Retina photosensitive neuronal lesion zebra fish model and construction method thereof
By using sgRNA and Cas9 protein that specifically target the elovl2 gene in a zebrafish model, the problems of off-target effects and long screening cycles were solved, and a retinal lesion model with a clear genetic background was constructed, realizing an efficient and reliable disease simulation and drug screening tool.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-31
- Publication Date
- 2026-04-07
AI Technical Summary
Existing technologies for constructing zebrafish models of retinal diseases suffer from off-target effects, chimerism problems, and lengthy screening cycles, resulting in low model construction efficiency and difficulty in stably and uniformly reproducing the key pathological features of human diseases.
We used sgRNA specifically targeting the zebrafish elovl2 gene, combined with Cas9 protein or its mRNA, to introduce it into single-cell stage fertilized eggs via microinjection. We then performed precise screening and PCR amplification sequencing to ensure that gene mutations occurred at specific sites in the elovl2 gene, reducing off-target risks and constructing a retinal lesion model with a clear genetic background.
The study achieved a zebrafish model of retinal disease with a clear genetic background and reliable phenotype, which can simulate the pathogenesis of human retinal photoreceptor neurons with high fidelity, providing a stable and reliable biological tool for disease mechanism research and drug screening.
Smart Images

Figure CN121801910A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering, and more specifically, to a zebrafish model of retinal photoreceptor neuron lesions and its construction method. Background Technology
[0002] Genetic engineering technologies, especially gene editing technologies represented by CRISPR / Cas9, can precisely modify specific genes in organisms at the molecular level, providing crucial technical support for the study of gene function and human hereditary diseases. By replicating specific pathogenic gene mutations in model organisms, animal models that highly mimic the pathological characteristics of human diseases can be constructed. These genetically engineered animal models are not only fundamental tools for in-depth analysis of disease pathogenesis but also provide important preclinical validation platforms for evaluating the efficacy and safety of candidate drugs, thus significantly accelerating the translation process from basic research to clinical application.
[0003] In the field of visual system disease research, constructing accurate animal models is crucial. The eye is a vital organ for the human body to acquire external information. Hereditary diseases such as retinitis pigmentosa lead to the progressive loss of photoreceptor cells, severely impacting patients' quality of life. Zebrafish have become an ideal visual research model for studying these diseases. The zebrafish genome is highly homologous to that of humans and other vertebrates, and its eye structure, especially the cellular composition of the retina, is remarkably similar to that of humans. For example, the proportion of cone cells responsible for photopic and color vision in its retina is very high, similar to the human eye, but significantly different from commonly used nocturnal rodent models. Furthermore, zebrafish possess advantages such as high reproductive capacity, transparent early embryos, low rearing costs, and the ability to regenerate the retina in adulthood, giving them unique application value in pathology and drug screening.
[0004] However, although the construction of zebrafish disease models using genetic engineering techniques is relatively mature, existing technologies still face challenges in terms of accuracy, efficiency, and reliability. Off-target effects that may occur during gene editing can introduce unexpected gene mutations, interfering with the accurate interpretation of experimental phenotypes. Furthermore, F0 generation individuals produced through fertilized egg injection are often chimeras, meaning that not all cells carry the target mutation, leading to unstable phenotypes and difficulty in using them for precise analysis. Obtaining stable, homozygous mutant lines requires multiple generations of breeding and screening, a time-consuming and labor-intensive process that significantly prolongs the experimental cycle and reduces the efficiency of model construction.
[0005] In summary, existing technologies for constructing animal models of retinal diseases are constrained by the inherent limitations of gene editing technology and the complexity of subsequent procedures. Off-target risks, chimerism issues, and lengthy screening cycles constitute the main technical bottlenecks in current model development. More importantly, even if gene mutants are successfully obtained, it cannot be guaranteed that they will stably and uniformly reproduce the key pathological features of human diseases. Therefore, there is an urgent need in this field for an animal model that can be stably inherited, fully validated, and can faithfully simulate the process of retinal photoreceptor neuron disease in humans to meet the urgent needs for in-depth research on disease mechanisms and large-scale drug screening.
[0006] In view of this, the present invention is hereby proposed. Summary of the Invention
[0007] The purpose of this invention is to provide a zebrafish model of retinal photoreceptor neuron lesions and a method for constructing the model, wherein the high specificity of the sgRNA can precisely target the elovl2 gene and reduce the risk of off-target effects, thereby constructing a disease model with a clear genetic background and reliable phenotype, providing a key tool for related research and drug screening.
[0008] In order to achieve the above-mentioned objectives of the present invention, the following technical solution is adopted: In a first aspect, the present invention provides an sgRNA targeting the zebrafish elovl2 gene, comprising a guide sequence capable of specifically recognizing and binding to the nucleotide sequence shown in SEQ ID NO.4 of the elovl2 gene.
[0009] In an optional implementation, the sgRNA targets a site located on exon 4 of the elovl2 gene.
[0010] In an optional embodiment, the nucleotide sequence of the sgRNA targeting the zebrafish elovl2 gene is shown in SEQ ID NO.1.
[0011] Secondly, the present invention provides a primer pair for constructing a transcription template of sgRNA as described in the foregoing embodiments, the primer pair comprising a forward primer with a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.3.
[0012] Thirdly, the present invention provides a method for constructing a zebrafish model of retinal disease, comprising: The sgRNA targeting the elovl2 gene as described in any of the foregoing embodiments, together with the Cas9 protein or the mRNA encoding the Cas9 protein, is introduced into the single-cell stage fertilized egg of zebrafish. The fertilized eggs were screened to identify zebrafish with mutations at the target site of the elovl2 gene, which were then used as the zebrafish model of retinal disease.
[0013] In an optional implementation, the steps are collectively introduced into a single-celled fertilized egg of a zebrafish, including: The sgRNA is mixed with the mRNA encoding the Cas9 protein; The injection mixture is injected into 200 to 500 fertilized eggs via microinjection.
[0014] In an optional implementation, the filtering process includes: After the injected fertilized eggs are cultured, the genomic DNA of the embryos is extracted; Using the genomic DNA as a template, PCR amplification was performed using a forward primer containing the sequence shown in SEQ ID NO. 5 and a reverse primer containing the sequence shown in SEQ ID NO. 6; and the PCR amplification product was sequenced using the primer containing the sequence shown in SEQ ID NO. 5 to confirm the mutation at the target site.
[0015] Fourthly, the present invention provides a zebrafish model of retinal photoreceptor neuron lesions, which is constructed by the method for constructing a zebrafish model of retinal lesions as described in any of the foregoing embodiments.
[0016] Fifthly, the present invention provides a method for detecting the elovl2 gene mutant zebrafish, comprising: Using the forward primer shown in SEQ ID NO.5 and the reverse primer shown in SEQ ID NO.6, PCR reaction was performed with the zebrafish genome as a template; and the zebrafish with the elovl2 gene mutation were screened by sequencing using SEQ ID NO.5.
[0017] Sixthly, the present invention provides an application of sgRNA targeting the zebrafish elovl2 gene as described in the foregoing embodiments in constructing a zebrafish model of retinal photoreceptor neuron lesions.
[0018] This invention provides a zebrafish model of retinal photoreceptor neuron lesions and a method for constructing the same. The sgRNA targeting the zebrafish elovl2 gene contains a guide sequence that specifically recognizes and binds to a precise nucleotide sequence within the elovl2 gene (as shown in SEQ ID NO. 4). This high specificity is its core advantage. It can precisely guide gene editing tools to a predetermined location in the genome, thereby achieving targeted modification of the elovl2 gene.
[0019] Because the elovl2 gene is closely related to the structure and function of the retina, mutations in it can trigger a phenotype similar to damage to human retinal visual cells. By using this highly specific sgRNA, it is possible to ensure that gene mutations occur precisely on the elovl2 gene, minimizing the risk of unintended mutations (i.e., off-target effects) occurring in other locations of the genome.
[0020] This precision ensures that the genetic background and mutation sites of the subsequently constructed zebrafish models are clear. Therefore, biological traits such as visual cell lesions observed in this model can be more reliably attributed to specific alterations in the elovl2 gene. This provides a biological tool with high similarity to human diseases, strong reproducibility, and high reliability for further in-depth research into the pathological mechanisms of retinal diseases, drug screening, and the search for new treatments. Attached Figure Description
[0021] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0022] Figure 1 This document presents a schematic diagram of the target site sequence of the Elovl2 gene, a peak diagram of the sequencing results including the mutation site, and schematic diagrams of the wild-type and predicted mutant Elovl2 protein structures in the embodiments of this application. Figure 2 This is a schematic diagram of elovl2 embryo in situ hybridization performed using juvenile zebrafish with the elovl2 gene mutation as material in an embodiment of this application; Figure 3 This is a bar chart showing the fatty acid composition analysis of elovl2 mutant zebrafish juveniles in the embodiments of this application; Figure 4 This is a schematic diagram of a section used in the embodiment of this application for HE staining of tissue morphology observation of juvenile elovl2 mutant zebrafish. Figure 5 This is a schematic diagram of visual cell-specific immunofluorescence analysis of frozen sections of juvenile elovl2 mutant zebrafish eyes in an embodiment of this application. Detailed Implementation
[0023] The embodiments of the present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer are followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.
[0024] In this application embodiment, an sgRNA targeting the zebrafish elovl2 gene is provided, which includes a guide sequence capable of specifically recognizing and binding to the nucleotide sequence shown in SEQ ID NO.4 in the elovl2 gene.
[0025] The ribonucleic acid (RNA) molecule provided in this embodiment is an artificially designed ribonucleic acid molecule. It includes a guide sequence: this is a nucleotide sequence in the sgRNA molecule that is responsible for recognizing and locating to a specific gene target.
[0026] "Targeting the zebrafish elovl2 gene": This defines the overall function and target of this sgRNA, namely, its target is the zebrafish elovl2 gene. Furthermore, "capable of specifically recognizing and binding to the nucleotide sequence shown in SEQ ID NO. 4 within the elovl2 gene": This further defines the necessary function of its core component, the "guide sequence." It defines that the guide sequence, through its molecular properties, can precisely locate and physically bind to a specific location (the sequence defined by SEQ ID NO. 4) within the vast zebrafish genome.
[0027] This embodiment provides a "molecular navigation tool" designed for gene editing. This tool is an RNA molecule with a sequence (guide sequence) designed to act like a key, matching only a specific sequence "lock" (SEQ ID NO.4) on the zebrafish elovl2 gene, thereby achieving precise location. Specifically, the guide sequence is: SEQ ID NO. 4: 5'-GGTTACCGTCTTCAGTGTCAGG-3'.
[0028] The working principle of this sgRNA is based on the base pairing principle in molecular biology. The nucleotides (A, U, G, C) in the guide sequence form precise, one-to-one chemical attraction with nucleotides (T, A, C, G) on one strand of the target DNA sequence (SEQ ID NO. 4) (A pairs with T, U pairs with A, G pairs with C, and C pairs with G). It is this predictable pairing rule that allows the guide sequence to bind stably to the target DNA sequence in its three-dimensional structure, thereby achieving highly specific recognition and localization.
[0029] The most significant advantage of the sgRNA provided in this embodiment is its precise targeting capability. Through a pre-designed guide sequence, it can be ensured that subsequent gene editing operations occur at a specific site in the elovl2 gene, rather than at other random locations in the genome. This high specificity significantly reduces the possibility of unintended mutations (i.e., off-target effects) in non-target genes, thereby ensuring that the genetic background of the constructed gene-mutated zebrafish model is clear and accurate. Because of its well-defined target, the biological phenotype of the retinal disease model constructed using this sgRNA can be more reliably attributed to alterations in the elovl2 gene. This provides a stable and reproducible biological tool for subsequent pathological mechanism research and drug screening.
[0030] In some embodiments, the sgRNA targets a site located on exon 4 of the elovl2 gene.
[0031] In some embodiments, the nucleotide sequence of the sgRNA targeting the zebrafish elovl2 gene is shown in SEQ ID NO. 1. Specifically, SEQ ID NO. 1 is: 5'-GGTTACCGTCTTCAGTGTCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT-3'.
[0032] In this embodiment, a primer pair for constructing a transcription template of sgRNA as described in the foregoing embodiments is provided. The primer pair includes a forward primer with a nucleotide sequence as shown in SEQ ID NO. 2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO. 3. The specific sequences of the primer pair include: (1) Forward primer SEQ ID NO.2: 5'-TAATACGACTCACTATAGGTTACCGTCTTCAGTGTCGTTTTAGAGCTAGAAATAGC-3'; (2) Reverse primer SEQ ID NO.3: 5'-AAAAAAAGCACCGACTCGGTGCCAC-3'.
[0033] This application provides a method for constructing a zebrafish model of retinal disease, including: Step S1: The sgRNA targeting the elovl2 gene as described in any of the foregoing embodiments, together with the Cas9 protein or the mRNA encoding the Cas9 protein, is introduced into the fertilized egg of zebrafish in the single-cell stage.
[0034] This step describes the delivery of gene-editing tools. It is the process of delivering all the molecular components needed to complete the gene-editing task into a live zebrafish single-cell fertilized egg in a single, intact manner.
[0035] The core of the process is microinjection. The operator injects a pre-mixed liquid containing sgRNA targeting the elovl2 gene and mRNA encoding the Cas9 protein directly into the cytoplasm of a single-celled zebrafish zygote through an extremely fine glass needle, thus obtaining a zygote loaded with a complete set of gene-editing instructions and tools. At this point, the sgRNA (the navigation tool) and Cas9 mRNA (the "blueprints" for the scissors) have successfully entered the cell, preparing all the starting materials for the subsequent gene-editing reaction.
[0036] Choosing to inject during the single-cell stage is a key advantage. Because the embryo has not yet begun to divide at this stage, any successful modification to the genome will be completely replicated in all cells produced during subsequent development, ensuring that the final adult fish is a fully mutant, rather than a chimera with some cells mutated and others normal. Modifying the gene at the very beginning of life ensures that the gene mutation can enter the germline cells, thus allowing it to be stably inherited by the next generation.
[0037] Step S2: The fertilized eggs are screened to identify zebrafish with mutations at the target site of the elovl2 gene, which will serve as the zebrafish model of retinal disease.
[0038] The essence of this step is quality control and identification. Since gene editing is not 100% successful, this step aims to accurately identify from all injected embryos those individuals whose elovl2 gene has indeed been successfully modified. Specifically, this may include: (1) Embryo culture: The injected fertilized eggs are cultured in a suitable environment for a period of time (e.g., 24 hours) to allow the gene editing reaction to occur in the cells.
[0039] (2) Genome extraction: Collect some embryos, lyse the cells and purify them to extract their total genomic DNA.
[0040] (3) PCR amplification: Using the extracted genomic DNA as a template, a pair of specific primers (such as SEQ ID NO.5 and 6) are used to replicate a large number of DNA fragments containing the target site of the elovl2 gene through polymerase chain reaction (PCR) technology.
[0041] (4) DNA sequencing: The DNA of the product obtained by PCR amplification is sequenced to read its precise base sequence and compared with the wild-type (unedited) sequence.
[0042] Through the above steps, mutant embryos with clearly defined genotypes can be obtained. Sequencing results can confirm whether base insertion, deletion, or substitution has occurred at the target site of the elovl2 gene, thereby screening out successfully edited zebrafish embryos, i.e., the desired zebrafish model of retinal disease.
[0043] In this example, directly "reading" the gene code through sequencing provides the most direct and accurate evidence of whether gene editing was successful. Early screening allows for the timely elimination of individuals that failed to edit, concentrating breeding and research resources on confirmed mutants and significantly saving time and costs.
[0044] In some embodiments, step S1, which is introduced into a single-cell stage fertilized egg of a zebrafish, includes: Step S11: Mix the sgRNA with the mRNA encoding the Cas9 protein.
[0045] The above steps constitute the "payload preparation" stage of gene editing tools. Its purpose is to combine two core, functionally complementary molecular components (sgRNA and Cas9 mRNA) into a ready-to-use injection solution.
[0046] Specifically, purified sgRNA solutions of a specific concentration and equally purified Cas9 mRNA solutions of a specific concentration can be physically mixed according to the proportions required by the experimental protocol. The technical disclosure also mentions that phenol red is typically added to this mixture as an indicator to facilitate visualization of subsequent injection procedures, resulting in a homogeneous, ready-to-use injection mixture. This mixture contains both the "navigation molecule" (sgRNA) responsible for targeting and the "blueprint" (Cas9 mRNA) responsible for generating the cleavage protein.
[0047] Premixing ensures that a complete set of gene-editing components is delivered to cells simultaneously with each injection, avoiding component loss or imbalance that could occur with separate injections. Combining multiple components into one simplifies subsequent microinjection procedures and improves the overall efficiency of the process.
[0048] Step S12: The injection mixture is injected into 200 to 500 fertilized eggs via microinjection.
[0049] This step is the "physical delivery" stage of the gene-editing tool. It is the process of using physical means to precisely deliver the molecular "payload" prepared in the first step through the cell's natural barrier into a single fertilized egg.
[0050] Under a microscope, the operator uses an extremely fine glass needle to pierce the cell membrane of a single zebrafish fertilized egg and injects a precise volume of injection mixture in nanoliters into the cytoplasm. This procedure is repeated one by one in batches of 200 to 500 fertilized eggs. For example, the number of eggs injected can be 200, 300, 400, 500, etc.
[0051] This step yields 200–500 treated zygotes containing exogenous sgRNA and Cas9 mRNA molecules. These zygotes now possess all the exogenous molecular conditions required to initiate a targeted gene editing reaction.
[0052] Microinjection in this step is a highly efficient and active delivery method that ensures the gene-editing tool reaches almost every cell being manipulated, far superior to other passive transfection methods. This technology allows for precise control of the injection volume (e.g., 1 nL per embryo as mentioned in the technical disclosure), ensuring a relatively consistent molecular dosage for each embryo and improving experimental reproducibility. Processing 200 to 500 embryos ensures a sufficient sample size, significantly increasing the probability of successfully identifying mutants.
[0053] In some implementations, the screening process includes: After the injected fertilized eggs are cultured, the genomic DNA of the embryos is extracted.
[0054] This step is the sample preparation stage, and its purpose is to obtain genetic material from the embryo for subsequent molecular testing after the gene editing reaction has occurred. Specific processing may include: (1) Culture: The microinjected fertilized eggs were cultured in a suitable culture medium (such as 0.3x Danieau's buffer) for 24 hours. This process is to give the injected sgRNA and Cas9 mRNA enough time to complete a series of biological reactions such as translation, assembly, targeting and DNA cleavage.
[0055] (2) Extraction: After the culture is completed, some embryos are collected, cells are lysed by physical or chemical methods, and after a series of purification steps, impurities such as proteins and RNA are removed, and finally pure genomic DNA is obtained.
[0056] Through the above steps, a genomic DNA sample containing the complete genetic information of the embryo can be obtained. If gene editing is successful, the target site of the elovl2 gene in this DNA sample will carry an artificially introduced mutation.
[0057] This step provides a necessary time window for gene editing events to occur through a 24-hour culture. Extracting high-quality genomic DNA is a fundamental prerequisite for all subsequent molecular assays (such as PCR).
[0058] Using the genomic DNA as a template, PCR amplification was performed using a forward primer containing the sequence shown in SEQ ID NO. 5 and a reverse primer containing the sequence shown in SEQ ID NO. 6; and the PCR amplification product was sequenced using the primer containing the sequence shown in SEQ ID NO. 5 to confirm the mutation at the target site. The giant sequence is as follows: (1) SEQ ID NO.5: 5'-CTCATCTGCCAATGTCGA-3'; (2) SEQ ID NO.6: 5'-TTTCATCCCAAAGCCAAG-3'.
[0059] This step is the "molecular copying" stage. Since the entire genome is very large, and the target site is only a very small part of it, the purpose of this step is to use PCR technology to replicate this small DNA fragment containing the elovl2 gene target in vitro, so that the quantity is sufficient to be easily detected.
[0060] Specifically, the genomic DNA extracted in the first step can be used as a template to add a pair of specially designed short DNA strands, i.e., primers. This pair of primers includes: a forward primer (its sequence is shown in SEQ ID NO.5) and a reverse primer (its sequence is shown in SEQ ID NO.6). These primers are designed to specifically bind to both sides of the elovl2 gene target region. In a PCR instrument, through repeated "heat-cool-heat" cycles, DNA polymerase continuously synthesizes new DNA strands between the primers, thereby obtaining a large amount of pure DNA fragments containing only the elovl2 gene target region (i.e., PCR amplification products).
[0061] This step uses the specific primers SEQ ID NO.5 and SEQ ID NO.6 to ensure that only the desired target elovl2 gene fragment is amplified, eliminating interference from other parts of the genome. PCR technology is extremely sensitive and can amplify sufficient product for subsequent analysis from extremely small amounts of DNA sample.
[0062] Furthermore, the primers described in SEQ ID NO. 5 are also primers used for Sanger DNA sequencing.
[0063] The steps described above represent the "sequence reading" or "final verification" stage. Its purpose is to accurately read the nucleotide sequence of the PCR amplification product from the previous step and compare it with the normal (wild-type) sequence, thereby ultimately confirming the presence and type of mutation.
[0064] Specifically, the PCR products can be subjected to Sanger DNA sequencing. In this process, primers with sequences as shown in SEQ ID NO. 5 are used to initiate the sequencing reaction. The sequencer "reads" the DNA fragments base by base and generates a sequence peak diagram. By analyzing the peak diagram, the operator checks for sequences near the target site that do not match the wild type, such as overlapping, disordered peaks (referred to as "random peaks" in the document). This is usually a sign of successful gene editing, ultimately obtaining precise DNA sequence information for the target region. This information allows for a definitive determination of whether the embryo is a mutant, thus completing the screening process.
[0065] Sequencing is the "gold standard" for genotyping and mutation detection, providing the most direct and accurate evidence with no gray areas. Furthermore, sequencing can not only determine the presence or absence of a mutation but also pinpoint its specific type (e.g., the number of bases deleted or inserted), providing detailed information for subsequent analysis of the mutation's impact on gene function.
[0066] In this embodiment of the application, a zebrafish model of retinal photoreceptor neuron lesions is provided, which is constructed by the method for constructing a zebrafish model of retinal lesions as described in any of the foregoing embodiments.
[0067] This application provides a method for detecting elovl2 gene mutant zebrafish, including: Using the forward primer shown in SEQ ID NO.5 and the reverse primer shown in SEQ ID NO.6, PCR reaction was performed with the zebrafish genome as a template; and the zebrafish with the elovl2 gene mutation were screened by sequencing using SEQ ID NO.5.
[0068] The above detection method comprises two consecutive core steps: (1) PCR reaction: The target region in zebrafish genomic DNA is replicated (amplified) in large quantities using specific primers. By precisely controlling the cyclical changes in temperature, the DNA template region between the primers SEQ ID NO.5 and SEQ ID NO.6 is replicated exponentially under the catalysis of DNA polymerase, thereby amplifying a trace amount of the target gene fragment to a detectable quantity.
[0069] (2) Sequencing screening: Sequence analysis of the amplified DNA products is performed to identify mutations and screen individuals carrying the mutations. Using Sanger sequencing and other technologies, the nucleotide sequence of the PCR product is determined base by base using SEQ ID NO.5 as the starting primer. By comparing the obtained sequence with the known wild-type elovl2 gene sequence, any differences (such as the addition, deletion or substitution of bases) will be identified as mutations.
[0070] Because it uses primers specifically targeting the elovl2 gene target region (SEQ ID NO.5 and SEQ ID NO.6) and combines them with DNA sequencing technology, the "gold standard," for final confirmation, this detection method is highly accurate and can accurately identify mutations, avoiding misdiagnosis.
[0071] PCR technology is extremely sensitive and requires only a very small amount of starting DNA template for effective detection. This means that enough DNA can be obtained for analysis from a single embryo or a small piece of tail fin tissue from an adult fish with minimal damage to the sample.
[0072] This method can not only be used to validate models constructed using the method of this invention, but also as a standalone diagnostic tool to detect whether zebrafish from any source have mutations in a specific region of the elovl2 gene.
[0073] In this application embodiment, an application of sgRNA targeting the zebrafish elovl2 gene as described in the foregoing embodiments is provided in constructing a zebrafish model of retinal photoreceptor neuron lesions.
[0074] The present invention will be further illustrated below with specific embodiments. However, it should be understood that these embodiments are merely for the purpose of more detailed illustration and should not be construed as limiting the present invention in any way.
[0075] Example 1 In this embodiment, gRNA was obtained.
[0076] Experimental methods: 1. Based on the CRISPER / Cas9 knockout principle, design and synthesize sgRNA sequences containing the elovl2 gene target site sequence, where the elovl2 gene target site is as follows: Figure 1As shown in the figure (the underlined sequence in the gene sequence is the target sequence, and the 20 bases in the box: TTACCGTCTTCAGTGTCAGG is the specific sequence of the deletion mutation). The target sequence of the gRNA is located on exon 4 of the elovl2 gene, and the site sequence is the nucleotide sequence shown in SEQ ID NO.4, SEQ ID NO.4: 5'-GGTTACCGTCTTCAGTGTCAGG-3'; the sgRNA has the nucleotide sequence shown in SEQ ID NO.1. SEQ ID NO.1: 5'-GGTTACCGTCTTCAGTGTCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT-3'.
[0077] 2. Synthesize PCR primers for constructing a synthetic sgRNA template. The synthesized primer sequences include the forward primer sequence as shown in SEQ ID NO.2 and the reverse primer sequence as shown in SEQ ID NO.3. SEQ ID NO.2: 5'-TAATACGACTCACTATAGGTTACCGTCTTCAGTGTCGTTTTAGAGCTAGAAATAGC-3'; SEQ ID NO.3: 5'-AAAAAAAGCACCGACTCGGTGCCAC-3'.
[0078] 3. Using the primers synthesized in step 2, PCR was performed with pMD19T-gRNA as the template for the PCR reaction. The PCR product was purified and recovered to prepare an in vitro transcription template for gRNA. To obtain the gRNA template, perform PCR amplification using the following reaction system: Table 1. Reaction System
[0079] Prepare a 200 μL PCR system. The PCR program is as follows: 94ºC for 5 min; 94ºC for 30 s; 60ºC for 30 s; 72ºC for 30 s, 30 cycles; 72ºC for 10 min. The purification and recovery steps for the PCR product are as follows: (1) Column equilibration step: Add 500 μL of equilibration solution BL to the adsorption column CB2 (the adsorption column is placed in the collection tube), centrifuge at 12,000 rpm (~13,400×g) for 1 min, discard the waste liquid in the collection tube, and put the adsorption column CB2 back into the collection tube.
[0080] (2) Estimate the volume of the PCR reaction solution or enzyme digestion reaction solution, add 5 times the volume of binding solution PB, and mix thoroughly.
[0081] (3) Add the solution obtained in the previous step to an adsorption column CB2 (place the adsorption column in the collection tube), place at room temperature for 2 min, centrifuge at 12,000 rpm (~13,400×g) for 30-60 sec, discard the waste liquid in the collection tube, and place the adsorption column CB2 into the collection tube.
[0082] (4) Add 600 μL of washing solution PW to the adsorption column CB2 (please check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm (~13,400×g) for 30-60 seconds, discard the waste liquid in the collection tube, and put the adsorption column CB2 into the collection tube.
[0083] (5) Repeat step (4).
[0084] (6) Place the adsorption column CB2 back into the collection tube and centrifuge at 12,000 rpm (~13,400×g) for 2 min to remove as much of the washing solution as possible. Place the adsorption column CB2 at room temperature for several minutes to dry it thoroughly to prevent residual washing solution from affecting the next step of the experiment.
[0085] (7) Place the adsorption column CB2 into a clean centrifuge tube, add 30-50 μL of elution buffer EB to the center of the adsorption membrane, and incubate at room temperature for 2 min. Centrifuge at 12,000 rpm (~13,400×g) for 2 min to collect the DNA solution.
[0086] 4. The gRNA in vitro transcription template obtained in step 3 is transcribed in vitro using T7 transcriptase, and the gRNA is purified and recovered.
[0087] T7 RNA transcriptase was used to transcribe gRNA in vitro. The components were then added to the following mixture and thoroughly combined: Table 2. Reaction System
[0088] After reacting at 37ºC for 1 hour, the synthesized gRNA was purified, and the specific steps are as follows: (1) DNase I treatment: Add 2.5 μL of 10X buffer and 2 μL of DNase I, and react at 37ºC for 15 min to remove DNA template; (2) Then use SigmaSpin TM Purification was performed using the Sequencing reaction clean-up kit: the purification column was placed in a 2 mL collection tube and centrifuged at 2800 rpm for 15 s; (3) Twist off the bottom sealing column of the tube, then discard the tube cap, put the purification column back into the collection tube, and centrifuge at 2800 rpm for 2 min; (4) Place the purification column into a new RNase-free EP tube and discard the collection tube; (5) Add the gRNA synthesis solution to the purification column and centrifuge at 2800 rpm for 4 min; (6) Collect the column buffer, perform electrophoresis to detect and determine the concentration, and then place it in a container. Store in a refrigerator at 80ºC for later use.
[0089] Example 2 In this embodiment, Cas9 mRNA is synthesized.
[0090] Experimental methods: 1. The plasmid containing the full-length Cas9 sequence optimized with zebrafish codons was linearized by restriction endonuclease digestion and purified using the GeneJET PCR Purification Kit for use as a transcription template.
[0091] The purification and recovery steps for PCR products are as follows: (1) Column equilibration step: Add 500 μL of equilibration solution BL to the adsorption column CB2 (the adsorption column is placed in the collection tube), centrifuge at 12,000 rpm (~13,400×g) for 1 min, discard the waste liquid in the collection tube, and put the adsorption column CB2 back into the collection tube.
[0092] (2) Estimate the volume of the PCR reaction solution or enzyme digestion reaction solution, add 5 times the volume of binding solution PB, and mix thoroughly.
[0093] (3) Add the solution obtained in the previous step to an adsorption column CB2 (place the adsorption column in the collection tube), place at room temperature for 2 min, centrifuge at 12,000 rpm (~13,400×g) for 30-60 sec, discard the waste liquid in the collection tube, and place the adsorption column CB2 into the collection tube.
[0094] (4) Add 600 μL of washing solution PW to the adsorption column CB2 (please check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm (~13,400×g) for 30-60 seconds, discard the waste liquid in the collection tube, and put the adsorption column CB2 into the collection tube.
[0095] (5) Repeat step (4).
[0096] (6) Place the adsorption column CB2 back into the collection tube and centrifuge at 12,000 rpm (~13,400×g) for 2 min to remove as much of the washing solution as possible. Place the adsorption column CB2 at room temperature for several minutes to dry it thoroughly to prevent residual washing solution from affecting the next step of the experiment.
[0097] (7) Place the adsorption column CB2 into a clean centrifuge tube, add 30-50 μL of elution buffer EB to the center of the adsorption membrane, and incubate at room temperature for 2 min. Centrifuge at 12,000 rpm (~13,400×g) for 2 min to collect the DNA solution. Use the Ambion mMessage mMachine in vitro transcription kit to synthesize Cas9 mRNA in vitro. The reaction system is as follows: Table 3. Reaction System
[0098] After the reaction system is prepared, mix it well and incubate it in a water bath at 37°C for 2 hours.
[0099] 2. Purify and recover Cas9 mRNA according to the following steps: (1) Add 1 μL of the DNase provided in the kit to the reaction system, mix well, and incubate in a water bath at 37°C for 15 minutes; (2) Add 20 μL of 5M ammonium acetate, mix well, and place on ice for 10 minutes; (3) Centrifuge at 4℃ and 12000rpm for 15 minutes. The white precipitate is mRNA. (4) Discard the supernatant, wash the precipitate with 75% ethanol, and centrifuge at 7500 rpm for 5 minutes at 4°C; (5) Discard the supernatant, air dry the precipitate, and add 10 μL of enzyme-free water to dissolve the precipitate; (6) Take 0.5 μL of RNA, dilute it 20 times, and test its concentration and purity. Then take 10 μL of the dilution solution for agarose gel electrophoresis to test the degree of degradation.
[0100] Example 3 In this embodiment, individuals with complete ELOVL2 deletions are constructed and screened.
[0101] Experimental methods: 1. The gRNA and Cas9 mRNA obtained in the above steps were mixed and microinjected into single-cell stage zebrafish fertilized eggs, with 1 nL injected into each embryo.
[0102] 2. After the gRNA and Cas9 mRNA are synthesized, prepare the injection sample according to the following system, with a 3μL injection volume as follows: Table 4. Injection System
[0103] In this step, the number of single-cell stage zebrafish fertilized egg embryos injected is 200 to 500.
[0104] In this step, 500 single-cell stage zebrafish fertilized egg embryos are injected.
[0105] 3. After injection, culture for 24 hours, collect embryos obtained from single-cell stage zebrafish fertilized eggs after microinjection, extract the genome, amplify the target sequence containing the target site by PCR, and sequence it; perform PCR amplification of the target sequence containing the target site according to the following reaction system: Table 5. Injection System
[0106] The PCR program was as follows: 94ºC for 5 min; 94ºC for 30 s; 60ºC for 30 s; 72ºC for 30 s, 35 cycles; 72ºC for 10 min.
[0107] The primer sequences used for sequencing include the forward primer sequence of SEQ ID NO.5 and the reverse primer sequence of SEQ ID NO.6: SEQ ID NO.5: 5'-CTCATCTGCCAATGTCGA-3'; SEQ ID NO.6: 5'-TTTCATCCCAAAGCCAAG-3'; For example, the primer in SEQ ID NO.5 is also a primer used for Sanger DNA sequencing.
[0108] 4. Embryos with random peaks near the target site in the sequencing results are introduced into the feeding system and raised until sexual maturity. For sexually mature zebrafish, the next generation of embryos are screened again using the above PCR and sequencing methods to detect zebrafish with effective mutation types, thereby obtaining zebrafish with the elovl2 gene mutation, that is, obtaining the zebrafish model of retinal photoreceptor neuron lesions.
[0109] Example 4 In this embodiment, functional verification and phenotypic analysis were performed on individuals with complete loss of elovl2.
[0110] Experimental methods: 1. The elovl2 gene expression of the zebrafish juveniles with the elovl2 gene mutation obtained in Example 3 was analyzed. like Figure 2As shown, the mRNA level of elovl2 in the mutant was significantly lower than that in the wild type. This result indicates that the method for constructing the zebrafish model of retinal photoreceptor neuron lesions caused by elovl2 gene mutation provided in this embodiment can effectively mutate the gRNA target sequence located on exon 4 of the elovl2 gene.
[0111] 2. Fatty acid composition analysis was performed on the elovl2 gene mutant zebrafish obtained in Example 3; like Figure 3 As shown, compared with wild-type zebrafish, the content of docosahexaenoic acid (DHA, C22:6n-3) in zebrafish using the elovl2 gene mutant provided in this embodiment was significantly reduced, indicating that the elovl2 gene mutation inhibits the synthesis of DHA.
[0112] 3. The eyeballs of the juvenile zebrafish with the elovl2 deletion mutation obtained in Example 3 were frozen sections stained with HE for histological observation. like Figure 4 As shown, compared to wild-type zebrafish, the method for constructing the zebrafish model of retinal photoreceptor neuron lesions with elovl2 gene mutation provided in this embodiment can effectively reduce the number of cells in the visual cell layer.
[0113] 4. Visual cell-specific immunofluorescence analysis was performed on frozen sections of the eyes of juvenile zebrafish with the elovl2 deletion mutation obtained in Example 3. like Figure 5 As shown, compared to wild-type zebrafish, the method for constructing the zebrafish model of retinal photoreceptor neuron lesions caused by the elovl2 gene mutation provided in this embodiment can effectively reduce the number of cone cells and rod cells located above the cone cells in the visual cell layer.
[0114] 5. Analyze and describe the visual cell lesions in the elovl2 deletion mutant zebrafish by analyzing the data obtained in steps 1-4.
[0115] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. An sgRNA targeting the zebrafish elovl2 gene, characterized in that, It contains a guide sequence that can specifically recognize and bind to the nucleotide sequence shown in SEQ ID NO.4 in the elovl2 gene.
2. The sgRNA targeting the zebrafish elovl2 gene as described in claim 1, characterized in that, The sgRNA targets a site located in exon 4 of the elovl2 gene.
3. The sgRNA targeting the zebrafish elovl2 gene as described in claim 1, characterized in that, The nucleotide sequence of the sgRNA targeting the zebrafish elovl2 gene is shown in SEQ ID NO.
1.
4. A primer pair for constructing a transcription template for the sgRNA as described in claim 1, characterized in that, The primer pair includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.
3.
5. A method for constructing a zebrafish model of retinal disease, characterized in that, include: The sgRNA targeting the elovl2 gene as described in any one of claims 1-3, together with the Cas9 protein or the mRNA encoding the Cas9 protein, is introduced into the single-cell stage fertilized egg of zebrafish. The fertilized eggs were screened to identify zebrafish with mutations at the target site of the elovl2 gene, which were then used as the zebrafish model of retinal disease.
6. The method for constructing a zebrafish model of retinal disease as described in claim 5, characterized in that, The steps described above are collectively introduced into the single-cell stage fertilized egg of zebrafish, including: The sgRNA is mixed with the mRNA encoding the Cas9 protein; The injection mixture is injected into 200 to 500 fertilized eggs via microinjection.
7. The method for constructing a zebrafish model of retinal disease as described in claim 5, characterized in that, The filtering process includes: After the injected fertilized eggs are cultured, the genomic DNA of the embryos is extracted. Using the genomic DNA as a template, PCR amplification was performed using a forward primer containing the sequence shown in SEQ ID NO. 5 and a reverse primer containing the sequence shown in SEQ ID NO. 6; and the PCR amplification product was sequenced using the primer containing the sequence shown in SEQ ID NO. 5 to confirm the mutation at the target site.
8. A zebrafish model of retinal photoreceptor neuron lesions, characterized in that, The zebrafish model of retinal lesions was constructed using the method described in any one of claims 5-7.
9. A method for detecting the elovl2 gene mutation in zebrafish, characterized in that, include: Using the forward primer shown in SEQ ID NO.5 and the reverse primer shown in SEQ ID NO.6, PCR reaction was performed with the zebrafish genome as a template; and the zebrafish with the elovl2 gene mutation were screened by sequencing using SEQ ID NO.
5.
10. The application of the sgRNA targeting the zebrafish elovl2 gene as described in claim 1 in constructing a zebrafish model of retinal photoreceptor neuron lesions.