A polyclonal antibody of nka-alpha protein of oyster from hong kong, its preparation method and application
By preparing a polyclonal antibody against Hong Kong oyster NKA-α with high affinity and specificity, the problem of lack of specific detection tools in existing technologies has been solved, enabling efficient detection and research of Hong Kong oyster NKA-α protein.
Patent Information
- Application Number
- CN202610142210.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-02
- Publication Date
- 2026-06-26
- Estimated Expiration
- 2046-02-02
Smart Images

Figure CN121627896B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a polyclonal antibody against Hong Kong oyster NKA-α protein, its preparation method, and its application. Background Technology
[0002] Hong Kong Oysters ( Crassostrea hongkongensis *Triplophysa* is an important marine aquaculture species in the coastal areas of South my country, mainly distributed in estuaries and nearshore waters of Guangdong and Guangxi. Its growth and aquaculture are constantly affected by changes in environmental factors, with salinity fluctuations being one of the most significant abiotic stressors. Salinity changes directly affect the distribution of ions and osmotic pressure homeostasis within the shellfish, thus significantly impacting its physiological activities and survival.
[0003] Under salinity stress, mollusks primarily maintain osmotic balance by regulating ion transport processes. Sodium-potassium ATPase (Na+) + / K + -ATPase (NKA) is a class of ion transport proteins widely distributed on cell membranes, capable of driving Na+ transport via ATP hydrolysis. + and K + Active transmembrane transport of NKA plays a crucial role in maintaining intracellular and extracellular ion gradients and osmotic homeostasis. Previous studies have shown that changes in environmental salinity can induce alterations in NKA activity and the expression levels of its encoding genes in the gill tissues of oysters and other shellfish, suggesting that this protein is involved in salinity adaptation.
[0004] NKA proteins are typically composed of multiple subunits, with the α subunit being a key structural unit for catalytic function and ion transport activity. Its expression level and localization characteristics are considered closely related to ion regulation capabilities. However, current research on the Hong Kong oyster NKA-α subunit mainly focuses on gene expression or enzyme activity levels, lacking molecular tools for specific detection and analysis at the protein level. In particular, specific polyclonal antibodies against Hong Kong oyster NKA-α protein have not yet been established, which limits its application in protein expression detection, tissue localization, and related physiological studies.
[0005] Therefore, developing a polyclonal antibody that can specifically recognize the NKA-α protein of Hong Kong oysters is of great significance for improving the methods of protein level research. Summary of the Invention
[0006] In view of the lack of specific detection tools for Hong Kong oyster NKA-α protein in the existing technology, the present invention provides a polyclonal antibody with high affinity and high specificity for Hong Kong oyster NKA-α protein and its preparation method.
[0007] In a first aspect, the present invention provides a method for preparing a polyclonal antibody against Hong Kong oyster NKA-α protein, comprising the following steps:
[0008] S1. Using bioinformatics analysis, the amino acid sequence of the NKA-α protein suitable as an antigen fragment is obtained, and a recombinant expression vector containing the NKA-α target gene fragment corresponding to the amino acid sequence is constructed; the amino acid sequence of the NKA-α protein is shown in SEQ ID NO.1;
[0009] S2. The recombinant expression vector was transformed into competent cells to construct a recombinant expression strain, and the strain was induced to express the fusion protein. The NKA-α recombinant protein was collected and purified.
[0010] S3. Animals were immunized with recombinant NKA-α protein as an antigen, and antiserum was collected, separated, and purified to obtain polyclonal antibody against Hong Kong oyster NKA-α protein.
[0011] In one or more embodiments, the amino acid sequence suitable as an antigen fragment in step S1 is shown in SEQ ID NO.2; the sequence of the NKA-α target gene fragment is shown in SEQ ID NO.3.
[0012] In one or more embodiments, the expression vector in step S1 is pET-30a.
[0013] In one or more embodiments, in step S1, the NKA-α target gene fragment as shown in SEQ ID NO.3 is recombined between the double restriction sites of the pET-30a vector; the double restriction sites are SacⅠ and XhoⅠ.
[0014] In one or more embodiments, the method for inducing expression of the fusion protein in step S2 is as follows: the constructed recombinant expression strain is picked and cultured in LB liquid medium until the bacterial concentration reaches OD0. 600 After adding IPTG to the bacterial culture at a concentration of 0.6-0.8, the expression of the fusion protein is induced. The final concentration of IPTG in the bacterial culture is 0.2-0.5 mM.
[0015] In one or more embodiments, the animal immunization treatment method in step S3 is as follows:
[0016] (1) First immunization: After thoroughly mixing the purified NKA-α recombinant protein with Freund's complete adjuvant, perform multiple subcutaneous immunizations on the back of the animal;
[0017] (2) Secondary immunization: Two weeks after the first immunization, the purified NKA-α recombinant protein was thoroughly emulsified and mixed with Freund's incomplete adjuvant, and then administered to multiple sites subcutaneously on the back of the animal.
[0018] (3) Three immunizations: Two weeks after the second immunization, the purified NKA-α recombinant protein was thoroughly emulsified and mixed with Freund's incomplete adjuvant, and then immunized at multiple points subcutaneously on the back of the animal.
[0019] In one or more embodiments, the animal subjected to immunization in step S3 is a New Zealand white rabbit.
[0020] Secondly, the present invention provides a polyclonal antibody against Hong Kong oyster NKA-α protein, wherein the polyclonal antibody is prepared by any of the preparation methods described in the present invention.
[0021] Thirdly, the present invention provides the application of the polyclonal antibody in detecting NKA-α protein expression in Hong Kong oysters.
[0022] The polyclonal antibody described in this invention can be used in various immunological detection methods to detect NKA-α protein in Hong Kong oysters, including but not limited to the Western blot method.
[0023] In one or more embodiments, the polyclonal antibody described in this invention is used to detect the expression of NKA-α protein in the gill tissue of Hong Kong oysters.
[0024] In one or more embodiments, the application is as follows: using the polyclonal antibody described in this invention as a primary antibody to specifically bind to the NKA-α protein in the Hong Kong oyster sample to be tested, and realizing the detection and analysis of the expression of NKA-α protein in Hong Kong oysters by secondary antibody color development or signal detection.
[0025] Fourthly, the present invention provides a kit for detecting NKA-α protein expression in Hong Kong oysters, the kit comprising the polyclonal antibody described in the present invention.
[0026] Compared with the prior art, the present invention has the following advantages:
[0027] The polyclonal antibody against Hong Kong oyster NKA-α prepared by this invention has high affinity and can specifically recognize the NKA-α protein in Hong Kong oysters. It can be widely used in the biological immunoassay of Hong Kong oysters and is of great importance to the research of Hong Kong oysters. Attached Figure Description
[0028] Figure 1 This is a schematic diagram of the nucleotides and amino acids of the NKA-α polypeptide fragment selected after antigen epitope analysis.
[0029] Figure 2 This is a schematic diagram showing the predicted transmembrane region of the NKA-α protein in Hong Kong oysters.
[0030] Figure 3This is a schematic diagram of the analysis results of the NKA-α protein signal peptide in Hong Kong oysters.
[0031] Figure 4 This is a schematic diagram illustrating the predicted hydrophilicity and hydrophobicity of the NKA-α protein in Hong Kong oysters.
[0032] Figure 5 This is a schematic diagram illustrating the predicted results of the intrinsic disorder region of the NKA-α protein in Hong Kong oysters.
[0033] Figure 6 This is a schematic diagram illustrating the predicted nuclear localization sequence of the NKA-α protein in Hong Kong oysters.
[0034] Figure 7 This is an image showing the SDS-PAGE and Western Blot results of the Hong Kong oyster pET-30a-NKAα recombinant expression strain; where M represents the standard protein maker, lane 1 on the left is the uninduced sample, lanes 2-6 on the left are the induced samples, and lane 3 on the right is the Western Blot detection result of the recombinant protein.
[0035] Figure 8 This is an SDS-PAGE result of purified pET-30a-NKAα recombinant protein from Hong Kong oysters; where M represents the standard protein maker, lane 1 is the precipitate after disruption, lane 2 is the supernatant after disruption, lane 3 is the breakthrough buffer, lane 4 is the recombinant protein before purification, and lane 5 is the recombinant protein after purification.
[0036] Figure 9 These are immunoblot images of NKA-α protein from Hong Kong oysters; lanes 1-2 are gill tissue samples from Hong Kong oysters treated in seawater at salinity 6 for 8 hours, lanes 3-4 are gill tissue samples from Hong Kong oysters treated in seawater at salinity 18 for 8 hours, and lanes 5-6 are gill tissue samples from Hong Kong oysters treated in seawater at salinity 30 for 8 hours. Detailed Implementation
[0037] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.
[0038] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention. The following embodiments regarding antigen design and preparation are only used to illustrate one method of obtaining polyclonal antibodies in the present invention and do not constitute a limitation on the source, sequence segment, or preparation method of the antigen. Any antigen or fragment thereof that can induce an immune response against Hong Kong oyster NKA-α protein should be considered to fall within the scope of protection of the present invention. The types of immunized animals, immunization doses, immunization times, immunization intervals, and adjuvant types involved in the embodiments are all exemplary embodiments of the present invention and do not constitute a limitation on the scope of protection of the present invention.
[0039] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0040] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.
[0041] Example 1: Bioinformatics Analysis of NKA-α Protein
[0042] To evaluate the expression potential of the NKA-α protein (amino acid sequence shown in SEQ ID NO.1) as an immunogen, this embodiment employed various bioinformatics tools (as shown in Table 1) to predict and analyze its physicochemical properties. Bioinformatics analysis was used to predict and analyze the protein's transmembrane structure, signal peptide, hydrophilic / hydrophobic distribution, inherent disordered regions, and potential nuclear localization sequences, providing a reference for antigen fragment screening.
[0043] Table 1 Online tools for bioinformatics analysis of NKA-α protein
[0044]
[0045] The results are as follows Figure 2-6The figures show the predicted transmembrane region, signal peptide analysis, hydrophilicity / hydrophobicity prediction, intrinsic disorder region prediction, and nuclear localization sequence prediction results for the NKA-α protein from Hong Kong oysters. The results indicate that the NKA-α protein consists of 1034 amino acids with a molecular weight of approximately 114.4 kDa. The signal peptide prediction results suggest a low probability of its presence. Transmembrane structure analysis confirms that it is a transmembrane protein with a disorder region. The nuclear localization sequence is located at amino acid positions 29 to 39.
[0046] Based on the above analysis results, and considering factors such as antigenicity, structural stability, and expression feasibility, this embodiment selects a fragment of the NKA-α protein located at amino acid positions 400–750 (…). Figure 1 (The amino acid sequence is shown in SEQ ID NO. 2) is used as an immunogenic antigen.
[0047] It should be understood that the above-mentioned segment selected in this embodiment is only a preferred option, and other segments derived from NKA-α protein that have immunogenicity can also be used for the preparation of the polyclonal antibody of this invention.
[0048] Example 2: Construction of recombinant vector and protein expression and purification
[0049] (1) Total RNA was extracted from the gill tissue of Hong Kong oysters using an RNA extraction kit, and cDNA was synthesized by reverse transcription using the RNA as a template;
[0050] (2) The synthesized cDNA was used as a template for PCR amplification to obtain the target gene fragment of Hong Kong oyster NKA-α. The primer sequences used for PCR amplification are as follows:
[0051] ① Upstream primer: GAGCTC ATGGCGTCGACCAAGGTGAAATCGC (underlined sites indicate SacⅠ restriction sites);
[0052] ② Downstream primer: CTCGAG CACCTGGTATTTGTTGGTCGAGTTG (underlined indicates XhoⅠ restriction site);
[0053] (3) After purifying the amplification product obtained in step (2), double digestion was performed using restriction endonucleases SacⅠ and XhoⅠ. After purification, the digested product was ligated with the expression vector pET-30a(+) that was also double-digested to obtain the recombinant plasmid pET-30a-NKAα.
[0054] (4) The successfully constructed pET-30a-NKAα recombinant plasmid was transformed into Escherichia coli BL21(DE3) competent cells to obtain a recombinant expression strain containing the sequence shown in SEQ ID NO.3;
[0055] (5) The constructed recombinant expression strain was picked and placed in LB liquid medium and cultured at 37°C for 4 h until the bacterial concentration reached OD600. 600 After adding 0.6-0.8 mg of the solution, IPTG was added to a final concentration of 0.5 mM, and the mixture was incubated at 37°C for 4 hours to induce fusion protein expression. After induction, the bacterial culture was collected, and samples were prepared for SDS-PAGE electrophoresis and Western blot analysis. The results are shown below. Figure 7 As shown, the recombinant expression strain was induced normally, and the target gene fragment carried by the vector was expressed normally and its size was consistent with the expectation;
[0056] (6) Following step (5), the recombinant expression strain was cultured in LB medium to a volume of 2L, and induced at 37℃ for 4h. The bacterial concentration OD 600 The concentration was 0.6-0.8. IPTG was added to a final concentration of 0.2 mM. After induction at 15°C for 16 hours, the bacterial cells were collected by centrifugation, washed twice with PBS, and resuspended. The cells were then sonicated and centrifuged to collect the supernatant crude protein. Subsequently, Ni column affinity chromatography was performed for purification. The protein eluted with imidazole (250 mM) was collected as the purified NKA-α recombinant protein, which was used as the antigen. The purified protein was analyzed by SDS-PAGE electrophoresis. The results are as follows: Figure 8 As shown, the target protein was well expressed, with clear bands, and the size of the target protein was consistent with the predicted results. After purification, the antigen protein was dialyzed to remove impurities and small molecules, then aseptically filtered, and its protein concentration was measured. Subsequently, it was stored at low temperature for later use.
[0057] Example 3: Preparation of NKA-α protein polyclonal antibody by animal immunization treatment
[0058] The recombinant NKA-α protein prepared in Example 2 was used as an antigen to immunize New Zealand white rabbits. The specific process is as follows:
[0059] Three healthy 4-month-old female New Zealand white rabbits (2.1 kg each) were immunized with recombinant NKA-α protein from Hong Kong oysters. The immunization dose was 200 μg / rabbit, injected subcutaneously into the back. The NKA-α antigen peptide was mixed with an equal volume of complete Freund's adjuvant. The first immunization used complete Freund's adjuvant, while the second and third immunizations used incomplete Freund's adjuvant. The immunization interval was 2 weeks, with 3 immunizations administered. The injections were performed subcutaneously at 5 points on the rabbit's back, and blood was collected venously to obtain polyclonal antibody serum. Each booster immunization used an emulsion of antigen and incomplete Freund's adjuvant. One week after the last booster immunization, 1 ml of blood was collected from the ear vein to test the antiserum titer. One week later, when the antiserum titer met the requirements, whole blood was collected from the carotid artery. After incubating at room temperature for 1 hour, incubating at 4°C for 1 hour, and centrifuging at 12,000 rpm for 10 minutes, the polyclonal antibody serum targeting NKA-α was collected.
[0060] After separation and purification, NKA-α polyclonal antibody was obtained. The specific separation and purification steps are as follows:
[0061] (1) Preparation of antigen affinity column: Take 3 mg of antigen and add it to 2 ml of equilibrated chromatography (containing blocking buffer and coupling elution buffer) empty column. Shake and react at room temperature for 1 hour. After standing at room temperature for 15 minutes, wash the packing with coupling buffer. Then add 2 column volumes of blocking buffer, shake and react at room temperature for 30 minutes, and incubate for 30 minutes. After draining the blocking buffer, add 10 column volumes of washing buffer, store in 2 column volumes of sealing buffer, and store at 4℃.
[0062] (2) Antibody affinity purification: Take 10-12 ml of rabbit serum prepared in this example, centrifuge (8000 r / min, 20 min), filter, take 10 ml for antigen affinity loading onto the column (antigen affinity column prepared in (1)), collect the flow-through, repeat the column loading once, wash with 5 times the column bed volume of equilibration buffer, add elution buffer, collect the eluted antibody; repeat this step until no more antibody is eluted from the elution buffer. Dialyze the eluted antibody into PBS, and use an ultrafiltration tube to concentrate the dialysate to obtain Hong Kong oyster NKA-α polyclonal antibody. The concentrated and purified antibody was determined according to the serum antibody titer detection method, and the NKA-α polyclonal antibody titer was 64 KB (as shown in Table 2).
[0063] Table 2. Results of antibody ELISA titer assay
[0064]
[0065] Example 4: Application of NKA-α polyclonal antibody
[0066] The expression of NKA-α protein in Hong Kong oysters was detected using the NKA-α polyclonal antibody prepared in Example 3. The specific steps are as follows:
[0067] (1) Take gill tissue samples of Hong Kong oysters stored at -80℃, add an appropriate amount of cell lysis buffer for homogenization, and repeatedly pipette to fully lyse the tissue. Add SDS loading buffer to the lysed sample, mix thoroughly, and place in a 37℃ water bath for 10 min;
[0068] (2) The denatured protein samples were separated by SDS-PAGE electrophoresis. After electrophoresis, the proteins in the gel were transferred to the PVDF membrane by wet transfer. The transfer conditions were constant current 300 mA and transfer time 40 min.
[0069] (3) After the transfer was completed, the PVDF membrane was placed in blocking solution containing 5% bovine serum albumin (BSA) and blocked at room temperature for 2 hours to reduce non-specific binding. After blocking, purified polyclonal antibody against Hong Kong oyster NKA-α protein was added as the primary antibody, diluted at a ratio of 1:10000, and incubated overnight at 4°C to allow it to specifically bind to the target protein on the membrane.
[0070] (4) After the primary antibody incubation was completed, the primary antibody solution was recovered, and the membrane was washed three times with 1×TBST for 10 min each time. Then, HRP-labeled goat anti-rabbit IgG was added as secondary antibody, and the membrane was incubated at room temperature for 1 h. After the secondary antibody incubation was completed, the secondary antibody solution was recovered, and the membrane was washed three times again with 1×TBST for 10 min each time;
[0071] (5) After washing the membrane, the membrane was colored by ECL chemiluminescence reagent and the signal was acquired by chemiluminescence imaging system. The NKA-α protein band of Hong Kong oyster was detected and analyzed to evaluate the binding of the prepared polyclonal antibody to NKA-α protein.
[0072] Figure 9 This is a Western blotting image showing the specific binding of the Hong Kong oyster NKA-α polyclonal antibody to NKA-α in this embodiment. The results show that the Hong Kong oyster NKA-α polyclonal antibody prepared in this invention can detect the target band corresponding to its protein molecular weight. This indicates that the Hong Kong oyster NKA-α polyclonal antibody prepared in this invention has high affinity and can specifically recognize the NKA-α protein in Hong Kong oysters, and can be widely used in the biological immunoassay of Hong Kong oysters.
[0073] Although the present invention has been described in detail through the above preferred embodiments, it should be understood that the above...
[0074] The description should not be considered a limitation of the invention. Various modifications and substitutions to the invention will be apparent to those skilled in the art after reading the foregoing. Therefore, the scope of protection of the invention should be defined by the appended claims.
Claims
1. A method for preparing a polyclonal antibody against Hong Kong oyster NKA-α protein, characterized in that, Includes the following steps: S1. Using bioinformatics analysis, the amino acid sequence of the NKA-α protein suitable as an antigen fragment is obtained, and a recombinant expression vector containing the NKA-α target gene fragment corresponding to the amino acid sequence is constructed; the amino acid sequence of the NKA-α protein is shown in SEQ ID NO.1; S2. The recombinant expression vector was transformed into competent cells to construct a recombinant expression strain, and the strain was induced to express the fusion protein. The NKA-α recombinant protein was collected and purified. S3. The recombinant NKA-α protein was used as an antigen to immunize animals. The animals immunized were New Zealand white rabbits. Antiserum was collected, separated, and purified to obtain polyclonal antibody against Hong Kong oyster NKA-α protein. The amino acid sequence suitable as an antigen fragment in step S1 is shown in SEQ ID NO.2; the sequence of the NKA-α target gene fragment is shown in SEQ ID NO.
3.
2. The preparation method according to claim 1, characterized in that, The expression vector in step S1 is pET-30a.
3. The preparation method according to claim 1, characterized in that, The method for inducing the expression of the fusion protein in step S2 is as follows: the constructed recombinant expression strain is picked and cultured in LB liquid medium until the bacterial concentration reaches OD0. 600 After adding IPTG to the bacterial culture at a concentration of 0.6-0.8, the expression of the fusion protein is induced. The final concentration of IPTG in the bacterial culture is 0.2-0.5 mM.
4. The preparation method according to claim 1, characterized in that, The animal immunization treatment method in step S3 is as follows: (1) First immunization: After thoroughly mixing the purified NKA-α recombinant protein with Freund's complete adjuvant, perform multiple subcutaneous immunizations on the back of the animal; (2) Secondary immunization: Two weeks after the first immunization, the purified NKA-α recombinant protein was thoroughly emulsified and mixed with Freund's incomplete adjuvant, and then administered to multiple sites subcutaneously on the back of the animal. (3) Three immunizations: Two weeks after the second immunization, the purified NKA-α recombinant protein was thoroughly emulsified and mixed with Freund's incomplete adjuvant, and then immunized at multiple points subcutaneously on the back of the animal.
5. A polyclonal antibody against Hong Kong oyster NKA-α protein, characterized in that, The polyclonal antibody is prepared by the preparation method according to any one of claims 1-4.
6. The use of the polyclonal antibody according to claim 5 in detecting NKA-α protein expression in Hong Kong oysters.
7. The application as described in claim 6, characterized in that, The polyclonal antibody was used as the primary antibody to specifically bind to the NKA-α protein in the Hong Kong oyster sample to be tested. The expression of NKA-α protein in Hong Kong oysters was detected and analyzed by secondary antibody color development or signal detection.
8. A kit for detecting NKA-α protein expression in Hong Kong oysters, characterized in that, The kit contains the polyclonal antibody as described in claim 5.