LAMP (loop-mediated isothermal amplification) detection primer and probe combination, lyophilizable reagent thereof, lyophilized reagent and application of lyophilized reagent and lyophilized reagent

Abstract

The invention relates to an LAMP (loop-mediated isothermal amplification) detection primer and probe combination for detecting ureaplasma urealyticum, a pre-freeze-drying detection reagent containing the primer and probe combination and a freeze-drying preparation of the pre-freeze-drying detection reagent, the freeze-drying preparation is high in sensitivity, good in stability, convenient to store, good in resolubility and high in redissolving speed, and during redissolving, DEPC (diethylpyrocarbonate) water or a to-be-detected sample can be directly added for on-machine detection; the operation is quick, simple and convenient.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of molecular biology, and particularly relates to detection of Ureaplasma urealyticum by using loop-mediated isothermal amplification technology. BACKGROUND

[0002] Loop-mediated isothermal amplification (LAMP) is a kind of isothermal nucleic acid amplification method developed by Notomi in 2000, which is characterized by designing 4-6 specific primers for 6 regions of the target gene, and using a strand displacement DNA polymerase (Bst DNA polymerase) to achieve 10 9 ~ 10 10 times of nucleic acid amplification at 60-65℃ for 15-60 minutes, which has the characteristics of rapidity, simplicity, high sensitivity, strong specificity, easy detection of products, and has been widely used in food safety, microbial testing, clinical diagnosis and other aspects.

[0003] Ureaplasma urealyticum (UU) is a kind of smallest prokaryotic cell type microorganism without cell wall, high polymorphism, capable of passing through a bacterial filter and capable of being cultured and proliferated by artificial medium. According to the difference of outer membrane protein antigen epitopes, various Ureaplasma urealyticum causing human diseases have been found, including serotypes UU2, UU4, UU5, UU7, UU8, UU9, UU10, UU11, UU12, UU13 and UP1, UP3, UP6, UP14. Ureaplasma urealyticum is one of the common parasitic bacteria in human urogenital tract, and after urethral infection, patients can have urethritis symptoms, and can also cause chronic prostatitis, and continue to infect the sperm duct, seminal vesicle and testis, affect the quality of sperm and semen, cause infertility, Ureaplasma urealyticum is closely related to infertility, spontaneous abortion, stillbirth, female genital tract inflammation, etc., and Ureaplasma urealyticum can also be transmitted from mother to infant during vaginal delivery. Laboratory diagnosis methods of Ureaplasma urealyticum include ① culture method: Ureaplasma urealyticum cell culture positive; ② antigen detection: enzyme-linked immunosorbent assay, direct immunofluorescence method or immunochromatography test for detecting Ureaplasma urealyticum antigen positive; ③ nucleic acid detection: Ureaplasma urealyticum nucleic acid detection positive.

[0004] In recent years, freeze-drying has been widely used in conventional PCR systems, and the effect is relatively obvious. However, due to the difference of raw materials, the freeze-drying protective agent used in the PCR system is not good for the LAMP system, mainly because of poor stability.

[0005] At present, the LAMP detection reagent is mostly in liquid form, and the reagent needs to be stored at-20 DEG C, and the environmental temperature has a higher requirement during transportation. The freeze-dried LAMP detection reagent can be stored at room temperature, but the detection performance will be reduced with the prolongation of storage time during storage, and the stability of the detection reagent cannot be guaranteed when transported under the condition of high environmental temperature.

[0006] Therefore, it is necessary to provide a LAMP freeze-dried detection system which is simple and convenient to operate, stable in structure, not easy to shrink, collapse and absorb moisture, convenient to store, good in reconstitution, and has stable and good detection performance. SUMMARY

[0007] In order to solve the problems in the prior art, the purpose of the present application is to provide a LAMP detection primer and probe combination for detecting Ureaplasma urealyticum, a freeze-dried pre-detection reagent containing the primer and probe combination and a freeze-dried preparation thereof, the freeze-dried preparation has high sensitivity, good stability, is convenient to store, has good reconstitution, and can be directly detected by adding DEPC water or a sample to be detected, and is fast, simple and convenient to operate.

[0008] In order to achieve the above-mentioned purpose, the present application adopts the following technical solutions:

[0009] According to one aspect of the present application, the present application provides a LAMP detection primer and probe combination for detecting Ureaplasma urealyticum, which is composed of a target gene primer and probe group and an internal reference gene primer and probe group, wherein,

[0010] The target gene primer and probe group is composed of:

[0011] UUureB3-F3: CATTAAAAATACTGGTGACCGT

[0012] UUureB3-B3: AAACTTCACGTGTTCCGA

[0013] UUureB3-FIP: CGTTCTTTGTCTTCGTTTCCTTTTCCAAGTTGGATCACATTTCC

[0014] UUureB3-BIP: TAAAGTTGCTTATGGACGTCGTTttCTGAAACTTCTTTTTTGTCTCCT

[0015] UUureB3-LF: TCCTTTTTCATCAAAGAATACTAATGCACT

[0016] UUureB3-LB: TCGATATTCCATCAGGTACTGCT

[0017] UUureB3-probe: 5'-BHQ1-CATCAGGTACTGCTATTCGTT / i6FAMdT / TGA-3'

[0018] The internal reference gene primer and probe set consists of the following:

[0019] ACTBexo4-81-F3:CCATCTACGAGGGGTATGCC

[0020] ACTBexo4-81-B3:AGGGAGGAGCTGGAAGC

[0021] ACTBexo4-81-FIP:GCGCTCGGTGAGGATCTTCATGttttCCCATGCCATCCTGCG

[0022] ACTBexo4-81-BIP:GGCCGAGCGGGAAATCGTttttCCATCTCTTGCTCGAAGTCC

[0023] ACTBexo4-81-LF: GGTAGTCAGTCAGGTCCCGG

[0024] ACTBexo4-81-LB:GTGACATTAAGGAGAAGCTGTGC

[0025] ACTBexo4-81-probe: 5'-BHQ2-TGGTAGTCAGTCAGG / Int-Cy5-dT / CCCGG-3'

[0026] In the UUureB3-probe, BHQ1 is a quencher group, labeled on the C base at the 5' end, and 6FAM is a fluorescent group, labeled on the T base at the 3' end. The specific structure is:

[0027]

[0028] In the ACTBexo4-81 probe, BHQ2 is a quencher group, labeled on the T base at the 5' end, and Cy5 is a fluorescent group, labeled on the T base at the 3' end. The specific structure is as follows:

[0029]

[0030] According to another aspect of the present invention, the present invention provides use of the above primer and probe combination in preparing a reagent, a lyophilized reagent or a kit for detecting Ureaplasma urealyticum.

[0031] According to another aspect of the present application, the present application provides a reagent containing the LAMP detection primer and probe combination for detecting Ureaplasma urealyticum according to the present application.

[0032] According to another aspect of the present application, the present application provides a lyophilizable reagent containing the LAMP detection primer and probe combination for detecting Ureaplasma urealyticum according to the present application.

[0033] Preferably, the lyophilizable reagent according to the present application further contains dNTP, DNA polymerase.

[0034] More preferably, the DNA polymerase is Bst DNA polymerase, and more preferably, the Bst DNA polymerase is selected from the group consisting of Bst DNA polymerase (large fragment), Bst DNA polymerase 2.0, Bst DNA polymerase 3.0, Bst DNA polymerase 4.0, and the like.

[0035] Preferably, the lyophilizable reagent according to the present application further contains a buffer, KCl, MgSO4, Tween 20, and water. The water is preferably DEPC-treated water.

[0036] As understood by those skilled in the art, various buffers in the art can be used in the present application. Preferably, the buffer is selected from the group consisting of Tris-HCl buffer, Tris-boric acid buffer, boric acid-borax buffer, borax-hydrochloric acid buffer, glycine-sodium hydroxide buffer, and the like.

[0037] Preferably, the lyophilizable reagent according to the present application further contains a lyoprotectant.

[0038] More preferably, the lyoprotectant consists of trehalose, dextran, glycine, and polyethylene glycol. The polyethylene glycol is preferably polyethylene glycol 6000.

[0039] More preferably, the weight ratio of trehalose, dextran, glycine, and polyethylene glycol in the lyoprotectant is (3-5):(3-5):(0.5-1):(0.5-1).

[0040] In a preferred embodiment, the lyophilizable reagent of the present application contains, per test, 10-40 mM Tris-HCl pH 8.8, 26-52 mM potassium chloride, 7-9 mM magnesium sulfate, 0.05-0.5% Tween 20, 1.2-2.0 mM dNTPs, 0.1-0.4 mM UUureB3-F3, 0.1-0.4 mM UUureB3-B3, 1.2-2.0 mM UUureB3-FIP, 1.2-2.0 mM UUureB3-BIP, 0.4-1.6 mM UUureB3-LF, 0.4-1.6 mM UUureB3-LB, 0.005-0.02 mM UUureB3-probe, 0.1-0.4 mM ACTBexo4-81-F3, 0.1-0.4 mM ACTBexo4-81-B3, 1.2-2.0 mM ACTBexo4-81-FIP, 1.2-2.0 mM ACTBexo4-81-BIP, 0.4-1.6 mM ACTBexo4-81-LF, 0.4-1.6 mM ACTBexo4-81-LB, 0.005-0.02 mM ACTBexo4-81-probe, 5-10 U Bst DNA polymerase, 3-5% trehalose, 3-5% dextran, 0.5-1% glycine, 0.5-1% polyethylene glycol 6000, DEPC-treated water (“%” means g / 100 mL). Preferably, the lyophilizable reagent of the present application consists of the above components, per test. Preferably, the volume of the lyophilizable reagent per test is 10-20 pL.

[0041] In one preferred embodiment, the lyophilizable reagent of the present application contains, per test, 20 mM Tris-HCl pH 8.8, 26 mM potassium chloride, 7 mM magnesium sulfate, 0.1% Tween 20, 1.6 mM dNTP, 0.2 μΜ UUureB3-F3, 0.2 μΜ UUureB3-B3, 1.6 μΜ UUureB3-FIP, 1.6 μΜ UUureB3-BIP, 0.8 μΜ UUureB3-LF, 0.8 μΜ UUureB3-LB, 0.01 μΜ UUureB3-probe, 0.2 μΜ ACTBexo4-81-F3, 0.2 μΜ ACTBexo4-81-B3, 1.6 μΜ ACTBexo4-81-FIP, 1.6 μΜ ACTBexo4-81-BIP, 0.8 μΜ ACTBexo4-81-LF, 0.8 μΜ ACTBexo4-81-LB, 0.01 μΜ ACTBexo4-81-probe, 8 U of Bst DNA polymerase (Large Fragment) without glycerol, 3% trehalose, 3% dextran, 1% glycine, 1% polyethylene glycol 6000, DEPC-treated water. Preferably, the lyophilizable reagent of the present application consists of the above components per test. Preferably, the volume of the lyophilizable reagent per test is 15 μΐ.

[0042] According to another aspect of the present application, the present application provides a lyophilized reagent containing the LAMP detection primer and probe combination for detecting Ureaplasma urealyticum of the present application.

[0043] According to another aspect of the present application, the present application provides a lyophilized reagent prepared by lyophilizing the lyophilizable reagent of the present application.

[0044] Those skilled in the art can understand that lyophilization can be performed using a common lyophilization process.

[0045] According to another aspect of the present application, the present application provides a kit containing the LAMP detection primer and probe combination for detecting Ureaplasma urealyticum of the present application.

[0046] According to another aspect of the present application, the present application provides a kit containing the lyophilized reagent of the present application.

[0047] Preferably, the kit further contains a positive control which is a plasmid containing a Ureaplasma urealyticum conserved gene ureB and an internal control which is a plasmid containing a human β-actin gene.

[0048] Those skilled in the art can understand that the positive control can be in the form of a liquid preparation, and the concentration thereof is, for example, 1 x 10 4copies / μL. One skilled in the art can prepare the positive control in liquid formulation form using conventional processes.

[0049] One skilled in the art can understand that the internal control can be in liquid formulation form, for example, 1 x 10 4 copies / μL. One skilled in the art can prepare the internal control in liquid formulation form using conventional processes.

[0050] One skilled in the art can understand that the positive control and the internal control can be in separate lyophilized formulation forms, or in a mixed lyophilized formulation form, which can be mixed before lyophilization or mixed after lyophilization. One skilled in the art can prepare the positive control and the internal control in lyophilized formulation form using conventional processes.

[0051] Preferably, the kit further contains a negative control, which is DEPC-treated water. One skilled in the art can understand that the negative control can be directly used to reconstitute the lyophilized reagent and / or the positive control and the internal control in lyophilized formulation form.

[0052] The lyophilized reagent of the present application does not contain ammonium sulfate (which is generally considered to eliminate non-specific amplification in the system). The lyophilized reagent of the present application has high sensitivity, good stability, easy storage, good reconstitution, fast reconstitution speed, and can be directly added to DEPC water or the sample to be tested for machine detection, which is fast, simple and convenient to operate, greatly reducing the transportation and storage costs of the reagent. BRIEF DESCRIPTION OF DRAWINGS

[0053] Figure 1 Results of the combination of primers and probes in detecting the positive control and the internal control

[0054] Figure 2 Freeze-drying appearance under different freeze-drying protectant schemes

[0055] Figure 3 Effect of different concentrations of MgSO4 on the detection time of the positive control

[0056] Figure 4 Effect of different concentrations of KCl on the detection time of the positive control

[0057] Figure 5 Sensitivity amplification curve DETAILED DESCRIPTION

[0058] The application will be further described in connection with specific examples. It should be understood that these examples are only used to illustrate the application and not used to limit the scope of the application. In addition, it should be understood that after reading the content described in the application, those skilled in the art can make various modifications or changes to the application, and these equivalent forms also fall within the scope of the application.

[0059] Example 1. LAMP detection primer and probe combination for detecting Ureaplasma urealyticum

[0060] The LAMP detection primer and probe combination for detecting Ureaplasma urealyticum of the application comprises a target gene primer and probe set, and an internal reference gene primer and probe set.

[0061] 1. Primer and probe combination design

[0062] The target gene primer is designed using the nucleic acid sequence of the Ureaplasma urealyticum conserved gene ureB gene, including a pair of outer primers F3 and B3, a pair of inner primers FIP and BIP, and a pair of loop primers LF and LB; the probe is designed according to the loop primer sequence, and a quenching group is labeled on the C base at the 5' end, and a fluorescent group is labeled on the T base at the 3' end.

[0063] The internal reference gene primer is designed using the nucleic acid sequence of the human β-Actin gene, including a pair of outer primers F3 and B3, a pair of inner primers FIP and BIP, and a pair of loop primers LF and LB; the probe is designed according to the loop primer sequence, and a quenching group is labeled on the T base at the 5' end, and a fluorescent group is labeled on the T base at the 3' end.

[0064] The sequence of the primer and probe combination is shown in Table 1.

[0065] Table 1 Sequence of primer and probe combination

[0066]

[0067] In UUureB3-probe, BHQ1 is a quenching group, labeled on the C base at the 5' end, and 6-FAM is a fluorescent group, labeled on the T base at the 3' end, and the specific structure is:

[0068]

[0069] In ACTBexo4-81 probe, BHQ2 is a quenching group, labeled on the T base at the 5' end, and Cy5 is a fluorescent group, labeled on the T base at the 3' end, and the specific structure is:

[0070]

[0071] 2. Preparation of plasmid template

[0072] The recombinant plasmid containing the human β-actin gene and the conserved gene ureB of Ureaplasma urealyticum was extracted from Escherichia coli using a Sangon Plasmid Mini Kit. The recombinant plasmid was synthesized by Sangon Biotechnology (Shanghai) Co., Ltd. The extracted plasmid was subjected to digital PCR determination by Beijing Xinyi Biotechnology Co., Ltd. The plasmid containing the human β-actin gene was used as the internal control plasmid and diluted to 2×10 4 copies / mL, used as the internal control of the kit; the plasmid containing the conserved gene ureB of Ureaplasma urealyticum was used as the positive control plasmid, which was diluted with DEPC water to 1×10 4 copies / μL, used as the positive control of the kit.

[0073] 3. Prepare the reaction solution

[0074] Prepare LAMP reaction solution with a volume of 25 μL, including reaction reagents, primer and probe combination, glycerol-free Bst DNA polymerase (large fragment), positive control, internal control, DPEC-treated water, reaction reagents including Tris-HCl (pH 8.8), KCl, Tween20, MgSO 4 The composition and final concentrations of 7H2O, dNTP, and LAMP reaction solution are shown in Table 2.

[0075] Table 2 Composition and concentration of LAMP reaction solution

[0076] Reagent name Final concentration Tris-HCl (pH 8.8) 20 mM KCl 26 mM Tween 20 0.10％ MgSO4.7H2O 7 mM dNTP 1.6 mM UUureB3-F3 0.2 μΜ UUureB3-B3 0.2 μΜ UUureB3-FIP 1.6 μΜ UUureB3-BIP 1.6 μΜ UUureB3-LF 0.8 μΜ UUureB3-LB 0.8 μΜ UUureB3-probe 0.01 μΜ ACTBexo4-81-F3 0.2 μΜ ACTBexo4-81-B3 0.2 μΜ ACTBexo4-81-FIP 1.6 μΜ ACTBexo4-81-BIP 1.6 μΜ ACTBexo4-81-LF 0.8 μΜ ACTBexo4-81-LB 0.8 μΜ ACTBexo4-81-probe 0.01 μΜ Glycerol-free Bst DNA polymerase (Large Fragment) 8 U / reaction Positive control 2 μL / reaction Internal control 2 μL / reaction DEPC-treated water Make up to 25 μL / reaction

[0077] 4. LAMP amplification reaction

[0078] Aliquot the LAMP reaction solution into a PCR reaction tube and start the LAMP reaction according to the reaction procedure in Table 3.

[0079] Table 3 Isothermal reaction program

[0080] Temperature Time Cycle number Collect fluorescence 63℃ 30s 60 FAM channel and CY5 channel 85℃ 5 min 1 /

[0081] 5. Results Analysis

[0082] like Figure 1 As shown, the primer and probe combination designed based on this embodiment can detect the target nucleic acid sequence and the internal reference nucleic acid sequence in the LAMP reaction solution of this embodiment. It shows that the above primer and probe combination prepared using methods known in the art can be used to detect Ureaplasma urealyticum. At the same time, the designed internal reference detection channel can well detect the internal reference human β-actin gene.

[0083] Example 2. Screening of lyophilization protectants

[0084] 1. Primer and probe combination

[0085] The primer and probe combination of the present embodiment is the same as that of Example 1, including the primer and probe set for the target gene and the primer and probe set for the internal reference gene, as shown in Table 1.

[0086] 2. Preparation of lyoprotectant

[0087] The lyoprotectant is a mixture of different components as shown in Table 4. In the present embodiment, combinations of different components at different concentrations in the pre-lyophilization reagent (i.e., the freeze-dryable reagent, the pre-lyophilization solution) are compared to screen a lyoprotectant suitable for the detection system of the present application. The concentrations of the components of the lyoprotectant in the pre-lyophilization reagent are shown in Table 4. The lyoprotectant mixture can be prepared in advance at a concentration of 3 times the concentrations shown in Table 4, and the amount of the lyoprotectant mixture added to the pre-lyophilization reagent is 5 μL per reaction.

[0088] Table 4. Concentrations of components of lyoprotectant in pre-lyophilization reagent

[0089] Protocol number Trehalose (w / v) Dextran (w / v) Glycine (w / v) PEG6000 (w / v) Protocol one 2％ 2％ 0.1％ 0.1％ Protocol two 3％ 3％ 0.5％ 0.5％ Protocol three 3％ 3％ 1％ 1％ Protocol four 5％ 5％ 1％ 1％ Protocol five 6％ 6％ 2％ 2％ Protocol six 5％ / 1％ 1％

[0090] Note: "%" represents g / 100 mL.

[0091] 3. Preparation of pre-lyophilization reagent

[0092] The pre-lyophilization reagent includes reaction reagents, primer and probe combination, glycerol-free Bst DNA polymerase (large fragment), lyoprotectant, and DEPC-treated water, with a volume of 15 μL per reaction. The specific composition and final concentration are shown in Table 5.

[0093] Table 5. Composition of pre-lyophilization reagent

[0094]

[0095]

[0096] Note: "%" represents g / 100 mL.

[0097] 4. Preparation of lyophilized reagent

[0098] After the pre-lyophilization reagent is prepared according to Table 5, the pre-lyophilization reagent is aliquoted into PCR reaction tubes at 15 μL per reaction, placed on a 96-well plate holder, and put into a freeze dryer for lyophilization. The lyophilization process is shown in Table 6. After the lyophilization process is completed, the PCR reaction tubes are sealed in aluminum foil bags for storage.

[0099] Table 6. Lyophilization process

[0100] Step Time Temperature Vacuum degree Pre-freezing 2h -55℃ - Primary drying 10h -40℃ 100 μbar Secondary drying 4h 30℃ 10 μbar

[0101] 5. Detection and result analysis

[0102] The lyophilized reagent was dissolved in 20 μL DEPC-treated water, mixed, and 5 μL of the positive control (see Example 1) was added. The sample was detected, the reaction was started, and the reaction program was as shown in Table 3 of Example 1.

[0103] The data were analyzed and compared with the detection time of the positive control. If the detection time of the positive control was increased by more than 2 min compared with the control group (without the addition of lyophilization protective agents), it was considered that the lyophilization protective agents had a significant effect on the detection performance of the lyophilized reagent.

[0104] The appearance of the lyophilized reagent was as shown in Table 7. Figure 2 The detection time of the positive control was as shown in Table 8. The appearance of the reagent of Scheme 1 was not good, and the detection time of the positive control was prolonged. The appearance of the reagent of Scheme 5 was good, but the detection time of the positive control was prolonged. The appearance of the reagent of Scheme 6 was not uniform, and the detection time of the positive control was also significantly prolonged. In summary, the preferred range of the lyophilization protective agent formulation was 3-5% trehalose, 3-5% dextran, 0.5-1% glycine, and 0.5-1% PEG6000.

[0105] Table 7: Appearance of the lyophilized reagent with different lyophilization protective agent formulations

[0106] Protocol number Freeze-dried appearance Protocol one The surface of finished product has different degrees of shrinkage Protocol two The surface of finished product is smooth, without shrinkage and collapse, and the reconstitution time is short Protocol three The surface of finished product is smooth, without shrinkage and collapse, and the reconstitution time is short Protocol four The surface of finished product is smooth, without shrinkage and collapse, and the reconstitution time is short Protocol five The surface of finished product is smooth, without shrinkage and collapse, and the reconstitution time is short Protocol six The appearance of finished product is not uniform, with slight shrinkage and collapse

[0107] Table 8: Detection time of the positive control with different lyophilization protective agent formulations

[0108]

[0109] Example 3: Effect of different concentrations of MgSO4 on the detection time of the positive control

[0110] The lyophilization protective agent was selected as 3% trehalose, 3% dextran, 1% glycine, and 1% PEG6000. The reagent before lyophilization was prepared according to Table 5 of Example 2, and the lyophilization was performed according to the process of Table 6. The difference was that the final concentration of MgSO4 in the reagent was set to 3, 5, 7, 9, and 11 mM.

[0111] The lyophilized reagent was dissolved in 20 μL DEPC-treated water, mixed, and 5 μL of the positive control (see Example 1) was added. The sample was detected, the reaction was started, and the reaction program was as shown in Table 3 of Example 1. The preferred concentration range was screened by the different detection times of the positive control.

[0112] The experimental results are shown in Table 8. Figure 3 As shown in Table 8, the reagent before lyophilization with each concentration of MgSO4 could detect the conserved gene ureB of Ureaplasma urealyticum. The most suitable concentration range of MgSO4 was 7-9 mM, and the detection time of the positive control was shorter in this range.

[0113] Example 4. Effect of different concentrations of KCl on detection time

[0114] The reagents before lyophilization were prepared according to Table 5 of Example 2, and lyophilization was performed according to the process of Table 6. The difference is that the final concentration of KCl in the reagent is set to 0, 13, 26, 39, 52, 104 mM for six concentrations; the lyoprotectant is selected to be 3% trehalose, 3% dextran, 1% glycine, and 1% polyethylene glycol 6000.

[0115] For detection, 20 μL of DEPC-treated water was used to reconstitute the lyophilized reagent, mixed well, and then 5 μL of positive control (see Example 1) was added, and the machine was detected. The reaction program is shown in Table 3 of Example 1. The preferred concentration range was screened by the different detection times of the positive control.

[0116] The experimental results are shown in Table 7. Figure 4 As shown in Table 7, the reagent before lyophilization of each concentration of KCl can detect the conserved gene ureB of Ureaplasma urealyticum. Among them, the optimal KCl concentration range is 26-52 mM, and the detection time of the positive control is shorter in this range.

[0117] Example 5. Sensitivity of detection reagent

[0118] 1. Primer and probe combination

[0119] The primer and probe combination of this example is the same as that of Example 1, including the primer and probe set of the target gene and the primer and probe set of the internal reference gene, which are shown in Table 1.

[0120] 2. Preparation of lyophilized reagent

[0121] The reagent before lyophilization includes reaction reagent, primer and probe combination, glycerol-free Bst DNA polymerase (large fragment), lyoprotectant, and DEPC-treated water, with a volume of 15 μL / reaction. The specific composition and final concentration are shown in Table 9.

[0122] Table 9 Composition of reagent before lyophilization

[0123]

[0124]

[0125] The reagent before lyophilization was prepared according to Table 9, and the reagent before lyophilization was divided into 15 μL / reaction into 8-tube tubes, placed on a 96-well plate rack, and placed into a lyophilizer for lyophilization. The lyophilization process is shown in Table 6 of Example 2. After the lyophilization process is completed, the 8-tube tubes are sealed in aluminum foil bags for storage.

[0126] 3. Detection

[0127] The positive control was diluted to 100, 10, 1 copies / μL with DEPC water to three different concentrations.

[0128] The lyophilized reagent was reconstituted with 20 μL of DEPC-treated water, mixed, and 5 μL of the positive control at different concentrations was added. The sample at 500, 50, 5 copies / reaction was detected, and the reaction program is shown in Table 3 of Example 1.

[0129] 4. Result analysis

[0130] The amplification results show that the kit can stably amplify the positive control at three concentrations, and the detection sensitivity of the kit is 5 copies / reaction. The specific amplification curve is shown in Figure 5 .

[0131] Example 6. Stability of lyophilized reagent

[0132] The lyophilized reagent was prepared according to Example 5, and after lyophilization, the lyophilized reagent was sealed in an aluminum foil bag with a drying agent and stored at 37°C for accelerated stability evaluation for 90 days. A normal temperature 22°C storage group was also set up, and the reagent performance was detected at the 14th day, 28th day, 60th day, and 90th day. The control group was the liquid reagent before lyophilization prepared on the same day (i.e., the lyophilizable reagent, the solution before lyophilization, and the composition is shown in Table 9).

[0133] During detection, the lyophilized reagent was reconstituted with 20 μL of DEPC-treated water, mixed, and 5 μL of the positive control (see Example 1) was added. The machine was started for reaction, and the reaction program is shown in Table 3 of Example 1. The detection time of the positive control was compared to judge the change of the detection reagent performance.

[0134] The results show that the detection time of the positive control is not significantly prolonged, and the lyophilized reagent can be stored at room temperature. Even if it encounters high temperature of 37°C during transportation, it will not affect the detection performance of the reagent. The specific data is shown in Table 10.

[0135] Table 10 Stability of lyophilized reagent

[0136]

[0137] The above describes the embodiments of the present application. However, the present application is not limited to the above embodiments. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. A LAMP detection primer and probe combination for detecting Ureaplasma urealyticum, consisting of a target gene primer and probe set, and an internal reference gene primer and probe set, wherein: The target gene primer and probe set consists of the following: UUureB3-F3:CATTAAAAATACTGGTGACCGT UUureB3-B3:AAACTTCACGTTGTTCCGA UUureB3-FIP:CGTTCTTTGTCTTCGTTTCCTTTTCCAAGTTGGATCACATTTCC UUureB3-BIP: TAAAGTTGCTTATGGACGTCGTTttCTGAAACTTCTTTTTTGTCTCCT UUureB3-LF:TCCTTTTTCATCAAAGAATACTAATGCACT UUureB3-LB:TCGATATTCCATCAGGTACTGCT UUureB3-probe: 5'-BHQ1-CATCAGGTACTGCTATTCGTT / i6FAMdT / TGA-3' The internal reference gene primer and probe set consists of the following: ACTBexo4-81-F3:CCATCTACGAGGGGTATGCC ACTBexo4-81-B3:AGGGAGGAGCTGGAAGC ACTBexo4-81-FIP:GCGCTCGGTGAGGATCTTCATGttttCCCATGCCATCCTGCG ACTBexo4-81-BIP:GGCCGAGCGGGAAATCGTttttCCATCTCTTGCTCGAAGTCC ACTBexo4-81-LF:GGTAGTCAGTCAGGTCCCGG ACTBexo4-81-LB:GTGACATTAAGGAGAAGCTGTGC ACTBexo4-81-probe: 5'-BHQ2-TGGTAGTCAGTCAGG / Int-Cy5-dT / CCCGG-3' In the UUureB3-probe, BHQ1 is a quencher group, labeled on the C base at the 5' end, and 6FAM is a fluorescent group, labeled on the T base at the 3' end. The specific structure is: In the ACTBexo4-81 probe, BHQ2 is a quencher group, labeled on the T base at the 5' end, and Cy5 is a fluorescent group, labeled on the T base at the 3' end. The specific structure is as follows:

2. Use of the LAMP detection primer and probe combination for detecting Ureaplasma urealyticum according to claim 1 in the preparation of a reagent, a lyophilized reagent or a kit for detecting Ureaplasma urealyticum.

3. A reagent comprising the LAMP detection primer and probe combination for detecting Ureaplasma urealyticum according to claim 1.

4. A lyophilizable reagent comprising the LAMP detection primer and probe combination for detecting Ureaplasma urealyticum according to claim 1. Preferably, it also contains dNTP and DNA polymerase. More preferably, the DNA polymerase is Bst DNA polymerase, and more preferably, the Bst DNA polymerase is selected from Bst DNA polymerase (large fragment), Bst DNA polymerase 2.0, Bst DNA polymerase 3.0, Bst DNA polymerase 4.0, etc. Preferably, the mixture further contains a buffer, KCl, MgSO4, Tween 20, and water, preferably DEPC-treated water. Preferably, it also contains a lyoprotectant. More preferably, the lyoprotectant is composed of trehalose, dextran, glycine, and polyethylene glycol, preferably polyethylene glycol 6000. More preferably, the weight ratio of trehalose, dextran, glycine and polyethylene glycol in the lyoprotectant is (3-5):(3-5):(0.5-1):(0.5-1).

5. The lyophilizable reagent according to claim 4, which contains, based on the detection per person, 10-40 mM Tris-HCl (pH 8.8), 26-52 mM potassium chloride, 7-9 mM magnesium sulfate, 0.05-0.5% Tween 20, 1.2-2.0 mM dNTP, 0.1-0.4 μM UUureB3-F3, 0.1-0.4 μM UUureB3-B3, 1.2-2.0 μM UUureB3-FIP, 1.2-2.0 μM UUureB3-BIP, 0.4-1.6 μM UUureB3-LF, 0.4-1.6 μM UUureB3-LB, 0.005-0. 0.2 μM UUureB3-probe, 0.1-0.4 μM ACTBexo4-81-F3, 0.1-0.4 μM ACTBexo4-81-B3, 1.2-2.0 μM ACTBexo4-81-FIP, 1.2-2.0 μM ACTBexo4-81-BIP, 0.4-1.6 μM ACTBexo4-81-LF, 0.4-1.6 μM ACTBexo4-81-LB, 0.005-0.02 μM ACTBexo4-81-probe, 5-10 U of Bst DNA polymerase, 3-5% trehalose, 3-5% dextran, 0.5-1% glycine, 0.5-1% polyethylene glycol 6000, DEPC-treated water ("%" represents g / 100 mL). Preferably, the volume of the lyophilizable reagent for testing one person is 10-20 μL.

6. The lyophilizable reagent according to claim 4, which contains 20 mM Tris-HCl (pH 8.8), 26 mM potassium chloride, 7 mM magnesium sulfate, 0.1% Tween 20, 1.6 mM dNTP, 0.2 μM UUureB3-F3, 0.2 μM UUureB3-B3, 1.6 μM UUureB3-FIP, 1.6 μM UUureB3-BIP, 0.8 μM UUureB3-LF, 0.8 μM UUureB3-LB, 0.01 μM UUureB3 ureB3-probe, 0.2 μM ACTBexo4-81-F3, 0.2 μM ACTBexo4-81-B3, 1.6 μM ACTBexo4-81-FIP, 1.6 μM ACTBexo4-81-BIP, 0.8 μM ACTBexo4-81-LF, 0.8 μM ACTBexo4-81-LB, 0.01 μM ACTBexo4-81-probe, 8 U of glycerol-free Bst DNA polymerase (large fragment), 3% trehalose, 3% dextran, 1% glycine, 1% polyethylene glycol 6000, DEPC-treated water. Preferably, the volume of the lyophilizable reagent for testing one person is 15 μL.

7. A lyophilized reagent comprising the LAMP detection primer and probe combination for detecting Ureaplasma urealyticum according to claim 1.

8. A lyophilized reagent prepared by lyophilizing the lyophilizable reagent according to any one of claims 3 to 6.

9. A kit comprising the LAMP detection primer and probe combination for detecting Ureaplasma urealyticum according to claim 1.

10. A kit comprising the lyophilized reagent according to claim 8. Preferably, the kit further contains a positive control and an internal reference control, the positive control being a plasmid containing the conserved gene ureB of Ureaplasma urealyticum, and the internal reference control being a plasmid containing the human β-actin gene. Preferably, the kit further contains a negative control, the negative control being DEPC-treated water.

Images