LAMP (loop-mediated isothermal amplification) primer group for visually and rapidly detecting brucella as well as kit and application of LAMP primer group

Abstract

The invention relates to the field of microbiological detection, in particular to an LAMP (loop-mediated isothermal amplification) primer group for visual rapid detection of Brucella as well as a kit and application of the LAMP primer group. The LAMP primer group for visual rapid detection is designed aiming at a bcsp31 gene sequence and comprises a forward outer primer (F3), a reverse outer primer (B3), a forward inner primer (FIP-T), a reverse inner primer (BIP-T), a forward loop primer (LF) and a reverse loop primer (LB). When the kit is used, DNA of a sample to be detected is extracted, the primer group is added, a fluorescent dye or methylphenol red is added, an amplification reaction is carried out, and whether the sample to be detected contains brucella or not is judged according to a color development result. The invention provides an LAMP (loop-mediated isothermal amplification) primer group, a kit containing the primer group and application of the LAMP primer group, wherein the LAMP primer group takes a bcsp31 gene as a reference sequence, is shorter in response time, high in sensitivity, good in compatibility and suitable for visual detection of Brucella in daily frequent public health.

Description

Technical Field

[0001] This invention relates to the field of microbial detection, and more particularly to a visual rapid detection LAMP primer set for Brucella spp., its kit, and its application. Background Technology

[0002] Brucella mainly includes Brucella bovis ( B. abortus ), Brucella mesenteriae ( B. melitensis ) and swine brucellosis ( B. suis Brucella, etc., is classified as a Class II animal disease in my country, and as a notifiable infectious disease by the World Organisation for Animal Health (WOAH). Characteristic clinical symptoms of Brucella infection in animals mainly include: abortion, retained placenta, orchitis, epididymitis, and occasional arthritis. Brucella is excreted through uterine secretions and breast milk. Its transmission routes include: 1) direct contact with the skin and mucous membranes, such as during childbirth, by veterinarians, livestock feeders, herders, fur processors, slaughterhouse workers, milking workers, and direct contact with contaminated water sources, soil, pastures, and tools; 2) infection through the digestive tract, mainly through ingestion of raw milk, dairy products, or contaminated drinking water and meat containing Brucella; and 3) infection through the respiratory tract, through inhalation of droplets or dust contaminated with Brucella, such as in fur processing, livestock feeding, herding, and cleaning livestock pens. Brucella exhibits strong tolerance to environmental factors, surviving for 2 days in milk at 8°C, 3 weeks in frozen meat, 3 months in cheese, and 120 days in the secretions of infected animals, excrement, and organs of dead animals. However, it is sensitive to light, heat, acid, and common disinfectants. Therefore, multiple Brucella species can coexist in mixed pastures, slaughterhouses, and animal processing plants. Identifying different Brucella species individually requires significant time and expense, while in practice, it is often sufficient to confirm the presence of Brucella without needing to determine the specific species. Therefore, rapid and visual detection of Brucella species has important public health significance.

[0003] Currently, the detection of Brucella mainly relies on the following methods: serological detection (such as the rose bengal plate test, SAT test), which is simple to operate and low in cost, but has cross-reaction (such as similarity with Yersinia and Vibrio cholerae antigens), which may lead to false positives; bacterial culture (the gold standard), which takes 2-4 weeks and requires high-level biosafety (BSL-3) laboratory, which is difficult to carry out in remote areas; conventional PCR and fluorescent quantitative PCR (qPCR), which relies on expensive equipment and requires regular maintenance. Loop-mediated isothermal amplification (LAMP) technology was introduced in 2000 to improve the sensitivity and specificity of nucleic acid amplification. LAMP amplification replaces PCR, does not require a complex thermal cycler, and its DNA amplification efficiency exceeds exponential growth, significantly shortening the amplification time, which is generally complete within 60 min. However, on-site testing often requires faster response time; and the amount of target gene nucleic acid in the sample to be tested is usually very small, so higher sensitivity is required; at the same time, most daily tests only need to determine whether it is Brucella at the taxonomic level, without accurate determination to the species or lower strain level, so compatibility is also required. The specific target genes for diagnosing brucellosis based on nucleic acid amplification technology mainly include 16S rRNA, insertion sequence IS711, etc., but 16S rRNA gene has cross-reaction, and insertion sequence IS711 has variation or deletion in some strains, resulting in unreliable results, so diverse specific target gene sequences still need to be explored.

[0004] Although LAMP technology has shown significant performance in field screening, to ensure the specificity and efficiency of the amplification reaction, LAMP technology usually uses 4-6 primers targeting 6-8 specific regions of the target sequence, and the total concentration of primers used in LAMP reaction is generally 3.6-4.4 μmol / L. The complexity of the primer set and the high concentration of the primer set may produce unnecessary primer dimers or other mismatched hybrids, leading to non-specific amplification extension, resulting in obvious background interference signals or false positive results at the end of the amplification. The longer the reaction time, the more significant the non-specific amplification, which restricts the application of this technology; at the same time, the synthesis cost of primers in LAMP reaction system is very high, and reducing the amount of primers is also an effective way to reduce costs. Therefore, it is of great significance to develop a low-cost, low-concentration primer, short-reaction-time, high-sensitivity, good-specificity, and excellent-compatibility primer set and its kit for visual detection of Brucella. SUMMARY

[0005] To address the aforementioned problems, the purpose of this invention is to provide a low-cost, low-primer-concentration, faster-response, high-sensitivity, high-specificity, and highly compatible LAMP primer set suitable for routine and frequent public health visualization detection of Brucella, along with a kit containing this primer set and its applications, using the bcsp31 gene as a reference sequence.

[0006] To achieve the objectives of this invention, this invention provides a method for visually detecting Brucella spp. ( Brucella The LAMP primer set consists of forward outer primer F3, reverse outer primer B3, forward inner primer FIP-T, reverse inner primer BIP-T, loop primer LF, and reverse loop primer LB. The nucleotide sequence of the forward outer primer F3 is shown in SEQ ID NO.1; The nucleotide sequence of the reverse outer primer B3 is shown in SEQ ID NO.2; The nucleotide sequence of the forward inner primer FIP-T is shown in SEQ ID NO.5; The nucleotide sequence of the reverse inner primer BIP-T is shown in SEQ ID NO.6; The nucleotide sequence of the forward loop primer LF is shown in SEQ ID NO.7; The nucleotide sequence of the reverse loop primer LB is shown in SEQ ID NO.8.

[0007] This invention also provides a method for preparing a visual detection kit for Brucella spp. containing the above-mentioned LAMP primer set. Brucella Applications in products.

[0008] This invention also provides a visual method for detecting Brucella spp. ( Brucella The kit contains a primer premix containing the LAMP primer set described above.

[0009] Furthermore, in the above LAMP primer set, the volume ratio of the forward outer primer F3, the reverse outer primer B3, the forward inner primer FIP-T, the reverse inner primer BIP-T, the forward loop primer LF, and the reverse loop primer LB is 1:1:7:7:2:2; and the total concentration of the LAMP primer set in the primer premix is ​​2 μmol / L.

[0010] This invention also provides the above-described primer set or kit for the detection of Brucella spp. for non-therapeutic purposes. Brucella Applications in ).

[0011] Furthermore, the above application includes the following steps: extracting DNA from the sample to be tested, adding the above primer set, adding a colorimetric dye, performing an amplification reaction, and determining whether the sample to be tested contains Brucella based on the colorimetric results.

[0012] Furthermore, if the above colorimetric results show fluorescence or yellow, the sample is considered to contain Brucella; if there is no fluorescence or the color is pink, the sample is considered to not contain Brucella.

[0013] Furthermore, the amplification reaction conditions are as follows: 63℃ reaction time not exceeding 30 min.

[0014] Furthermore, the target gene nucleic acid in the sample to be tested in the above amplification reaction is not less than 48.7 copies / μL.

[0015] Furthermore, the aforementioned Brucella ( Brucella ) including Brucella mesenteriae ( B. melitensis ), bovine Brucella ( B. abortus ), swine brucellosis ( B. suis Brucella epididymitis of sheep ( B. ovis Brucella canis ( B. canis Brucella aureus (Virginia) B. microti ) and Salimella brucellosis ( B. neotomae Any one of them.

[0016] Through the above technical solution, the present invention can achieve at least the following beneficial effects: (1) High sensitivity and low sample requirement. Based on the LAMP amplification principle, the application of visual detection methods is increased. The bcsp31 gene sequence LAMP primer set is screened and designed to achieve the detection of Brucella spp. with a target gene nucleic acid of not less than 48.7 copies / μL in the sample within 30 minutes without relying on detection equipment. Brucella Perform rapid visual detection.

[0017] (2) High specificity, accurately distinguishing Brucella from non-Brucella; good compatibility, convenient operation, avoiding the time and expense required to separately detect and determine different Brucella species, especially convenient for routine and frequent public health early warning detection when multiple Brucella strains are present in the sample, and for Brucella mesenteriae ( B. melitensis ), bovine Brucella ( B. abortus ), swine brucellosis ( B. suis Brucella epididymitis of sheep ( B. ovis Brucella canis ( B. canis Brucella aureus (Virginia) B. microti ) and Salimella brucellosis ( B. neotomaeAll of these can be quickly and visually detected.

[0018] (3) Low cost, low primer concentration, and less non-specific amplification; The total concentration of the primer set provided by this invention is 2 μmol / L, while the total concentration of primers used in LAMP reaction is generally 3.6~4.4 μmol / L. The reduction of primer set concentration can effectively reduce non-specific amplification and reduce costs. Attached Figure Description

[0019] Figure 1 Amplification results for different primer combinations; Figure 2 Amplification curves under different temperature reaction conditions; Figure 3 The results are visualized using the fluorescent dye method; the top image shows the negative control reaction, and the bottom image shows the positive control reaction; in the top image, NTC is the negative control, and the 63℃ section represents 7 replicates of the negative control experiment; in the bottom image, NTC is the negative control, and the 63℃ section represents 7 replicates of the positive control experiment. Figure 4 The results are visualized using the methylphenol red dye method. The top image shows the negative control reaction, and the bottom image shows the positive control reaction. In the top image, NTC is the negative control, and the 63℃ section represents seven replicates of the negative control experiment. In the bottom image, NTC is the negative control, and the 63℃ section represents seven replicates of the positive control experiment. Figure 5 The results are visualized for compatibility verification using the fluorescent dye method; NTC serves as the negative control, and sheep, cattle, pigs, sheep, dogs, voles, and sand rats represent *Brucella aegilops* species in the sheep population, respectively. B. melitensis M5 strain vaccine, bovine Brucella ( B. abortus A19 strain vaccine, swine brucellosis (B. suis S2 strain vaccine, ovine epididymal Brucella ( B. ovis bcsp31 gene plasmid, Brucella canis ( B. canis bcsp31 gene plasmid and Brucella vulgaris ( B. microti bcsp31 gene plasmid and Brucella aurea species (from Salimius) B. neotomae bcsp31 gene plasmid; Figure 6 The results show the visualization compatibility verification of the methylphenol red dye method; NTC is the negative control, and sheep, cattle, pigs, sheep, dogs, voles, and sand rats represent sheep Brucella in that order. B. melitensis M5 strain vaccine, bovine Brucella ( B. abortus A19 strain vaccine, swine brucellosis ( B. suis S2 strain vaccine, ovine epididymal Brucella ( B. ovis bcsp31 gene plasmid, Brucella canis (B. canis bcsp31 gene plasmid and Brucella vulgaris ( B. microti bcsp31 gene plasmid and Brucella aurea species (from Salimius) B. neotomae bcsp31 gene plasmid; Figure 7 To verify the specificity of the fluorescence staining method, the amplification curve was validated. Figure 8 The results of specificity verification by the fluorescent dye method are visualized. Malt, Yersinia, Cholera, Streptococcus suis, Salmonella, Staphylococcus aureus, Brucella, and Escherichia coli represent, in order: *Pseudomonas maltophilia*, *Yersinia enterocolitica*, *Vibrio cholerae*, *Streptococcus suis*, *Salmonella*, *Staphylococcus aureus*, *Brucella*, and *Escherichia coli*. Figure 9 The results of the visualization specificity verification by the methylphenol red dye method are shown; among them, malt, Yersinia, cholera, swine streptococcus, salmonella, Staphylococcus aureus, Brucella, and Escherichia coli represent, in order, Pseudomonas maltophilia, Yersinia enterocolitica, Vibrio cholerae, Streptococcus suis, Salmonella, Staphylococcus aureus, Brucella, and Escherichia coli. Figure 10 For sensitivity detection of the amplification curve; Figure 11 This is a visualization analysis of the sensitivity results using the fluorescent dye method; the NTC portion represents six negative control replicates, PC is the positive control, and the others, from left to right, are 4.87 copies / μL - 4.87 × 10⁻⁶. 6 Seven gradient concentrations per copy / μL; Figure 12 This is a visualization analysis of the sensitivity results using the methylphenol red dye method; the NTC portion represents 8 negative control replicates, PC is the positive control, and the others, from left to right, are 4.87 copies / μL - 4.87 × 10⁻⁶. 6 Seven gradient concentrations per copy / μL; Figure 13 This is a visualization of the LAMP clinical sample test results using the methylphenol red dye method; samples 1, 2, and 6 are positive, samples 3, 4, 5, 7, 8, 9, and 10 are negative, 4 NTCs are negative controls, and PC is a positive control. Empty tubes were used for color comparison without any added reagents. Detailed Implementation

[0020] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0021] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0022] Brucella ( Brucella ), Stenotrophomonas maltophilia (Stenotrophomonas maltophilia Yersinia enterocolitica ( ), Yersinia enterocolitica ), Vibrio cholerae ( Vibrio cholerae Streptococcus suis ( Streptococcus suis ),salmonella( Salmonella Staphylococcus aureus ( Staphylococcus aureus ), Escherichia coli ( Escherichia coli All were provided by the Baoshan Municipal Center for Disease Control and Prevention laboratory after being cultured and inactivated.

[0023] Brucella medullaris ( B. Melitensis The full-length plasmid of the bcsp31 gene (sequence number: CP001489.1), and Brucella ovis epididymis ( B. ovis The full-length plasmid of the bcsp31 gene (sequence number: CP000709.1), Brucella canis ( B. canis The full-length plasmid of the bcsp31 gene (sequence number: CP000873.1), Brucella vulnificus ( B. microti The full-length plasmid of the bcsp31 gene (sequence number: CP001579.1) and Brucella aurea species (from Salimus) were also included. B. neotomae The full-length plasmid of the bcsp31 gene (sequence number: NZ_UIGH01000002.1) was designed by the laboratory of Baoshan Municipal Center for Disease Control and Prevention and synthesized and prepared by Sangon Biotech (Shanghai) Co., Ltd. and then stored.

[0024] Brucella melanogaster ( B. melitensis M5 strain vaccine, bovine Brucella ( B. abortus A19 strain vaccine, swine brucellosis ( B. suis The S2 strain vaccine was purchased and stored by the Baoshan Municipal Center for Disease Control and Prevention laboratory. (M5, A19, and S2 are all manufactured by Tiankang Biopharmaceutical Co., Ltd. A19 and S2 are available in 20 doses / vial, while M5 is available in 100 doses / vial.)

[0025] Ten clinical human blood samples were collected, tested, and preserved by the Baoshan Municipal Center for Disease Control and Prevention laboratory. Among them, three blood samples were positive for the Rose Bengal plate agglutination test and seven blood samples were negative for the Rose Bengal plate agglutination test. The results of the clinical sample plate agglutination test are shown in Table 1.

[0026] Table 1. Clinical Sample Details Sample Number 1 2 3 4 5 6 7 8 9 10 Plate Agglutination Test Results + + - - - + - - - -

[0027] Note: "+" represents a positive result (i.e., Brucella is present, the same meaning applies throughout), and "-" represents a negative result (i.e., Brucella is not present, the same meaning applies throughout). WarmStart ®LAMP Kit (DNA & RNA), purchased from New England Biolabs; WarmStart® Colorimetric LAMP 2X Master Mix (DNA & RNA), purchased from New England Biolabs; RNase-free water, prepared in the laboratory of Baoshan City Center for Disease Control and Prevention; bacterial DNA extraction kit, purchased from Shenzhen Aodong Inspection and Testing Technology Co., Ltd. Example 1

[0028] I. Determining reference sequence Primers were designed for the bcsp31 gene sequence, and the gene sequence is as follows: SEQ ID NO. 9: ATGAAGTCCGTAATTTTGGCGTCCATCGCCGCTATGTTCGCCACGTCCGCTATGGCTGCCGACGTGGTTGTTTCTGAACCTTCCGCCCCTACTGCTGCTCCTGTTGACACCTTCTCGTGGACCGGCGGCTATATCGGTATCAACGCCGGTTACGCAGGCGGCAAGTTCAAGCATCCATTTTCTAGCTTTGACAAGGAAGACAACGAACAGGTTTCCGGTTCGCTCGACGTAACAGCTGGCGGCTTCGTCGGTGGTGTTCAGGCCGGTTACAACTGGCAGCTCGACAACGGCGTCGTGCTCGGCGCGGAAACCGACTTCCAGGGATCGAGCGTTACGGGTTCGATTTCAGCCGGTGCCAGCGGTCTCGAAGGCAAAGCTGAAACCAAGGTCGAGTGGTTCGGCACAGTTCGTGCCCGTCTTGGCTACACGGCTACCGAACGCCTCATGGTTTATGGTACCGGCGGTCTGGCCTATGGTAAGGTCAAGTCTGCGTTCAACCTGGGTGATGATGCAAGTGCCCTGCACACGTGGTCCGACAAGACGAAAGCTGGCTGGACCCTCGGCGCTGGTGCTGAATATGCCATCAACAACAACTGGACGCTCAAGTCGGAATACCTCTACACCGACCTCGGCAAGCGCAACCTCGTCGACGTTGACAATAGCTTCCTTGAGAGCAAGGTCAATTTCCACACTGTTCGCGTCGGTCTGAACTACAAGTTCTAA II. Primer design The following initial primers were designed using NEB lamp design primers, https: / / lamp.neb.com / , for the reference DNA sequence: forward outer primer F3, reverse outer primer B3, forward inner primer FIP, reverse inner primer BIP, forward loop primer LF, and reverse loop primer LB. The forward inner primer and the reverse inner primer were manually designed by the inventors, and 5 consecutive T bases were added to the forward inner primer and the reverse inner primer to form the forward inner primer FIP-T and the reverse inner primer BIP-T. After design, BLAST was used for target gene specificity analysis, and the final screening determined the primer sequences in Table 2. The primers were synthesized by Shengong Bioengineering (Shanghai) Co., Ltd. and diluted to a final concentration of 100 μmol / L with nuclease-free water according to the requirements.

[0029]

[0030] III. Preparation of positive plasmid Using recombinant plasmid technology, the target gene was transferred into the plasmid by gene recombination technology. The bcsp31 gene of the sheep Brucella was used as the target gene, and the target gene fragment was introduced into the vector Puc57 to form a recombinant plasmid containing the sheep Brucella target gene. The above operations were entrusted to Shengong Bioengineering (Shanghai) Co., Ltd. for synthesis and preparation. After the preparation of the positive plasmid was completed, 100 μL TE was added for dilution and storage, and the nucleic acid concentration was determined by NP50 ultramicro spectrophotometer to calculate the plasmid copy concentration (calculation formula: plasmid copy concentration = 6.02 x 10 23 (copies / mol) x mass concentration (ng / μL) x 10 -9 / [plasmid base number (bp) x 660 (dalton / bp)] (1 dalton = 1 g / mol) ) as a positive control. The nucleic acid concentration determined by the NP50 ultramicro spectrophotometer was 16.1 ng / μL, and the plasmid copy concentration was 4.87 x 10 9 copies / μL.

[0031] IV. Extraction of nucleic acid The sample nucleic acid extraction was performed using a commercial nucleic acid extraction kit, and the eluent was replaced with nuclease-free water during elution to avoid introducing excess ions into the LAMP reaction.

[0032] V. Construction of visual LAMP reaction system (1) Setting of initial system The total volume is 25 uL, WarmStart® LAMP Kit (DNA & RNA) 12.5 uL, 10x primer premix 2.5 uL, and each group of primer premix preparation components are shown in Table 2. The specific method is as follows: 1 uL of F3 and B3, 7 uL of FIP and BIP, or 7 uL of FIP-T and BIP-T, 2 uL of LF and LB, or no addition, and the rest is supplemented with nuclease-free water to 100 uL; 0.5 uL of fluorescent dye (provided in WarmStart® LAMP Kit), 7.5 uL of nuclease-free water, 2 uL of template DNA (4.87 x 10 9 copies / uL plasmid as the template), and 0.5 uL of WarmStart® LAMP Kit (DNA & RNA) enzyme. The reaction program is as follows: 65℃, 60 min.

[0033] (2) Optimization of primer combination Based on the initial system, 4 groups of primers were used in the fluorescence PCR instrument, and the positive control (Brucella bcsp31 gene plasmid as the template) and the negative control (nuclease-free water) in the present application were subjected to LAMP reaction, data were obtained through the FAM channel, then the reaction was stopped at 80℃ for 5 min, the best primer combination was determined, and the amplification results of different primer combinations are shown in Figure 1 .

[0034] It can be seen from the results that the reaction rate of group 1 is the slowest, the reaction of group 2 is slightly faster than that of group 1, which indicates that the addition of 5 consecutive T bases to the forward inner primer and the reverse inner primer promotes the reaction rate; the reaction rate of group 4 is faster, which indicates that the addition of the loop primer significantly improves the reaction rate, but the negative control of group 4 produces non-specific amplification at about 30 min; the reaction rate of group 3 is the fastest, which indicates that the system with the addition of the loop primer and the modification of 5 consecutive T bases to the forward inner primer and the reverse inner primer has the fastest reaction rate, and the negative control of group 3 is normal within 60 min without non-specific amplification; the best primer combination is determined by comprehensive comparison.

[0035] (3) Optimization of reaction conditions In the real-time PCR instrument, according to the optimal reaction temperature of BST enzyme of 59-65℃, a gradient is set at every 1℃, 4.87 x 10 7 copies / uL plasmid as the template, the positive control (Brucella bcsp31 gene positive plasmid) and the negative control (nuclease-free water) are set, and the LAMP reaction is performed for 60 min, data are obtained through the FAM channel, then the reaction is stopped at 80℃ for 5 min, and the amplification curves of different temperature reaction conditions are shown in Figure 2 .

[0036] From the results, it can be seen that at 61 °C and 63 °C, the reaction results can be obtained faster. However, at 61 °C, non-specific amplification occurs in the negative control after 50 min. To avoid non-specific amplification, 63 °C for 30 min is the best reaction condition.

[0037] (4) Visual reaction test After determining the optimized reaction conditions, the metal bath was used to perform reaction reproduction and visual reaction test at the corresponding temperature. When determining the results by fluorescent dye method, the reaction system without fluorescence indicates negative, and the reaction system with fluorescence indicates positive. When determining the results by methyl phenol red dye method, the reaction system showing pink indicates negative, and the reaction system showing yellow indicates positive.

[0038] According to the optimized determination of the best primer combination of the primer combination and the optimized determination of the best reaction condition of the reaction condition, 4.87 x 10 7 copies / μL plasmid as template, respectively, fluorescent dye method and methyl phenol red dye method experiment was carried out.

[0039] Fluorescent dye method selects NEB WarmStart® LAMP Kit(DNA&RNA) reaction system, each reaction contains 1.6mM dNTPS, 20mM Tris-HCl(pH8.8), 10mM KCl, 10mM (NH4)2SO4, 2mM MgSO4 and 0.1% Triton X-100, 0.5µL Bst 3.0 DNA polymerase(New England Biolabs), 0.8M betaine. Using NEB matching LAMP Fluorescent Dye fluorescent dye, then need to add 2.0µM fluorescent dye in the reaction system, under the excitation of ultraviolet lamp, the fluorescence change is observed by naked eye to judge the results.

[0040] Methyl phenol red dye method reaction system selects WarmStart® Colorimetric LAMP 2X Master Mix(DNA&RNA), each reaction contains 1.6mM dNTPS, 5mM Tris-HCl(pH8.8), 10mM KCl, 10mM (NH4)2SO4, 2mM MgSO4 and 0.1% Triton X-100, 0.5µl Bst 3.0 DNA polymerase(New England Biolabs), 0.8M betaine, 100µM methyl phenol red, see Table 3 for reaction system preparation: Table 3 LAMP reaction system Serial Number Ingredient Volume (μL) of Fluorochrome Method Volume (μL) of Methyl Red Dye Method 1 WarmStart® LAMP 2X Master Mix 12.5 12.5 2 10x Primer Master Mix 2.5 2.5 3 50x Fluorochrome 0.5 - 5 Template DNA 2 2 6 Nuclease-Free Water 7.5 8 The total reaction volume was 25 μL, but other reaction volumes (10 μL, 12.5 μL, 20 μL, 50 μL) were also effective. The 10x primer premix preparation method: 1 μL F3, 1 μL B3, 7 μL FIP-T, 7 μL BIP-T, 2 μL LF, 2 μL LB, and the volume was supplemented to 100 μL with nuclease-free water. The total concentration of the primer set was 2 μmol / . The negative control was prepared by replacing the template DNA with an equal volume of nuclease-free water. The results were judged by observing the color change with the naked eye, and the results of the fluorescent dye method are shown in Figure 3 The results of the methyl red dye method are shown in Figure 4 .

[0041] The results were consistent with those of the real-time PCR instrument, and both staining methods could be used to visually determine whether the sample contained Brucella by the naked eye, and the fluorescent dye method could also be used for real-time PCR instrument interpretation.

[0042] Example 2 Compatibility verification

[0043] The M5 strain vaccine of ovine Brucella ( B. melitensis ), the A19 strain vaccine of bovine Brucella ( B. abortus ), the S2 strain vaccine of porcine Brucella ( B. suis ), the bcsp31 gene plasmid of ovine epididymal Brucella ( B. ovis ), the bcsp31 gene plasmid of canine Brucella (B. canis ), the bcsp31 gene plasmid of hamster Brucella ( B. microti ), and the bcsp31 gene plasmid of salin Brucella ( B. neotomae ) were detected for compatibility verification according to the optimal reaction conditions and reaction system determined in Example 1. The compatibility verification results of the fluorescent dye method are shown in Figure 5 , and the compatibility verification results of the methyl red dye method are shown in Figure 6 .

[0044] From the results, it can be seen that ovine Brucella ( B. melitensis ), bovine Brucella ( B. abortus ), porcine Brucella ( B. suis ), ovine epididymal Brucella ( B. ovis ), canine Brucella ( B. canis ), hamster Brucella ( B. microti ), and salin Brucella ( B. neotomae ) can be detected. Example 3 Specificity verification

[0045] Specificity verification was performed using Pseudomonas aeruginosa, Yersinia enterocolitica, Vibrio cholerae, Streptococcus suis, Salmonella, Staphylococcus aureus, Escherichia coli, the optimal reaction conditions and reaction system determined in Example 1. The fluorescence dye specificity verification amplification curve is shown in Figure 7 The fluorescence dye specificity verification results are shown in Figure 8 The methyl phenol red dye specificity verification results are shown in Figure 9

[0046] From the results, it can be seen that the method has no cross-reaction to the above-mentioned pathogens, and only Brucella nucleic acid can be specifically detected.

[0047] Example 4 Analysis Sensitivity

[0048] Using about 4.87 x 10 7 copies / μL of reference DNA plasmid sequence (concentration converted by ultraviolet spectrophotometer), with a gradient of one order of magnitude, 7 times of gradient dilution, i.e. the concentration from 4.87 x 10 6 copies / μL-4.87 copies / μL, while setting a negative control (no nuclease water), the optimal reaction conditions and reaction system determined in Example 1 were used for analysis sensitivity test. The fluorescence PCR instrument sensitivity test detection results are shown in Table 4, the sensitivity detection amplification curve is shown in Figure 10 The fluorescence dye method analysis sensitivity results are shown in Figure 11 The methyl phenol red dye method visual analysis sensitivity results are shown in Figure 12

[0049]

[0050] From the results, based on the LAMP method, under the reaction condition of 63℃, the minimum detection limit of the fluorescence dye method and the methyl phenol red dye method is 48.7 copies / μL, and the visual detection effect is consistent with the instrument results; the fluorescence PCR instrument sensitivity test detection shows that within 30 min, the target gene nucleic acid of the sample to be tested diluted by 10 5 times, i.e. 48.7 copies / μL, can be visually detected.

[0051] Example 5 Clinical Sample Detection

[0052] 10 clinical samples were extracted using a commercial bacterial DNA extraction kit, and the extraction product was used as a template, while setting up a positive control (Brucella bcsp31 gene positive plasmid) and a negative control (no nuclease water), and using the methyl phenol red dye method established in Example 1 for detection. The clinical sample detection result graph is shown in Figure 13 ​​As shown, the results show that 3 of 10 clinical samples are positive samples, and 7 are negative samples, and the detection results are consistent with the results of the brucella rose plate (see Table 1).

[0053] In summary, the primer set provided by the present application has high sensitivity and low sample requirement, is based on the amplification principle of LAMP, increases the application of visual detection method, screens and designs the bcsp31 gene sequence LAMP primer set, realizes the rapid visual detection of Brucella (Brucella) in the target gene nucleic acid not less than 48.7 copies / μL in the detection sample within 30 minutes without relying on the detection equipment. Brucella The primer set provided by the present application has high specificity, can accurately distinguish Brucella from non-Brucella, has good compatibility, is convenient to operate, avoids the need to spend a lot of time and cost to respectively detect and determine different Brucella species, especially facilitates the daily frequent public health early warning detection when there are multiple Brucella strains in the sample, and can rapidly and visually detect ovine Brucella (B. melitensis), bovine Brucella (B. abortus), porcine Brucella (B. suis), sheep epididymal Brucella (B. ovis), canine Brucella (B. canis), field mouse Brucella (B. neotomiae) and salin mouse Brucella (B. inopinata). B. melitensis B. abortus B. suis B. ovis B. canis B. microti B. neotomae The primer set provided by the present application has low cost and low primer concentration, and has less non-specific amplification; the concentration of the primer set provided by the present application is 2 μmol / L, while the total concentration of the primer used in the LAMP reaction is generally 3.6-4.4 μmol / L, the concentration of the primer set is reduced, which can effectively reduce non-specific amplification and reduce cost.

[0054] Finally, it should be pointed out that the above preferred embodiments are only used to illustrate the technical solutions of the present application and are not limiting, although the present application has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made in form and details without departing from the scope defined by the claims of the present application.​​​​​​

Claims

1. A method for visually detecting Brucella spp. ( Brucella The LAMP primer set of ) is characterized by, The primer set includes forward outer primer F3, reverse outer primer B3, forward inner primer FIP-T, reverse inner primer BIP-T, forward loop primer LF, and reverse loop primer LB; The nucleotide sequence of the forward outer primer F3 is shown in SEQ ID NO.1; The nucleotide sequence of the reverse outer primer B3 is shown in SEQ ID NO.2; The nucleotide sequence of the forward inner primer FIP-T is shown in SEQ ID NO.5; The nucleotide sequence of the reverse inner primer BIP-T is shown in SEQ ID NO.6; The nucleotide sequence of the forward loop primer LF is shown in SEQ ID NO.7; The nucleotide sequence of the reverse loop primer LB is shown in SEQ ID NO.

8.

2. The application of the LAMP primer set as described in claim 1 in the preparation of products for visual detection of Brucella.

3. A reagent kit for visually detecting Brucella spp., characterized in that, It includes a primer premix containing the LAMP primer set as described in claim 1.

4. The kit according to claim 3, characterized in that, In the LAMP primer set, the volume ratio of the forward outer primer F3, the reverse outer primer B3, the forward inner primer FIP-T, the reverse inner primer BIP-T, the forward loop primer LF, and the reverse loop primer LB is 1:1:7:7:2:2; the total concentration of the LAMP primer set is 2 μmol / L.

5. The application of the primer set according to claim 1 or the kit according to claim 3 or 4 in the detection of Brucella spp. for non-therapeutic purposes.

6. The application according to claim 5, characterized in that, The procedure includes the following steps: extracting DNA from the sample to be tested, adding the primer set described in claim 1, adding a chromogenic dye, performing an amplification reaction, and determining whether the sample to be tested contains Brucella based on the chromogenic result.

7. The application according to claim 6, characterized in that, The colorimetric dye is either a fluorescent dye or methylphenol red. If the colorimetric result is fluorescent or yellow, the sample is determined to contain Brucella. If the result is not fluorescent or pink, the sample is determined to not contain Brucella.

8. The application according to claim 6, characterized in that, The amplification reaction conditions are: 63℃ and reaction time not exceeding 30 minutes.

9. The application according to claim 6, characterized in that, The target gene nucleic acid in the sample to be tested shall not be less than 48.7 copies / μL.

10. The application according to claim 5, characterized in that, The Brucella genus includes Brucella mesenteriae (Brucella aegioidea). B.melitensi s), bovine Brucella ( B.abortus ), swine brucellosis ( B.suis Brucella epididymitis of sheep ( B.ovis Brucella canis ( B.canis Brucella aureus (Virginia) B.microti ) and Salimella brucellosis ( B.neotomae Any one of them.

Images