Glucosyltransferase and application thereof in synthesis of ethyl vanillin alpha-D-glucoside

Abstract

The invention relates to the technical field of biological catalysis, in particular to glucosyltransferase and application of the glucosyltransferase in synthesis of ethyl vanillin alpha-D-glucoside. The protein provided by the invention is selected from at least one of the following items: (1) an amino acid sequence as shown in SEQ ID NO.1; (2) the amino acid sequence has at least 80% of identity with the amino acid sequence shown as SEQ ID NO.1 in the step (1), and has glucosyltransferase activity; (3) compared with the amino acid sequence as shown in SEQ ID NO.1 in the step (1), alanine at the 304th site is mutated into tryptophan; (4) the amino acid sequence has at least 80% of identity with the amino acid sequence in (3), retains a mutation site, and has glucosyltransferase activity; as glucosyltransferase, the protein can efficiently catalyze ethyl vanillin and maltose to generate ethyl vanillin alpha-D-glucoside.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological catalysis, and in particular to a glucosyltransferase and its application in synthesis of ethyl vanillin alpha-D-glucoside. BACKGROUND

[0002] Ethyl vanillin, as a common artificial synthetic flavor, has similar aroma to natural vanillin. However, it has more intense aroma and better stability, and thus is widely used in food, daily chemical, medicine and other fields.

[0003] Ethyl vanillin has poor solubility and thermal stability, especially in application scenarios such as beverages, high-temperature baking and cigarettes. The ethyl vanillin glucoside formed after glucosidation has greatly improved water solubility and stability, and has no odor or only precursor aroma. It can be used to achieve delayed release or directional release of aroma, has lower irritation, higher safety, and is more suitable for sensitive applications such as infant products, oral care products, etc.

[0004] Chemical synthesis of ethyl vanillin alpha-D-glucoside has many limitations, such as complicated synthesis steps, usually requiring multi-step protection and deprotection; producing alpha / beta isomer mixture, which is not conducive to configuration control; and there is a risk of residual organic solvent, which is not conducive to application in the food field. In contrast, one-step synthesis by biological enzyme method has the advantages of green and efficient.

[0005] Patent document CN109762794B discloses a glucosyltransferase of Xanthomonas arboricola, which can produce ethyl vanillin-alpha-D-glucoside by means of biological catalysis. After 4 hours of reaction, an ethyl vanillin-alpha-D-glucoside solution with a concentration of 21 g / L can be obtained, and the substrate conversion rate is 64%. However, in the existing technical route for preparing ethyl vanillin alpha-D-glucoside by biological catalysis with the participation of glucosyltransferase, the problem of low production efficiency of the key enzyme glucosyltransferase synthesis reaction still exists, which limits its application on an industrial scale. SUMMARY

[0006] Therefore, the technical problem to be solved by the present application is the low product production efficiency of the existing glucosyltransferase catalytic synthesis of ethyl vanillin alpha-D-glucoside, so as to provide a glucosyltransferase and its application in synthesis of ethyl vanillin alpha-D-glucoside.

[0007] To this end, the present application provides the following technical solutions:

[0008] The embodiment of the present application provides a protein selected from at least one of the following:

[0009] (1), comprising the amino acid sequence as shown in SEQ ID NO. 1;

[0010] (2), the amino acid sequence having at least 80%, 85%, 88%, 90%, 93%, 95%, 97%, 98%, 99%, 99%, 99.9% or 99.99% or more identity with the amino acid sequence as shown in SEQ ID NO. 1 in (1) and having glucosyltransferase activity;

[0011] (3), compared with the amino acid sequence as shown in SEQ ID NO. 1 in (1), comprising the following mutation site: the alanine at position 304 is mutated to tryptophan;

[0012] (4), the amino acid sequence having at least 80%, 85%, 88%, 90%, 93%, 95%, 97%, 98%, 99%, 99%, 99.9% or 99.99% or more identity with the amino acid sequence described in (3) and retaining the mutation site: the alanine at position 304 is mutated to tryptophan, and having glucosyltransferase activity.

[0013] As used herein, the term "sequence identity" refers to the percentage of sequence identity between two polypeptide sequences or two nucleic acid sequences.

[0014] In the above embodiment, the amino acid sequence as shown in SEQ ID NO. 1 is the original sequence of the glucosyltransferase XeGTase derived from Xanthomonas euvesicatoria, which catalyzes the synthesis of ethyl vanillin alpha-D-glucoside with high production efficiency.

[0015] In a preferred embodiment, the glucosyltransferase XeGTase is subjected to site-directed mutation, the mutation site is that the alanine at position 304 is mutated to tryptophan, and is named as XeGTase-A304W, the amino acid sequence of which is shown as SEQ ID NO: 3, so that a glucosyltransferase mutant with significantly improved catalytic activity is obtained.

[0016] The embodiment of the present application provides a nucleic acid molecule encoding the protein.

[0017] As used herein, the terms "polynucleotide" and "nucleic acid molecule" can be used interchangeably and include DNA molecules or RNA molecules. The DNA molecules can be single-stranded or double-stranded.

[0018] Due to the degeneracy of the genetic code, a large number of polynucleotides that can be used to encode the proteins of the present application can be obtained, and therefore, in the case that a specific amino acid sequence has been identified, a person skilled in the art can prepare any number of different nucleic acids by simply modifying the sequence of one or more codons in a manner that does not change the amino acid sequence of the encoded protein. The more preferred polynucleotides can be selected by codon optimization according to the preference of the host cell used in the actual preparation process.

[0019] The polynucleotides described can be obtained by conventional methods, such as PCR amplification or artificial synthesis methods, etc. At present, the polynucleotide sequences described can be obtained completely by chemical synthesis.

[0020] In some preferred but not limiting embodiments, the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO. 2 or SEQ ID NO. 4.

[0021] The embodiments of the present application provide a recombinant vector comprising the nucleic acid molecule.

[0022] As used herein, "vector" refers to a construct capable of delivering, preferably expressing in a host cell, one or more genes or sequences of interest to a host cell. The vector includes but is not limited to a viral vector, a naked DNA or RNA expression vector, a plasmid, a cosmid, or a bacteriophage vector, a DNA or RNA expression vector bound with a cationic condensing agent, a DNA or RNA expression vector packaged in a liposome.

[0023] In some embodiments, the recombinant vector is pET-28a(+)-XeGTase-A304W, which is obtained by replacing the sequence between the EcoRI and HindIII enzyme cutting sites of pET-28a(+) with the nucleic acid molecule encoding the above-mentioned mutant glucosyltransferase, and the rest of the sequence remains unchanged.

[0024] The embodiments of the present application provide a recombinant cell comprising the nucleic acid molecule or the recombinant vector.

[0025] In some embodiments, the recombinant cell can be prepared by transforming the above-mentioned recombinant vector into a host cell. The host cell is a conventional host cell in the art, as long as it can meet the requirements that the recombinant expression vector can be stably replicated by itself, and the genes carried by it can be effectively expressed.

[0026] In some embodiments, the host cell can be a prokaryotic cell or a eukaryotic cell, such as E. coli, yeast, etc., wherein E. coli expression host E. coli BL21(DE3) is preferred. The recombinant vector is transformed into E. coli E. coli BL21(DE3) to obtain the preferred genetically engineered strain of the present application, for example, the recombinant vector pET-28a(+)-XeGTase-A304W is transformed into E. coli E. coli BL21(DE3) to obtain recombinant E. coli E. coli BL21(DE3) / pET-28a(+)-XeGTase-A304W, or the recombinant vector pET-28a(+)-XeGTase is transformed into E. coli E. coli BL21(DE3) to obtain recombinant E. coli E. coli BL21(DE3) / pET-28a(+)-XeGTase.

[0027] The present application provides a method for preparing a protein, comprising:

[0028] 1) culturing the recombinant cell and inducing the expression of the protein;

[0029] 2) isolating the protein from the culture obtained in 1).

[0030] In some embodiments, the method of culturing and inducing the recombinant cell, and the method of isolating the glucose transferase mutant from the culture are conventional methods in the art.

[0031] The present application provides a glucose transferase comprising the protein, the nucleic acid molecule, the recombinant vector, the recombinant cell, or the protein prepared by the method for preparing a protein.

[0032] The present application provides the use of the glucose transferase in preparing ethyl vanillin α-D-glucoside.

[0033] The present application provides a method for preparing ethyl vanillin α-D-glucoside, comprising: using the protein, the nucleic acid molecule, the recombinant vector, the recombinant cell, the protein prepared by the method for preparing a protein, or the glucose transferase as a catalyst to catalyze the reaction of ethyl vanillin and maltose.

[0034] In some embodiments, the temperature of the catalytic reaction in the above method is 20-40℃, such as 20℃, 25℃, 30℃, 35℃, 40℃, or any two of these values or ranges, wherein 30℃ is preferred.

[0035] In some embodiments, the pH of the catalytic reaction is 6-8, for example, pH 6, pH 7, pH 8, or a value or range between any two of these values, and preferably pH 7.

[0036] In some embodiments, the reaction feed comprises: ethyl vanillin, maltose. The final concentration of ethyl vanillin is 5-50 g / L, for example, 5 g / L, 10 g / L, 15 g / L, 20 g / L, 25 g / L, 30 g / L, 35 g / L, 40 g / L, 45 g / L, 50 g / L, or a value or range between any two of these values, and preferably 30 g / L; the amount of maltose added is 5-20 equivalents of ethyl vanillin, for example, 5, 10, 12, 14, 16, 18, 20 equivalents, and preferably 10 equivalents.

[0037] In some embodiments, the medium used in the reaction is a glycosyltransferase fermentation broth.

[0038] In some embodiments, the catalytic synthesis reaction of ethyl vanillin and maltose is catalyzed by the recombinant cell described above to prepare ethyl vanillin α-D-glucoside.

[0039] Specifically, the whole-cell catalytic production of ethyl vanillin α-D-glucoside can be carried out using the wet cell, freeze-dried cell or freeze-dried powder of the recombinant cell described above as a catalyst, and the amount of wet cell, freeze-dried cell or freeze-dried powder used is 0.5-1.5 g / g of ethyl vanillin, and can be 1 g / g of ethyl vanillin. The freeze-dried powder is obtained by crushing the recombinant cell described above to obtain a cell crushing liquid, and then freeze-drying the cell crushing liquid to obtain a freeze-dried enzyme powder. The freeze-dried cell is obtained by freeze-drying the recombinant cell without crushing.

[0040] It should be understood that the glucosyltransferase XeGTase and the glucosyltransferase mutant XeGTase-A304W described in the present application can be used in the form of an engineered whole cell, in the form of a crude enzyme without purification, or in the form of a partially purified or completely purified enzyme. The glucosyltransferase XeGTase and the glucosyltransferase mutant XeGTase-A304W of the present application can also be prepared into a catalyst in the form of an immobilized enzyme or an immobilized cell by using immobilization techniques known in the art.

[0041] In some embodiments, the catalytic reaction in any of the methods described above is carried out under stirring or oscillation, for example, under stirring at 100-500 rpm, for example, 100 rpm, 200 rpm, 300 rpm, 400 rpm, 500 rpm.

[0042] The technical solution of the present application has the following advantages:

[0043] The protein provided by the present application is selected from at least one of the following: (1) comprising the amino acid sequence as shown in SEQ ID NO. 1; (2) having at least 80%, 85%, 88%, 90%, 93%, 95%, 97%, 98%, 99%, 99%, 99.9%, or 99.99% or more identity with the amino acid sequence as shown in SEQ ID NO. 1 in (1), and having glucosyltransferase activity; (3) comprising the following mutation site: alanine at position 304 is mutated to tryptophan, compared with the amino acid sequence as shown in SEQ ID NO. 1 in (1); (4) having at least 80%, 85%, 88%, 90%, 93%, 95%, 97%, 98%, 99%, 99%, 99.9%, or 99.99% or more identity with the amino acid sequence in (3), and retaining the mutation site: alanine at position 304 is mutated to tryptophan, and having glucosyltransferase activity; the protein above can efficiently catalyze the formation of ethyl vanillin alpha-D-glucoside from ethyl vanillin and maltose as glucosyltransferase XeGTase or XeGTase-A304W, the conversion rate of 4h substrate ethyl vanillin is as high as 92%, and the yield of product ethyl vanillin alpha-D-glucoside is 54g / L, which has important industrial application value for efficiently and greenly preparing ethyl vanillin alpha-D-glucoside.

[0044] 2, The present application provides a preparation method of ethyl vanillin alpha-D-glucoside, comprising: the protein, the nucleic acid molecule, the recombinant vector, the recombinant cell, the protein prepared by the preparation method of the protein or the glucosyltransferase as a catalyst, catalyzing the reaction of ethyl vanillin and maltose, the reaction condition is mild and easy to control, the production efficiency is high, and it has broad application prospect.

[0045] Further, in the reaction system, by controlling the pH value, temperature and other parameters, the efficient reaction can be ensured. BRIEF DESCRIPTION OF DRAWINGS

[0046] In order to more clearly illustrate the specific embodiments of the present application or the technical solutions in the prior art, the drawings needed in the specific embodiments or prior art description will be briefly introduced below. Obviously, the drawings in the following description are some embodiments of the present application, and those skilled in the art can also obtain other drawings according to these drawings without creative labor.

[0047] Figure 1 is the map of pET-28a(+)-XeGTase plasmid in Example 1 of the present application;

[0048] Figure 2 is a map of the pET-28a(+)-XeGTase-A304W plasmid in Example 1 of the present application;

[0049] Figure 3 is a reaction route for catalytic synthesis of ethyl vanillin α-D-glucoside by using the bacterial agent in Example 4 of the present application. DETAILED DESCRIPTION

[0050] The following examples are provided to better enable those skilled in the art to further understand the application, and are not intended to limit the scope of the application or the content of the disclosure, and do not limit the scope of the application and the scope of protection, and any person under the inspiration of the present application or the combination of the present application with other prior art features, any products same or similar to the present application, fall within the scope of protection of the present application.

[0051] The specific experimental steps or conditions not mentioned in the examples can be carried out according to the conventional experimental steps described in the literature in the art or the operation or conditions. The reagents or instruments used are not marked by the manufacturer, which are conventional reagent products that can be obtained by market purchase.

[0052] pET-28a(+) is a product of Sigma-Aldrich Company, and the product catalog number is 70777.

[0053] Example 1 Obtaining of pET-28a(+)-XeGTase plasmid and pET-28a(+)-XeGTase-A304W plasmid

[0054] (1) Obtaining of wild-type XeGTase and mutant XeGTase-A304W gene sequences

[0055] The amino acid sequence of the wild-type XeGTase glucosyltransferase is shown in SEQ ID NO. 1, and the nucleotide sequence encoding it is shown in SEQ ID NO. 2.

[0056] The amino acid sequence of the mutant XeGTase-A304W is shown in SEQ ID NO. 3, and the nucleotide sequence encoding it is shown in SEQ ID NO. 4.

[0057] The wild-type XeGTase and mutant XeGTase-A304W gene sequences were synthesized by Suzhou Jinyuizhi Biological Technology Co., Ltd.

[0058] (2) Construction method of pET-28a(+)-XeGTase plasmid

[0059] 1), using the synthetic XeGTase wild-type coding gene as a template, and primers XeGTase-FP and XeGTase-RP for PCR amplification, the primers are as follows:

[0060] Table 1, primers

[0061] Primer Sequence (5'→ 3') Sequence Listing XeGTase-FP GCGGAATTCATGTTGCAGACACCATGGTGG SEQ ID NO. 7 XeGTase-RP GCGAAGCTTTCACTCCCCGCCCAT SEQ ID NO. 8

[0062] The PCR amplification system is as follows: ddH2O, 18 μL; 2 × Phanta Max Buffer, 25 μL; dNTP Mix (commercially available), 1 μL; XeGTase-FP (concentration 10 μM), 2 μL; XeGTase-RP (concentration 10 μM), 2 μL; Phanta Max Super-Fidelity DNA polymerase (enzyme activity 1 U), 1 μL; template (concentration 1 ng / μL), 1 μL.

[0063] PCR reaction program: 95°C 3 min; (95°C 30 s, 58°C 30 s, 72°C 90 s) × 30 cycles; 72°C 10 min, 4°C 10 min.

[0064] 2), the PCR amplification product obtained in step 1) and the vector pET-28a(+) were recovered and subjected to enzyme digestion, and the enzyme digestion system was as follows: 16 μL of the amplification product or the vector; 1 μL of EcoRI endonuclease (enzyme activity 20 U); 1 μL of HindIII endonuclease (enzyme activity 20 U); 2 μL of 10 × Buffer (commercially available).

[0065] Enzyme digestion conditions: 37°C, 2 h.

[0066] 3), the enzyme digestion product obtained in step 2) was subjected to ligation, and the ligation system was as follows: 4 μL of the target fragment; 4 μL of the vector plasmid; 1 μL of T4 DNA ligase (enzyme activity 40 U); 1 μL of 10 × T4 Buffer.

[0067] Ligation conditions: 16°C, 12 h.

[0068] The recombinant plasmid obtained by ligation was named pET-28a(+)-XeGTase, and the plasmid was sent for sequencing, and the results were consistent with the expectations, the nucleotide sequence of the recombinant plasmid was SEQ ID NO: 5, and the plasmid map was as shown in Figure 1 .

[0069] (3) Construction of pET-28a(+)-XeGTase-A304W plasmid:

[0070] 1) PCR amplification was performed with the coding gene of the synthesized glucose transferase mutant XeGTase-A304W as a template, and primers XeGTase-A304W-FP and XeGTase-A304W-RP as shown in Table 2 below:

[0071] Table 2, primers

[0072] Primer Sequence (5'→ 3') XeGTase-A304W-FP GCGGAATTCATGTTGCAGACACCATGGTGG XeGTase-A304W-RP GCGAAGCTTTCACTCCCCGCCCAT

[0073] The PCR amplification system was as follows: ddH2O, 18 μL; 2 × Phanta Max Buffer, 25 μL; dNTP Mix (commercially available), 1 μL; XeGTase-A304W-FP (concentration 10 μM), 2 μL; XeGTase-A304W-RP (concentration 10 μM), 2 μL; Phanta Max Super-Fidelity DNA polymerase (enzyme activity 1 U), 1 μL; Template, 1 μL.

[0074] The PCR reaction program was as follows: 95 °C 3 min, (95 °C 30 s, 58 °C 30 s, 72 °C 90 s) × 30, 72 °C 10 min, 4 °C 10 min.

[0075] 4) The PCR amplification product obtained in step 1) and the vector pET-28a(+) were recovered and subjected to enzyme digestion, and the enzyme digestion system was as follows: 16 μL of the amplification product or the vector, 1 μL of EcoRI endonuclease, 1 μL of HindIII endonuclease, and 2 μL of 10 × Buffer.

[0076] The enzyme digestion conditions were as follows: 37 °C for 2 h.

[0077] 5) The enzyme digestion product obtained in step 2) was subjected to ligation, and the ligation system was as follows: 4 μL of the target fragment, 4 μL of the vector plasmid, 1 μL of T4 DNA ligase, and 1 μL of 10 × T4 Buffer.

[0078] The ligation conditions were as follows: 16 °C for 12 h.

[0079] The recombinant plasmid obtained by ligation was named pET-28a(+)-XeGTase-A304W, and the plasmid was sent for sequencing, and the results were consistent with the expectations. The nucleotide sequence of the recombinant plasmid was SEQ ID NO: 6, and the plasmid map was as shown in Figure 2 .

[0080] Both the pET-28a(+)-XeGTase plasmid and the pET-28a(+)-XeGTase-A304W plasmid were entrusted to Suzhou Jinyuizhi Biotechnology Co., Ltd. for construction and synthesis.

[0081] Construction of expression strains of wild type XeGTase and mutant XeGTase-A304W

[0082] The recombinant plasmid pET-28a(+)-XeGTase obtained in Example 1 was transformed into the expression host E. coli BL21(DE3) by chemical transformation, and plated on LB solid medium containing 50 μg / mL kanamycin for selection, to obtain the recombinant strain E. coli BL21(DE3) / pET-28a(+)-XeGTase expressing wild type XeGTase.

[0083] The mutant recombinant plasmid pET-28a(+)-XeGTase-A304W obtained in Example 1 was transformed into the expression host E. coli BL21(DE3) by chemical transformation, and plated on LB solid medium containing 50 μg / mL kanamycin for selection, to obtain the recombinant strain E. coli BL21(DE3) / pET-28a(+)-XeGTase-A304W expressing mutant XeGTase-A304W.

[0084] Example 3 Preparation of enzyme

[0085] The recombinant strains E. coli BL21(DE3) / pET-28a(+)-XeGTase and E. coli BL21(DE3) / pET-28a(+)-XeGTase-A304W obtained in Example 2 were inoculated into LB test tube medium containing 50 μg / mL kanamycin, and incubated at 37°C, 220 rpm for 12 hours, then transferred into 100 mL LB flask medium containing 50 μg / mL kanamycin at an inoculation amount of 1% (v / v), and incubated at 37°C, 220 rpm until the OD 600nm = 0.6-0.8, and 0.2 mM inducer IPTG was added, and the culture was induced at 25°C for 12 hours. The fermentation broth was obtained, which was a bacterial agent for producing ethyl vanillin-α-D-glucoside.

[0086] Example 4 Preparation of ethyl vanillin-α-D-glucoside catalyzed by enzyme

[0087] The bacterial agent prepared in Example 3 was used as a biological catalyst in the preparation reaction of ethyl vanillin-α-D-glucoside, and the reaction route is shown in Figure 3

[0088] ​1L reaction system: final concentration of substrate ethyl vanillin (5g / L initial concentration, 1-2g / L flow rate every 5-15min), 1L fermentation broth containing 30g wet cells (equivalent to 1g / g ethyl vanillin), 300g / L maltose, 30°C, pH 7.0, 200rpm stirring reaction for 4 hours.

[0089] After the reaction, 100μL of the reaction solution was taken and added to 900μL of 0.01mol / L dilute hydrochloric acid, centrifuged at 13000xg for 5min, filtered with a 0.22μm filter membrane, and the filtrate was collected in a liquid phase sample bottle. The concentrations of ethyl vanillin and ethyl vanillin α-D-glucoside were detected by high performance liquid chromatography analysis.

[0090] It was calculated that when the wild-type enzyme XeGTase was used as a biological catalyst, the conversion rate of the substrate ethyl vanillin (conversion rate = (initial amount of reactant - remaining amount of reactant) / initial amount of reactant x 100%) was 73%, and the yield of the product ethyl vanillin α-D-glucoside was 43g / L.

[0091] When the mutant enzyme XeGTase-A304W was used as a biological catalyst, the conversion rate of the substrate ethyl vanillin (conversion rate = (initial amount of reactant - remaining amount of reactant) / initial amount of reactant x 100%) was 92%, and the yield of the product ethyl vanillin α-D-glucoside was 54g / L.

[0092] 1L reaction system: final concentration of substrate ethyl vanillin (5g / L initial concentration, 1-2g / L flow rate every 5-15min), 1L fermentation broth containing 30g wet cells (equivalent to 1g / g ethyl vanillin), 300g / L maltose, 30°C, pH 7.0, 200rpm stirring reaction for 4 hours.

[0093] After the reaction, 100μL of the reaction solution was taken and added to 900μL of 0.01mol / L dilute hydrochloric acid, centrifuged at 13000xg for 5min, filtered with a 0.22μm filter membrane, and the filtrate was collected in a liquid phase sample bottle. The concentrations of ethyl vanillin and ethyl vanillin α-D-glucoside were detected by high performance liquid chromatography analysis.

[0094] It was calculated that when the wild-type enzyme XeGTase was used as a biological catalyst, the conversion rate of the substrate ethyl vanillin (conversion rate = (initial amount of reactant - remaining amount of reactant) / initial amount of reactant x 100%) was 73%, and the yield of the product ethyl vanillin α-D-glucoside was 43g / L.

[0095] When the mutant enzyme XeGTase-A304W is used as a biocatalyst, the conversion rate of the substrate vanillin (conversion rate = (initial amount of reactant - remaining amount of reactant) / initial amount of reactant x 100%) is 99%, and the yield of the product vanillin a-D-glucoside is 39.1 g / L.

[0096] The high performance liquid chromatography detection method is as follows:

[0097] An Agilent high performance liquid chromatograph, a C18 chromatographic column (specification 4.6 x 250 mm); mobile phase: methanol: water = 45:55 (volume ratio); flow rate: 1.0 mL / min; wavelength of the ultraviolet detector: 272 nm; column temperature: 25°C; all samples are centrifuged at 13000 x g and filtered through a 0.22 μm filter membrane, and the loading amount is 10 μL.

[0098] The elution time of the ethyl vanillin standard is 10 min, and the elution time of the ethyl vanillin a-D-glucoside standard is 4 min.

[0099] The elution time of ethyl vanillin in the reaction solution is 10 min, and the elution time of ethyl vanillin a-D-glucoside is 4 min.

[0100] Obviously, the above examples are merely examples for the purpose of clarity, and are not intended to limit the embodiments. Based on the above description, other different forms of changes or variations can also be made by those of ordinary skill in the art. It is not necessary or possible to exhaust all embodiments. The obvious changes or variations derived therefrom are still within the protection scope of the present application.

Claims

1. A protein, characterized in that, selected from at least one of the following: (1) an amino acid sequence as shown in SEQ ID NO. 1; (2) an amino acid sequence having at least 80%, 85%, 88%, 90%, 93%, 95%, 97%, 98%, 99%, 99%, 99.9%, or 99.99% or more identity to the amino acid sequence as shown in SEQ ID NO. 1 in (1) and having glucosyltransferase activity; (3) an amino acid sequence comprising the following mutation site: alanine at position 304 is mutated to tryptophan, as compared to the amino acid sequence as shown in SEQ ID NO. 1 in (1); (4) an amino acid sequence having at least 80%, 85%, 88%, 90%, 93%, 95%, 97%, 98%, 99%, 99%, 99.9%, or 99.99% or more identity to the amino acid sequence described in (3) and retaining the mutation site: alanine at position 304 is mutated to tryptophan, and having glucosyltransferase activity.

2. A nucleic acid molecule, characterized in that, a nucleic acid molecule encoding the protein of claim 1; optionally, the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO. 2 or SEQ ID NO.

4.

3. A recombinant vector, characterized in that, a vector comprising the nucleic acid molecule of claim 2.

4. A recombinant cell, characterized in that, a recombinant vector comprising the nucleic acid molecule of claim 2 or the recombinant vector of claim 3.

5. A method for producing a protein, characterized by, comprising: 1) culturing the recombinant cell of claim 4 and inducing the expression of the protein of claim 1; 2) isolating the protein of claim 1 from the culture obtained in 1).

6. A glucosyltransferase, characterized in that, a protein prepared by the method of claim 5.

7. Use of the glucosyltransferase of claim 6 in the preparation of ethylvanillin alpha-D-glucoside.

8. A process for the preparation of ethyl vanillin α-D-glucoside, characterized in that, comprising: the protein of claim 1, the nucleic acid molecule of claim 2, the recombinant vector of claim 3, the recombinant cell of claim 4, the protein prepared by the method of claim 5, or the glucosyltransferase of claim 6 as a catalyst for catalyzing the reaction of ethylvanillin and maltose.

9. The preparation method according to claim 8, characterized in that, the pH of the catalytic reaction is 6-8; and / or, the temperature of the catalytic reaction is 20-40℃.

10. The production method according to claim 8 or 9, characterized by, the final concentration of the ethylvanillin is 5-50 g / L; and / or, the amount of maltose added is 10-20 times the equivalent amount of ethylvanillin; and / or, in the catalytic reaction, the amount of the recombinant cell used is 0.5-1.5 g / g of ethylvanillin; and / or, in the catalytic reaction, the stirring speed is 100-500 rpm.

Images