Bacillus engineering bacterium with high yield of siderophore bacillus and application of bacillus engineering bacterium

Abstract

The invention relates to the field of synthetic biology and microbial engineering, in particular to a bacillus engineering bacterium with high yield of siderophore bacillus and application of the bacillus engineering bacterium. According to the invention, the yield of the siderophore Bacillus licheniformis is increased in the Bacillus licheniformis DW2 by means of metabolic engineering for the first time, and efficient de novo synthesis of the siderophore Bacillus licheniformis is realized. The strain is expected to provide a biological control inoculant and a bioremediation agent with the performance obviously better than that of a natural strain, and a brand new and efficient technical scheme is provided for solving the problem of soil-borne diseases in agricultural production, reducing the use of chemical pesticides, remediating heavy metal contaminated soil and regulating and controlling healthy micro-ecology of rhizosphere. The method has an important theoretical value and a wide application prospect.

Description

Technical Field

[0001] This invention relates to the fields of synthetic biology and microbial engineering, specifically to a Bacillus strain that produces high levels of the bacillibactin and its applications. The applicant has used metabolic engineering techniques to directionally modify the bacillibactin biosynthesis pathway of Bacillus strains to construct a genetically engineered strain that produces high levels of this bacillibactin. Technical Background

[0002] Iron is an essential micronutrient for the vast majority of organisms. In aerobic and neutral pH environments, iron mainly exists in the form of ferric iron (Fe³⁺), which is difficult for organisms to utilize directly, leading to a severe shortage of bioavailable iron in the environment. To address this limitation, microorganisms and plants have evolved a strategy of secreting siderophores. Siderophores are a class of low-molecular-weight, high-affinity iron chelators that specifically complex Fe³⁺ in the environment, forming soluble complexes that can be recognized and absorbed by organisms, thereby solving the iron limitation problem. This process is not only central to the survival competition among microorganisms but also significantly influences plant nutrient absorption, host-pathogen interactions, and even global element cycling.

[0003] Among numerous heparamitas, Bacillibactin, secreted by Bacillus bacteria, is a typical catechol-type heparamita. Its biosynthesis is accomplished via a non-ribosomal peptide synthase (NRPS) pathway encoded by the highly conserved dhbACEBF operon. This gene cluster is ubiquitous and highly conserved in strains such as Bacillus subtilis, Bacillus amyloliquefaciens, and Bacillus licheniformis. Bacillibactin exhibits a very high affinity for Fe³⁺, making it a crucial player in microbial iron competition. Studies have shown that Bacillibactin-mediated iron chelation effectively inhibits the growth of several important soil-borne plant pathogens, including Fusarium oxysporum and Ralstonia solanacearum. It significantly influences the structure and function of the rhizosphere microbial community through iron competition or by generating indirect antibacterial activity, serving as a key regulator of shared iron sources in the rhizosphere environment.

[0004] Based on the aforementioned mechanisms, biocontrol using naturally occurring Bacillibactin-producing Bacillus strains has become a research hotspot. However, the Bacillibactin yield of natural strains is strictly limited by environmental and metabolic regulation, and its efficacy is often unstable in complex field environments, hindering its large-scale commercial application. Currently, there are no publicly reported studies on the systematic metabolic engineering strategies used to modify Bacillus strains to remove endogenous regulation, enhance precursor supply, and optimize the synthetic pathway, thereby achieving efficient Bacillibactin synthesis. This technological gap presents a significant challenge to developing engineered strains with stable and efficient iron competition and biocontrol capabilities. Meanwhile, Bacillibactin's high metal affinity also demonstrates great potential in the remediation of heavy metal-contaminated environments and in preventing plant yellowing, but its practical application is also limited by natural yield, making it difficult to meet engineering requirements. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention aims to construct a high-yield and stable-yield recombinant Bacillus licheniformis engineered strain by rationally designing and metabolically engineering the Bacillibactin biosynthetic pathway.

[0006] Another object of the present invention is to provide the application of the above-mentioned engineered strains.

[0007] To achieve the above objectives, the present invention adopts the following technical measures:

[0008] A high-yielding and stable-yielding recombinant Bacillus licheniformis engineered strain, wherein the promoters of the dhbACEBF, aroB, aroC, aroE and menF genes in the Bacillibactin synthase gene cluster of Bacillus licheniformis are all replaced with promoter PbacA, the ymfE gene is introduced exogenously, and the aroH, feuA and besA genes are deleted. The protein sequence encoded by the ymfE gene is shown in SEQ ID NO.2.

[0009] One of the polynucleotide sequences of the ymfE gene is shown in SEQ ID NO.1.

[0010] All Bacillus licheniformis species possessing the Bacillibactin synthase gene cluster can complete this invention.

[0011] The preferred Bacillus licheniformis strain described above is Bacillus licheniformis DW2 (CN116656712A). In Bacillus licheniformis DW2, the sequence of the promoter PbacA is shown in SEQ ID NO.3, and the genes for aroH, feuA, and besA are shown in SEQ ID NO.4~6, respectively.

[0012] The application of the above-mentioned recombinant Bacillus licheniformis in the production of bacillibactin.

[0013] The above-mentioned recombinant Bacillus licheniformis was used in the preparation of biocontrol inoculants.

[0014] The above-mentioned recombinant Bacillus licheniformis was used in the preparation of bioremediation agents.

[0015] The preferred bioremediation agent described above is Fe. 3+ Cu 2+ Mn 2+ and / or Co 2+ Heavy metal pollution remediation agents.

[0016] The above-mentioned recombinant Bacillus licheniformis was used to regulate the rhizosphere health microecology.

[0017] In the above-described applications, it is preferred to inoculate the recombinant Bacillus licheniformis into a Bacillibactin fermentation medium to prepare Bacillibactin. The preferred Bacillibactin fermentation medium comprises: 30-80 g / L sucrose, 5-20 g / L glycerol, 8-12 g / L sodium citrate, 1.0-2.0 g / L potassium dihydrogen phosphate (6-20 g / L), 0.5-2.0 g / L magnesium sulfate, 0.01-0.03 g / L ferric chloride, 0.01-0.03 g / L manganese sulfate, 0.01-0.03 g / L calcium chloride, pH 7.0, with the remainder being water.

[0018] In the above-described application of bacillibactin in the production of bacillibactin, preferably, the fermentation process employs a fed-batch fermentation method.

[0019] The above-described application, specifically the fed-batch fermentation process, includes: cultivation at 35-38℃. During the 0-48 hour fermentation period, the pH is controlled at 7.0-7.2, and the dissolved oxygen at 20%-40%. When the sucrose concentration is below 20 g / L, sucrose is added to maintain a concentration of not less than 15 g / L.

[0020] Compared with the prior art, the present invention has the following advantages:

[0021] 1. This invention is the first to discover that Bacillus licheniformis has a higher capacity to produce Bacillibactin.

[0022] 2. This invention is the first to discover that Bacillus licheniformis lacking the aroH, feuA, and besA genes can further increase the production of Bacillibactin.

[0023] 3. This invention is the first to improve the yield of bacillibactin in Bacillus licheniformis DW2 through metabolic engineering, achieving efficient de novo synthesis of bacillibactin.

[0024] 4. This strain is expected to provide a biocontrol inoculant and bioremediation agent with significantly better performance than natural strains, offering a novel and efficient technical solution for solving soil-borne diseases in agricultural production, reducing the use of chemical pesticides, remediating heavy metal-contaminated soil, and regulating rhizosphere health microecology. It has important theoretical value and broad application prospects. Attached Figure Description

[0025] Figure 1 Results of Bcillibactin synthesis by shake-flask fermentation of Bacillus licheniformis DW2, B1, B2, B3, B4, B5, B6, B7, B8 and B9.

[0026] Figure 2 Results of batch fermentation process curve detection for recombinant Bacillus licheniformis B9 in a 5L fermenter. Detailed Implementation

[0027] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application. Reagents not specifically described in detail herein are all conventional reagents and are commercially available; methods not specifically described in detail are all conventional experimental methods and can be learned from the prior art.

[0028] The method for determining Bacillibactin is as follows:

[0029] The content of bacillibactin in the sample was determined using the Arnow method. 1 mL of fermentation broth supernatant was taken, and 0.5 M hydrochloric acid and 1 mL of 10% sodium molybdate-sodium nitrite solution were added. Then, 1 mL of 1 M sodium hydroxide solution was added. The color turned red, and a characteristic absorption peak was observed at 510 nm using a UV spectrophotometer. A standard curve was prepared using 2,3-dihydroxybenzoic acid as described above.

[0030] In this example, the starting strain was Bacillus licheniformis DW2, with accession number CCTCC NO: M2011344.

[0031] The present invention will be further described below with reference to embodiments:

[0032] Example 1:

[0033] Construction of different recombinant Bacillus licheniformis:

[0034] In its preliminary work, the applicant explored the Bacillibactin production potential of Bacillus licheniformis DW2, Bacillus licheniformis WX-02, Bacillus amyloliquefaciens Hz-12, and Bacillus subtilis 168, and found that the Bacillus licheniformis DW2 strain has the most stable and highest Bacillibactin production capacity.

[0035] 1) Construction of strain B1 with the promoter of the Bacillibactin synthase gene cluster dhbACEBF replaced by PbacA:

[0036] Step 1: Based on the dhbACEBF sequence in the Bacillus licheniformis DW2 genomic DNA sequence, primers (dhbACEBF-AF, dhbACEBF-AR, dhbACEBF-BF, and dhbACEBF-BR) were designed to amplify the upstream and downstream homologous arms A (540 bp) and B (543 bp) of dhbACEBF; based on the PbacA sequence in the Bacillus licheniformis DW2 DNA sequence, primers (PbacA-F and PbacA-R) were designed to amplify the promoter PbacA (333 bp); among them, the primers for dhbACEBF-AF, dhbACEBF-AR, PbacA-F, PbacA-R, dhbACEBF-BF, and dhbACEBF-BR are as follows:

[0037] dhbACEBF-AF:GATCTTTTCTACGAGCTCGGAAGTCCGTCCATCCAT

[0038] dhbACEBF -AR:TCTCGCCGAAATCGCAGGTCTTATCATTTCCTTTCT

[0039] PbacA-F:GAGATTCAAGCCCGGGTCT

[0040] PbacA-R:ATAAAAATTCTCCTTTTGA

[0041] dhbACEBF-BF: ACAAAGGGGGAGATTTGTGTGAAAGGCAAGGTTGCT

[0042] dhbACEBF -BR:AACGAATTCCTGCAGCCCGCGTATCGGTTGATCCGG

[0043] Step 2: The upper homologous arm of dhbACEBF, PbacA and the lower homologous arm of dhbACEBF are ligated together by overlap extension PCR (the primers used are dhbACEBF-AF and dhbACEBF-BR) to form the target gene fragment (1416 bp).

[0044] Step 3: Design primers (T2-T5-F and T2-T5-R) to amplify the backbone using plasmid T2(2)-ori as a template; wherein, the primers for T2-T5-F and T2-T5-R are:

[0045] T2-T5-F:GAGCTCGTAGAAAAGATCAAAGG

[0046] T2-T5-R: GGGCTGCAGGAATTCGTTAA

[0047] Step 4: Using a one-step cloning kit, ligate the gene fragment and linear plasmid fragment obtained in Steps 2 and 3. Transform the ligation product into *E. coli* DH5α using the calcium chloride transformation method. Screening is performed at 37°C on a medium containing kanamycin resistance to obtain transformants. Plasmids from the transformants are then selected for colony PCR verification (primers used: T2-F and T2-R). If an electrophoretic band appears at 1704 bp, the knockout vector has been successfully constructed, and the transformants are considered positive transformants, named vector T2-PbacA-dhbACEBF.

[0048] The one-step cloning kit was manufactured by Novizan; the sequences of T2-F and T2-R are:

[0049] T2-F: atgtgataactcggcgta

[0050] T2-R: gcaagcagcagattacgc

[0051] Step 5: Transform the vector T2-PbacA-dhbACEBF into Bacillus licheniformis DW2, and screen for transformants at 37°C in a medium containing kanamycin resistance. Transformants were obtained, and plasmids from the transformants were selected for colony PCR verification (primers used: T2-F and T2-R).

[0052] Step 6: The positive transformants obtained in Step 5 were cultured three times at 45°C on a medium containing cannabinoid resistance, each time for 12 hours. Colony PCR was performed using T2-F and dhbACEBF-YR primers to detect the single-exchange strain. A band of 1208 bp in length was amplified, which proved that it was a single-exchange strain.

[0053] The sequence of dhbACEBF-YR is as follows:

[0054] dhbACEBF-YR: TACTCGGCAAGTTCAAGGCC

[0055] Step 7: The single-crossover strain obtained in Step 6 was inoculated and cultured in a kanamycin-free medium at 37°C for several transfections. Transformants were selected for colony PCR verification (primers were PbacA-YF and dhbACEBF-YR). If an electrophoretic band appeared at 918 bp, it indicated that the dhbACEBF gene promoter had been successfully replaced by PbacA. Subsequent DNA sequencing of positive transformants further verified the results, revealing a strain with a successfully double-crossover dhbACEBF gene promoter replaced by PbacA, namely Bacillus licheniformis B1.

[0056] 2) Construction of strain B2 with promoter replacement aroB promoter

[0057] The upstream and downstream 500bp sequences of the aroB promoter were amplified using primers, serving as upper and lower homologous arms respectively. The PbacA promoter sequence was amplified using the promoter library in our laboratory as a template. The upper homologous arm, promoter, and lower homologous arm were fused. Primers (T2-T5-F and T2-T5-R) were designed, and the backbone was amplified using plasmid T2(2)-ori as a template. The fusion fragment and the linear plasmid fragment were ligated using a one-step cloning kit and transformed into *E. coli* DH5α competent cells. The recombinant plasmid T2-PbacA-aroB was obtained through PCR verification and sequencing analysis. The recombinant plasmid was electroporated into *Bacillus licheniformis* B1 for homologous recombination exchange. After screening and verification, strain B2 with the promoter replaced by the aroB promoter was obtained.

[0058] aroB-AF:TTTTTTATAACAGGAATTCTGATAGGTGGTATGTTTTCG

[0059] aroB-AR: TATATATTCCTCCTTTTCTAATATACCTATCACTTTATATGGG

[0060] PbacA-F:GAGATTCAAGCCCGGGTCT

[0061] PbacA-R:ATAAAAATTCTCCTTTTGA

[0062] aroB-BF: TCAAAAAGGAGAATTTTTATCCTGCGATTTCGGCGAG

[0063] aroB-BR: TATATATTCCTCCTTTTCTAATATACTCACCATAATATTGGTC

[0064] aroB-YR:TCATTTGCCTCCCTCCAA

[0065] 3) Construction of strain B3 with promoter replacement aroC promoter:

[0066] The upstream and downstream 500bp sequences of the aroC promoter were amplified using primers, serving as upper and lower homologous arms respectively. The PbacA promoter sequence was amplified using Bacillus licheniformis DW2 genomic DNA as a template. The upper homologous arm, promoter, and lower homologous arm were fused. Primers (T2-T5-F and T2-T5-R) were designed to amplify the backbone using plasmid T2(2)-ori as a template. The fusion fragment and linear plasmid fragment were ligated using a one-step cloning kit and transformed into Escherichia coli DH5α competent cells. PCR verification and sequencing analysis yielded the recombinant plasmid T2-PbacA-aroC. The recombinant plasmid was electroporated into Bacillus licheniformis B2 for homologous recombination exchange. Screening and verification yielded strain B3 with the promoter replaced by the aroC promoter.

[0067] aroC-AF:GATCTTTTCTACGAGCTCAGCGGTCAGCAGATAGCA

[0068] aroC-AR:CGTTTACCCTCTGTCTCGTTATTCTCTCTCCTGTCGCACTT

[0069] PbacA-F:GAGATTCAAGCCCGGGTCT

[0070] PbacA-R:ATAAAAATTCTCCTTTTGA

[0071] aroC-BF:ATTGAGGAGGTTGTTTCAATGAATACGGTTAAGATACGAGG

[0072] aroC-BR:AACGAATTCCTGCAGCCCGCCTCAAGCAACACCAGC

[0073] aroC-YR: GCTTCGCATACCGCTCAT

[0074] 4) Construction of strain B4 with promoter replacement of aroE promoter:

[0075] The upstream and downstream 500bp sequences of the aroE promoter were amplified using primers, serving as upper and lower homologous arms respectively. The PbacA promoter sequence was amplified using Bacillus licheniformis DW2 genomic DNA as a template. The upper homologous arm, promoter, and lower homologous arm were fused. Primers (T2-T5-F and T2-T5-R) were designed to amplify the backbone using plasmid T2(2)-ori as a template. The fusion fragment and linear plasmid fragment were ligated using a one-step cloning kit and transformed into E. coli DH5α competent cells. PCR verification and sequencing analysis yielded the recombinant plasmid T2-PbacA-aroE. The recombinant plasmid was electroporated into Bacillus licheniformis B3 for homologous recombination exchange. Screening and verification yielded strain B4 with the promoter replaced by the aroE promoter.

[0076] aroE-AF: CTGCAGCCCGGGGGATCCCGCCGTTACAAGCGTGAT

[0077] aroE-AR: AAAACATACCACCTATCAGTGTTCCACCTCAATCAG

[0078] PbacA-F:GAGATTCAAGCCCGGGTCT

[0079] PbacA-R:ATAAAAATTCTCCTTTTGA

[0080] aroE-BF:AGAAAGGAGGAATATATAATGAAAAGAGGAAAAAATC

[0081] aroE-BR:GATCTTTTCTACGAGCTCTCCGTTCCGTATGGTCTC

[0082] aroE-YR:TTGCAGGTCTGCAGGC

[0083] 5) Construction of strain B5 with promoter replacement menF promoter

[0084] The upstream and downstream 500bp sequences of the menF promoter were amplified using primers, serving as upper and lower homologous arms respectively. The PbacA promoter sequence was amplified using Bacillus licheniformis DW2 genomic DNA as a template. The upper homologous arm, promoter, and lower homologous arm were fused. Primers (T2-T5-F and T2-T5-R) were designed to amplify the backbone using plasmid T2(2)-ori as a template. The fusion fragment and linear plasmid fragment were ligated using a one-step cloning kit and transformed into Escherichia coli DH5α competent cells. PCR verification and sequencing analysis yielded the recombinant plasmid T2-PbacA-menF. The recombinant plasmid was electroporated into Bacillus licheniformis B4 for homologous recombination exchange. Screening and verification yielded strain B5 with the menF promoter replaced by the promoter.

[0085] menF-AF:CTGCAGCCCGGGGGATCAAAATCGGCAGCGTCTCTTC

[0086] menF-AR:CGAGCGTTACAGGGACAACCTGCGATTTCGGCGAGA

[0087] PbacA-F:GAGATTCAAGCCCGGGTCT

[0088] PbacA-R:ATAAAAATTCTCCTTTTGA

[0089] menF-BF: AAAAAGGAGAATTTTTATATGGTGACAACAGTGCAG

[0090] menF-BR:GATCTTTTCTACGAGCTGTCAGCATAGCGGTAGGA

[0091] menF-YR:CCTGCTCACTTTCGCCTC

[0092] 6) Construction of ymfE integrated expression strain B6:

[0093] The 500bp upstream and downstream sequences of the lanP promoter were amplified using primers, serving as upper and lower homologous arms, respectively. The PbacA promoter sequence was amplified using Bacillus licheniformis DW2 genomic DNA as a template, and the ymfE gene fragment was amplified using Bacillus subtilis 168 genomic DNA as a template. The upper homologous arm, promoter, ymfE gene fragment, and lower homologous arm were fused, and primers (T2-T5-F and T2-T5-R) were designed to amplify the backbone using plasmid T2(2)-ori as a template. The fused fragment and the linear plasmid fragment were ligated using a one-step cloning kit and transformed into Escherichia coli DH5α competent cells. The recombinant plasmid T2ΔlanP::PbacA-ymfE was obtained by PCR verification and sequencing analysis. The recombinant plasmid was electroporated into Bacillus licheniformis B5 for homologous recombination exchange, and after screening and verification, ymfE integrated expression strain B6 was obtained.

[0094] ymfE-AF:CTGCAGCCCGGGGGATCAGCAGGCGTTCAAGAT

[0095] ymfE-AR:AAAATAATACGCCAAATAACCAAAAAACATAATGACAC

[0096] PbacA-F:GAGATTCAAGCCCGGGTCT

[0097] PbacA-R:ATAAAAATTCTCCTTTTGA

[0098] ymfE-F:GTGTCATTATGTTTTTGGTTATTTGGCGTATTATTT

[0099] ymfE-R:CATCTAAAGCAGGAAGAGCCATTCCAATCCCAATCC

[0100] ymfE-BF:GGATTGGGATTGGAATGGCTCTTCCTGCTTTAGATG

[0101] ymfE-BR:GATCTTTTCTACGAGCTCTTCATCCCAGCCCATTC

[0102] ymfE-YF:AGGAGCTGTCAAGGGTCA

[0103] ymfE-YR:TTTCTCACGCACTTTCGG

[0104] 7) Construction of aroH knockout strain B7:

[0105] The upstream and downstream 500bp sequences of the aroH gene were amplified using primers, serving as upper and lower homologous arms, respectively. The upper and lower homologous arms were fused, and primers (T2-T5-F and T2-T5-R) were designed to amplify the backbone using plasmid T2(2)-ori as a template. The fusion fragment and the linear plasmid fragment were ligated using a one-step cloning kit and transformed into E. coli DH5α competent cells. The recombinant plasmid T2ΔaroH was obtained by PCR verification and sequencing analysis. The recombinant plasmid was electroporated into Bacillus licheniformis B6 for homologous recombination exchange, and the aroH knockout strain B7 was obtained by screening and verification.

[0106] aroH-AF:GATCTTTTCTACGAGCTCAATTGTCCTGTGACCGC

[0107] aroH-AR:AAGCGTCTACCGGATGAACATTTTTTAAGGGCGTGT

[0108] aroH-BF:ACACGCCCTTAAAAAATGTTCATCCGGTAGACGCTT

[0109] aroH-BR:AACGAATTCCTGCAGCCCGCAATCTCTTCAGCCGTT

[0110] aroH-YF:TTTCCCCTTTTTAAAAAT

[0111] aroH-YR:ATGAAATCACTTCAAATC

[0112] 8) Construction of feuA knockout strain B8:

[0113] The upstream and downstream 500bp sequences of the feuA gene were amplified using primers, serving as upper and lower homologous arms, respectively. The upper and lower homologous arms were fused, and primers (T2-T5-F and T2-T5-R) were designed to amplify the backbone using plasmid T2(2)-ori as a template. The fusion fragment and the linear plasmid fragment were ligated using a one-step cloning kit and transformed into E. coli DH5α competent cells. The recombinant plasmid T2ΔfeuA was obtained by PCR verification and sequencing analysis. The recombinant plasmid was electroporated into Bacillus licheniformis B7 for homologous recombination exchange, and the feuA knockout strain B8 was obtained through screening and verification.

[0114] feuA-AF: GCTGGACCGTCATCATTACGGCGACCTTGGCTTTGA

[0115] feuA-AR:CCGATAAACGAATAGCCCATTCCACGCTTCCCGTAAT

[0116] feuA-BF:ATTACGGGAAGCGTGGAATGGGCTATTCGTTTATCGG

[0117] feuA-BR:TTTGCCCAAGCTTCTAGAGGAAGAAAGGAACGCCGA

[0118] feuA-YF:TCACAGGAACAATGGAGGAA

[0119] feuA-YR:GGAAGAAAGGAACGCCGA

[0120] 9) Construction of besA knockout strain B9:

[0121] The upstream and downstream 500bp sequences of the besA gene were amplified using primers, serving as upper and lower homologous arms, respectively. The upper and lower homologous arms were fused, and primers (T2-T5-F and T2-T5-R) were designed to amplify the backbone using plasmid T2(2)-ori as a template. The fusion fragment and the linear plasmid fragment were ligated using a one-step cloning kit and transformed into E. coli DH5α competent cells. The recombinant plasmid T2ΔbesA was obtained by PCR verification and sequencing analysis. The recombinant plasmid was electroporated into Bacillus licheniformis B8 for homologous recombination exchange, and after screening and verification, besA knockout strain B9 was obtained.

[0122] besA-AF: GCTGGACCGTCATCATCGCTATTTCGCTGTACCTG

[0123] besA-AR:AAACAGGCTTGAAGGCAATGTGATTCTCCCTTCCCC

[0124] besA-BF:GGGGAAGGGAGAATCACATTGCCTTCAAGCCTGTTT

[0125] besA-BR:TTTGCCCAAGCTTCTACGTCTTCTCCCAATCTTCAT

[0126] besA-YF:GACAAGGAACGGACTGGC

[0127] besA-YR:GATCCTTCAATTACGCCTT

[0128] Example 2:

[0129] Different recombinant Bacillus licheniformis bacillibactin preparations were prepared by shake-flask fermentation:

[0130] Seed fermentation: Activated recombinant Bacillus licheniformis DW2, B1, B2, B3, B4, B5, B6, B7, B8, and B9 were picked from plates and inoculated into 250 mL Erlenmeyer flasks containing 30 mL of liquid LB. The flasks were incubated at 37°C and 230 rpm for 12 h. Subsequently, the inoculum was added to the fermentation medium at a rate of 3% (v / v).

[0131] The fermentation medium for Bacillibactin consisted of: sucrose 50 g / L, glycerol 5 g / L, sodium citrate 12 g / L, ammonium sulfate 6 g / L, potassium dihydrogen phosphate 1.0 g / L, magnesium sulfate 0.5 g / L, ferric chloride 0.02 g / L, manganese sulfate 0.01 g / L, calcium chloride 0.01 g / L, pH 7.0, with the remainder being water. The mixture was incubated at 37℃ and 230 rpm for 60 h. Bacillibactin yield was then measured after fermentation.

[0132] The results show that ( Figure 1 The control strain DW2 produced only 120.76 mg / L of Bacillibactin. Replacing the promoter of the synthase gene cluster dhbACEBF with the promoter PbacA significantly increased the Bacillibactin production to 406.93 mg / L. Strengthening the promoters aroB, aroC, aroE, and menF through promoter replacement yielded strain B5, increasing Bacillibactin production to 607.80 mg / L. Introducing ymfE from Bacillus subtilis 168 yielded strain B6, increasing Bacillibactin production to 650.42 mg / L. Subsequently, deleting aroH, feuA, and besA yielded strain B9, significantly increasing Bacillibactin production to 1030.00 mg / L. Therefore, strain B9 was selected for the next fermentation experiment.

[0133] Example 3:

[0134] Feed-batch fermentation of recombinant Bacillus licheniformis B9 to produce bacillibactin

[0135] Recombinant Bacillus licheniformis strain B9 was subjected to fed-batch fermentation in a 5L fermenter. The seed culture was obtained using the same method as in Example 3 above. A 10% inoculum was added to a bioreactor containing 2.25L of fermentation medium, the same as in Example 2. The culture was carried out at 37°C. During the 0–48 hours of fermentation, the pH was controlled at 7.0–7.2 with ammonia, the aeration rate was controlled at 1L / min, and the dissolved oxygen was controlled at 20%–40%. When the sucrose concentration fell below 20g / L, sucrose was added to maintain a concentration not lower than 15g / L.

[0136] The results are as follows Figure 2 As shown, B9 achieved a Bacillibactin yield of 348.4 mg / L after 12 h of fed-batch fermentation. The yield significantly increased between 12 and 24 h, indicating a rapid synthesis phase. The yield peaked at 2097.2 mg / L at 36 h, the highest level reported in the literature to date. This corresponds to a productivity of 58.26 mg / L / h, fully demonstrating the highly efficient synthetic capacity of the engineered strain.

[0137] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. A high-yielding and stable-yielding recombinant Bacillus licheniformis engineered strain, wherein the recombinant Bacillus licheniformis is derived from the Bacillibactin synthase gene cluster of Bacillus licheniformis. dhbACEBF , aroB, aroC, aroE and menF The promoters of all genes were replaced with promoter PbacA, and exogenous introduction was used. ymfE Genes, simultaneously missing aroH , feuA , besA Genes, the genes mentioned ymfE The encoded protein sequence is shown in SEQ ID NO.

2.

2. The engineered strain according to claim 1, wherein the Bacillus licheniformis is Bacillus licheniformis DW2, and the sequence of the promoter PbacA in Bacillus licheniformis DW2 is shown in SEQ ID NO.

3. aroH , feuA , besA The genes are shown in SEQ ID NO.4~6.

3. The use of the recombinant Bacillus licheniformis according to claim 1 in the production of bacillibactin.

4. The application of the recombinant Bacillus licheniformis according to claim 1 in the preparation of biocontrol inoculants.

5. The application of the recombinant Bacillus licheniformis according to claim 1 in the preparation of bioremediation agents.

6. The application according to claim 5, wherein the bioremediation agent is Fe. 3+ Cu 2+ Mn 2+ and / or Co 2+ Heavy metal pollution remediation agent.

7. The application of the recombinant Bacillus licheniformis according to claim 1 in regulating the rhizosphere healthy microecology.

8. The application according to claim 3, wherein the application process comprises inoculating the recombinant Bacillus licheniformis according to claim 1 into a Bacillibactin fermentation medium, wherein the Bacillibactin fermentation medium comprises: 30-80 g / L sucrose, 5-20 g / L glycerol, 8-12 g / L sodium citrate, 1.0-2.0 g / L potassium dihydrogen phosphate (6-20 g / L), 0.5-2.0 g / L magnesium sulfate, 0.01-0.03 g / L ferric chloride, 0.01-0.03 g / L manganese sulfate, 0.01-0.03 g / L calcium chloride, pH 7.0, with the remainder being water.

9. The application according to claim 8, wherein the fermentation adopts a fed-batch fermentation method.

10. The application according to claim 8, wherein the fed-batch fermentation process comprises: Cultivate at 35-38℃. Control the pH at 7.0-7.2 during the first 0-48 hours of fermentation, and at 5.2 during the last 48-72 hours. Maintain dissolved oxygen at 20%-40%. When the sucrose concentration is below 20 g / L, add sucrose and maintain the concentration at no less than 15 g / L.

Images