SNP molecular marker of sorghum stem thickness related gene SbSAL1 and application thereof

Abstract

This invention discloses the SNP molecular markers of the sorghum stem diameter-related gene SbSAL1 and their applications. The technical problem this invention aims to solve is how to rapidly and accurately identify the sorghum stem diameter trait. The provided SNP1 and SNP2 are located at positions 1329 and 1972 of SEQ ID NO: 1 in the sequence listing, respectively. The average stem diameter of the tested sorghum genotype CCA A at these two SNP loci is significantly higher than that of other genotypes. The method established by this invention can be used to predict the phenotypic effect of sorghum on stem diameter, for early screening of sorghum to be screened, and for marker-assisted breeding of sorghum. It has significant application value in the research of discovering sorghum germplasm resources with heavier stem diameter and breeding tall sorghum varieties.

Description

SNP molecular markers of SbSAL1, a gene related to sorghum stem diameter, and their applications Technical Field

[0001] This invention belongs to the field of gene biotechnology, specifically involving the SNP molecular marker of the sorghum stem diameter-related gene SbSAL1 and its application. Background Technology

[0002] Soil salinization is a widespread problem worldwide, with approximately 20% of arable land already salinized or undergoing salinization to varying degrees. The loss of land suitable for crop cultivation has become a serious issue for agricultural sustainability. Salt content is one of the most significant environmental stressors, drastically reducing arable land area while also lowering crop yields and quality. Sorghum possesses characteristics such as drought resistance, flood tolerance, salt and alkali tolerance, and high-temperature tolerance, making it suitable for planting on saline-alkali and arid marginal lands. Therefore, planting salt-tolerant sorghum varieties is an effective measure to fully utilize resources and improve agricultural production on saline-alkali land.

[0003] The sucrose-rich juice from sweet sorghum stalks can be fermented into biofuels and bioproducts. The yield and quality of plant biomass are crucial economic factors in plant biofuel production. Stalk diameter is the preferred factor for increasing biomass yield; in sugarcane, there is a strong correlation between stalk weight and stalk diameter. Furthermore, sorghum varieties, especially those sensitive to photoperiod, can produce large amounts of lignocellulose biomass, which can serve as a sustainable and economically viable conversion feedstock.

[0004] By studying the genes that regulate sorghum stem diameter, obtaining KASP molecular markers closely linked to stem diameter genes, locating and detecting major gene loci for sorghum stem diameter, effectively regulating sorghum stem diameter types, and breeding new sorghum varieties with the desired stem diameter types, it is of great significance for increasing sorghum yield. Summary of the Invention

[0005] The technical problem to be solved by this invention is how to quickly and accurately identify or assist in the identification of the stem thickness of sorghum.

[0006] To address the aforementioned issues, this invention provides an application for detecting polymorphisms, genotypes, or haplotypes of SNPs in the sorghum genome. The SNPs can be SNP1 and SNP2. SNP1 is a single nucleotide polymorphism in the sorghum genome, located at nucleotide 1329 of SEQ ID NO: 1 in the sequence listing, and its nucleotide type is C or T. SNP2 is another single nucleotide polymorphism in the sorghum genome, located at nucleotide 1972 of SEQ ID NO: 1 in the sequence listing, and its nucleotide type is A or C.

[0007] The application can be any one of the following A1)-A4):

[0008] A1) The application of the substance described in the identification or auxiliary identification of the sorghum stalk thickness trait.

[0009] Application of the substance described in A2) in sorghum breeding

[0010] A3) The application of the substance described therein in the preparation of products for identifying or assisting in the identification of sorghum stalk thickness.

[0011] A4) The application of the substance described therein in the preparation of sorghum breeding products.

[0012] In the above applications, the substance may be B1), B2), or B3):

[0013] B1) The substance described is a primer composition for amplifying sorghum genomic DNA fragments, including the SNP mentioned above.

[0014] B2) The substance described is a PCR reagent containing the primer composition described in B1).

[0015] B3) The substance is a kit containing the primer composition described in B1) or the PCR reagent described in B2).

[0016] The present invention also provides a method for identifying or assisting in the identification of sorghum stem thickness traits. The method may include detecting the genotype of SNPs in the genome of the sorghum to be tested, and identifying or assisting in the identification of sorghum stem thickness traits based on the genotypes. The SNPs may be SNP1 and SNP2 as described above.

[0017] Based on the genotype identification or auxiliary identification, the sorghum stem diameter trait can be determined that the sorghum with the genotype CCAA has a higher stem diameter than the following three genotypes: TTCC, CCCC, and TTAA. The genotype CCAA is a combination of two SNPs, where SNP1 has the genotype CC and SNP2 has the genotype AA. The genotype TTCC is a combination of two SNPs, where SNP1 has the genotype TT and SNP2 has the genotype CC. The genotype CCCC is a combination of two SNPs, where SNP1 has the genotype CC and SNP2 has the genotype CC. The genotype TTAA is a combination of two SNPs, where SNP1 has the genotype TT and SNP2 has the genotype AA.

[0018] The genotype of SNP1 is CC, which is homozygous for SNP1 being C; the genotype of SNP1 is TT, which is homozygous for SNP1 being T; the genotype of SNP2 is AA, which is homozygous for SNP2 being A; and the genotype of SNP2 is CC, which is homozygous for SNP2 being C.

[0019] Using the sorghum genome (BTx623(v3.1) sequence as a reference genome, the SNP1 is located in the SbSAL1 gene, which is located at positions 52107407-52109437 on chromosome 10 of sorghum and is associated with the thickness of the sorghum stem. Its nucleotide sequence is the DNA molecule shown in SEQ ID NO: 1 in the sequence listing.

[0020] Optionally, the method for identifying or assisting in the identification of sorghum stalk thickness may be any of the following:

[0021] (1) The sorghum (such as sorghum inbred lines) whose genotypes CC for SNP1 and AA for SNP2 are CCAA are or are candidates for tall and thick sorghum.

[0022] (2) The average stem diameter of the tested sorghum (such as sorghum inbred lines) with genotype CCAA is significantly higher than or candidate higher than that of the tested sorghum with genotype TTCC and genotypes CCCC and TTAA.

[0023] As one implementation scheme, the method for identifying or assisting in the identification of sorghum stalk diameter may include the following steps:

[0024] (1) Using the genomic DNA of the sorghum to be tested as a template, KASP detection was performed using primer combination F1 and primer set F2;

[0025] The primer set F1 may include primer F1-A, primer F1-B, and primer F1-C; the primer set F2 may include primer F2-A, primer F2-B, and primer F2-C;

[0026] In the primer set F1, primer F1-A has a nucleotide sequence that is a single-stranded DNA molecule of sequence 2 in the sequence listing, or a nucleotide sequence that is a single-stranded DNA molecule at positions 22-42 of sequence 2 in the sequence listing.

[0027] In the primer set F1, primer F1-B is either a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence listing, or a single-stranded DNA molecule whose nucleotide sequence is positions 22-43 of sequence 3 in the sequence listing.

[0028] The primer F1-C in primer set F1 is a single-stranded DNA molecule whose nucleotide sequence is sequence 4 in the sequence listing;

[0029] In the primer set F2, primer F2-A is either a single-stranded DNA molecule whose nucleotide sequence is sequence 5 in the sequence listing, or a single-stranded DNA molecule whose nucleotide sequence is positions 22-41 of sequence 5 in the sequence listing.

[0030] The primer F2-B in primer set F2 is either a single-stranded DNA molecule whose nucleotide sequence is sequence 6 in the sequence listing or a single-stranded DNA molecule whose nucleotide sequence is positions 22-40 of sequence 6 in the sequence listing.

[0031] The primer F2-C in primer set F2 is a single-stranded DNA molecule whose nucleotide sequence is sequence 7 in the sequence listing.

[0032] (2) After completing step (1), fluorescence detection is performed to determine the genotypes of the SNP1 and SNP2 sites of the sorghum to be tested;

[0033] (3) Identify the stem diameter of the sorghum to be tested based on the genotype results: The average stem diameter of the sorghum to be tested (such as sorghum inbred lines) with the genotype CCAA at the two SNP loci SNP1 and SNP2 is significantly higher than or candidate higher than the stem diameter of the sorghum to be tested with the genotypes TTC C, CCCC and TTAA (such as sorghum inbred lines); the stem diameter of the sorghum with the genotype TTCC is higher than the stem diameter of the sorghum to be tested with the genotypes CCCC and TTAA (such as sorghum inbred lines); the stem diameter of the sorghum to be tested with the genotype CCCC is higher than the stem diameter of the sorghum to be tested with the genotype TTAA (such as sorghum inbred lines).

[0034] This invention also provides the application of the above method in sorghum breeding.

[0035] The present invention also provides a method for sorghum breeding, the method comprising detecting SNP1 and SNP2 in the sorghum genome, and selecting sorghum with the genotype CC of SNP1 and the genotype AA of SNP2 as parents for breeding.

[0036] The sorghum breeding method provided by this invention can be M1:

[0037] The M1 method includes detecting the genotypes of SNP1 and SNP2 in the sorghum genome, selecting sorghum with the genotype CCAA at the two SNP loci of SNP1 and SNP2 as parents for breeding, and the breeding objective of the method includes selecting sorghum with tall stems and thick stalks.

[0038] As an implementation method, sorghum breeding methods may include the following steps:

[0039] (1) Using the genomic DNA of the sorghum to be tested as a template, KASP detection was performed using the above primer combination F1 and primer set F2;

[0040] (2) After completing step (1), perform fluorescence detection to determine the genotypes of the SNP1 and SNP2 sites of the sorghum to be tested;

[0041] (3) Select sorghum with the genotype CCAA at the two SNP loci, SNP1 and SNP2, for breeding to produce taller stems.

[0042] The indicators for sorghum breeding mentioned above include sorghum stem diameter.

[0043] The sorghum stem thickness mentioned above specifically refers to the stem thickness at the sorghum maturity stage.

[0044] Furthermore, the purpose of the sorghum breeding includes cultivating sorghum with thicker and taller stalks (the sorghum stalks are thicker than the parent sorghum).

[0045] In the above applications and methods, the sorghum can be a homozygous sorghum inbred line.

[0046] In the applications and methods described above, sorghum inbred lines can be selected as parents for breeding.

[0047] The present invention also provides a product for detecting polymorphisms, genotypes, or haplotypes of SNPs in the sorghum genome, wherein the SNP is the aforementioned SNP, the product contains the aforementioned substance, and the product may be any of the following:

[0048] C1) Products used to detect or assist in the detection of single nucleotide polymorphisms or genotypes related to sorghum stem diameter.

[0049] C2) Products used for identification or auxiliary identification of sorghum stalk thickness.

[0050] C3) Products used in sorghum breeding.

[0051] The above products may be D1), D2), or D3):

[0052] D1) The product described is a primer composition for amplifying sorghum genomic DNA fragments including the SNP sites.

[0053] D2) The product described is a PCR reagent containing the primer composition described in D1).

[0054] D3) The product is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

[0055] In the above applications, methods, and products, the substance may be a reagent and / or instrument required to determine the polymorphism or genotype of the SNP by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chips. The SNP chips include chips based on nucleic acid hybridization reactions, chips based on single-base extension reactions, chips based on allele-specific primer extension reactions, chips based on one-step reactions, chips based on primer ligation reactions, chips based on restriction endonuclease reactions, chips based on protein-DNA binding reactions, and chips based on fluorescent molecule-DNA binding reactions.

[0056] In the above text, the primer composition may consist of primer set F1 and primer set F2;

[0057] Primer set F1 includes primer F1-A, primer F1-B, and primer F1-C; primer set F2 includes primer F2-A, primer F2-B, and primer F2-C.

[0058] In the primer set F1, primer F1-A has a nucleotide sequence that is a single-stranded DNA molecule of sequence 2 in the sequence listing, or a nucleotide sequence that is a single-stranded DNA molecule at positions 22-42 of sequence 2 in the sequence listing.

[0059] In the primer set F1, primer F1-B is either a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence listing, or a single-stranded DNA molecule whose nucleotide sequence is positions 22-43 of sequence 3 in the sequence listing.

[0060] The primer F1-C in primer set F1 is a single-stranded DNA molecule whose nucleotide sequence is sequence 4 in the sequence listing;

[0061] In the primer set F2, primer F2-A is either a single-stranded DNA molecule whose nucleotide sequence is sequence 5 in the sequence listing, or a single-stranded DNA molecule whose nucleotide sequence is positions 22-41 of sequence 5 in the sequence listing.

[0062] The primer F2-B in primer set F2 is either a single-stranded DNA molecule whose nucleotide sequence is sequence 6 in the sequence listing or a single-stranded DNA molecule whose nucleotide sequence is positions 22-40 of sequence 6 in the sequence listing.

[0063] The primer F2-C in primer set F2 is a single-stranded DNA molecule whose nucleotide sequence is sequence 7 in the sequence listing.

[0064] In the above applications, methods, and products, the primer composition may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Markers include, but are not limited to, dyes; radioactive markers, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties whose emission spectra can be inhibited or shifted by fluorescence resonance energy transfer (FRET). The marker can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, optionally, charge-neutral. The marker can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the marker is detectable. In some embodiments, nucleic acids are detected directly without labeling (e.g., direct sequence reading).

[0065] Primer set F1 can be a primer combination consisting of single-stranded DNA with nucleotide sequences of positions 22-42 of sequence 2 in the sequence listing, single-stranded DNA with nucleotide sequences of positions 22-43 of sequence 3 in the sequence listing, and single-stranded DNA with nucleotide sequences of sequence 4 in the sequence listing. Primer combination F1 can also be a primer set consisting of single-stranded DNA shown in sequence 2, sequence 3, and sequence 4 in the sequence listing. Sequence 2 in the sequence listing consists of 42 nucleotides, with nucleotides 1-21 being the FAM sequence (as a marker) and nucleotides 22-42 being the specific sequence; sequence 3 in the sequence listing consists of 43 nucleotides, with nucleotides 1-21 being the HEX sequence (as a marker) and nucleotides 22-43 being the specific sequence. Primer set F2 can be a primer combination consisting of single-stranded DNA with nucleotide sequences of positions 22-41 of sequence 5 in the sequence listing, single-stranded DNA with nucleotide sequences of positions 22-40 of sequence 6 in the sequence listing, and single-stranded DNA with nucleotide sequences of sequence 7 in the sequence listing. Primer combination F2 can also be a primer set consisting of single-stranded DNA shown in sequence 5, sequence 6, and sequence 7 in the sequence listing. Sequence 5 in the sequence listing consists of 41 nucleotides, with nucleotides 1-21 being the FAM sequence (as a marker) and nucleotides 22-41 being the specific sequence; sequence 6 in the sequence listing consists of 40 nucleotides, with nucleotides 1-21 being the HEX sequence (as a marker) and nucleotides 22-40 being the specific sequence.

[0066] The present invention also provides a DNA molecule, wherein the nucleotide sequence of the DNA molecule may be sequence 1 in the sequence listing.

[0067] The present invention also provides applications of the above-mentioned DNA molecule, wherein the application may be any of the following:

[0068] E1) The application of the DNA molecule described in the identification or auxiliary identification of the sorghum stem thickness trait.

[0069] Application of the DNA molecules described in E2) in sorghum breeding

[0070] E3) The application of the DNA molecule described therein in the preparation of products for identification or auxiliary identification of sorghum stalk thickness.

[0071] E4) The application of the DNA molecule described therein in the preparation of sorghum breeding products.

[0072] Optionally, in the above applications, the DNA molecule serves as a detection target.

[0073] The substance that detects the SNP polymorphism and genotype or the haplotype can be combined with other substances (such as substances that detect single nucleotide polymorphisms or genotypes of other molecular markers associated with sorghum stem diameter) to prepare a product for identifying sorghum stem diameter varieties.

[0074] This invention, through genetic variation analysis of the SbSAL1 gene in a population of sorghum inbred lines, identified two SNPs: SNP1, located in the SbSAL1 gene associated with stem diameter (sequence position 1329 of SEQ ID NO: 1), and SNP2, located in the same gene (sequence position 1972 of SEQ ID NO: 1). The invention provides primer compositions for amplifying sorghum genomic DNA fragments including SNP1 and SNP2, and also provides a method for identifying or assisting in the identification of sorghum stem diameter using these primer compositions. The method established in this invention can be used to predict the phenotype of sorghum stem diameter, for early screening of sorghum varieties, and for marker-assisted breeding of sorghum. It has significant application value in the research of discovering sorghum germplasm resources with heavier stems and breeding taller sorghum varieties. Detailed Implementation

[0075] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0076] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0077] Example 1: Discovery of SNP molecular markers associated with sorghum stem diameter

[0078] I. Statistics on stem diameter of the test materials

[0079] 1. Cultivation of test materials

[0080] In 2021, 231 sorghum inbred line related population germplasm resources were planted in farmland soil in the Agricultural High-tech Zone of Dongying City, Shandong Province, China. A randomized complete block design was adopted. The experimental plot was 3m long and 2m wide, with 5 rows of 10 plants per row, a plant spacing of 0.3m, a row spacing of 0.5m, and normal irrigation.

[0081] 2. Statistical analysis of stem diameter of the tested materials

[0082] After the 231 sorghum inbred lines were fully mature, three plants were selected from each material, and the stem diameter of the main stem of each plant (the diameter at the middle of the third node of the main stem) was counted. The average value of the three replicates was taken as the final result of the stem diameter of the sample, as shown in Table 1.

[0083] II. Discovery of SNP molecular markers related to the SbSAL1 gene

[0084] 1. Whole-genome sequencing of 231 sorghum inbred line associated populations

[0085] Linkage disequilibrium (LD) analysis was performed on 210 SNP sites in the SbSAL1 gene sequence using HaploView software (https: / / www.broadinstitute.org). The parameters were set to r. 2 A threshold of >0.8 was used to screen tag SNP sites for tight linkage, and sites significantly associated with sorghum stem diameter were selected. The t-test using GraphPad Prism v8.0 software (https: / / www.graphpad-prism.cn) was used to analyze the significant differences in stem diameter corresponding to different alleles at the tag SNP sites, and superior allelic variations with significant differences were selected as functional SNP sites. One-way ANOVA was used to analyze the differences in haplotype combinations of the selected SbSAL1 gene.

[0086] 2. Discovery of SNP molecular markers related to the SbSAL1 gene

[0087] Based on the stem diameter and genome sequencing results of sorghum inbred lines, a haplotype combination of the gene SbSAL1, associated with sorghum stem diameter, was identified. This haplotype combination includes two SNP sites: SNP1 corresponds to position 52108685 on chromosome 10 of the sorghum inbred line BTx623, with nucleotides C or T, corresponding to position 1329 of SEQ ID NO: 1 in the sequence listing; SNP2 corresponds to position 52109328 on chromosome 10 of the sorghum inbred line BTx623, with nucleotides A or C, corresponding to position 1972 of SEQ ID NO: 1 in the sequence listing. In the sequence listing, Y in SEQ ID NO: 1 represents C or T, and M represents A or C.

[0088] Sequence 1 (SEQ ID NO: 1) is as follows:

[0089]

[0090] The genotyping results for each sorghum variety are shown in Table 1. The results show that there are two genotypes at the SNP1 locus (referred to as SNP1 genotypes), namely CC or TT. Genotype CC is homozygous for SNP1 with the genotype C, and genotype TT is homozygous for SNP1 with the genotype A. There are two genotypes at the SNP2 locus (referred to as SNP2 genotypes), namely AA or CC. Genotype AA is homozygous for SNP2 with the genotype A, and genotype CC is homozygous for SNP1 with the genotype C.

[0091] III. Design and establishment of specific primers for SNP molecular markers related to the SbSAL1 gene.

[0092] 1. Design of genome-specific primers for haplotype combination-related SNP sites

[0093] Specific primer sequences designed based on SNP1 and SNP2 (SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7 in the sequence listing) were all synthesized by Zhongyu Gold Label (Beijing) Biotechnology Co., Ltd.

[0094] The primer set F1 for identifying SNP1 site polymorphism is as follows:

[0095] Specific primer F1-A (SEQ ID NO: 2):

[0096] 5'- GAAGGTGACCAAGTTCATGCT CCATGGAGATGCACCTTCCTC-3'

[0097] Specific primer F1-B (SEQ ID NO: 3):

[0098] 5'- GAAGGTCGGAGTCAACGGATT GCCATGGAGATGCACCTTCCTT-3'

[0099] Universal primer F1-C (SEQ ID NO: 4): 5'-CCTCCGCATGCCGGCGGAA-3'

[0100] Specific primer F2-A (SEQ ID NO: 5):

[0101] 5'- GAAGGTGACCAAGTTCATGCT CCTCGTAGTCGCTGCGACAT-3'

[0102] Specific primer F2-B (SEQ ID NO: 6):

[0103] 5'- GAAGGTCGGAGTCAACGGATTCTCGTAGTCGCTGCGACAG-3'

[0104] Universal primer F2-C (SEQ ID NO: 7): 5'-CCGCACCAAGTCAGGATGATCAAT-3'

[0105] The primer set F1 for identifying SNP1 polymorphism was designed based on the sense strand of sequence SEQ ID NO: 1. The primer set F2 for identifying SNP2 polymorphism was designed based on the antisense strand of sequence SEQ ID NO: 1.

[0106] The underlined sequences (positions 1-21) in primers F1-A and F2-A are FAM sequences; the underlined sequences (positions 1-21) in primers F1-B and F2-B are HEX sequences.

[0107] The fragment with SNP1 at site C in SEQ ID NO: 1 of the single-stranded DNA molecule amplification sequence listing SEQ ID NO: 2 and SEQ ID NO: 4 above can be read by an enzyme-linked immunosorbent assay (ELISA) reader or a real-time PCR instrument to detect the fluorescent signal of the fluorescent group bound to the FAM sequence in the template.

[0108] The fragment with SNP1 at site T in SEQ ID NO: 1 of the single-stranded DNA molecule amplification sequence listing SEQ ID NO: 3 and SEQ ID NO: 4 can be read by an enzyme-linked immunosorbent assay (ELISA) reader or a real-time PCR instrument to detect the fluorescent signal of the fluorescent group bound to the HEX sequence in the template.

[0109] The fragment with SNP2 site A in SEQ ID NO: 1 of the single-stranded DNA molecule amplification sequence listing SEQ ID NO: 5 and SEQ ID NO: 7 above can be read by an enzyme-linked immunosorbent assay (ELISA) reader or a real-time PCR instrument to detect the fluorescent signal of the fluorescent group bound to the FAM sequence in the template.

[0110] The fragment with SNP2 at site C in SEQ ID NO: 1 of the single-stranded DNA molecule amplification sequence shown in SEQ ID NO: 6 and SEQ ID NO: 7 can be read by an enzyme-linked immunosorbent assay (ELISA) reader or a real-time PCR instrument to detect the fluorescent signal of the fluorescent group in the template that binds to the HEX sequence.

[0111] 2. Establishment of a method for detecting sorghum stem diameter using KASP molecular markers

[0112] 2.1 DNA Extraction

[0113] Genomic DNA was extracted from the tested sorghum variety, dissolved in ddH2O, and used as a template for PCR amplification.

[0114] 2.2 PCR amplification and fluorescence signal detection

[0115] Using the SNP primer sets F1 and F2 from section 1 above, PCR amplification was performed on the template obtained in section 2.1 above to detect the polymorphism (nucleotide type) and genotype of the SNP sites. The PCR products of primer sets F1 and F2 were read using a Douglas-Araya high-throughput automated fluorescence signal scanner, and the fluorescence signal was processed using Douglas-Kraken software.

[0116] Preparation of primer mixtures: First, dilute primers F1-A, F1-B, and F1-C with ddH2O to a concentration of 100 mmol·L⁻¹, obtaining primer solutions F1-A, F1-B, and F1-C, respectively. Take 60 μL of primer solution F1-A, 60 μL of primer solution F1-B, and 150 μL of primer solution F1-C, and add 230 μL of 10 mM Tris-HCl to obtain primer mixture F1. Using the same method, obtain primer solutions F2-A, F2-B, and F2-C. Take 60 μL of primer solution F2-A, 60 μL of primer solution F2-B, and 150 μL of primer solution F2-C, and add 230 μL of 10 mM Tris-HCl to obtain primer mixture F2.

[0117] The 2μL PCR reaction system for quantitative PCR included: 50ng genomic DNA, 0.02μL primer mixture, 0.6μL LGC 1×KASP Mix (Low Rox), and the remainder ddH2O. Following the operating manuals for the Douglas-Nexar and Soellex water bath systems, the program was edited, run, and the data saved. The template obtained in section 2.1 was amplified using SNP primer sets F1 and F2 from step 1 above. Polymorphisms (nucleotide types) and genotypes at SNP1 and SNP2 sites were detected. Fluorescence data of the PCR products from primer sets F1 and F2 were read using a microplate reader or quantitative PCR instrument, and fluorescence signal processing was performed using the online software SNP decoder (http: / / www.snpway.com / snpdecoder01 / ).

[0118] If the PCR product of the F1 primer set shows only a fluorescent signal from the fluorescent group that binds to the FAM sequence, then the genotype of the sorghum SNP1 locus to be tested is CC (i.e., homozygous for SNP1 locus C in the sorghum genome); if it shows only a fluorescent signal from the fluorescent group that binds to the HEX sequence, then the genotype of the sorghum SNP1 locus to be tested is TT (i.e., homozygous for SNP1 locus C in the sorghum genome). The genotype of the SNP1 site is homozygous for T. If the PCR product of the F2 primer set shows fluorescence signals from both fluorescent groups binding to the FAM sequence and those binding to the HEX sequence, the genotype of the SNP1 site in sorghum is CT (i.e., heterozygous for SNP1 sites in the sorghum genome, where SNP1 is C and T). If the PCR product of the F2 primer set shows fluorescence signals from only fluorescent groups binding to the FAM sequence, the genotype of the SNP2 site in sorghum is AA (i.e., homozygous for SNP2 sites in the sorghum genome, where SNP2 is A). If the PCR product shows fluorescence signals from only fluorescent groups binding to the HEX sequence, the genotype of the SNP2 site in sorghum is CC (i.e., homozygous for SNP2 sites in the sorghum genome, where SNP2 is C). If the PCR product shows fluorescence signals from both fluorescent groups binding to the FAM sequence and those binding to the HEX sequence, the genotype of the SNP2 site in sorghum is AC (i.e., heterozygous for SNP2 sites in the sorghum genome, where SNP2 is A and C).

[0119] Example 2: Application of SNP molecular markers of the SbSAL1 gene, which is significantly associated with sorghum stem diameter.

[0120] Sorghum samples tested: 231 sorghum inbred lines associated populations, see Table 1. Variety names are listed in Accession, Supplemental Table 10, Reference 1. Reference 1 is from Xiaoyuan Wu et al. Genomic footprints of sorghum domestication and breeding selection for multiple end uses. Molecular Plant, 2022, VOLUME 15, ISSUE 3, P537 551 DOI: https: / / doi.org / 10.1016 / j.molp.2022.01.002.

[0121] The 231 sorghum inbred lines associated with this population were provided by the research team of Jing Haichun at the National Key Laboratory of High-Efficiency Design and Utilization of Forage Germplasm, Institute of Botany, Chinese Academy of Sciences. Detailed information on this associated population can be found in Reference 1, and its germplasm resource information can also be obtained from the SorGSD website (https: / / ngdc.cncb.ac.cn / sorgsd / ). Detailed information on the varieties is shown in Table 1. The relevant biological materials are available to the public from the Institute of Botany, Chinese Academy of Sciences. These biological materials are solely for the purpose of replicating the experiments of this invention and should not be used for other purposes.

[0122] I. Sorghum Stalk Diameter Measurement

[0123] The method was the same as in Example 1. The results showed that 231 sorghum inbred lines were planted in farmland soil in the Agricultural High-tech Zone of Dongying City, Shandong Province, China. There were significant differences in stem diameter among different sorghum varieties, ranging from 8.57 to 33.43 mm. Among them, 114 sorghum inbred lines had stem diameters exceeding 20 mm, accounting for approximately 49.35% of the associated population.

[0124] II. Molecular identification or auxiliary identification of sorghum inbred lines stem diameter

[0125] Genomic DNA was extracted from the sorghum stalks to be tested and dissolved in ddH2O as a template. PCR amplification was performed using the genome-specific primer sets F1 and F2 of the haplotype-related SNP loci from Example 1 to obtain polymorphic information of the SbSAL1 genotype, thereby determining the SbSAL1 genotype of the sorghum stalks to be tested, and thus identifying or assisting in the identification of the stem diameter of the tested sorghum varieties: the stem diameter of the sorghum stalks with the SbSAL1 genotype CCAA was significantly higher than that of the following three SbSAL1 genotypes: TTCC, CCCC, and TTAA.

[0126] Among them, SbSAL1 genotype CCAA is a combination of two SNPs with genotypes CC for SNP1 and AA for SNP2; SbSAL1 genotype TTCC is a combination of two SNPs with genotypes TT for SNP1 and CC for SNP2; SbSAL1 genotype CCCC is a combination of two SNPs with genotypes CC for SNP1 and CC for SNP2; and SbSAL1 genotype TTAA is a combination of two SNPs with genotypes TT for SNP1 and AA for SNP2.

[0127] Table 1 shows the SNP genotypes and stem diameters of 231 sorghum varieties tested. The SNP1 locus of the tested sorghum varieties contained two genotypes, CC and TT (shown in the SNP1 genotype column), and the SNP2 locus contained two genotypes, AA and CC (shown in the SNP2 genotype column). The results indicate that, for the 231 sorghum varieties in Table 1, among the 40 CCAA genotype varieties, 28 had stem diameters greater than 20 mm, and 70% of the CCAA genotype varieties had stem diameters greater than 20 mm. Among the 38 TTAA genotype varieties, 25 had stem diameters less than 20 mm, and 65.79% of the TTAA genotype varieties had stem diameters less than 20 mm (Table 2). This demonstrates that using the CCAA genotype to breed tall-stem-diameter sorghum varieties and eliminating the TTAA genotype for short-stem-diameter sorghum varieties, and using CCAA as an SNP molecular marker for stem diameter-assisted selection, is indeed effective.

[0128] Table 1. Stem diameter and genotypes of two SNP loci in 231 sorghum inbred lines.

[0129]

[0130]

[0131]

[0132]

[0133]

[0134]

[0135]

[0136]

[0137]

[0138] Remarks: IS: Sweet Sorghum; IG: Grain Sorghum; LG: Grain Sorghum; AL: unknown; LB: Bro om Sorghum

[0139] Example 2 uses GraphPad Prism v8.0 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA test is used, and different letters are used to indicate whether there is a significant difference.

[0140] At a significance level of 0.05, the largest mean is labeled with a lowercase Latin letter 'a'. This mean is then compared to all other means in descending order. If the difference from the largest mean is not significant, it is labeled with the same letter 'a', until a mean with a significant difference is labeled with the letter 'b'. The mean labeled 'b' is then compared to all the larger means above it. If the difference is not significant, it is labeled with the letter 'b' again, until a significant difference is labeled with the letter 'c'. This process is repeated until all means have been labeled and compared. Means sharing even one letter are considered insignificant; means without sharing a letter are considered significant.

[0141] A significant difference analysis was performed on the stem diameter of the four haplotypes. There was a highly significant difference between the homozygous sorghum genotype CCAA and the homozygous sorghum genotypes TTAA and CCCC (P<0.01). There was a significant difference between the homozygous sorghum genotype CCAA and the homozygous sorghum genotype TTCC (P<0.05). The stem diameter of the homozygous sorghum genotype CCAA was higher than that of the homozygous sorghum genotypes TTAA, CCCC, and TTCC.

[0142] Table 2. Stem diameter and differences among 231 sorghum inbred lines corresponding to different genotypes of gene SbSAL1.

[0143] Number of genotype varieties / Average stem diameter ± standard deviation (mm) CCAA402 2.14 ± 3.855 a TTAA3818.57±3.577 b CCCC5219.18±4.832 b TTCC10119.84±4.531 b surface

[0144] The above results indicate a correlation between the SbSAL1 genotype and sorghum stem diameter: sorghum with the SbSAL1 genotype CCAA had significantly larger stem diameters than sorghum with the following three SbSAL1 genotypes: TTCC, CCCC, and TTAA. In sorghum breeding aimed at cultivating taller and thicker sorghum, sorghum with the CCAA genotype can be selected as the parent. This sorghum breeding can include crossing sorghum with the CCAA genotype with a parent of a non-CCAA genotype to obtain hybrid offspring with stem diameters greater than those of the non-CCAA parent.

[0145] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. An application for detecting polymorphisms, genotypes, or haplotypes of SNPs in the sorghum genome, characterized in that, The SNPs are SNP1 and SNP2. SNP1 is a single nucleotide polymorphism in the sorghum genome, located at nucleotide 1329 of SEQ ID NO: 1 in the sequence listing, and its nucleotide type is C or T. SNP2 is another single nucleotide polymorphism in the sorghum genome, located at SEQ ID NO: 1 in the sequence listing. The nucleotide at position 1972 of NO:1 is of type A or C; the substance is as follows: B1) the substance is a primer composition for amplifying sorghum genomic DNA fragments including the SNP; B2) the substance is a PCR reagent containing the primer composition of B1); B3) the substance is a kit containing the primer composition of B1) or the PCR reagent of B2); the application is any one of the following: A1) in identifying or assisting in identifying the sorghum stem diameter trait; A2) the substance is used in cultivating sorghum with stem diameter greater than that of the parent; A3) the substance is used in preparing products for identifying or assisting in identifying the sorghum stem diameter trait; A4) the substance is used in preparing products for cultivating sorghum with stem diameter greater than that of the parent.

2. The application according to claim 1, characterized in that, The primer composition comprises primer set F1 and primer set F2; primer set F1 includes primer F1-A, primer F1-B, and primer F1-C; primer set F2 includes primer F2-A, primer F2-B, and primer F2-C; primer F1-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or whose nucleotide sequence is position 22-42 of sequence 2 in the sequence listing; primer F1-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence listing or whose nucleotide sequence is position 22-42 of sequence 3 in the sequence listing. The single-stranded DNA at position 43; primer F1-C is a single-stranded DNA molecule whose nucleotide sequence is sequence 4 in the sequence listing; primer F2-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 5 in the sequence listing or whose nucleotide sequence is single-stranded DNA at positions 22-41 of sequence 5 in the sequence listing; primer F2-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 6 in the sequence listing or whose nucleotide sequence is single-stranded DNA at positions 22-40 of sequence 6 in the sequence listing; primer F2-C is a single-stranded DNA molecule whose nucleotide sequence is sequence 7 in the sequence listing.

3. A method for identifying or assisting in the identification of sorghum stalk thickness, characterized in that, The method includes detecting the genotype of SNPs in the genome of the sorghum to be tested, and identifying or assisting in the identification of the sorghum stem diameter trait based on the genotype, wherein the SNPs are SNP1 and SNP2 as described in claim 1; the sorghum with the genotype CCAA has a greater stem diameter than sorghum with the genotypes TTCC, CCCC, or TTAA; the genotype CCAA is a combination of two SNPs, where the genotype of SNP1 is CC and the genotype of SNP2 is AA; the genotype TTCC is a combination of two SNPs, where the genotype of SNP1 is TT and the genotype of SNP2 is CC. The genotype CCCC is a combination of two SNPs where the genotype of SNP1 is CC and the genotype of SNP2 is CC; the genotype TTAA is a combination of two SNPs where the genotype of SNP1 is TT and the genotype of SNP2 is AA; the genotype of SNP1 CC is a homozygous genotype of SNP1 being C; the genotype of SNP1 TT is a homozygous genotype of SNP1 being T; the genotype of SNP2 AA is a homozygous genotype of SNP2 being A; and the genotype of SNP2 CC is a homozygous genotype of SNP2 being C.

4. The application of the method of claim 3 in cultivating sorghum stalks with a diameter greater than that of the parent sorghum.

5. A method for sorghum breeding, characterized in that, The method includes detecting SNP1 and SNP2 as described in claim 1 in the sorghum genome, and selecting sorghum with genotype CC for SNP1 and genotype AA for SNP2 as parents for breeding.

Images