Enhancer for improving amplification efficiency of mismatched primers in PCR (polymerase chain reaction), reaction system and application of reaction system

Abstract

The invention belongs to the technical field of molecular biology, and provides a reinforcing agent for improving amplification efficiency of mismatched primers in PCR (polymerase chain reaction), a reaction system and application of the reinforcing agent. The reaction system is a liquid reaction system and comprises a reinforcing agent, Trisma, dNTP (deoxyribonucleoside triphosphate), MgCl2, NH4Cl, KCl, BSA (bovine serum albumin), glycerol, betaine, a specific primer, a DNA (deoxyribonucleic acid) template, DNA polymerase, DMSO (dimethylsulfoxide) and water. The invention also provides an application of the enhancer in gene polymorphism detection by a PCR-RFLP (Polymerase Chain Reaction-Restriction Fragment Length Polymorphism) method. Tetramethylammonium chloride and glutathione in the enhancer have a synergistic effect, so that the binding capacity of a mismatched primer and a DNA template can be remarkably enhanced, the completeness of a mismatched region at the 3'end of the primer is protected, and non-specific amplification is inhibited while the amplification efficiency is improved.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of molecular biology, and specifically relates to an enhancer for improving the amplification efficiency of mismatch primers in PCR reaction, a reaction system and application thereof. BACKGROUND

[0002] Polymerase chain reaction (PCR) is a core technology for amplifying specific DNA fragments, and its efficiency is highly dependent on the precise pairing of primers and template DNA. In practical applications, mismatches between primers and templates often occur, for example, when detecting gene mutations, pathogen variations or highly polymorphic sites, the primers cannot completely match the target sequence, resulting in a significant decrease in amplification efficiency or even failure. This problem seriously affects the sensitivity and accuracy of detection, especially in clinical diagnosis, which may cause false negative results.

[0003] Taking polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) as an example, it is a classical detection method based on DNA sequence polymorphism, widely used in gene typing, pathogen identification and genetic disease diagnosis. Its core principle is to amplify the target DNA region by PCR, then use restriction endonuclease to specifically cut the amplified product, and judge the sequence variation (such as SNP or mutation) of the target site according to the difference in fragment length in the electrophoretogram.

[0004] However, this technology faces multiple challenges in practical applications, especially in primer design, amplification efficiency and specificity control. The conventional PCR reaction system on the market is mainly designed and optimized for the amplification needs of perfectly matched primers, and the concentration of its components, ion strength and other parameters are based on the normal binding and extension reaction of perfectly matched primers and template DNA. However, mismatch primers in these conventional PCR reaction systems cannot meet the needs of high-efficiency amplification of mismatch primers due to their weak binding ability to template DNA, their tendency to form secondary structures, and other characteristics.

[0005] Therefore, the present application provides an enhancer for improving the amplification efficiency of mismatch primers in PCR reaction, a reaction system and application thereof, which aims to significantly improve the amplification efficiency of mismatch primers in PCR-RFLP while maintaining high specificity and enzyme cutting compatibility. SUMMARY

[0006] In order to solve the above technical problems, the application provides an enhancer for improving the mismatch primer amplification efficiency of PCR reaction, a reaction system and application thereof, so as to solve the problems that the specificity of the binding of the mismatch primer and the template DNA is reduced, the non-specific amplification is increased, when the 3' end of the primer has more mismatch bases in the design of the primer, the amplification efficiency is obviously reduced, and the subsequent enzyme cutting result is affected, and the existing PCR reaction system cannot adapt to the mismatch primer, and the amplification efficiency is difficult to improve.

[0007] According to a first aspect of the present disclosure, an enhancer for improving the mismatch primer amplification efficiency of PCR reaction is provided, and the enhancer is composed of tetramethylammonium chloride and glutathione.

[0008] Preferably, the final concentration of the tetramethylammonium chloride added to the PCR reaction system is 0.2 mM.

[0009] Preferably, the final concentration of the glutathione added to the PCR reaction system is 3 mM.

[0010] According to a second aspect of the present disclosure, a PCR reaction system for improving the amplification efficiency of the mismatch primer is provided, and the reaction system is a liquid reaction system, which comprises the enhancer of the first aspect, and Trisma, dNTP, MgCl2, NH4Cl, KCl, BSA, glycerol, betaine, specific primers, DNA template, DNA polymerase, DMSO and water.

[0011] According to a third aspect of the present disclosure, the application of the enhancer of the first aspect in the detection of genetic polymorphism by PCR-RFLP method is provided.

[0012] Preferably, the genetic polymorphism is the polymorphism of the SNP site rs5219 of the KCNJ11 gene.

[0013] Preferably, the specific primers used in the PCR reaction system comprise an upstream primer and a downstream primer.

[0014] The nucleotide sequence of the upstream primer is shown in SEQ ID No. 1, and specifically is: TCCGCTGGCGGGCACGGTACCTGAGCT.

[0015] The nucleotide sequence of the downstream primer is shown in SEQ ID No. 2, and specifically is: GCCCGGCCTGAGGCTGGTATTAAGAGCTC.

[0016] Preferably, the PCR-RFLP method comprises an enzyme cutting step, and the enzyme cutting reaction system used in the enzyme cutting step comprises a restriction enzyme SacI and a restriction enzyme buffer.

[0017] Preferably, the PCR-RFLP method further comprises a genotype determining step: performing agarose gel electrophoresis on the enzyme digestion products, and determining the genotype of the SNP site rs5219 of the KCNJ11 gene according to the characteristic bands of the electrophoretogram;

[0018] The specific determination criteria are as follows:

[0019] When the electrophoretogram has a 310bp band and no 250bp band, the genotype of the sample at the rs5219 polymorphic site is wild-type homozygote TT.

[0020] When the electrophoretogram has both a 310bp band and a 250bp band, the genotype of the sample at the rs5219 polymorphic site is heterozygote TC.

[0021] When the electrophoretogram has no 310bp band and has a 250bp band, the genotype of the sample at the rs5219 polymorphic site is mutant-type homozygote CC.

[0022] Compared with the prior art, the present application has the following beneficial effects:

[0023] 1. The tetramethylammonium chloride in the enhancer of the present application synergizes with glutathione to significantly enhance the binding ability of the mismatch primer to the DNA template, protect the integrity of the 3' end mismatch region of the primer, and inhibit non-specific amplification while improving the amplification efficiency.

[0024] 2. The enhancer of the present application has simple components, only two core substances, and the raw materials are easy to obtain and low in cost; it can be prepared into a premix or a kit with other components of the PCR reaction system, simplifying the experimental operation process and facilitating large-scale application.

[0025] 3. The enhancer of the present application is designed to be compatible with the components of the PCR reaction system to limit the activity of the restriction enzyme, which does not interfere with the subsequent enzyme digestion reaction, ensuring the stability and continuity of the PCR-RFLP detection. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 The electrophoretogram for concentration test of the enhancer of the present application; wherein the M well is a marker, the 1st well is a control group, the 2nd well is an experimental group 1, the 3rd well is an experimental group 2, the 4th well is an experimental group 3, the 5th well is an experimental group 4, the 6th well is an experimental group 5, and the 7th well is an experimental group 6.

[0027] Figure 2The electropherogram of the SNP site rs5219 of the KCNJ11 gene of 8 samples detected in the present application is shown in the figure, wherein the No. M hole is a marker, the No. 1 hole is a No. 1 sample, the No. 2 hole is a No. 2 sample in the experimental group, the No. 3 hole is a No. 3 sample in the experimental group, the No. 4 hole is a No. 4 sample in the experimental group, the No. 5 hole is a No. 5 sample in the experimental group, the No. 6 hole is a No. 6 sample in the experimental group, the No. 7 hole is a No. 7 sample in the experimental group, and the No. 8 hole is a No. 8 sample in the experimental group.

[0028] Figure 3 The sequencing peak chart of the No. 1-4 samples in the embodiment of the present application is shown in the figure, and the detected gene site is shown in the frame.

[0029] Figure 4 The sequencing peak chart of the No. 5-8 samples in the embodiment of the present application is shown in the figure, and the detected gene site is shown in the frame. DETAILED DESCRIPTION

[0030] The embodiments of the present application are further described in detail below in combination with the drawings and examples. The following examples are used to illustrate the present application, but cannot be used to limit the scope of the present application.

[0031] Example 1: Test of the concentration of the enhancer

[0032] The purpose of the present example is to screen the optimal final concentration of the enhancer in the PCR reaction system, taking the SNP site rs5219 of the KCNJ11 gene as the research object.

[0033] Experimental materials:

[0034] Template DNA: KCNJ11 gene standard product DNA extracted;

[0035] Primers: upstream primer (SEQ ID No. 1: TCCGCTGGCGGGCACGGTACCTGAGCT) and downstream primer (SEQ ID No. 2: GCCCGGCCTGAGGCTGGTATTAAGAGCTC);

[0036] Enhancer components: tetramethylammonium chloride and glutathione;

[0037] PCR basic reagents: Trisma, dNTP, MgCl2, NH4Cl, KCl, BSA, glycerol, betaine, DNA polymerase, DMSO, and enzyme-free pure water;

[0038] Electrophoresis reagents: agarose, TAE buffer, and nucleic acid dye

[0039] Among them, the PCR reaction system without the enhancer is taken as the control group, and the final concentration of the enhancer in the PCR reaction system in the experimental group is shown in Table 1:

[0040] Table 1. Final concentration of enhancer in PCR reaction system

[0041]

[0042]

[0043] The SNP site rs5219 of KCNJ11 gene was taken as the research object, and the upstream primer (KCNJ11-F) SEQ ID NO. 1 and the downstream primer (KCNJ11-R) SEQ ID NO. 2 were designed, and the sequences were as follows:

[0044] SEQ ID NO. 1: TCCGCTGGCGGGCACGGTACCTGAGCT

[0045] SEQ ID NO. 2: GCCCGGCCTGAGGCTGGTATTAAGAGCTC

[0046] The PCR reaction system was configured according to Table 2:

[0047] Table 2. PCR reaction system

[0048]

[0049] The prepared PCR reaction system was placed on a PCR instrument, and the program in Table 3 was used for amplification.

[0050] Table 3. PCR amplification program

[0051]

[0052]

[0053] After the PCR reaction, the product was subjected to agarose gel electrophoresis under a voltage of 120V, and the results are shown in Figure 1 .

[0054] From the electrophoretogram shown in Figure 1 , it can be seen that the control group (hole No. 1): the amplification product band is very shallow and almost invisible, indicating that the mismatch primer amplification efficiency is very low without enhancer; Experimental groups 1-4 and 6 (holes 2-4 and 7): amplification bands can be observed, but the band brightness is weak, indicating that the concentration of enhancer has not reached the optimum; Experimental group 5 (hole No. 5): the amplification band is the brightest, and there is no obvious non-specific band, indicating that the final concentration of 0.2 mM tetramethylammonium chloride combined with the final concentration of 3 mM glutathione is the optimal combination, which can maximize the amplification efficiency and specificity of the mismatch primer.

[0055] Example Two: Method for detecting gene SNP site by PCR-RFLP method

[0056] This example is based on the optimal enhancer concentration (0.2 mM tetramethylammonium chloride + 3 mM glutathione) screened in Example One, to establish a standard process for detecting the SNP site rs5219 of the KCNJ11 gene by PCR-RFLP:

[0057] Experimental materials:

[0058] Template DNA: TT, TC, and CC genotype standard DNA of the rs5219 site of the KCNJ11 gene

[0059] Primers, enhancers, and PCR base reagents: same as in Example One

[0060] Enzyme digestion reagents: restriction endonuclease SacI (10 U / μL), SacI special buffer (10×).

[0061] Prepare the PCR reaction system according to Table 4:

[0062] Table 4. PCR reaction system

[0063]

[0064]

[0065] Place the prepared PCR reaction system in a PCR instrument and perform amplification using the program in Table 5:

[0066] Table 5. PCR amplification program

[0067]

[0068] Prepare the restriction endonuclease system, and the amounts of each component are as shown in Table 6:

[0069] Table 6. Restriction endonuclease system

[0070] Reagent name Amount Restriction enzyme 1.0 μL Restriction enzyme buffer 1.0 μL PCR product 1.0 μL DEPC water 7.0 μL

[0071] Prepare the restriction endonuclease system for enzyme digestion, and the reaction conditions are as shown in Table 7:

[0072] Table 7. Enzyme digestion reaction program

[0073]

[0074]

[0075] After enzyme digestion, the samples were subjected to agarose gel electrophoresis at a voltage of 120 V, and photographed and analyzed using a gel imaging analysis system. The genotype of the SNP site of the gene was determined according to the enzyme digestion bands:

[0076] TT genotype standard: only 310 bp band (Sac I cannot cut wild type sequence) appears;

[0077] TC genotype standard: both 310 bp band (un-cut wild type fragment) and 250 bp band (cut mutant fragment) appear;

[0078] CC genotype standard: only 250 bp band (Sac I completely cut mutant sequence) appears.

[0079] The results show that after adding the enhancer, the amplification products of the three genotype standards are stable in enzyme cutting effect, the bands are clear without impurity bands, and the genotypes can be accurately distinguished, proving that the enhancer is completely compatible with the PCR-RFLP process.

[0080] Example Three: Detection and Verification of Clinical Blood DNA Samples

[0081] In this example, the method established in Example Two was used to detect the SNP site rs5219 of the KCNJ11 gene in 8 clinical blood DNA samples, and the accuracy of the results was verified by sequencing.

[0082] Experimental materials:

[0083] Clinical samples: 8 healthy human peripheral blood DNA (ethically approved, sample numbers 1-8);

[0084] Detection reagents: same as Example Two;

[0085] Sequencing service: Sanger sequencing by Shengong Biotechnology (Shanghai) Co., Ltd.

[0086] The SNP site rs5219 of the KCNJ11 gene was used as the research object, the upstream primer (KCNJ11-F) SEQ ID NO. 1 and the downstream primer (KCNJ11-R) SEQ ID NO. 2 were used, and the restriction endonuclease was Sac I.

[0087] According to the detection method in Example Two, the enhancer was added to the PCR reaction system at a final concentration of 0.2 mM tetramethylammonium chloride and 3 mM glutathione, and the 8 clinical blood DNA samples were detected by PCR-RFLP method.

[0088] The electrophoresis detection results are shown in Figure 2

[0089] Samples 1, 2, 5, 7, and 8: only 310 bp band appears, then the genotype is determined as TT;

[0090] Samples 3 and 4: both 310 bp and 250 bp bands appear, then the genotype is determined as TC; ​

[0091] Sample 6: If only a 250bp band appears, the genotype is determined to be CC.

[0092] Sequencing validation results:

[0093] like Figure 3 As shown, in the sequencing peak diagrams of samples 1 and 2, only the "T" peak (TT) appears at the rs5219 site, while in samples 3 and 4, both the "T" peak and the "C" peak (TC) appear at the same site.

[0094] like Figure 4 As shown, samples 5-8: samples 5, 7, and 8 showed only a "T" peak (TT) at this site, while sample 6 showed only a "C" peak (CC) at this site;

[0095] Based on the above experimental results, the PCR-RFLP detection results of the 8 samples were completely consistent with the sequencing results, proving that the detection method of the present invention meets the clinical needs in terms of accuracy. At the same time, the amplification product bands of all samples were clear and the enzyme digestion reaction was stable, further verifying that the addition of the enhancer can promote amplification efficiency, improve the stability of enzyme digestion identification, and greatly improve the typing effect.

[0096] It is important to note that the constructions and arrangements of this application shown in several different exemplary embodiments are merely illustrative. Although only a few embodiments are described in detail in this disclosure, those who consult this disclosure will readily understand that many modifications are possible without substantially departing from the novel teachings and advantages of the subject matter described in this application. Other substitutions, modifications, alterations, and omissions may be made in the design, operation, and arrangement of the exemplary embodiments without departing from the scope of the invention. Therefore, the invention is not limited to the particular embodiments but extends to various modifications that still fall within the scope of the appended claims.

[0097] It should be understood that numerous specific implementation decisions can be made during the development of any actual implementation method, and in any engineering or design project. Such development efforts may be complex and time-consuming, but for those of ordinary skill in the art who benefit from this disclosure, the development effort will be a routine work of design, manufacturing, and production without requiring much experimentation.

[0098] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. An enhancer for improving the efficiency of mismatch primer amplification in a PCR reaction, characterized in that: The enhancing agent is composed of tetramethylammonium chloride and glutathione. ​ 2. The enhancer for improving the amplification efficiency of mismatched primers in PCR reactions as described in claim 1, characterized in that: The tetramethylammonium chloride is added to the PCR reaction system at a final concentration of 0.2 mM.

3. The enhancer for improving the amplification efficiency of mismatched primers in PCR reactions as described in claim 1, characterized in that: The glutathione is added to the PCR reaction system at a final concentration of 3 mM.

4. A PCR reaction system for improving the efficiency of mismatch primer amplification, characterized by, The reaction system is a liquid reaction system, which comprises the enhancing agent for improving the mismatch primer amplification efficiency in PCR reaction according to any one of claims 1-3, and Trisma, dNTP, MgCl2, NH4Cl, KCl, BSA, glycerol, betaine, specific primers, DNA template, DNA polymerase, DMSO and water.

5. The enhancing agent according to any one of claims 1-3 in the application of detecting genetic polymorphism by PCR-RFLP method.

6. Use according to claim 5, wherein: The genetic polymorphism is the polymorphism of SNP site rs5219 of KCNJ11 gene.

7. Use according to claim 6, wherein: The specific primers used in the PCR reaction system comprise an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID No. 1, specifically TCCGCTGGCGGGCACGGTACCTGAGCT. The nucleotide sequence of the downstream primer is shown in SEQ ID No. 2, specifically GCCCGGCCTGAGGCTGGTATTAAGAGCTC.

8. Use according to claim 7, wherein the compound is ###0002### The PCR-RFLP method comprises an enzyme cutting step; the enzyme cutting reaction system used in the enzyme cutting step comprises restriction enzyme Sac I and restriction enzyme buffer.

9. Use according to claim 8, wherein the compound is ###0002### The PCR-RFLP method further comprises a genotype determination step: the enzyme cutting product is subjected to agarose gel electrophoresis, and the genotype of SNP site rs5219 of KCNJ11 gene is determined according to the characteristic bands of the electrophoretogram. The specific determination criteria are as follows: When there is a 310 bp band and no 250 bp band in the electrophoretogram, the genotype of the sample at the rs5219 polymorphic site is wild type homozygote TT; When there are both 310 bp band and 250 bp band in the electrophoretogram, the genotype of the sample at the rs5219 polymorphic site is heterozygote TC; When there is no 310 bp band and there is 250 bp band in the electrophoretogram, the genotype of the sample at the rs5219 polymorphic site is mutant homozygote CC.

Images