold nanoparticle probe on the gold label pad by base complementary pairing, when flowing through the detection line, the remaining base of the substrate probe hybridizes with the capture probe on the detection line and is captured by the capture probe on the detection line, so that a red band appears on the detection line. The uncut substrate probe is still connected to the fixed carrier microsphere, and the microsphere diameter is larger than the pore size of the nitrocellulose membrane, so it cannot flow to the detection line by capillary action and cannot cause false positive results. In addition, the gold nanoparticle probe that does not combine with the substrate probe flows through the quality control line by capillary force, is captured by the quality control line capture probe by base complementary pairing, so that a red band appears on the quality control line.
[0113] When the target does not exist, the Cas protein / crRNA complex does not bind to it, and the subsequent cis cleavage activity and trans cleavage activity of the Cas protein are not triggered, so the substrate probe is not cleaved from the surface of the microsphere and a red band does not appear on the detection line. The gold nanoparticle probe still makes a red band appear on the quality control line.
[0114] Example 2
[0115] CRISPR solid-phase cleavage interception type nucleic acid rapid detection test strip detects nucleic acid of herpes simplex virus 1 (1) pathogenic nucleic acid of viral keratitis
[0116] The GB gene sequence of herpes simplex virus is analyzed, and three pairs of LAMP amplification primers are designed, and the primer sequences are as follows:
[0117] F3: GGTTGTTGCGCACGTACT;
[0118] B3: CGGTGGTCTTCAAGGAGAAC;
[0119] FIP: CCGTCCCCTTCGAGGAGGTGAGCCGTGGACCGACAGA
[0120] BIP: GAGTAGCGGTGGCCGAACCCGCCCCGTACAAGTTCAA
[0121] LF: CGACAAGATCAACGCCAAGG
[0122] LB: CACCTGCGAAACGGTGAC
[0123] The LAMP amplification system is as shown in Table 1, water is added to 20 μL, the amplification reaction temperature is 60°C for 30 minutes, the total volume of the reaction system is 20 μL.
[0124] Table 1
[0125]
[0126]
[0127] (2) Design of crRNA
[0128] Find the PAM (TTTN) site sequence that Cas12a can recognize in the LAMP amplification sequence, design crRNA according to the PAM site information, the crRNA sequence is: UAAUUUCUACUAAGUGUAGAUUAGUACAUGGUGGCCUUGAA.
[0129] (3) Assembly of lateral flow chromatography test strip
[0130] Assemble the lateral flow chromatography test strip according to the procedure (4) of Example 1.
[0131] (4) Cleavage reaction of CRISPR / Cas system:
[0132] Mix the amplification reagent in (1), Cas12a protein, crRNA in step (3), and reaction buffer together, with a total volume of 20 μl, incubate at 37°C for 5 minutes, the crRNA concentration in this cleavage system is 400 nM crRNA, and the Cas12a concentration is 80 nM. Drop the obtained CRISPR / Cas12a cleavage system mixture onto the reaction pad of the lateral flow chromatography test strip, and incubate at 37°C for 30 minutes.
[0133] (6) Color development of lateral flow chromatography test strip and result reading
[0134] After the reaction of step (5) is completed, the reaction pad is overlapped with the gold pad at the end of the detection line, and then 100 μl of the flow buffer is added to the reaction pad. After standing for 5 minutes, the detection line and the quality control line on the lateral flow chromatography test paper are observed. Whether there is a band on the detection line can determine whether the target exists.
[0135] Example 3
[0136] Sensitivity evaluation of CRISPR solid-phase cleavage-trapped nucleic acid rapid detection test strip for detecting herpes simplex virus nucleic acid
[0137] The herpes simplex virus standard was diluted at a certain concentration (5×10 3 pfu / μL, 500 pfu / μL, 200 pfu / μL, 50 pfu / μL, 20 pfu / μL, 10 pfu / μL, 5 pfu / μL) and amplified and detected by the method of Example 2. The results are shown in Figure 3 , which shows that the concentration of herpes simplex virus that can be detected by the method is 20 pfu, indicating that the method has high detection sensitivity.
[0138] Example 4
[0139] Specificity evaluation of CRISPR solid-phase cleavage-trapped nucleic acid rapid detection test strip for detecting herpes simplex virus nucleic acid
[0140] (1) Six kinds of herpes viruses: herpes simplex virus type 1 (HSV-1), herpes simplex virus type 2 (HSV-2), varicella-zoster virus (VZV), Epstein-Barr virus (EB-V), cytomegalovirus (CMV), and human adenovirus (HAdv) were selected, and viral nucleic acid was extracted by using a viral micro-extraction kit. The specific steps are as follows: (a) After centrifuging the tear sample in the centrifuge tube at 10000×g for 30s, 200 μL of PBS was added, followed by adding 25 μL of proteinase K and 200 μL of lysis solution containing 6 μg of Carrier RNA, vortexing for 15s, then placing the centrifuge tube in a 56°C water bath for 15min, and after water bath, centrifuging at 10000×g for 10s, adding 250 μL of anhydrous ethanol, shaking for 15s, and standing at room temperature for 5min. (b) Take 650 μL of the mixed solution and place it in a filter column, centrifuge at 6800×g for 1min, discard the liquid after centrifugation, wash twice with 500 μL of elution solution, centrifuge at 6800×g for 1min, discard the elution solution, continue to centrifuge at 20000×g for 1min, remove the residual elution solution, stand at room temperature for 1min, then add 40 μL of RNase-free water to the centrifugal column, centrifuge at 20000×g for 1min, collect the liquid in the centrifuge tube, and store at -20°C.
[0141] (2) The method of Example 2 was used for amplification and result determination. The results are shown inFigure 4 As shown, the detection line of herpes simplex virus type 1 has a band, while the detection lines of other non-target viruses have no bands, indicating that the test kit of the present invention has good specificity.
[0142] Example 5
[0143] Detection of herpes simplex virus nucleic acid in clinical tear specimens using a CRISPR solid-phase shearing and retention nucleic acid rapid test strip
[0144] (1) Tear collection and viral nucleic acid extraction
[0145] Tear collection: Place a disposable sterile tear test paper of approximately 2*2mm in size on the outer third of the lower eyelid margin of the left and right eyes of patients to be diagnosed with viral eye disease under a slit lamp. After 3 minutes, use sterile tweezers to transfer the test paper into a centrifuge tube.
[0146] (2) Extraction of viral nucleic acid from tear fluid: Viral nucleic acid was extracted using a viral microextraction kit. The specific steps were as follows: (a) After centrifuging the tear fluid sample in the centrifuge tube at 10,000 × g for 30 seconds, 200 μL of PBS was added, followed by 25 μL of proteinase K and 200 μL of lysis buffer containing 6 μg of carrier RNA. The tube was vortexed for 15 seconds, and then the centrifuge tube was placed in a 56°C water bath for 15 minutes. After the water bath, the tube was centrifuged at 10,000 × g for 10 seconds. After centrifugation, 250 μL of anhydrous ethanol was added, and the tube was vortexed for 15 seconds and then allowed to stand at room temperature for 5 minutes. (b) 650 μL of the mixed solution was placed in a filter column and centrifuged at 6800 × g for 1 min. After discarding the liquid after centrifugation, the solution was eluted twice with 500 μL of eluent and centrifuged at 6800 × g for 1 min. After discarding the eluent, the solution was centrifuged at 20,000 × g for 1 min to remove the residual eluent. The solution was allowed to stand at room temperature for 1 min. Subsequently, 40 μL of RNase-free water was added to the column and centrifuged at 20,000 × g for 1 min.
[0147] (3) Amplification and result determination were performed using the method of Example 2. The results are as follows Figure 5 As shown, the detection line of the positive specimen clinically diagnosed as herpes simplex virus epitheliitis has a band, while the detection line of the negative specimen has no band, indicating that the kit of the present invention has the potential to be applied to clinical sample detection.
Claims
1. A CRISPR solid phase shearing and interception nucleic acid rapid detection test strip, characterized in that The test strip includes a lateral flow chromatography test paper, a Cas protein, crRNA, and an enzyme-cleavage substrate probe. The enzyme-cleavage substrate probe is fixed on a solid-phase microsphere carrier and embedded in the lateral flow chromatography test paper. The nucleic acid sequence of the enzyme-cleavage substrate probe includes a first sequence that cannot be cut by the activated Cas protein and a second sequence that can be cut by the activated Cas protein.
2. The test strip according to claim 1, wherein The Cas protein includes Cas12a protein or Cas13a protein, and the enzyme cleavage substrate probe includes CRISPR / Cas12a enzyme cleavage substrate probe or CRISPR / Cas13a enzyme cleavage substrate probe; The CRISPR / Cas12a enzyme cleavage substrate probe includes a first sequence that cannot be cleaved by the activated Cas12a protein and a second sequence that can be cleaved by the activated Cas12a protein. The sequence of the CRISPR / Cas12a enzyme cleavage substrate probe is expressed as 5'-(A)n-(B)m-3', wherein A is a nucleic acid sequence that is not degraded by Cas12a / crRNA, B represents a DNA sequence that can be degraded by Cas12a / crRNA, n represents the number of bases in the A sequence, and m represents the number of bases in the B sequence; n is an integer greater than or equal to 16, and m is an integer greater than or equal to 2; The CRISPR / Cas13a enzyme cleavage substrate probe includes a first sequence that cannot be cut by the activated Cas13a protein and a second sequence that can be cut by the activated Cas13a protein. The sequence of the CRISPR / Cas13a enzyme cleavage substrate probe is expressed as: 5'-(C)p-(D)q-3', wherein C is a nucleic acid sequence that is not degraded by Cas13a / crRNA, D represents an RNA sequence that can be degraded by Cas12a / crRNA, p represents the number of bases in the C sequence, and q represents the number of bases in the D sequence; p is an integer greater than or equal to 16, and q is an integer greater than or equal to 2.
3. The test strip according to claim 2, wherein The nucleic acid sequence that is not degraded by Cas12a / crRNA is an RNA sequence or a chemically modified DNA or RNA sequence, and the chemical modification includes phosphorothioation, peptide nucleic acid or methoxy modification; The nucleic acid sequence that is not degraded by Cas13a / crRNA is a DNA sequence or a chemically modified DNA or RNA sequence, and the chemical modification includes phosphorothioate modification, peptide nucleic acid or methoxy modification.
4. The test strip according to any one of claims 1 to 3, characterized in that The enzyme cleavage substrate probe is fixed on a solid phase microsphere carrier, and the solid phase microsphere carrier includes Fe3O4 microspheres or polystyrene microspheres.
5. The test strip according to claim 4, wherein The connection mode of the enzyme-cleaved substrate probe and the solid phase microsphere carrier includes biotin-avidin interaction and carboxyl-amino compound reaction.
6. The test strip according to claim 1, wherein The test strip includes a nanogold labeled probe, which is prepared by labeling a labeled probe on colloidal gold. The labeled probe includes a third sequence, and the third sequence is complementary to a part of the bases of the first sequence in the enzyme-cleaved substrate probe.
7. The test strip according to any one of claims 1 to 6, characterized in that The lateral flow chromatography test paper includes a reaction pad, a gold label pad, a nitrocellulose membrane and a water absorbent pad; the gold label pad, the nitrocellulose membrane and the water absorbent pad are arranged in sequence, and adjacent parts thereof overlap; the enzyme cleavage substrate probe is fixed on a solid phase microsphere carrier and embedded in the reaction pad, and the nanogold labeling probe is embedded in the gold label pad.
8. The test strip according to claim 7, wherein The particle size of the solid phase microsphere carrier for fixing the enzyme-cleaved substrate probe is larger than the pore size of the nitrocellulose membrane.
9. The test strip according to claim 7, wherein A detection line and a quality control line are sequentially arranged on the nitrocellulose membrane. The detection line is connected to a detection line capture probe, and the quality control line is connected to a quality control line capture probe.
10. The test strip according to claim 9, characterized in that The detection line capture probe is connected to the detection line through the biotin-avidin effect; the quality control line capture probe is connected to the quality control line through the biotin-avidin effect.
11. The test strip according to claim 10, characterized in that The detection line capture probe includes a sixth sequence that is complementary and paired with part of the bases of the first sequence of the enzyme cleavage substrate probe; part of the bases of the first sequence of the enzyme cleavage substrate probe are complementary and paired with the third sequence of the label probe, and the remaining part of the bases are complementary and paired with the sixth sequence of the detection line capture probe.
12. The test strip according to claim 10, characterized in that The quality control line capture probe includes a seventh sequence that is complementary to the third sequence base pairing of the label probe.
13. A method for detecting pathogen nucleic acid using the CRISPR solid phase shearing and entrapment nucleic acid rapid detection test strip according to any one of claims 8 to 12, wherein the pathogen comprises one or more of bacteria, viruses, mycoplasmas, fungi, and parasites, characterized in that The method comprises the following steps: (1) Extracting nucleic acid from the sample to be tested and amplifying it to obtain the nucleic acid sample to be tested; (2) Cas12a or Cas13a protein and crRNA, or Cas12a / crRNA or Cas13a / crRNA complex, are added to the nucleic acid sample to be tested. The resulting reaction solution is added dropwise to the reaction pad. After incubation at 37°C for 10 to 60 minutes, the reaction pad is partially overlapped with the end of the gold label pad away from the detection line. Flow buffer is added dropwise to the reaction pad. The test strip is left to stand and the test line and quality control line on the test strip are observed: a red stripe appears on the test line, indicating a positive result and the presence of the target; no red stripe on the test line indicates a negative result and the absence of the target; a red stripe on the quality control line indicates that the test is valid, and no red stripe on the quality control line indicates that the test is invalid.
14. The method according to claim 13, wherein In the step (2), if the nucleic acid sample to be tested is DNA, Cas12a and crRNA are added, or a Cas12a / crRNA complex is added; if the sample to be tested is RNA, Cas13a and crRNA are added, or a Cas13a / crRNA complex is added.
15. A CRISPR solid-phase shearing and trapped nucleic acid rapid detection kit, comprising the CRISPR solid-phase shearing and trapped nucleic acid rapid detection test strip according to any one of claims 8 to 12.