Metal coordination nucleic acid polypeptide targeted delivery nanoparticle and preparation method thereof

Abstract

The invention belongs to the field of nano materials, relates to a metal coordination nucleic acid polypeptide targeted delivery nanoparticle and a preparation method thereof, and particularly discloses a stable metal coordination nucleic acid polypeptide targeted delivery nanoparticle. The metal coordination nucleic acid polypeptide nano-particles are spherical nano-particles formed by combining metal, nucleic acid and polypeptide drugs through mutual coordination, and the surfaces of the nano-particles are modified with a targeting reagent folic acid-polyethylene glycol-amino to prepare the metal coordination nucleic acid polypeptide targeted delivery nano-particles. Wherein the metal is selected from copper chloride; the nucleic acid is linear nucleic acid; the ratio of the amount of substance of metal, nucleic acid and polypeptide in the metal coordination nucleic acid polypeptide targeted delivery nanoparticle is (10-400): (0.5-10): 1; the stable metal coordination nucleic acid polypeptide targeted delivery nanoparticle can deliver nucleic acid, polypeptide and metal ion drugs to tumor cells in a targeted manner, and synergistically exerts an anti-tumor effect.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of nanomaterials, and relates to a metal-coordinated nucleic acid polypeptide targeted delivery nanoparticle and a preparation method thereof. BACKGROUND

[0002] Tumor therapy has always been an important challenge in the field of medicine and biotechnology. Traditional treatment methods such as chemotherapy and radiotherapy are effective, but often accompanied by serious side effects and drug resistance problems. Biological macromolecular drugs, nucleic acid and polypeptide drugs show good therapeutic effect, but their anti-tumor application is limited due to poor delivery efficiency and low bioavailability. In recent years, nanomaterials have shown broad application prospects in tumor therapy due to their unique physical and chemical properties and biocompatibility. In particular, metal-coordinated self-assembled nanomaterials, by combining the catalytic properties of metal ions and the precise recognition ability of biological molecules, provide a new strategy for tumor therapy.

[0003] Metal ions (such as Cu 2+ , Fe 2+ , etc.) can catalyze endogenous hydrogen peroxide (H2O2) to generate highly toxic hydroxyl radicals (•OH) through Fenton or Fenton-like reaction in the tumor microenvironment, realizing chemical dynamic therapy (CDT). However, the efficacy of single CDT is limited by the insufficient concentration of H2O2 in the tumor microenvironment and the low delivery efficiency of metal ions. Nucleic acids are ideal candidate drugs for combined use due to their programmability, high loading capacity and biocompatibility. In recent years, researchers have constructed multifunctional nanomaterials by metal-coordinated self-assembly technology to combine metal ions with nucleic acids. For example, Wang et al. developed a "repair-activated" DNAzyme (RADzyme) that realizes real-time monitoring of DNA damage repair through methylation modification and enzyme repair mechanism, providing a new tool for tumor therapy. Liu et al. used Cu 2+ and DNAzyme to form a nanohybrid, realizing Cu 2+ mediated CDT and DNAzyme mediated gene silencing, further expanding the application range of metal-coordinated nanomaterials. These studies have shown the great potential of metal-coordinated nucleic acid nanomaterials in tumor therapy, overcoming the limitations of single therapy by integrating the catalytic function of metal ions and the precise recognition of nucleic acids.

[0004] Currently, co-delivery of metal ions and biological macromolecular nucleic acid molecules and polypeptide drugs is still a challenging task. Moreover, optimizing material design to improve the targeted delivery of biological drugs is still a difficult problem to overcome, therefore, it is important to develop a simple and effective method to achieve the targeted co-delivery of metal ions, nucleic acid drugs and polypeptide drugs.

[0005] A metal nucleic acid nanoparticle is disclosed in patent CN111110846B, which is a nanoparticle with a spherical structure formed by the combination of metal ions and nucleic acids through coordination; the metal nucleic acid nanoparticle structure can enable functional nucleic acids to enter cells to play a role, and can encapsulate drug molecules or fluorescent tracer molecules, so that the drug and nucleic acid play a synergistic therapeutic effect, while realizing real-time monitoring of the nanoparticle. However, although this technology plays a dual drug delivery role, the targeting of its delivery system is poor.

[0006] In current nucleic acid or polypeptide delivery systems, chemical modification of nucleic acids or polypeptides is often required, and the modification process is complex and costly. However, the present method does not require secondary modification of nucleic acids or polypeptides, and can be directly prepared by mixing and heating according to the optimized ratio, with extremely high loading efficiency and being suitable for large-scale production. SUMMARY

[0007] The present application discloses that metal ions are combined with nucleic acid molecules and polypeptide drugs through coordination, the surface is modified with a targeting molecule folate, and a stable spherical structure is formed. The metal-coordinated nucleic acid polypeptide targeting nanoparticle targets the delivery of drugs to tumor cells, treats tumors, does not require secondary modification of nucleic acids or polypeptides, has high loading efficiency, and is suitable for large-scale production. Based on this, the present application is completed.

[0008] In a first aspect, the present application provides a stable metal-coordinated nucleic acid polypeptide targeting nanoparticle, which is formed by the mutual coordination of metal, nucleic acid molecules and polypeptide drugs, and is modified with a targeting agent on the surface through coordination and electrostatic interaction.

[0009] Further, the shape of the nanoparticle is spherical.

[0010] Further, the metal is selected from copper chloride and / or ferrous chloride.

[0011] Further, the nucleic acid is selected from antisense nucleic acid G3139 or immune nucleic acid CpG.

[0012] Further, the nucleic acid is selected from deoxyribonucleic acid or ribonucleic acid.

[0013] Further, the deoxyribonucleic acid is single-stranded DNA or double-stranded DNA.

[0014] Preferably, the DNA sequence of the deoxyribonucleic acid is as shown in SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3.

[0015] More preferably, the deoxyribonucleic acid is 18-base DNA, and the sequence of the DNA is as shown in SEQ ID NO. 1.

[0016] Further, the ribonucleic acid is selected from microRNA or small interfering RNA.

[0017] Further, the polypeptide drug is mitochondrial apoptosis peptide KLAK.

[0018] Further, the mass ratio of the metal, the nucleic acid and the polypeptide in the targeted delivery nanoparticle is 10-400:0.5-10:1.

[0019] Further, the mass ratio of the metal, the nucleic acid and the polypeptide in the targeted delivery nanoparticle is selected from 10-320:0.5-8:1; preferably 160:4:1; preferably 80:4:1; preferably 80:2:1; preferably 40:1:1; preferably 20:0.5:1.

[0020] Further, the particle size of the metal-coordinated nucleic acid polypeptide targeted delivery nanoparticle is selected from 10-2000 nm, preferably from 20-1000 nm; preferably from 50-500 nm; preferably from 50-200 nm; preferably from 50-150 nm; preferably from 100-160 nm, etc.

[0021] Further, the targeting agent is folate-polyethylene glycol-amino (FA-PEG-NH2).

[0022] Further, the metal-coordinated nucleic acid polypeptide targeted nanoparticle targets the drug delivery to tumor cells.

[0023] Further, the tumor cells include but are not limited to breast cancer cells, ovarian cancer cells, lung cancer cells and lymphoma cells.

[0024] In a second aspect, the present application provides a preparation method of the stable metal-coordinated nucleic acid polypeptide targeted nanoparticle according to the first aspect of the present application, which comprises the following steps: S1, mixing a metal solution, a nucleic acid solution and a polypeptide drug solution to obtain a mixed solution of the three; S2, vortexing, heating, centrifuging and water washing the mixed solution, and resuspending to obtain the metal-coordinated nucleic acid polypeptide nanoparticle; S3, mixing the metal-coordinated nucleic acid polypeptide nanoparticle and a FA-PEG-NH2 solution to obtain a mixed solution of the two; S4, vortexing and stirring the mixed solution, then centrifuging and water washing and resuspending to obtain the metal-coordinated nucleic acid polypeptide targeted nanoparticle.

[0025] Further, in step S1, the concentration of the nucleic acid is preferably selected from 5-100 μM; preferably from 5-50 μM; preferably from 12.5 μM.

[0026] Further, in step S1, the nucleic acid is selected from the group consisting of antisense nucleic acid G3139 or immunostimulatory nucleic acid CpG.

[0027] Further, in step S1, the nucleic acid is selected from the group consisting of deoxyribonucleic acid or ribonucleic acid.

[0028] Further, the deoxyribonucleic acid is single-stranded DNA or double-stranded DNA.

[0029] Preferably, the DNA sequence of the deoxyribonucleic acid is shown in SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3.

[0030] More preferably, the deoxyribonucleic acid is 18-base DNA, and the sequence of the DNA is shown in SEQ ID NO. 1.

[0031] Further, the ribonucleic acid is selected from the group consisting of microRNA or small interfering RNA.

[0032] Further, in step S1, the concentration of the polypeptide drug is preferably selected from the group consisting of 10-50 μΜ; preferably 15-30 μΜ; preferably 25 μΜ.

[0033] Further, the polypeptide drug is mitochondrial apoptosis peptide KLAK.

[0034] Further, in step S1, the metal solution in the mixed solution is selected from the group consisting of copper chloride solution, and the concentration of the copper chloride solution is preferably selected from the group consisting of 0.2-2 mM; preferably 0.2-1.5 mM; preferably 0.2-1 mM; preferably 0.4-0.5 mM; preferably 0.5 mM.

[0035] Further, in step S2, the temperature of the heating is selected from the group consisting of 60-95 degrees Celsius, preferably 75 degrees Celsius.

[0036] Further, in step S2, the time of the heating is selected from the group consisting of 0.5-4 hours, preferably 2 hours.

[0037] Further, in step S2, the speed of the centrifugation is selected from the group consisting of 4000-10000 rpm, preferably 8000 rpm.

[0038] Further, in step S4, the time of the vortexing is selected from the group consisting of 15-120 seconds, preferably 60 seconds.

[0039] Further, the metal, nucleic acid and polypeptide drug in the metal-coordinated nucleic acid polypeptide targeted nanoparticle have a molar ratio of 10-320:0.5-8:1; preferably 160:4:1; preferably 80:4:1; preferably 80:2:1; preferably 40:1:1; preferably 20:0.5:1.

[0040] Further, the nanoparticle has a spherical shape.

[0041] In a third aspect, the present application provides a preparation containing the metal-coordinated nucleic acid polypeptide targeted nanoparticle, wherein the metal-coordinated nucleic acid polypeptide targeted nanoparticle is as described in the first aspect of the present application; and the preparation further contains a pharmaceutically acceptable adjuvant.

[0042] Further, the nanoparticle has a spherical shape.

[0043] Further, the nanoparticle is formed by coordination among the metal, nucleic acid molecule and polypeptide drug, and a targeting agent is modified on the surface of the nanoparticle by coordination and electrostatic interaction.

[0044] Further, the targeting agent is folate-polyethylene glycol-amino (FA-PEG-NH2).

[0045] Further, the metal is selected from copper chloride and / or ferrous chloride.

[0046] Further, the nucleic acid is selected from antisense nucleic acid G3139 or immunonucleic acid CpG.

[0047] Further, the nucleic acid is selected from deoxyribonucleic acid or ribonucleic acid.

[0048] Further, the deoxyribonucleic acid is single-stranded DNA or double-stranded DNA.

[0049] Preferably, the DNA sequence of the deoxyribonucleic acid is as shown in SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3.

[0050] More preferably, the deoxyribonucleic acid is 18-base DNA, and the sequence of the DNA is as shown in SEQ ID NO. 1.

[0051] Further, the ribonucleic acid is selected from microRNA or small interfering RNA.

[0052] Further, the polypeptide drug is mitochondrial apoptosis peptide KLAK.

[0053] Further, the metal, nucleic acid and polypeptide in the targeted delivery nanoparticle have a molar ratio of 10-400:0.5-10:1.

[0054] Preferably, the mass ratio of the metal, nucleic acid and polypeptide in the targeted delivery nanoparticle is selected from the group consisting of 10-320:0.5-8:1; preferably 160:4:1; preferably 80:4:1; preferably 80:2:1; preferably 40:1:1; preferably 20:0.5:1.

[0055] Further, the particle size of the metal-coordinated nucleic acid polypeptide targeted delivery nanoparticle is selected from the group consisting of 10-2000 nm, preferably 20-1000 nm; preferably 50-500 nm; preferably 50-200 nm; preferably 50-150 nm; preferably 100-160 nm, and the like.

[0056] Further, the metal-coordinated nucleic acid polypeptide targeted nanoparticle targets the drug delivery to tumor cells.

[0057] Still further, the tumor cells include, but are not limited to, breast cancer cells, ovarian cancer cells, lung cancer cells and lymphoma cells.

[0058] Further, the dosage form of the preparation includes, but is not limited to, injection preparation, oral preparation or implant.

[0059] In a fourth aspect, the present application provides a use of the metal-coordinated nucleic acid polypeptide targeted nanoparticle according to the first aspect of the present application in the preparation of a medicament for treating or adjuvant treating tumors.

[0060] Further, the nanoparticle is spherical in shape.

[0061] Further, the nanoparticle is formed by the coordination of the metal, nucleic acid molecule and polypeptide drug, and the targeting agent is modified on the surface of the nanoparticle by coordination and electrostatic interaction.

[0062] Still further, the targeting agent is folate-polyethylene glycol-amino (FA-PEG-NH2).

[0063] Still further, the metal is selected from the group consisting of copper chloride and / or ferrous chloride.

[0064] Still further, the nucleic acid is selected from the group consisting of antisense nucleic acid G3139 or immunonucleic acid CpG.

[0065] Still further, the nucleic acid is selected from the group consisting of deoxyribonucleic acid and ribonucleic acid.

[0066] Still further, the deoxyribonucleic acid is single-stranded DNA or double-stranded DNA.

[0067] Preferably, the DNA sequence of the deoxyribonucleic acid is as shown in SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3.

[0068] More preferably, the deoxyribonucleic acid is 18-base DNA, the sequence of which is shown in SEQ ID NO. 1.

[0069] Further, the ribonucleic acid is selected from microRNA or small interfering RNA.

[0070] Further, the polypeptide drug is mitochondrial apoptosis peptide KLAK.

[0071] Further, the mass ratio of the metal, nucleic acid and polypeptide in the targeted delivery nanoparticle is 10-400: 0.5-10: 1.

[0072] Preferably, the mass ratio of the metal, nucleic acid and polypeptide in the targeted delivery nanoparticle is selected from 10-320: 0.5-8: 1; preferably 160: 4: 1; preferably 80: 4: 1; preferably 80: 2: 1; preferably 40: 1: 1; preferably 20: 0.5: 1.

[0073] Further, the particle size of the metal-coordinated nucleic acid polypeptide targeted delivery nanoparticle is selected from 10-2000 nm, preferably from 20-1000 nm; preferably from 50-500 nm; preferably from 50-200 nm; preferably from 50-150 nm; preferably from 100-160 nm, etc.

[0074] Further, the metal-coordinated nucleic acid polypeptide targeted nanoparticle targets the drug delivery to tumor cells.

[0075] Further, the tumor cells include but are not limited to breast cancer cells, ovarian cancer cells, lung cancer cells and lymphoma cells.

[0076] Beneficial effects (1) The metal-coordinated nucleic acid polypeptide targeted nanoparticle prepared by the present application is formed by mutual coordination among metal, nucleic acid and polypeptide, thereby the stability of the nanoparticle in cells is significantly improved, that is, the metal ion is connected with the nucleic acid through coordination of the metal ion with carboxyl, hydroxyl, amino and phosphate groups on the nucleic acid, the metal ion is connected with the polypeptide through coordination of the metal ion with amino and carboxyl groups on the polypeptide, and the nucleic acid is connected with the polypeptide through non-covalent interaction such as π-π stacking; after the metal ion is connected with the nucleic acid and the polypeptide, due to the effect of steric hindrance, part of the sites are still exposed, the addition of the targeting agent FA-PEG-NH2 can make up for these sites, further encapsulate the nucleic acid, the polypeptide and the metal ion, make the structure more compact, and make it have better biological stability.

[0077] (2) The metal coordination nucleic acid polypeptide targeted nanoparticles prepared by the application have stability, can target into cells to play a role, and can make metal ions, nucleic acids and polypeptide drugs play a synergistic therapeutic effect, and can realize real-time monitoring of the nanoparticles.

[0078] (3) The metal coordination nucleic acid polypeptide targeted nanoparticles prepared by the application have a suitable particle size by adjusting the concentration and ratio of nucleic acids and polypeptide drugs, can recognize tumor tissues and stay at tumor sites under the high permeability and retention effect of tumor blood vessels, and can be degraded by the micro-acid and glutathione overexpression environment of the tumor sites, so as to release metal ions, nucleic acids and polypeptide drugs with specific functions, and further play a role in killing tumor cells.

[0079] (4) The method for preparing the metal coordination nucleic acid polypeptide targeted nanoparticles is simple and easy to operate, and the metal coordination nucleic acid polypeptide targeted nanoparticles can be obtained by only mixing, stirring and heating, so that the method is suitable for large-scale production. BRIEF DESCRIPTION OF DRAWINGS

[0080] Fig. 1 is a transmission electron microscope image of the metal coordination nucleic acid polypeptide nanoparticles prepared in Examples 1-8.

[0081] Note: 1A is a transmission electron microscope image of the nanoparticles of Example 1; 1B is a transmission electron microscope image of the nanoparticles of Example 2; 1C is a transmission electron microscope image of the nanoparticles of Example 3; 1D is a transmission electron microscope image of the nanoparticles of Example 4; 1E is a transmission electron microscope image of the nanoparticles of Example 5; 1F is a transmission electron microscope image of the nanoparticles of Example 6; 1G is a transmission electron microscope image of the nanoparticles of Example 7; and 1H is a transmission electron microscope image of the nanoparticles of Example 8.

[0082] Fig. 2 is a loading efficiency diagram of the nucleic acids and polypeptides loaded in the metal coordination nucleic acid polypeptide nanoparticles prepared in Examples 2 and 3. Note: 2A is a loading efficiency diagram of the nucleic acids loaded in the nanoparticles; and 2B is a loading efficiency diagram of the polypeptides loaded in the nanoparticles.

[0083] Figure 3 Fig. 3 is the stability of the metal coordination nucleic acid polypeptide nanoparticles in water after being dispersed for different time.

[0084] Figure 4 Fig. 4 is an element distribution test diagram of the nanoparticles in Example 1.

[0085] Fig. 5 is a schematic diagram of the selected area of the metal coordination nucleic acid polypeptide nanoparticles in Example 1 for line scanning.

[0086] Note: 5A is a line scanning diagram of the nanoparticles; and 5B is an element linear scanning diagram of the nanoparticles.

[0087] Figure 6UV spectrum of nanoparticles in Example 2.

[0088] Figure 7 Zeta potential of nanoparticles in Example 1 and 7.

[0089] Figure 8 is a cell uptake diagram of nanoparticles in Example 2 and Example 8 (Hoechst: nuclear staining; Cy5: nucleic acid; RodB: polypeptide; Merge: overlay).

[0090] Note: 8A is a cell uptake diagram of nanoparticles in Example 2; 8B is a cell uptake diagram of nanoparticles in Example 8.

[0091] Figure 9 is a cell flow uptake diagram of nanoparticles in Example 2 and Example 8.

[0092] Note: 9A is a nucleic acid uptake diagram of nanoparticles in Example 2 and Example 8; 9B is a polypeptide uptake diagram of nanoparticles in Example 2 and Example 8.

[0093] Figure 10 Figure 10 is a cytotoxicity diagram of nanoparticles in Example 7.

[0094] Figure 11 Figure 11 is a morphology diagram of Gd-nucleic acid-polypeptide nanoparticles prepared in Example 15.

[0095] Figure 12 Figure 12 is a morphology diagram of Fe-polypeptide nanoparticles prepared in Example 16.

[0096] Figure 13 Figure 13 is a morphology diagram of Cu-polypeptide nanoparticles prepared in Example 17.

[0097] Figure 14 Figure 14 is a morphology diagram of Cu-nucleic acid-polypeptide nanoparticles prepared in Example 18. DETAILED DESCRIPTION

[0098] The specific embodiments of the present application will be further described with the following examples. It is to be understood that the description of these embodiments is intended to serve as illustrative examples only and is not intended to limit the present application in any way. Furthermore, the technical features involved in the following described embodiments can be combined with each other as long as there is no conflict.

[0099] The experimental methods in the following examples are all conventional methods unless otherwise specified. The experimental materials used in the following examples are all commercially available unless otherwise specified.

[0100] Terminology MCF-7 cells: MCF7 cells were established from pleural effusion of metastatic breast cancer patients, with molecular characteristics of estrogen receptor (ER) positive and progesterone receptor (PR) positive. It is often used as a model of ER-positive breast cancer cells.

[0101] FA-PEG-NH2: or NH2-PEG-FA, is a folic acid (FA) functionalized polyethylene glycol (PEG) derivative modified with an amino group (NH2), with a molecular weight of about 2000. The structure of NH2-PEG-FA is mainly composed of three parts: PEG chain, amino group (NH2) and folic acid (FA) molecule. The PEG chain provides good water solubility, low immunogenicity and longer in vivo half-life, which makes the molecule stable in vivo, reduces non-specific adsorption, and increases the bioavailability of drugs. The amino group can be coupled with other molecules to further enhance its functionalization potential. This compound combines the targeting of folic acid and the biocompatibility of PE, and is widely used in targeted drug delivery, gene therapy and molecular detection.

[0102] Example 1 Preparation of metal-coordinated nucleic acid polypeptide nanoparticle 1 15 μL of 20 mM CuCl2·2H2O solution was quickly added to a total volume of 600 μL aqueous solution containing 12.5 μM nucleic acid and 25 μM polypeptide KLAK, wherein the nucleic acid was an 18-base deoxyribonucleotide sequence (TCT CCC AGC GTG CGC CAT ); the mixture was vortexed for 20 s, then heated in a metal bath at 90℃ for 2 h; centrifuged at 8000 rpm for 10 min, and resuspended with water, this step was repeated twice to obtain the metal-coordinated nucleic acid polypeptide nanoparticle 1. The nucleic acid used in the present application can be synthesized by biological methods, or can be purchased, and its sequence can be replaced by other functional nucleic acid sequences.

[0103] Example 2 Preparation of metal-coordinated nucleic acid polypeptide nanoparticle 2 15 μL of 20 mM CuCl2·2H2O solution was quickly added to a total volume of 600 μL aqueous solution containing 12.5 μM nucleic acid and 25 μM polypeptide KLAK, wherein the nucleic acid was an 18-base deoxyribonucleotide sequence (TCT CCC AGC GTG CGC CAT ); the mixture was vortexed for 20 s, then heated in a metal bath at 75℃ for 2 h; centrifuged at 8000 rpm for 10 min, and resuspended with water, this step was repeated twice to obtain the metal-coordinated nucleic acid polypeptide nanoparticle 2.

[0104] The nucleic acid used in the present application can be synthesized by biological method, or commercially available, and its sequence can be replaced by other functional nucleic acid sequence.

[0105] Example 3 Preparation of metal-coordinated nucleic acid polypeptide nanoparticle 3 15 μL of 20 mM CuCl2·2H2O solution was quickly added to a total volume of 600 μL aqueous solution containing 25 μM Cy5 fluorescently labeled nucleic acid and 50 μM RodB fluorescently labeled polypeptide KLAK, wherein the nucleic acid was a 20 base deoxyribonucleotide sequence (ATCGTCGATGCTAATCCTGA); the mixture was vortexed for 30 s, and then heated in a metal bath at 90°C for 1.5 h; centrifuged at 7000 rpm for 20 min, and resuspended with water, and this step was repeated twice to obtain the metal-coordinated nucleic acid polypeptide nanoparticle 3.

[0106] The nucleic acid used in the present application can be synthesized by biological method, or commercially available, and its sequence can be replaced by other functional nucleic acid sequence.

[0107] Example 4 Preparation of metal-coordinated nucleic acid polypeptide nanoparticle 4 15 μL of 20 mM CuCl2·2H2O solution was quickly added to a total volume of 600 μL aqueous solution containing 12.5 μM Cy5 fluorescently labeled nucleic acid and 12.5 μM RodB fluorescently labeled polypeptide KLAK, wherein the nucleic acid was a 20 base deoxyribonucleotide sequence (TCCATGACGTTCCTGACGTT); the mixture was vortexed for 15 s, and then heated in a metal bath at 85°C for 2 h; centrifuged at 6000 rpm for 30 min, and resuspended with water, and this step was repeated twice to obtain the metal-coordinated nucleic acid polypeptide nanoparticle 4.

[0108] The nucleic acid used in the present application can be synthesized by biological method, or commercially available, and its sequence can be replaced by other functional nucleic acid sequence.

[0109] Example 5 Preparation of metal-coordinated nucleic acid polypeptide nanoparticle 5 30 μL of 20 mM CuCl2·2H2O solution was quickly added to a total volume of 600 μL aqueous solution containing 12.5 μM Cy5 fluorescently labeled nucleic acid and 50 μM RodB fluorescently labeled polypeptide KLAK, wherein the nucleic acid was a 20 base deoxyribonucleotide sequence (TCCATGACGTTCCTGACGTT); the mixture was vortexed for 15 s and then heated in a metal bath at 85 °C for 3 h; centrifuged at 7000 rpm for 30 min and resuspended in water, this step was repeated twice to obtain the metal-coordinated nucleic acid polypeptide nanoparticle 5.

[0110] The nucleic acid used in the present application can be synthesized by biological methods, or can be commercially available, and its sequence can be replaced by other functional nucleic acid sequences.

[0111] Example 6 Preparation of metal-coordinated nucleic acid polypeptide nanoparticle 6 30 μL of 20 mM FeCl2·4H2O solution was quickly added to a total volume of 600 μL aqueous solution containing 12.5 μM Cy5 fluorescently labeled nucleic acid and 25 μM RodB fluorescently labeled polypeptide KLAK, wherein the nucleic acid was a 20 base deoxyribonucleotide sequence (TCCATGACGTTCCTGACGTT); the mixture was vortexed for 45 s and then heated in a metal bath at 80 °C for 1 h; centrifuged at 9000 rpm for 15 min and resuspended in water, this step was repeated twice to obtain the metal-coordinated nucleic acid polypeptide nanoparticle 6.

[0112] The nucleic acid used in the present application can be synthesized by biological methods, or can be commercially available, and its sequence can be replaced by other functional nucleic acid sequences.

[0113] Example 7 Preparation of metal-coordinated nucleic acid polypeptide targeting nanoparticle 1-1 The product prepared in Example 1 above was mixed with 20 μL of 100 μM FA-PEG-NH2 in dimethyl sulfoxide, and after stirring for 48 h, centrifuged at 8000 rpm for 10 min and resuspended in water, this step was repeated twice to obtain the metal-coordinated nucleic acid polypeptide targeting nanoparticle.

[0114] Example 8 Preparation of metal-coordinated nucleic acid polypeptide targeting nanoparticle 2-1 The metal-coordinated nucleic acid polypeptide nanoparticle 2 prepared in Example 2 above was mixed with 40 μL of 100 μM FA-PEG-NH2 in dimethyl sulfoxide, and after stirring for 48 h, centrifuged at 9000 rpm for 15 min and resuspended in water, this step was repeated twice to obtain the metal-coordinated nucleic acid polypeptide targeting nanoparticle.

[0115] Example 9 Morphology and particle size test and its stability The products prepared in the above Examples 1-8 were subjected to morphology and particle size test.

[0116] Test method The prepared product was ultrasonically dispersed with deionized water, the dispersion was dropped on a copper mesh, and after natural drying, the sample was observed by transmission electron microscope, and then the average particle size of any 100 particles in the electron microscope image was calculated by using ImageJ software as the average particle size of the sample.

[0117] The loading efficiency of nucleic acids and polypeptides was determined by fluorescence measurement. All supernatants were collected during the reaction and washing to calculate the amount of encapsulated nucleic acids and polypeptides in the nanoparticles. The nucleic acid concentration was determined by fluorescence spectroscopy at 670 nm (ex 640 nm). The polypeptide concentration was determined by fluorescence spectroscopy at 625 nm (ex 540 nm). Then, the nucleic acid and polypeptide loading efficiency was calculated using the following formula: loading efficiency = (m a -m y ) / m a x 100%, where m y is the nucleic acid or polypeptide not encapsulated in the nanoparticles, m a is the total amount of nucleic acid or polypeptide initially added during synthesis.

[0118] Test results The nucleic acid and polypeptide loading efficiency of Examples 2 and 3 labeled with fluorescent dyes was determined.

[0119] The results are shown in Figure 1 and Table 1. Figure 1A 、 Figure 1B 、 Figure 1C 、 Figure 1D 、 Figure 1E 、 Figure 1F 、 Figure 1G and Figure 1H are the electron micrographs of Example 1, Example 2, Example 3, Example 4, Example 5, Example 6, Example 7 and Example 8, respectively, and Figures 1A-1F and Table 1, the products prepared in Examples 1-6 are nanoparticles with spherical structure and particle size distribution. As can be seen from Figures 1G-1H , the products prepared in Examples 7-8 are metal-coordinated nucleic acid polypeptide targeting nanoparticles 1-1 and 2-1 with core-shell structure and particle size distribution.

[0120] Figure 2A The nucleic acid drug loading efficiency of the metal-coordinated nucleic acid polypeptide nanoparticles prepared in Examples 2 and 3 is 94.33% and 86.86%, respectively, Figure 2BThe drug loading efficiencies of the metal-coordinated nucleic acid peptide nanoparticles prepared in Examples 2 and 3 are shown to be 85.51% and 76.12%, respectively.

[0121] Literature review indicates that nanoparticles with a diameter of 100-200 nm are more conducive to cellular uptake, and Cu 2+ Fe 2+ It has a stronger Fenton-like reaction and can kill tumor cells more efficiently. Therefore, the metal-coordinated nucleic acid peptide nanoparticle 1 prepared in Example 1 and the metal-coordinated nucleic acid peptide nanoparticle 2 prepared in Example 2 are consistent. Subsequently, the metal-coordinated nucleic acid peptide nanoparticles prepared in Example 1 and Example 2 will be selected to verify the therapeutic effect.

[0122] Table 1. Particle size distribution of metal-coordinated nucleic acid peptide nanoparticles Product Particle size Example 1 152 nm Example 2 158 nm Example 3 198 nm Example 4 423 nm Example 5 544 nm Example 6 1068 nm To evaluate the stability of the metal-coordinated nucleic acid peptide nanoparticles, the metal-coordinated nucleic acid peptide nanoparticles 1 prepared in Example 1 were placed in water, and samples were dropped onto a copper grid at different time points. Transmission electron microscopy (TEM) images were then taken, and the results are shown below. Figure 3 As shown, the results indicate that the metal-coordinated nucleic acid polypeptide nanoparticles 1 prepared in Example 1 have good stability.

[0123] Example 9 Element Distribution Test The elemental distribution of the metal-coordinated nucleic acid polypeptide nanoparticles 1 prepared in Example 1 above was tested.

[0124] Test methods Disperse the sample with deionized water and drop the dispersion onto a copper grid. After the droplets dried naturally, the elemental distribution and linear scans were analyzed using a high-angle annular dark-field scanning transmission electron microscope-energy dispersive X-ray spectrometer.

[0125] Test results Depend on Figure 4 , 5A As can be seen from 5B, the elements Cu, P, and N are evenly distributed throughout the nanoparticles, indicating that Cu is well integrated with DNA and polypeptides.

[0126] Example 10: Ultraviolet Performance Test A. Test methods To detect the binding effect of different components, dye-labeled nanoparticles were selected for ultraviolet testing. The ultraviolet performance of the metal-coordinated nucleic acid peptide nanoparticles 2 prepared in Example 2 above was tested.

[0127] The samples were prepared into dispersions of the same concentration, placed in cuvettes, and their ultraviolet absorption was measured in the spectral range of 400-1000 nm using an ultraviolet spectrophotometer.

[0128] B. Test results From Figure 6 It can be seen that the metal-coordinated nucleic acid polypeptide nanoparticles 2 prepared in Example 2 have ultraviolet absorption peaks near 568, 607, and 654 nm, and compared with Cy5 alone, the Cy5-labeled nucleic acid has a red shift of about 7 nm in the ultraviolet spectrum, which is related to the coordination of metal ions with the DNA on the surface of the nucleic acid. Compared with RodB alone, the RodB-labeled polypeptide has a red shift of about 7 nm in the ultraviolet spectrum, which is related to the coordination of metal ions with the polypeptide. It is shown that the metal nucleic acid polypeptide nanoparticles are indeed combined by coordination.

[0129] Example 11 Potential test Test method In order to detect the potential change of the nanoparticles before and after modification of the targeting group to determine whether the targeting group is successfully modified, the metal-coordinated nucleic acid polypeptide nanoparticles 1 prepared in Example 1 and the metal-coordinated nucleic acid polypeptide targeting nanoparticles 1-1 prepared in Example 7 are subjected to potential test.

[0130] The sample is dispersed and diluted with deionized water and placed in a potential measuring dish, and a nanolaser particle size instrument is used for testing.

[0131] Test results From Figure 7 It can be seen that the potential of the metal-coordinated nucleic acid polypeptide nanoparticles is -11.35 mV, indicating that Cu is combined with nucleic acid and polypeptide, making it uniformly dispersed in aqueous solution. After modification of the targeting reagent FA-PEG-NH2, the potential is -17.82 mV, indicating that folate is successfully modified on the surface of the metal-coordinated nucleic acid polypeptide nanoparticles.

[0132] Example 12 Cell uptake test Laser confocal detection of cell uptake effect requires the use of dye-labeled nanoparticles, and the products prepared in Example 2 (metal-coordinated nucleic acid polypeptide nanoparticles 2) and Example 8 (metal-coordinated nucleic acid polypeptide targeting nanoparticles 2-1) are subjected to cell uptake test.

[0133] Test method MCF-7 cells are cultured in Dulbecco's modified Eagle's medium (DMEM) at a density of 4×10 5 Cells are cultured in a culture dish at a density of 4×10 -3 M L- glutamine and 10% FBS and 100 μg / mL streptomycin.

[0134] After 24 hours of incubation, the culture medium was washed and fresh cell culture medium containing the product of Example 2 or 8 was added. After another 2 hours of incubation, the treated cells were rinsed with preheated PBS solution (3 × 2 mL) to remove free nanoparticles, and then fresh culture medium was added to the culture dish. Cell nuclei were stained with DAPI, and cell uptake imaging was performed using a laser confocal fluorescence imaging system.

[0135] Test results Depend on Figure 8A It can be seen that the metal-coordinated nucleic acid peptide nanoparticles 2 prepared in Example 2 showed strong fluorescence intensity, indicating that the metal-coordinated nucleic acid peptide nanoparticles 2 prepared in Example 2 entered the cells.

[0136] Depend on Figure 8B It can be seen that the metal-coordinated nucleic acid peptide targeted nanoparticles 2-1 prepared in Example 8 showed stronger fluorescence intensity, indicating that more of the metal-coordinated nucleic acid peptide nanoparticles 2-1 prepared in Example 8 entered the cells compared with the metal-coordinated nucleic acid peptide nanoparticles 2 prepared in Example 2, proving that targeted modification is beneficial to improving the cellular uptake effect of nanoparticles.

[0137] Example 13 Cell Uptake Flow Cytometry Test Flow cytometry analysis of cellular uptake requires the use of dye-labeled nanoparticles. The products prepared in Example 2 (metal-coordinated nucleic acid peptide nanoparticles 2) and Example 8 (metal-coordinated nucleic acid peptide targeted nanoparticles 2-1) were subjected to flow cytometry analysis.

[0138] Test methods MCF-7 cells were cultured in Dulbecco modified Eagle medium (DMEM) at a rate of 4 × 10⁻⁶. 5 Cells were cultured at the specified density in culture dishes in a CO2 incubator at 37°C. The culture medium was supplemented with 100 units / ml aqueous penicillin G, 4.5 mg / mL glucose, and 4 × 10⁴ mg / mL HCl. -3 M L-glutamine and 10% FBS and 100 μg / mL streptomycin.

[0139] After 24 hours of incubation, the culture medium was washed and fresh cell culture medium containing the product of Example 2 was added. After another 4 hours of incubation, the treated cells were rinsed with preheated PBS solution (3 × 2 mL) to remove free nanoparticles, and then fresh culture medium was added to culture dishes. Cell flow cytometry was performed using a flow cytometer.

[0140] After 24 hours incubation, the culture medium was washed and fresh cell culture medium containing the product of Example 8 was added. After another 4 hours incubation, the treated cells were rinsed with pre-warmed PBS solution (3 x 2 mL) to remove free nanoparticles, and fresh culture medium was added to the culture dish. Cell flow test was performed using a flow cytometer.

[0141] Test results From Figure 9A and 9B it can be seen that more metal-coordinated nucleic acid polypeptide targeted nanoparticles 2-1 prepared in Example 8 entered the cells than metal-coordinated nucleic acid polypeptide nanoparticles 2 prepared in Example 2, which quantitatively indicates that the targeted modification is conducive to improving the cell uptake effect of the nanoparticles.

[0142] Example 14 Tumor cell killing effect test To detect the tumor cell killing effect of the metal-coordinated nucleic acid polypeptide targeted nanoparticles 1-1 prepared in Example 7, a cytotoxicity test was performed using nanoparticles without dye labeling.

[0143] Test method MCF-7 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) at a density of 4 x 10 5 Cells were cultured in a culture dish at a density of 4 x 10 -3 cells / well, and were cultured in a CO2 incubator at 37°C, supplemented with 100 units / ml aqueous penicillin G, 4.5 mg / mL glucose, 4 x 10

[0144] After 24 hours incubation, the culture medium was washed and fresh cell culture medium containing the product of Example 7 was added, and free nucleic acids and polypeptides were used as a control. After another 4 hours incubation, the treated cells were rinsed with pre-warmed PBS solution (3 x 2 mL) to remove free nanoparticles, and fresh culture medium was added to the culture dish. An appropriate amount of cells was treated and added to a culture solution containing MTT, and an enzyme marker was used to perform an MTT test.

[0145] Test results From Figure 10 it can be seen that the cell survival rate of the metal-coordinated nucleic acid polypeptide targeted nanoparticles 1-1 prepared in Example 7 was low, indicating that the nanoparticles had a strong killing effect on tumor cells.

[0146] Example 15 Preparation of Gd-nucleic acid-polypeptide and morphology test Test method Preparation 15 μL of 20 mM GdCl3-6H2O solution was quickly added to a 600 μL aqueous solution containing 12.5 μM nucleic acid and 25 μM polypeptide KLAK, wherein the nucleic acid was an 18-base deoxyribonucleotide sequence (TCT CCC AGC GTG CGC CAT); the mixture was vortexed for 20 s, and then heated in a metal bath at 90°C for 2 h; centrifuged at 8000 rpm for 10 min, and resuspended with water, and this step was repeated twice to obtain the metal-coordinated nucleic acid polypeptide nanoparticles.

[0147] Morphology test The prepared product was subjected to morphology test, the prepared product was ultrasonically dispersed with deionized water, the dispersion liquid was dropped on a copper mesh, and the sample was subjected to morphology observation by transmission electron microscope after natural drying.

[0148] Test results Figure 11 It can be seen that the Gd-nucleic acid-polypeptide nanoparticles prepared by Example 15 are not regular spherical particles, but irregular particles.

[0149] Example 16 Preparation and morphology test of Fe-polypeptide nanoparticles Test method Preparation 15 μL of 20 mM FeCl2-2H2O solution was quickly added to a 600 μL aqueous solution containing 25 μM polypeptide KLAK; the mixture was vortexed for 20 s, and then heated in a metal bath at 90°C for 2 h; centrifuged at 8000 rpm for 10 min, and resuspended with water, and this step was repeated twice to obtain the Fe-polypeptide nanoparticles.

[0150] Morphology test The prepared product was subjected to morphology test, the prepared product was ultrasonically dispersed with deionized water, the dispersion liquid was dropped on a copper mesh, and the sample was subjected to morphology observation by transmission electron microscope after natural drying.

[0151] Test results Figure 12 It can be seen that the Fe-polypeptide prepared by Example 16 has almost no product.

[0152] Example 17 Preparation and morphology test of Cu-polypeptide nanoparticles A. Test method Preparation 15 μL of 20 mM CuCl2»2H2O solution was quickly added to a 600 μL aqueous solution containing 25 μM polypeptide KLAK; the mixture was vortexed for 20 s, and then heated in a metal bath at 90°C for 2 h; centrifuged at 8000 rpm for 10 min, and resuspended with water, which was repeated twice to obtain the Cu-polypeptide nanoparticles.

[0153] Morphology test The prepared product was subjected to a morphology test, and the prepared product was ultrasonically dispersed with deionized water, and the dispersion liquid was dropped on a copper mesh, and then the sample was observed for morphology using a transmission electron microscope after natural drying.

[0154] B. Test results Figure 13 It can be seen that the Cu-polypeptide prepared by Example 17 has almost no product.

[0155] Example 18 Preparation of Cu-nucleic acid-polypeptide nanoparticles A. Test method Preparation 15 μL of 20 mM CuCl2»2H2O solution was quickly added to a 600 μL aqueous solution containing 18 μM nucleic acid and 25 μM polypeptide KLAK, wherein the nucleic acid was a 18-base deoxyribonucleotide sequence (TCT CCC AGC GTGCGC CAT); the mixture was vortexed for 20 s, and then heated in a metal bath at 90°C for 2 h; centrifuged at 8000 rpm for 10 min, and resuspended with water, which was repeated twice to obtain the metal-coordinated nucleic acid polypeptide nanoparticles.

[0156] Morphology test The prepared product was subjected to a morphology test, and the prepared product was ultrasonically dispersed with deionized water, and the dispersion liquid was dropped on a copper mesh, and then the sample was observed for morphology using a transmission electron microscope after natural drying.

[0157] B. Test results Figure 14 It can be seen that the Cu-nucleic acid-polypeptide nanoparticles prepared by Example 18 are not regular spherical, but irregular particles.

Claims

1. A stable metal-coordinated nucleic acid peptide-targeting nanoparticle, wherein the nanoparticle is a spherical nanoparticle formed by the mutual coordination of a metal, a nucleic acid molecule, and a peptide drug, and the surface of the nanoparticle is modified with a targeting reagent folic acid-polyethylene glycol-amino (FA-PEG-NH2) through coordination and electrostatic interactions; wherein the metal is selected from copper chloride and / or ferrous chloride; and the peptide drug is the mitochondrial apoptosis peptide KLAK.

2. The metal-coordinated nucleic acid peptide-targeting nanoparticles as described in claim 1, wherein the nucleic acid is selected from antisense nucleic acid G3139 or immune nucleic acid CpG; the nucleic acid is selected from deoxyribonucleic acid or ribonucleic acid; the deoxyribonucleic acid is single-stranded DNA or double-stranded DNA; the DNA sequence of the deoxyribonucleic acid is as shown in SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3; the ribonucleic acid is selected from microRNA or small interfering RNA; the molar ratio of metal, nucleic acid and peptide in the metal-coordinated nucleic acid peptide-targeting nanoparticles is 10-400: 0.5-10:1; the particle size of the metal-coordinated nucleic acid peptide-targeting nanoparticles is selected from 20-1000 nm; and the metal-coordinated nucleic acid peptide-targeting nanoparticles deliver drugs to tumor cells.

3. The nanoparticles according to claim 2, wherein the deoxyribonucleic acid is an 18-base DNA sequence as shown in SEQ ID NO. 1; the particle size of the metal-coordinated nucleic acid polypeptide-targeted nanoparticles is selected from 50-200 nm; the molar ratio of metal, nucleic acid and polypeptide in the metal-coordinated nucleic acid polypeptide-targeted nanoparticles is 20:0.5-1; and the tumor cells include, but are not limited to, breast cancer cells, ovarian cancer cells, lung cancer cells and lymphoma cells.

4. The method for preparing stable metal-coordinated nucleic acid peptide-targeting nanoparticles as described in claim 1, wherein the method comprises the following steps; S1. Mix the metal solution, nucleic acid solution, and polypeptide drug solution to obtain a mixed solution of the three. S2. The above mixed solution is vortexed, heated, centrifuged and washed with water, and resuspended to obtain the metal-coordinated nucleic acid polypeptide nanoparticles. S3. Mix the metal-coordinated nucleic acid peptide nanoparticles and the FA-PEG-NH2 solution to obtain a mixed solution of the two. S4. The above mixed solution is vortexed, stirred, centrifuged, washed and resuspended with water to obtain the metal-coordinated nucleic acid polypeptide targeted nanoparticles.

5. The preparation method according to claim 4, wherein in step S1, the concentration of the nucleic acid is 12.5 μM; the nucleic acid is selected from antisense nucleic acid G3139 or immune nucleic acid CpG; the nucleic acid is selected from deoxyribonucleic acid or ribonucleic acid; the deoxyribonucleic acid is single-stranded DNA or double-stranded DNA; the DNA sequence of the deoxyribonucleic acid is as shown in SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3; the ribonucleic acid is selected from microRNA or small interfering RNA; the polypeptide drug is the mitochondrial apoptosis peptide KLAK; the concentration of the polypeptide drug is 25 μM; the metal solution in the mixed solution is selected from copper chloride solution, and the concentration of the copper chloride solution is selected from 0.2-2 mM; in step S2, the heating temperature is selected from 60-95 degrees Celsius; the heating time is selected from 0.5-4 hours; the centrifugation speed is selected from 4000-10000 rpm; the vortexing time is selected from 15- 120 seconds; the molar ratio of metal, nucleic acid and peptide drug in the metal-coordinated nucleic acid peptide-targeting nanoparticles is selected from 10-400: 0.5-10:1; the particle size of the stable metal-coordinated nucleic acid peptide-targeting nanoparticles is selected from 20-1000 nm.

6. The preparation method according to claim 5, wherein in step S1, the deoxyribonucleic acid is an 18-base DNA sequence, the DNA sequence being as shown in SEQ ID NO. 1; the metal solution in the mixed solution is selected from copper chloride solution, the concentration of the copper chloride solution being preferably 0.5 mM; in step S2, the heating temperature is 75 degrees Celsius; the heating time is 2 hours; the centrifugation speed is 8000 rpm; the vortexing time is 60 seconds; the molar ratio of metal, nucleic acid, and polypeptide drug in the metal-coordinated nucleic acid polypeptide targeting nanoparticles is 20:0.5:1; and the particle size of the stable metal-coordinated nucleic acid polypeptide targeting nanoparticles is selected from 50-200 nm.

7. A formulation containing metal-coordinated nucleic acid peptide-targeting nanoparticles, wherein the metal-coordinated nucleic acid peptide-targeting nanoparticles are as described in claim 1 of the present invention; the formulation further contains pharmaceutically acceptable excipients.

8. The formulation of claim 7, wherein the nanoparticles are spherical nanoparticles formed by the coordination of a metal, a nucleic acid molecule, and a polypeptide drug, and the surface of the nanoparticles is modified with a targeting reagent, folic acid-polyethylene glycol-amino (FA-PEG-NH2), through coordination and electrostatic interactions; the metal is selected from copper chloride and / or ferrous chloride; the deoxyribonucleic acid is an 18-base DNA sequence as shown in SEQ ID NO. 1; the polypeptide drug is the mitochondrial apoptosis peptide KLAK; the particle size of the metal-coordinated nucleic acid polypeptide targeted delivery nanoparticles is selected from 50-200 nm; the metal-coordinated nucleic acid polypeptide targeted nanoparticles target and deliver the drug to tumor cells; the tumor cells include, but are not limited to, breast cancer cells, ovarian cancer cells, lung cancer cells, and lymphoma cells.

9. The application of the metal-coordinated nucleic acid peptide-targeting nanoparticles as described in claim 1 in the preparation of drugs for the treatment or adjuvant treatment of tumor diseases; wherein the nanoparticles are spherical nanoparticles formed by the mutual coordination of metal, nucleic acid molecules and peptide drugs, and the surface of the nanoparticles is modified with the targeting reagent folic acid-polyethylene glycol-amino (FA-PEG-NH2) through coordination and electrostatic interactions; wherein the metal is selected from copper chloride and / or ferrous chloride; wherein the peptide drug is the mitochondrial apoptosis peptide KLAK; and wherein the deoxyribonucleic acid is an 18-base DNA sequence, the DNA sequence being shown in SEQ ID NO.

1.

10. The application as described in claim 9, wherein the particle size of the metal-coordinated nucleic acid peptide targeted delivery nanoparticles is selected from 50-200 nm; the metal-coordinated nucleic acid peptide targeted nanoparticles deliver the drug to tumor cells; the tumor cells include, but are not limited to, breast cancer cells, ovarian cancer cells, lung cancer cells, and lymphoma cells.

Images