Recombinant vector, recombinant bacteria and fermentation method for high-yield ghk
By constructing a recombinant expression vector containing (GHK)n polypeptide and trypsinogen gene, GHK was produced by one-step fermentation of Escherichia coli BL21, which solved the problems of complex and high cost of GHK synthesis in the existing technology and realized efficient and convenient large-scale production.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INST OF BOTANY JIANGSU PROVINCE & CHINESE ACADEMY OF SCI
- Filing Date
- 2025-12-15
- Publication Date
- 2026-05-05
AI Technical Summary
The existing synthesis process for GHK is complex and costly, which limits its large-scale production and industrial application.
A recombinant expression vector containing a bicistronic expression cassette was constructed. The vector contained a (GHK)n polypeptide and a trypsinogen gene operably linked to a prokaryotic inducible promoter. GHK was produced by fermentation with Escherichia coli BL21 and synthesized in a one-step manner using glucose or glycerol as a carbon source.
The synthesis steps of GHK are simplified, the production cost is reduced, it is suitable for large-scale preparation, purification is convenient, and the GHK yield can reach up to 3.9 g/L.
Smart Images

Figure CN121320399B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to recombinant vectors, recombinant bacteria, and fermentation methods for high-yield GHK. Background Technology
[0002] Glycyl histidine tripeptide (GHK) is a small oligopeptide naturally found in human body fluids such as plasma, urine, saliva, and cerebrospinal fluid. In the human body, GHK promotes collagen production, increases angiogenesis and antioxidant capacity, stimulates glucosamine production, helps the skin restore its self-repair ability, promotes epithelial cell growth and differentiation, accelerates wound healing, promotes hair follicle proliferation, increases hair follicle size, and promotes hair growth. Therefore, it is widely used in the cosmetics industry. Glycyl histidine tripeptide chelates with copper ions to form blue copper peptide, which is widely used in cosmetics. Currently, blue copper peptide is mainly synthesized through chemical methods, which are complex and expensive, greatly limiting its application.
[0003] With the development of synthetic biology, the green and efficient synthesis of GHK using bioengineering methods has become a new research hotspot. Chinese invention patents with application numbers 202411680487.2, 202211724146.1, and 202410664944.2 all employ heterologous expression of the GHK repeat sequence (GHK) in engineered E. coli bacteria. n The GHK repeating polypeptides or oligopeptides are obtained through separation and purification. Based on this, the GHK repeating polypeptides or oligopeptides are then degraded in vitro using enzymatic methods to form GHK tripeptide products. However, the process of preparing GHK by microbial fermentation combined with in vitro enzymatic degradation involves many steps and is costly, thus severely hindering the large-scale production and industrial application of GHK. Summary of the Invention
[0004] In view of the technical problems existing in the prior art, the first technical problem to be solved by the present invention is to provide a recombinant vector for high-yield GHK; the second technical problem to be solved by the present invention is to provide a recombinant bacterium constructed using the aforementioned recombinant vector for high-yield GHK; and the third technical problem to be solved by the present invention is to provide the application of the aforementioned recombinant bacterium in one-step fermentation production of GHK.
[0005] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:
[0006] A recombinant expression vector comprising a bicistronic expression cassette; the expression cassette includes the following elements operatively linked downstream of a prokaryotic inducible promoter, in order of transcription direction:
[0007] a) Encoding (GHK)n The first cistron of a polypeptide, whose translation is regulated by the first ribosome binding site; and
[0008] b) Encodes the second cistron of trypsinogen, the translation of which is regulated by the second ribosome binding site;
[0009] Where n is an integer from 2 to 200.
[0010] In some embodiments, the prokaryotic inducible promoter is a T7 / lac hybrid promoter.
[0011] In some embodiments, the first ribosome binding site and / or the second ribosome binding site comprises the sequence AGGAG.
[0012] In some embodiments, n is 30, 100, or 200, and the first cistron encoding the (GHK)n polypeptide comprises any of the following sequences:
[0013] 1) Encoding (GHK) 30 The nucleotide sequence of the polypeptide is shown in SEQ ID NO. 1;
[0014] 2) Encoding (GHK) 100 The nucleotide sequence of the polypeptide is shown in SEQ ID NO. 2;
[0015] 3) Encoding (GHK) 200 The nucleotide sequence of the polypeptide is shown in SEQ ID NO. 3.
[0016] In some embodiments, the trypsinogen is porcine trypsinogen.
[0017] A prokaryotic recombinant bacterium, characterized in that it comprises any of the recombinant expression vectors described above.
[0018] In some embodiments, the prokaryotic recombinant bacterium is Escherichia coli BL21.
[0019] A method for producing GHK by fermentation includes the following steps:
[0020] Cultivate the aforementioned prokaryotic recombinant bacteria;
[0021] During fermentation, an inducer capable of inducing the prokaryotic inducible promoter is added to induce expression.
[0022] After the induction culture was completed, GHK tripeptide was obtained from the fermentation product.
[0023] In some embodiments, the culture medium contains per liter: when the OD of the culture... 600 The inducing agent is added when the value reaches 0.6 to 0.8.
[0024] In some embodiments, the induced expression is performed at 25°C to 40°C for 3-24 hours.
[0025] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0026] 1) This application starts with Escherichia coli, using pET28a(+) as the expression vector, and constructs (GHK) n The expression cassette of the gene and the porcine trypsinogen gene were co-expressed. This vector was transformed into *E. coli* BL21, and then, using glucose or glycerol as a carbon source, *E. coli* was fermented in a one-step process to synthesize GHK. Examples show that the highest GHK yield can reach 3.9 g / L. This invention also provides specific (GHK) formulations. 30 (GHK) 100 Or (GHK) 200 The nucleotide sequence.
[0027] 2) The recombinant Escherichia coli that produces high levels of GHK constructed in this application has fewer steps and is easier to purify compared to other GHK synthesis methods, making it suitable for large-scale GHK preparation. Attached Figure Description
[0028] Figure 1 For (GHK) 30 Recombinant expression vector pET28a(+)-(ghk) 30 A schematic diagram of its construction;
[0029] Figure 2 For (GHK) 100 Recombinant expression vector pET28a(+)-(ghk) 100 A schematic diagram of its construction;
[0030] Figure 3 For (GHK) 200 Recombinant expression vector pET28a(+)-(ghk) 200 A schematic diagram of its construction;
[0031] Figure 4 Based on (GHK) 30 Construct the recombinant expression vector pET28a(+)-(ghk) for GHK. 30 -Schematic diagram of the construction of RBS-trypsinogen;
[0032] Figure 5 Based on (GHK) 100 Construct the recombinant expression vector pET28a(+)-(ghk) for GHK. 100-Schematic diagram of the construction of RBS-trypsinogen;
[0033] Figure 6 Based on (GHK) 200 Construct the recombinant expression vector pET28a(+)-(ghk) for GHK. 200 -Schematic diagram of the construction of RBS-trypsinogen;
[0034] Figure 7 The graph shows the yield of GHK synthesized by recombinant Escherichia coli. Detailed Implementation
[0035] To make the objectives, technical solutions, and advantages of this invention clearer, the invention is further described below with reference to specific embodiments. Unless otherwise described in detail, the technical means used in the following embodiments are all conventional means well known to those skilled in the art. Alternatively, they may be carried out according to the kit and product instructions. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.
[0036] Example 1
[0037] (GHK) 30 Construction of recombinant expression vectors
[0038] Based on the alternative gene (GHK) 30 Primers F1 / R1 (GTTTAACTTTAAGAAGGAGATATACCATGGGACATAAGGGTCACAAAGG (SEQ ID NO. 4), CCACCAGTCATGCTAGCCATATGTTATTTGTGGCCCTTGTGGCC (SEQ ID NO. 5)) were designed based on sequence SEQ ID NO. 1, and the gene (GHK) was amplified using the high-fidelity PCR polymerase Prime Star. 30 Gene fragment; using pET28a(+) as a template, the plasmid pET28a(+) was amplified using primers F2 / R2 (CATATGGCTAGCATGACTGGTGG(SEQ ID NO. 6), CATGGTATATCTCCTTCTTAAAGTTAAAC(SEQ ID NO. 7)), and (GHK) was added. 30 The gene fragment and the pET28a(+) vector fragment were assembled using Gibbson technology to generate (GHK). 30 Gene fragments were homologously integrated into the Nco I and Nde I sites of pET28a(+) to construct the recombinant expression vector pET28a(+)-(ghk). 30 ( Figure 1 ).
[0039] Example 2
[0040] (GHK) 100 Construction of recombinant expression vectors
[0041] Based on the alternative gene (GHK) 100 Primers F3 / R3 (GTTTAACTTTAAGAAGGAGATATACCATGGGACATAAGGGTCACAAAGGAC (SEQ ID NO. 8), CCACCAGTCATGCTAGCCATATGTTACTTGTGACCCTTGTGCCCTTTATG (SEQ ID NO. 9)) were designed based on sequence SEQ ID NO. 2, and the gene (GHK) was amplified using the high-fidelity PCR polymerase Prime Star. 100 Gene fragment; using pET28a(+) as a template, the plasmid pET28a(+) was amplified using primers F4 / R4 (CATATGGCTAGCATGACTGGTGG, CATGGTATATCTCCTTCTTAAAGTTAAAC), and (GHK) was added. 100 The gene fragment and the pET28a(+) vector fragment were assembled using Gibbson technology to generate (GHK). 100 Gene fragments were homologously integrated into the Nco I and NdeI sites of pET28a(+) to construct the recombinant expression vector pET28a(+)-(ghk). 100 ( Figure 2 ).
[0042] Example 3
[0043] (GHK) 200 Construction of recombinant expression vectors
[0044] Based on the alternative gene (GHK) 200 Primers F5 / R5 (GTTTAACTTTAAGAAGGAGATATACCATGGGACATAAGGGTCACAAAGGAC, CCACCAGTCATGCTAGCCATATGTTACTTGTGGCCCTTGTGGC (SEQ ID NO. 10)) were designed based on sequence SEQ ID NO. 3, and the gene (GHK) was amplified using the high-fidelity PCR polymerase Prime Star. 200 Gene fragment; using pET28a(+) as a template, the plasmid pET28a(+) was amplified using primers F6 / R6 (CATATGGCTAGCATGACTGGTGG, CATGGTATATCTCCTTCTTAAAGTTAAAC), and (GHK) was added. 200The gene fragment and the pET28a(+) vector fragment were assembled using Gibbson technology to generate (GHK). 200 Gene fragments were homologously integrated into the Nco I and NdeI sites of pET28a(+) to construct the recombinant expression vector pET28a(+)-(ghk). 200 ( Figure 3 ).
[0045] Example 4
[0046] Based on (GHK) 30 Construction of GHK recombinant expression vector
[0047] Primers F7 / R7 (CTAGCCATATGCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCatgaacacctttgtcttgcttgcg(SEQ ID NO. 11), GCTCGAATTCttagttggcagcgatggtctgc(SEQ ID NO. 12)) were designed based on the candidate porcine trypsinogen gene sequence (NCBI Reference Sequence: NM_001162891.1). The porcine trypsinogen gene fragment was amplified using the high-fidelity PCR polymerase Prime Star. EcoRI and NdeI enzymes were used to amplify the trypsinogen gene fragment and the recombinant expression vector pET28a(+)-(ghk), respectively. 30 Double digestion was performed at 37°C for 1 h. The trypsinogen digested fragment and pET28a(+)-(ghk) were then recovered separately. 30 The fragments were digested with enzymes and ligated using T4 ligase at 16°C for 3 h to construct the recombinant expression vector pET28a(+)-(ghk) for GHK. 30 -RBS-trypsinogen ( Figure 4 ).
[0048] Example 5
[0049] Based on (GHK) 100 Construction of GHK recombinant expression vector
[0050] Primers F8 / R8 (CTAGCCATATGCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCatgaacacctttgtcttgcttgcg, GCTCGAATTCttagttggcagcgatggtctgc) were designed based on the candidate porcine trypsinogen gene sequence (NCBI Reference Sequence: NM_001162891.1). The porcine trypsinogen gene fragment was amplified using the high-fidelity PCR polymerase PrimeStar. EcoRI and NdeI enzymes were used to amplify the trypsinogen gene fragment and the recombinant expression vector pET28a(+)-(ghk), respectively. 100 Double digestion was performed at 37°C for 1 h. The trypsinogen digested fragment and pET28a(+)-(ghk) were then recovered separately. 100 The fragments were digested with enzymes and ligated using T4 ligase at 16°C for 3 h to construct the recombinant expression vector pET28a(+)-(ghk) for GHK. 100 -RBS-trypsinogen ( Figure 5 ).
[0051] Example 6
[0052] Based on (GHK) 200 Construction of GHK recombinant expression vector
[0053] Primers F9 / R9 (CTAGCCATATGCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCatgaacacctttgtcttgcttgcg, GCTCGAATTCttagttggcagcgatggtctgc) were designed based on the candidate porcine trypsinogen gene sequence (NCBI Reference Sequence: NM_001162891.1). The porcine trypsinogen gene fragment was amplified using the high-fidelity PCR polymerase PrimeStar. EcoRI and NdeI enzymes were used to amplify the trypsinogen gene fragment and the recombinant expression vector pET28a(+)-(ghk), respectively. 200 Double digestion was performed at 37°C for 1 h. The trypsinogen digested fragment and pET28a(+)-(ghk) were then recovered separately. 200 The fragments were digested with enzymes and ligated using T4 ligase at 16°C for 3 h to construct the recombinant expression vector pET28a(+)-(ghk) for GHK. 200 -RBS-trypsinogen ( Figure 6 ).
[0054] Example 7
[0055] GHK fermentation preparation
[0056] 1. Construction of E. coli cell factories
[0057] The recombinant expression vector pET28a(+)-(ghk) from Examples 4, 5, and 6 were used respectively. 30 -RBS-trypsinogen, pET28a(+)-(ghk) 100 -RBS-trypsinogen, pET28a(+)-(ghk) 200 50 ng each of RBS-trypsinogen were incubated with competent E. coli BL21 cells on ice for 30 min, followed by heat shock at 42℃ for 90 s to transform E. coli BL21, resulting in a recombinant E. coli expression strain E. coli BL21 pET28a(+)-(ghk) that accumulates GHK. 30 -RBS-trypsinogen, E. coli BL21 pET28a(+)-(ghk) 100 -RBS-trypsinogen and E. coli BL21 pET28a(+)-(ghk) 200 -RBS-trypsinogen, in preparation for subsequent GHK production.
[0058] 2. Culture of E. coli cell factories and preparation of GHK
[0059] Recombinant Escherichia coli expression strain E. coli BL21 pET28a(+)-(ghk) was selected. 30 -RBS-trypsinogen, E. coli BL21 pET28a(+)-(ghk) 100 -RBS-trypsinogen and E. coli BL21pET28a(+)-(ghk) 200 A single colony of RBS-trypsinogen was inoculated into 3 mL of LB medium (with a final concentration of 50 mg / L kanamycin) and incubated overnight at 37°C and 200 rpm. Then, it was transferred at a 1% (v / v) ratio to 50 mL of fermentation medium (with a final concentration of 50 mg / L kanamycin) and incubated at 37°C until OD reached. 600 nmThe concentration of the solution was 0.6-0.8. IPTG was added to a final concentration of 0.1 mM, and the mixture was induced at 37°C for 5 h. After induction, the mixture was centrifuged at 8000 rpm and 4°C for 5 min. The supernatant was collected, which is the crude GHK product.
[0060] The fermentation medium is formulated as follows: each liter of medium contains 4-50 g yeast powder, 4-20 g peptone, 1-15 g dipotassium hydrogen phosphate, 1-6 g potassium dihydrogen phosphate and 1-8 mL glycerol.
[0061] The fermentation medium can also be formulated as follows: each liter of medium contains 4-50 g yeast powder, 4-20 g peptone, 1-15 g dipotassium hydrogen phosphate, 1-6 g potassium dihydrogen phosphate and 20-100 g glucose.
[0062] In this embodiment, the fermentation medium used has the following formula: 23.6 g yeast extract, 11.8 g peptone, 9.4 g dipotassium hydrogen phosphate, 2.2 g potassium dihydrogen phosphate and 40 g glucose per liter of medium.
[0063] Example 8
[0064] Identification and yield determination of GHK
[0065] 1. Inspection of GHK structure
[0066] The supernatant of GHK fermentation broth after passing through 0.22 μm was detected by high performance liquid chromatography-mass spectrometry (HPLC-MS).
[0067] The HPLC-MS conditions used were as follows: column: Shim-pack Scepter C18-120, 1.9 μm, 3.0 x 30 mm; mobile phase: 10% acetonitrile / water solution (v / v); flow rate: 0.25 mL / min. The corresponding mass spectrometry conditions were: ion source: ESI; nebulizer flow rate: 1.5 L / min; drying gas flow rate: 5 L / min; ion source temperature: 200℃; transfer line temperature: 250℃.
[0068] The results showed that, in cationic mode, the mass-to-charge ratio of GHK synthesized by recombinant *E. coli* was 341.1946, indicating that *E. coli* can synthesize GHK in one step using glucose as a substrate. Under the current chromatographic conditions, the elution time of GHK was 2.7 min, and the concentration of GHK in the sample was 3.82 g / L (E. coli BL21 pET28a(+)-(ghk)). 30 -RBS-trypsinogen), 3.90 g / L (E. coli BL21 pET28a(+) -(ghk) 100-RBS-trypsinogen) and 1.17 g / L (E. coli BL21 pET28a(+) -(ghk) 200 -RBS-trypsinogen), indicating that the level of GHK accumulation in engineered E. coli was 3.82 g / L (E. coli BL21 pET28a(+)-(ghk)). 30 -RBS-trypsinogen), 3.90 g / L (E. coli BL21 pET28a(+)-(ghk) 100 -RBS-trypsinogen) and 1.17 g / L (E. coli BL21 pET28a(+)-(ghk)). 200 -RBS-trypsinogen) Figure 7 ).
[0069] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.
Claims
1. A method for producing GHK by one-step fermentation, characterized in that, Includes the following steps: (1) A prokaryotic recombinant bacterium is provided, the prokaryotic recombinant bacterium comprising a recombinant expression vector, the recombinant expression vector comprising a bicistronic expression cassette; the expression cassette comprising the following elements operably linked downstream of a prokaryotic inducible promoter, in the order of transcription direction: a) Encoding (GHK) n The translation of the first cistron of a polypeptide is regulated by the first ribosome binding site; and b) Encodes the second cistron of trypsinogen, the translation of which is regulated by the second ribosome binding site; Where n is an integer from 2 to 200; (2) Cultivate the prokaryotic recombinant bacteria; (3) When the OD of the culture 600 When the value reaches 0.6 to 0.8, an inducer capable of inducing the prokaryotic inducible promoter is added to induce expression; (4) After the induction culture is completed, GHK tripeptide is obtained from the fermentation product.
2. The method according to claim 1, characterized in that, The prokaryotic inducible promoter is a T7 / lac hybrid promoter.
3. The method according to claim 1, characterized in that, The first ribosome binding site and / or the second ribosome binding site contain the sequence AGGAG.
4. The method according to claim 1, characterized in that, The n is 30, 100, or 200, and the encoding (GHK) n The first cistron of the polypeptide contains any of the following sequences: 1) Encoding (GHK) 30 The nucleotide sequence of the polypeptide is shown in SEQ ID NO. 1; 2) Encoding (GHK) 100 The nucleotide sequence of the polypeptide is shown in SEQ ID NO. 2; 3) Encoding (GHK) 200 The nucleotide sequence of the polypeptide is shown in SEQ ID NO.
3.
5. The method according to claim 1, characterized in that, The trypsinogen is porcine trypsinogen.
6. The method according to claim 1, characterized in that, The prokaryotic recombinant bacteria is Escherichia coli BL21.
7. The method according to claim 1, characterized in that, The induction of expression was carried out at 25°C to 40°C for 3-24 hours.
8. A recombinant expression vector for use in the method of any one of claims 1-7, characterized in that, It comprises a bicistronic expression cassette; the expression cassette contains the following elements operatively linked downstream of a prokaryotic inducible promoter, in order of transcription direction: a) Encoding (GHK) n The translation of the first cistron of a polypeptide is regulated by the first ribosome binding site; and b) Encodes the second cistron of trypsinogen, the translation of which is regulated by the second ribosome binding site; Where n is an integer from 2 to 200.
9. A prokaryotic recombinant bacterium for use in the method according to any one of claims 1-7, characterized in that, It includes the recombinant expression vector as described in claim 8.
Citation Information
Patent Citations
Biosynthesis method of oligopeptide
CN115807050A
Preparation method of Pro. GHK-Cu blue copper peptide with barrier repairing and anti-aging effects
CN118580375A
Novel method for realizing efficient biosynthesis of copper-blue peptide
CN119530261A
High-purity preparation method of recombinant blue copper peptide precursor-oligopeptide
CN112608933A