A material, device and use thereof for the separation of rare earth elements

Abstract

The application provides a material for separating rare earth, an apparatus and use thereof. The material comprises a rare earth binding protein, which comprises or consists of any one of the following: (I) a protein with an amino acid sequence as shown in SEQ ID NO. 2; (II) a protein obtained by adding a linker, a sequence for purification, a sequence for cleavage, a sequence for solubilization, or a sequence for immobilization to (I); (III) a protein with 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% or more sequence identity with (I) or (II). The rare earth binding protein contained in the material and the apparatus has significant affinity to rare earth elements (REE), and can not only separate rare earth elements from non-rare earth elements, but also separate light, medium and heavy rare earths and adjacent rare earth pairs, and has a good application prospect in fine separation of rare earth elements.

Description

Technical Field

[0001] This application belongs to the field of biotechnology, and specifically relates to a material, apparatus, and use for separating rare earth elements. Background Technology

[0002] Rare earth elements (REEs), including the lanthanides, yttrium, and scandium, are crucial for the transition from the fossil fuel era to a low-carbon era. The U.S. Department of Energy has specifically highlighted the criticality and supply shortage of five REEs (Tb, Dy, Eu, Nd, and Y) for clean energy technologies such as electric vehicles, wind turbines, and LEDs. However, current REE extraction and separation processes consume significant amounts of energy and cause severe environmental pollution, hindering the development of a diversified REE supply chain and diminishing the environmental benefits of clean energy technologies. Therefore, to meet the demand for REEs in emerging clean energy technology markets, new processing methods must be developed to extract REEs from rare earth mines in an environmentally friendly manner.

[0003] Incorporating bioligands into solid-liquid extraction processes offers potential for developing novel chemical methods and environmentally sustainable rare earth separation processes. For example, lanthanide-binding tags (LBTs), short peptides with affinity and selectivity for rare earth elements, have been exhibited on the surfaces of biomaterials (cells, coiled fibers, etc.) and used in solid-liquid extraction for the selective recovery of neutralized heavy rare earth elements from various feedstock leachates. However, LBTs exhibit limited affinity for Cu... 2+ The selectivity of rare earth elements is low, and the binding of rare earth elements is negligible when the pH value is below 5, which limits the raw material compatibility of LBT.

[0004] Current methods for fine separation of rare earth elements rely on cascade extraction technology, which involves organic solvents, phosphorus ligands, and strong acids. This process is complex and constitutes a highly polluting, energy-intensive industry. Furthermore, it suffers from low separation efficiency and limited binding sites (existing rare earth protein affinity materials can bind at most fewer than four rare earth ions, and sometimes only one). In addition, current technologies cannot directly separate adjacent rare earth elements in a single step.

[0005] Therefore, providing a method to solve the difficulty of fine separation of rare earth elements is of great practical significance. Summary of the Invention

[0006] The purpose of this application is to provide a material, apparatus and its use for separating rare earth elements.

[0007] Specifically, this application relates to the following aspects:

[0008] A material for separating rare earth elements, comprising a rare earth binding protein, wherein the rare earth binding protein comprises or is composed of any one of the following proteins:

[0009] (I) A protein with the amino acid sequence shown in SEQ ID NO.2;

[0010] (II) Proteins obtained by adding a linker, a sequence for purification, a sequence for cutting, a sequence for solubilization, or a sequence for immobilization to (I);

[0011] (III) Proteins that have 80%, 85%, 90%, 95%, 96%, 97%, 98% or more sequence identity with (I) or (II).

[0012] Optionally, the amino acid sequence of the rare earth binding protein is as shown in SEQ ID NO.2 or SEQ ID NO.4, or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more sequence identity with SEQ ID NO.2 or SEQ ID NO.4.

[0013] Optionally, the material further includes microspheres coupled to the rare earth binding protein.

[0014] Optionally, the microspheres are selected from one or more of the following: natural polysaccharide and hydrogel microspheres, organic synthetic polymer microspheres, inorganic microspheres, organic-inorganic hybrid microspheres, and magnetic microspheres.

[0015] An apparatus comprising any one of the aforementioned materials.

[0016] Optionally, the apparatus is a chromatography apparatus.

[0017] The use of any of the above materials or any of the above devices in the recovery, and / or separation, and / or purification of rare earth elements.

[0018] Optionally, the rare earth element is selected from one or more of lanthanum, cerium, praseodymium, neodymium, samarium, europium, gadolinium, terbium, dysprosium, holmium, erbium, thulium, ytterbium, lutetium, and yttrium.

[0019] Optionally, the separation refers to the separation between any two rare earth elements.

[0020] A method for recovering, and / or separating, and / or purifying rare earth elements, comprising processing rare earth elements using any of the aforementioned materials or any of the aforementioned apparatus.

[0021] Optionally, the rare earth element is selected from one or more of lanthanum, cerium, praseodymium, neodymium, samarium, europium, gadolinium, terbium, dysprosium, holmium, erbium, thulium, ytterbium, lutetium, and yttrium.

[0022] Optionally, the separation refers to the separation between any two rare earth elements.

[0023] The materials and apparatus of this application include rare earth binding proteins, which have a significant affinity for rare earth elements (REEs), and this affinity varies significantly among different rare earth elements. Therefore, the rare earth binding proteins of this application can not only separate rare earth elements from non-rare earth elements, but also separate light (lanthanum, cerium, praseodymium, neodymium), medium (samarium, europium, gadolinium, terbium, dysprosium), and heavy (holmium, erbium, thulium, ytterbium, lutetium, yttrium) rare earth elements, as well as adjacent rare earth pairs (europium, gadolinium; dysprosium, holmium; holmium, erbium; erbium, thulium; thulium, ytterbium, etc.), showing promising application prospects in the fine separation of rare earth elements. Attached Figure Description

[0024] Figure 1 The flow-through curves show the rare earth concentrations corresponding to the flow-through of each column volume.

[0025] Figure 2 The adsorption capacity of MIF-agarose and H10MIF-agarose microsphere packed columns was demonstrated;

[0026] Figure 3 Displays column efficiency test results;

[0027] Figure 4 The results show the recovery of rare earth elements from non-rare earth elements;

[0028] Figure 5 The results of ICP-OES for direct separation of various rare earth elements are shown.

[0029] Figure 6 This displays the ICP-OES or ICP-MS results of individual fractions from experiments preparing high-purity rare earth elements (>99.99%). Detailed Implementation

[0030] The present application is further illustrated below with reference to embodiments. It should be understood that the embodiments are only used to further illustrate and explain the present application and are not intended to limit the present application.

[0031] Unless otherwise defined, technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art. While similar or identical methods and materials may be applied in experimental or practical applications, materials and methods are described herein. In case of conflict, the definitions included herein shall prevail. Furthermore, materials, methods, and examples are for illustrative purposes only and are not intended to be limiting. The present application is further described below with reference to specific embodiments, but is not intended to limit the scope of the application.

[0032] definition

[0033] As used in this article, "rare earth binding protein" refers to a class of proteins that can bind rare earth elements. Based on their ability to bind rare earth elements, rare earth binding proteins can be used to recover, and / or separate, and / or purify rare earth elements.

[0034] As used herein, the terms “gene,” “polynucleotide,” “nucleotide sequence,” and “nucleic acid molecule” are used interchangeably. They refer to a polymer of nucleotides of any length, which may be deoxyribonucleotides or ribonucleotides, or analogs thereof. The nucleic acid molecule may be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule may also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

[0035] As used herein, the percentage of "identity," such as 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%, refers to the degree of similarity between amino acid sequences or nucleotide sequences determined by sequence alignment, and is 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%. For example, it is the percentage of positions with identical bases or amino acid residues determined out of the total number of positions after two sequences have as many identical residues as possible by introducing vacancies, etc. The percentage of "identity" can be determined using software programs known in the art. It is preferred to use default parameters for alignment. A preferred alignment program is BLAST. Preferred programs are BLASTN and BLASTP. Details of these programs can be found at the following internet address: ncbi.nlm.nih.gov / cgi-bin / BLAST.

[0036] As used herein, “expression” includes any step involved in peptide production, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion. Expression can be detected using conventional techniques for protein detection, such as ELISA, Western blotting, flow cytometry, immunofluorescence, immunohistochemistry, etc.

[0037] As used herein, "expression vector" or "recombinant vector" refers to any substance such as plasmids, granules, viruses, self-replicating sequences, bacteriophages, linear or circular single-stranded or double-stranded DNA or RNA nucleotide sequences. Recombinant vectors can originate from any source, are capable of genome integration or self-replication, and contain promoter nucleic acid sequences operatively linked to one or more nucleic acid sequences. Recombinant vectors are typically used to introduce said operatively linked sequences into a suitable host.

[0038] In view of the problems existing in the prior art, this application provides a material for separating rare earth elements, comprising a rare earth binding protein, wherein the rare earth binding protein comprises or is composed of any one of the following proteins:

[0039] (I) A protein with the amino acid sequence shown in SEQ ID NO.2;

[0040] (II) Proteins obtained by adding a linker, a sequence for purification, a sequence for cutting, a sequence for solubilization, or a sequence for immobilization to (I);

[0041] (III) Proteins that have 80%, 85%, 90%, 95%, 96%, 97%, 98% or more sequence identity with (I) or (II).

[0042] Type (II) proteins are obtained by adding linkers, sequences for purification, sequences for cleavage, sequences for solubilization, or sequences for immobilization to the basis of (I) proteins to facilitate purification, immobilization, and other applications. Therefore, there is no substantial difference in function or structure between Type (II) and Type (I) proteins.

[0043] The linker, the sequence for purification, the sequence for cleavage, the sequence for solubilization, or the sequence for immobilization can all be known in the art. For example, the sequence for purification can be His6, His10, Avi tag, etc. The sequence for cleavage can be a TEV site. The sequence for solubilization can be Sumo. The sequence for immobilization can be a spy tag, spy catcher, etc. In some embodiments, the amino acid sequence of class (II) protein is as shown in SEQ ID NO.4.

[0044] In some embodiments, the amino acid sequence of the rare earth binding protein is as shown in SEQ ID NO.2, or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more sequence identity with the sequence shown in SEQ ID NO.2.

[0045] In some embodiments, the amino acid sequence of the rare earth binding protein is as shown in SEQ ID NO.4, or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more sequence identity with the sequence shown in SEQ ID NO.4.

[0046] Furthermore, the material also includes microspheres coupled to the rare earth binding protein. The microspheres can be any type of microsphere known in the art suitable for coupling with the binding protein. In some embodiments, the material is a microsphere for use in chromatography columns, i.e., a packing material.

[0047] In some embodiments, the microspheres may be selected from one or more of the following: natural polysaccharide and hydrogel microspheres, organic synthetic polymer microspheres, inorganic microspheres, organic-inorganic hybrid microspheres, and magnetic microspheres.

[0048] Among them, natural polysaccharide and hydrogel microspheres may include cross-linked dextran microspheres, cellulose / microcrystalline cellulose microspheres, chitosan / chitin derivative microspheres, pullulan / alginate / carrageenan cross-linked microspheres, agarose-PEG copolymer / composite microspheres, agarose microspheres, etc.

[0049] Organic synthetic polymer microspheres may include porous poly(meth)acrylate (PMMA / PGMA / EMA-based) microspheres, polyacrylamide / acrylamide-copolymer network microspheres, polystyrene-divinylbenzene (PS-DVB) microspheres, poly(hydroxyethyl methacrylate) (PHEMA) microspheres, chloromethylated / bromomethylated polymer core-shell microspheres, etc.

[0050] Inorganic microspheres can include porous silica microspheres, pore-controlled glass microspheres, metal oxide (zirconia / titanium oxide / alumina) microspheres, hydroxyapatite (HAP) / ceramic media microspheres, etc.

[0051] Organic-inorganic hybrid microspheres can include polymer-coated silica microspheres, dopamine / polydopamine coated (PDA) microspheres, and silanized microspheres followed by click chemistry (Azide-Alkyne, Thiol-ene) microspheres.

[0052] Magnetic microspheres may include Fe3O4 or γ-Fe2O3 core-shell magnetic microspheres.

[0053] In some embodiments, the microspheres are agarose microspheres.

[0054] All of the above-described microspheres can be prepared by methods known in the art or obtained commercially. The coupling of the microspheres with rare earth binding proteins can also be achieved using methods known in the art. This application also provides an apparatus comprising any of the above-described materials.

[0055] Those skilled in the art will understand that the device comprising the above-mentioned material means containing the above-mentioned material.

[0056] The form of the apparatus described in this application is not limited, as long as it can accommodate the materials used for separating rare earth elements and can fully contact the rare earth elements to be processed. For example, the apparatus can be a reaction vessel, a fluidized bed, a chromatography device, etc.

[0057] In some embodiments, the apparatus is a chromatography device. In some embodiments, the chromatography device is a chromatography column.

[0058] This application also provides the use of the above-mentioned materials or apparatus in the recovery of rare earth elements.

[0059] This application also provides the use of the above-mentioned materials or apparatus in the separation of rare earth elements. The separation of rare earth elements can be the separation of rare earth elements from non-rare earth elements, or the separation of different rare earth elements.

[0060] In some implementations, the separation refers to the separation between any two rare earth elements, that is, the separation between any rare earth pairs.

[0061] Among these rare earth pairs, separating adjacent rare earth pairs is the most difficult.

[0062] In some implementations, the separation refers to the separation between adjacent rare earth elements. Adjacent rare earth elements are those with an atomic number difference of 1. For example, La has an atomic number of 57, and Ce has an atomic number of 58, so La and Ce are adjacent rare earth elements. For Pm, due to its radioactivity, Nd with an atomic number of 60 and Sm with an atomic number of 62 are adjacent rare earth elements. Exemplary adjacent rare earth element pairs also include Eu / Gd, Dy / Ho, Ho / Er, Er / Tm, Tm / Yb, and Yb / Lu, etc.

[0063] The material or device containing rare earth binding protein of this application can not only separate rare earth elements from non-rare earth elements, but also separate any two rare earth elements. Furthermore, it can also separate adjacent rare earth elements.

[0064] This application also provides the use of any of the above-mentioned materials or devices in the purification of rare earth elements.

[0065] In the above-mentioned applications, the rare earth element can be any rare earth element known in the art. For example, the rare earth element can be selected from one or more of lanthanum, cerium, praseodymium, neodymium, samarium, europium, gadolinium, terbium, dysprosium, holmium, erbium, thulium, ytterbium, lutetium, and yttrium.

[0066] This application also provides a method for recovering rare earth elements, including processing rare earth elements using any of the above-described materials or apparatus.

[0067] This application also provides a method for separating rare earth elements, including processing rare earth elements using any of the aforementioned materials or apparatus. The separation of rare earth elements can be either separating rare earth elements from non-rare earth elements, or separating different rare earth elements.

[0068] In some embodiments, the separation refers to the separation between any two rare earth elements. In some embodiments, the separation refers to the separation between adjacent rare earth elements. For example, adjacent rare earth elements such as Eu / Gd, Dy / Ho, Ho / Er, Er / Tm, Tm / Yb, and Yb / Lu can be classified.

[0069] This application also provides a method for purifying rare earth elements, including processing rare earth elements using any of the above-described materials or apparatus.

[0070] In the above methods, "processing" can refer to contacting the material used for separating rare earth elements with rare earth elements, thereby achieving the recovery, separation, or purification of rare earth elements. For example, the material used for separating rare earth elements can be directly mixed with rare earth elements to achieve contact, or the material used for separating rare earth elements can be filled into a device, allowing the rare earth elements to flow through the device to achieve contact between the material used for separating rare earth elements and the rare earth elements.

[0071] In the above method, the rare earth element can be any rare earth element known in the art. For example, the rare earth element can be selected from one or more of lanthanum, cerium, praseodymium, neodymium, samarium, europium, gadolinium, terbium, dysprosium, holmium, erbium, thulium, ytterbium, lutetium, and yttrium.

[0072] Experimental results show that the rare earth binding protein contained in the material or device of this application can adsorb La ions up to 935.3 mg / L. ICP-OES results show that the material and device containing the rare earth binding protein of this application can successfully separate rare earth elements from non-rare earth elements, with a rare earth element recovery rate of 60.01% and a recovery purity of 99.76%. The material and device of this application can also separate and purify multiple rare earth ion pairs, especially adjacent rare earth ion pairs, such as Eu / Gd, Dy / Ho, Ho / Er, Er / Tm, Tm / Yb, and Yb / Lu ion pairs.

[0073] In summary, the rare earth binding protein contained in the materials and apparatus of this application has a significant affinity for rare earth elements. It can not only separate rare earth elements from non-rare earth elements, but also separate light (lanthanum, cerium, praseodymium, neodymium), medium (samarium, europium, gadolinium, terbium, dysprosium), and heavy (holmium, erbium, thulium, ytterbium, lutetium, yttrium) rare earth elements as well as adjacent rare earth pairs (europium, gadolinium; dysprosium, holmium; holmium, erbium; erbium, thulium; thulium, ytterbium, etc.). It has good application prospects in the fine separation of rare earth elements.

[0074] Example

[0075] Example 1: Construction of MIF expression vector

[0076] To construct the protein MIF (152 aa), the codons of the fusion gene were optimized according to the codon usage preferences of *E. coli*, and a start codon ATG was added at the beginning. The fusion gene was inserted into the NdeI / BlpI site of the expression vector pET-25b(+) and transformed into *E. coli* BLR(DE3) cells (Novagen) to construct an engineered bacterium expressing the MIF protein.

[0077] SEQ ID NO.1: MIF fusion gene sequence (547bp, where the stop codon is shown in bold, the 5'NdeI restriction site is shown in underline, and the 3'BlpI restriction site is shown in wavy line):

[0078] CATATG GATCACCATTTTCCGAAAGGTAAAGTGAGCCTGGAAACCTGCCTGGAAGCGGCCCTGAAAGCCAAACCGGGCACCGTGGTGAAGGTGGAATATAAACTGGAAGGCGAAACCCCGGTGTACGAATTTGATATTG AAAGCAGCGATAGCACCGCGTGGGATGTGGAATGCGATGCGAACACCGGCAAAATTGTGGAAATTGAACAGGAAGTGGATAGCGCGGATCACCCGCTGTTTAAAGCGAAACAGAAAGTGAGCGAAGCCGAAGCG CGCAAAACCGCCCTGGCGGCGCACCCGGGCGAAATTGTGGAAGTGGAATATGAAATTGAGGAAAATGGCGCAGCCAGCTACGAATTTGACATCAAAACCAAAGACGGCAAAGAATTTAAAGTGGAAGTGGATGC CAGCACCGGTAAAATTGTGGAAGCGAACCAGGAATTTTATCAGATTGGCAAAGAATAACTCGAGATCAAACGGGCTAGCTGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCG CTGAGC

[0079] SEQ ID NO.2: Protein sequence of the MIF to be expressed (153 aa, containing a Met as a start codon):

[0080] MDHHFPKGKVSLETCLEAALKAKPGTVVKVEYKLEGETPVYEFDIESSDSTAWDVECDANTGKIVEIEQEVDSADHPLFKAKQKVSEAEARKTALAAHPGEIVEVEYEIEENGAASYEFDIKTKDGKEFKVEVDASTGKIVEANQEFYQIGKE

[0081] Example 2: Construction of H10MIF expression vector

[0082] A His10-tag consisting of 10 histidine residues (His, H) was added to the N-terminus of the MIF gene sequence and linked using a flexible linker (SGGS) to construct the H10MIF protein. The codons of the fusion gene were then optimized according to the codon usage preferences of *E. coli*, and a start codon (ATG) was added at the beginning. The fusion gene was inserted into the NdeI / XhoI site of the expression vector pET-25b(+) and transformed into *E. coli* BLR(DE3) cells (Novagen) to construct an engineered bacterium expressing the H10MIF protein.

[0083] SEQ ID NO.3: Fusion gene sequence of H10MIF (547bp, where stop codons are shown in bold, 5'NdeI restriction sites are shown underlined, and 3'XhoI restriction sites are shown with wavy lines):

[0084] CATATGAGCGGCGGCCATCATCATCACCACCATCATCATTCGGGCGGCAGCGATCACCATTTTCCGAAAGGTAAAGTGAGCCTGGAAACCTGCCTGGAAGCGGCCCTGAAAGCCAAACCGGGCACCGTGGTGAAGGTGGAATAAACTGGAAGGCGAAACCCCGGTGTACGAATTTGATATTGAAAGCAGCGATAGCACCGCGTGGGATGTGGAATGCGATGCGAACACCGGCAAAATTGTGGAAATTGAACAG GAAGTGGATAGCGCGGATCACCCGCTGTTTAAAGCGAAACAGAAAGTGAGCGAAGCCGAAGCGCGCAAAACCGCCCTGGCGGCGCACCCGGGCGAAATTGTGGAAGTGGAATATGAAATTGAGGAAA ATGGCGCAGCCAGCTACGAATTTGACATCAAAACCAAAGACGGCAAAGAATTTAAAGTGGAAGTGGATGCCAGCACCGGTAAAATTGTGGAAGCGAACCAGGAATTTTATCAGATTGGCAAAGAATAA CTCGAG

[0085] SEQ ID NO.4: Protein sequence of H10MIF to be expressed (170 aa, containing 10 His as His tags, underlined, and including a Met as a start codon, and SGGS and SGG as linkers):

[0086] MSGG HHHHHHHHH SGGSDHHFPKGKVSLETCLEAALKAKPGTVVKVEYKLEGETPVYEFDIESSDSTAWDVECDANTGKIVEIEQEVDSADHPLFKAKQKVSEAEARKTALAAHPGEIVEVEYEIEENGAASYEFDIKTKDGKEFKVEVDASTGKIVEANQEFYQIGKE

[0087] Example 3 Expression and purification of MIF

[0088] After large-scale expression (1 L) of the engineered Escherichia coli BLR(DE3) cells expressing the MIF protein in Example 1, the harvested recombinant bacteria (150 g) were resuspended at a 1:5 (w / v) ratio in Q-lysis (25 mM Tris, 150 mM NaCl, adjusted to pH 5.9 with 12 M hydrochloric acid), containing 1 g / L lysozyme, 5 mg / L DNase, and 30 mM magnesium chloride. The bacterial cells were homogenized using a high-pressure homogenizer (homogenization conditions: pressure 800–1000 Bar, flow rate 40 L / h, homogenization for 10 cycles). After centrifugation, the supernatant was filtered through a 0.45 μm capsule filter, followed by purification by anion exchange column chromatography and molecular sieving. Finally, to analyze protein expression and purification, the desalted protein was confirmed by a 4–20% polyacrylamide gel. The molecular weight of MIF was 16.97 kDa.

[0089] Example 4: Expression and purification of H10MIF

[0090] After large-scale expression (200 L) of the engineered Escherichia coli BLR(DE3) cells expressing the H10MIF protein was constructed in Example 2, the harvested recombinant bacteria (150 g) were suspended at a 1:5 (w / v) ratio in Ni-lysis solution (50 mM Na3PO4, 500 mM NaCl, 20 mM imidazole, adjusted to pH 7.4 with 12 M hydrochloric acid), containing 1 g / L lysozyme, 5 mg / L DNase, and 30 mM magnesium chloride. The bacterial cells were then homogenized using an autoclave (homogenization conditions: pressure 800–1000 Bar, flow rate 40 L / h, homogenization for 10 cycles). After centrifugation, the supernatant was filtered through a 0.45 μm capsule filter and then purified by Ni-sepharose chromatography. Finally, to analyze the expression and purification of the protein, the desalted protein was confirmed by SDS-PAGE on a 4–20% polyacrylamide gel. The molecular weight of H10MIF is 18.83 kDa.

[0091] Example 5: Coupling proteins to agarose microspheres

[0092] 180 mg of protein (MIF obtained in Example 3 and H10MIF obtained in Example 4) were dissolved in 6 mL of coupling buffer (0.1 M NaHCO3, 0.5 M NaCl, pH 8.3) to obtain protein lysate. 6 g of substrate beads (NHS-Activated Chromstar 4FF) were added to a 50 mL three-necked flask and washed 10 times with 18 mL of 1 mM HCl in an ice-water bath. Then, 9 mL of coupling buffer was added to the substrate beads to adjust the pH to 8.5, followed by the addition of the protein lysate. The pH was adjusted to 8.3, and the system was incubated at 24°C. The reaction was stopped when the A280 absorption in the supernatant reached a stable level. After removing the reaction solution, 18 mL of blocking buffer (0.1 M Tris-HCl, pH 8.5) was added to the substrate beads, and the A280 absorption in the supernatant was stopped when it reached a stable level, completing the blocking process. Finally, the microspheres were washed 10 times with 18 mL of 0.1 M acetic acid solution in an ice-water bath, and then 10 times with 18 mL of ultrapure water in an ice-water bath to obtain protein-coupled agarose microspheres (MIF-agarose microspheres and H10MIF-agarose microspheres). The obtained microspheres were stored in purified water at 4 °C.

[0093] Example 6: Determination of the binding capacity of rare earth elements in a protein-agarose microsphere packed column

[0094] Protein-agarose microspheres (MIF-agarose microspheres and H10MIF-agarose microspheres, respectively) were resuspended in ultrapure water (18 MΩ / cm) and then packed into chromatography columns by gravity with a column volume of 1 mL, resulting in protein-agarose microsphere packed columns (MIF-agarose microsphere packed columns and H10MIF-agarose microsphere packed columns, respectively). Before adsorption experiments, the columns were washed with 20.0 g / L citrate buffer (pH=5) and equilibrated with MES buffer (MES concentration 25 mM, pH adjusted to 6 using 12 M hydrochloric acid and concentrated sodium hydroxide). After equilibration, rare earth solution (LaCl3, 1 mM, dissolved in MES buffer at pH 6) was added to the chromatography column at a flow rate of 0.75–1.00 mL / min. The flow-through solution from the column was collected. The lanthanum content in the flow-through solution in the above steps was detected by ICP-OES, and the binding capacity of the protein-agarose microsphere packed columns (MIF-agarose microsphere packed column and H10MIF-agarose microsphere packed column, respectively) was detected.

[0095] The results are as follows Figure 1 and Figure 2As shown, after the MIF-agarose microsphere packed column adsorbed 6 column volumes of 1.0 mM LaCl3, La ions were detectable in the flow-through solution. Calculations indicate that the adsorption capacity of this MIF-agarose microsphere packed column for La ions is approximately 935.3 mg / L. Similarly, after the H10 MIF-agarose microsphere packed column adsorbed 5 column volumes of 1.0 mM LaCl3, La ions were detectable in the flow-through solution. Calculations indicate that the adsorption capacity of this H10 MIF-agarose microsphere packed column for La ions is approximately 844.6 mg / L. In contrast, the adsorption capacity of the unimmobilized agarose microsphere packed column for La ions is approximately 3.224 mg / L. These results clearly demonstrate the significant affinity of protein-coupled materials for rare earth elements (REEs).

[0096] Example 7: Testing the Cyclic Performance of Protein-Agarose Microsphere Packed Columns

[0097] The MIF-agarose microsphere packed column and the H10 MIF-agarose microsphere packed column prepared in Example 6 can be recycled. Utilizing La... 3+ Forty cycles of adsorption and desorption were performed on 1 mL of the same batch of column material. The adsorption process was the same as in Example 6. The loading buffer was MES buffer (MES concentration of 25 mM, pH adjusted to 6 using 12 M hydrochloric acid and concentrated sodium hydroxide), containing 1.0 mM LaCl. 3， The volume was 15 mL. The results were as follows: Figure 3 As shown in the figure. Each cycle used 20.0 g / L citrate buffer (pH=5) for desorption. Before the desorption experiment, the chromatography column was washed with ultrapure water for 10 column volumes. The eluent was collected and its total rare earth content was tested, and the rare earth loading was calculated. The results show that the MIF-agarose microsphere packed column and the H10MIF-agarose microsphere packed column maintained column efficiency during 40 cycles of adsorption and desorption.

[0098] Example 8: Detection of the separation performance of protein-agarose microsphere packed column for rare earth elements and non-rare earth elements

[0099] The MIF-agarose microsphere packed column and the H10 MIF-agarose microsphere packed column prepared in Example 6 can successfully separate rare earth elements and non-rare earth elements (e.g. Figure 4The loading solution contained equal concentrations of 16 rare earth elements (excluding promethium) (total concentration 1.0 mM), as well as iron, aluminum, and magnesium, which are commonly found in nature as companions to rare earth elements, and calcium, which has properties similar to rare earth elements. The concentration of each element was 1.0 mM. The loading solution was an acetate buffer solution (25 mM acetic acid, pH adjusted using 12M hydrochloric acid and concentrated sodium hydroxide) containing the aforementioned metal ions and their corresponding concentrations. Loading conditions were the same as in Example 6, with a total loading volume of 15 mL. Unbound metal ions were then rinsed with ultrapure water and eluted with a 20.0 g / L citrate buffer solution (pH 5). The concentrations of rare earth ions in the loading solution, flow-through solution, and eluent were measured using ICP-OES.

[0100] ICP-OES results showed that REEs could be successfully separated from non-rare earth elements using MIF-agarose microsphere packed columns and H10MIF-agarose microsphere packed columns, with rare earth element recoveries of 60.01% (MIF) and 54.99% (H10MIF), and recoveries of purities of 99.76% (MIF) and 99.13% (H10MIF), respectively.

[0101] Example 9: Detection of the separation performance of rare earth elements by a protein-agarose microsphere packed column

[0102] The MIF-agarose microsphere packed column prepared in Example 6, H10 MIF-agarose microsphere packed column, can separate and purify all rare earth ion pairs, especially adjacent rare earth ion pairs. Here, the H10 MIF-agarose microsphere packed column is used as an example. The concentration of both rare earth elements in the loading solution is 10 mM, dissolved in MES buffer (MES concentration 25 mM, pH adjusted to 6 using 12M hydrochloric acid and concentrated sodium hydroxide). The loading volume is 100 μL-10 mL, and the total column volume is 2.7 mL-150 mL. Equilibration is performed using MES buffer for a total of 0.5-5 column volumes. Desorption and elution are performed in two steps. The first step is elution with a fixed concentration of citrate buffer (70 mg / L), mainly used to elute any non-rare earth elements and further equilibrate the column, for 0.5-5 column volumes. The second step is gradient elution with citrate buffer at concentrations of 70-400 mg / L. Specifically, different rare earth element pairs can be eluted using the gradient of citrate buffer shown in the table below.

[0103]

[0104] The collection of the flow-through solution was performed in the same manner as in Example 6. ICP-OES results for all rare earth elements directly separated into individual fractions are as follows: Figure 5As shown in Table 1, the H10MIF-agarose microsphere packed column successfully separated all ion pairs using the above elution method, and the purity is shown in Table 1.

[0105] Methods for calculating the purity of metal ions:

[0106] Purity_(REE1)=(c_(REE1)) / ((c_(REE1))+(c_(REE2)))

[0107] Where c_(REE1) and c_(REE2) are the molar concentrations of REE1 and REE2, respectively.

[0108] Table 1

[0109]

[0110] Example 10: Preparation of high-purity rare earth elements (99.99%+) using protein-agarose microsphere packed columns

[0111] The MIF-agarose microsphere packed column H10 prepared in Example 6 can be used for the preparation and purification of rare earth elements to a purity of 99.99%+. Here, the H10MIF-agarose microsphere packed column is used as an example. Commercially available rare earth elements with a purity of 99%-99.9% are used as the loading solution, with a concentration of approximately 10 mM, and dissolved in MES buffer (MES concentration 25 mM, pH adjusted to 6 using 12M hydrochloric acid and concentrated sodium hydroxide). The loading volume is 100 μL-10 mL, and the total column volume is 2.7 mL-150 mL. Equilibration is performed using MES buffer for a total of 0.5-5 column volumes. Desorption and elution are performed in three steps. The first step is elution with a fixed concentration of citrate buffer, at a concentration of 90% of the citrate concentration corresponding to the initial elution of the target rare earth element. This is mainly used to elute rare earth impurities heavier than the target element, and is performed for 0.5-5 column volumes. The second step involves gradient elution with citrate buffer, starting at 90% of the citrate concentration corresponding to the initial elution of the target rare earth element and continuing up to 1.2 times the citrate concentration. The fractions are collected as high-purity rare earth products. The third step involves elution with a 600-1500 mg / L citrate buffer solution to remove all residual rare earth elements from the column and regenerate the column. The collection of the flow-through solution is the same as in Example 6. The ICP-OES results for each fraction directly separated from all rare earth elements are as follows: Figure 6 As shown in Table 2, high-purity rare earth elements can be prepared using the H10MIF-agarose microsphere packed column elution method described above. Ce, Nd, Gd, Dy, Ho, and Yb are used as example elements, and their purities are shown in Table 2.

[0112] Table 2

[0113]

[0114] Example 11

[0115] Rare earth elements (REEs) in rare earth ores were leached using microorganisms capable of leaching REEs to obtain a leachate, which was then used as a rare earth solution for sample loading. The loading, equilibration, and elution methods were the same as in Example 7. ICP-OES results showed that the REEs in the leachate could be successfully separated from non-rare earth elements using a MIF-agarose microsphere packed column (H10 MIF-agarose microsphere packed column). The results are shown in Table 3; the flow-through contained only rare earth elements, and no non-rare earth elements were detected.

[0116] Table 3

[0117] .

Claims

1. Use of a material for separating rare earth elements, or an apparatus comprising said material, in the separation of rare earth elements, wherein the separation refers to the separation between any two rare earth elements; The material includes a rare earth-binding protein, the amino acid sequence of which is shown in SEQ ID NO.2 or SEQ ID NO.

4.

2. The use according to claim 1, wherein the rare earth element is selected from one or more of lanthanum, cerium, praseodymium, neodymium, samarium, europium, gadolinium, terbium, dysprosium, holmium, erbium, thulium, ytterbium, lutetium, and yttrium.

3. The use according to claim 1, wherein the material further comprises microspheres coupled to the rare earth binding protein.

4. The use according to claim 3, wherein the microspheres are selected from one or more of the following: natural polysaccharide and hydrogel microspheres, organic synthetic polymer microspheres, inorganic microspheres, organic-inorganic hybrid microspheres, and magnetic microspheres.

5. The use according to claim 1, wherein the apparatus is a chromatography apparatus.

6. A method for separating rare earth elements, comprising processing the rare earth elements using a material for separating rare earth elements, or an apparatus including said material, wherein the separation refers to the separation between any two rare earth elements; The material includes a rare earth-binding protein, the amino acid sequence of which is shown in SEQ ID NO.2 or SEQ ID NO.

4.

7. The method according to claim 6, wherein the rare earth element is selected from one or more of lanthanum, cerium, praseodymium, neodymium, samarium, europium, gadolinium, terbium, dysprosium, holmium, erbium, thulium, ytterbium, lutetium, and yttrium.

8. The method of claim 6, wherein the material further comprises microspheres coupled to the rare earth binding protein.

9. The method according to claim 8, wherein the microspheres are selected from one or more of the following: natural polysaccharide and hydrogel microspheres, organic synthetic polymer microspheres, inorganic microspheres, organic-inorganic hybrid microspheres, and magnetic microspheres.

10. The method according to claim 6, wherein the apparatus is a chromatography apparatus.

Images