Method for culturing thalamus / interbrain organs and neurons

By adding inducing factors in stages and using two-dimensional/three-dimensional culture techniques, the problems of simple structure and unclear function in the culture of human thalamus/diencephalon organoids have been solved, enabling efficient and rapid construction of thalamus/diencephalon organoid models and neuron culture, which are suitable for disease simulation and drug screening.

CN121852322APending Publication Date: 2026-04-14THE FIFTH AFFILIATED HOSPITAL OF GUANGZHOU MEDICAL UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511951443.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-23
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

In existing technologies, human thalamic/diencephalic organoid culture technology suffers from problems such as simple structure, unclear function, and the presence of cells from other brain regions, making qualitative analysis and observation difficult.

Method used

A phased addition of inducing factors was employed, including TGF-β/Activin inhibitors, BMP inhibitors, WNT activators, SHH agonists, insulin, BMP7, and c-JUN, to direct the differentiation of human embryonic stem cells or induced pluripotent stem cells into thalamic/diencephalic organoids. Combined with two-dimensional and three-dimensional culture techniques, neurons expressing high levels of TCF7L2+ were cultured.

Benefits of technology

We have established an efficient and rapid human thalamus/diencephalon organoid model that can simulate the early neural development process in humans for disease simulation and drug screening. It also provides observation and analysis methods for two-dimensional and three-dimensional cell models, improving the differentiation rate and network density of thalamus/diencephalon neurons.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121852322A_ABST
    Figure CN121852322A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biomedicine, in particular to a thalamus / interbrain organ and neuron culture method. The invention provides a method for efficiently differentiating thalamic / interbrain organs and neurons by using human embryonic stem cells or induced pluripotent stem cells. It is found that in the early stage of cell differentiation, the c-JUN gene plays an important role in promoting nerve maturation and maintaining tight junction, the growth rate and the size of thalamus / interbrain organs can be remarkably increased by overexpressing c-JUN or adding c-JUN protein in thalamus / interbrain differentiation, the obtained organs have high-abundance neurons and tight junction protein, and the cell differentiation effect is good. And high expression of thalamus / interbrain characteristic signal protein TCF7L2 is realized. The neurons have abundant nerve fibers and adherent growth ability under the 2D culture condition, and the lifetime is long. The invention provides an efficient 2D neuron and 3D organoid differentiation technology for researching related development and pathology of thalamus / interbrain.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to a method for culturing thalamic / diencephalic organoids and neurons. Background Technology

[0002] The thalamus / diencephalon is a crucial information relay and hub in the central nervous system, playing a vital role in information transmission. The thalamus is the essential station for all sensory information (except olfaction), responsible for transmitting signals such as touch, pressure, pain, temperature, vision, and hearing to the corresponding cerebral cortex, where initial integration and regulation occur. The diencephalon as a whole (including the thalamus, hypothalamus, epithalamus, and posterior thalamus) acts as a hub in the reception, initial processing, and redistribution of sensory information to the cortex, while also participating in the regulation of the autonomic nervous system and endocrine system.

[0003] Recent genetic and functional imaging studies have shown that the thalamus plays a "coordination center" role in working memory, attention regulation, and higher cognitive networks. The reticular nucleus and inner nucleus of the thalamus are core nodes for maintaining wakefulness and regulating the wake-sleep transition. The pineal gland in the epithalamus secretes melatonin, regulating circadian rhythms, while the diencephalon as a whole has a wide-ranging influence on sleep, mood, and motivation. In terms of emotion, memory, and cognition, the anterior nucleus and dorsolateral nucleus of the thalamus / diencephalon connect with emotional circuits such as the amygdala and prefrontal cortex, participating in emotional processing, memory consolidation, and attention control.

[0004] Because the thalamus / diencephalon is located deep within the core of the brain, its observation and study face numerous obstacles. Current research on the thalamus / diencephalon in living humans is largely based on indirect neuroimaging. Structural MRI / multimodal MRI can be used to create individualized thalamic atlases and regional nuclear volumes. Functional MRI (resting-state / task-state) can reveal the dynamic functional connections of the thalamus within brain networks, particularly arousal, attention, and emotional circuits. PET / MEG can supplement metabolic and electromagnetic activity information, helping to locate metabolic abnormalities or sources of rapid oscillations.

[0005] In animal models, the methods for studying the thalamus / diencephalon are relatively diverse. Besides neuroimaging, electrophysiology and optogenetics can analyze the structure and function of the thalamus / diencephalon from multiple perspectives: capturing the firing patterns of thalamic nuclei to study the neural matrix of diseases such as pain and epilepsy. Optogenetics can precisely activate or inhibit specific thalamic nuclei in mice to verify causal relationships (such as visual-auditory fusion and motor regulation). However, the thalamic structure in animal models such as mice differs significantly from that in humans, and a considerable gap remains between animal research results and clinical translation needs.

[0006] In recent years, in vitro organoid technology has flourished, with human cell-derived central nervous system and brain organoids avoiding species differences. Directed differentiation of thalamic / diencephalic organoids has made it possible to directly observe and study the thalamus / diencephalon in vitro. Currently reported human thalamic / diencephalic organoid culture techniques are still in their early stages, and publicly available technologies are quite limited.

[0007] Patent CN119365203A discloses a method for differentiating hypothalamic organoids and using the derived neural stem cells as active ingredients for the prevention and treatment of geriatric diseases. Patent CN120818488A discloses a method and application for a mouse embryonic hypothalamic organoid model. This invention directly utilizes mouse embryonic tissue to induce self-organization and development in an in vitro three-dimensional (3D) culture system, forming hypothalamic organoids with specific spatial structures and physiological functions. Patent CN120665813A discloses a composition for preparing brain organoids, the brain organoids themselves, and their applications. Its construction method is used to simulate a three-dimensional brain organoid model of the trigeminal nerve in the medulla oblongata. The model includes thalamic organoids; however, as a component, the thalamic organoids are surrounded by other structures and cell types, which is not conducive to qualitative analysis, observation, and detection. Existing technologies provide culture techniques for mouse-derived hypothalamic organoids and human thalamic organoids, but their structures and functions are very simple, the culture cycle is long, and they contain cells or structures from other brain regions, causing many inconveniences for qualitative analysis. Summary of the Invention

[0008] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a method for the directed differentiation of human embryos or induced pluripotent stem cells into thalamic / diencephalic organoids with high expression of the characteristic marker TCF7L2. + The method of neurons.

[0009] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides a method for culturing thalamic / diencephalic organoids and neurons, which achieves directed differentiation of human embryonic stem cells or induced pluripotent stem cells into thalamic / diencephalic organoids expressing thalamic / diencephalic characteristic markers and cellular characteristics by adding inducing factors in stages, including at least one of the following (1)-(3): (1) Thalamic / diencephalic organoids were cultured through the following steps: a. Neuroectodermal induction stage: Human embryonic stem cells or induced pluripotent stem cells are prepared into single-cell suspensions and cultured in a neuroectodermal induction medium containing TGF-β / Activin inhibitors and bone morphogenetic protein BMP inhibitors to form embryoids; b. Regional patterning stage: The embryoids obtained in step (a) are transferred to a regional patterning medium containing WNT activator and SHH agonist for suspension culture to form cell spheres; c. Thalamic modeling stage: The cell spheres obtained in step (b) were transferred to a thalamic modeling medium containing insulin, BMP7, and c-JUN for suspension culture to drive forebrain caudalization; d. Neural maturation and maintenance stage: Replace the culture medium with a mature thalamus / diencephalon maintenance medium containing basic fibroblast growth factor 2 and BDNF and culture in suspension until thalamus / diencephalon organoids are formed; (2) Thalamic / diencephalic neurons are cultured through the following steps: Human pluripotent stem cells or induced pluripotent stem cells are induced to differentiate into neural progenitor cells, and thalamic / diencephalic neurons are obtained by culturing them in the thalamic model culture medium of step (c). (3) Dimensional conversion of thalamic / diencephalic cell culture: After digestion and dispersion of the obtained thalamic / diencephalic organoids, thalamic / diencephalic neurons were sorted and cultured in two dimensions on a plane coated with extracellular matrix. Alternatively, the obtained thalamic / diencephalic neurons can be digested and enriched into cell clusters, then embedded in matrix gel for three-dimensional suspension culture to form a three-dimensional structure rich in thalamic / diencephalic neurons.

[0010] This invention discloses for the first time a method for directed differentiation of human embryos or induced pluripotent stem cells into cells that highly express the characteristic marker TCF7L2. + This invention relates to a method for thalamic / diencephalic organoids. The invention first employs a dual SMAD inhibition-neurocele induction process. SMAD signaling is initially blocked using a transforming growth factor-β / activin (TGF-β) inhibitor (such as SB-431542) and a bone morphogenetic protein (BMP) inhibitor (such as LDN-193189), enabling rapid neuroectodermal fate determination in human embryonic stem cells (hESCs) (or induced pluripotent stem cells (hiPSCs)). During the neuroectodermal stage, a WNT activator (CHIR-99021) and an SHH agonist (Purmorphamine or SAG) are added to drive forebrain caudalization and promote thalamic lineage formation. Insulin, added during the thalamic / diencephalic pattern formation stage, promotes caudalization, and BMP7 further enhances the expression of thalamic-specific genes (SOX2, TCF7L2, etc.). High c-JUN expression promotes neural differentiation and maturation, promotes tight junction protein expression, and promotes nerve fiber elongation and maintenance. Continuous supplementation of basic fibroblast growth factor 2 (FGF2) and brain-derived neurotrophic factor (BDNF) in a microbioreactor helps cells differentiate into hypothalamic peptidergic neurons and maintain their maturity.

[0011] This invention can also be used to induce stem cells to differentiate into thalamus / diencephalon-specific neurons and perform two-dimensional (2D) culture: by inducing hESCs (or iPSCs) into neural progenitor cells (NPCs), and then rapidly converting NPCs into TCF7L2-expressing cells under thalamic patterned culture (insulin, BMP7, PD325901, and c-JUN) induction. + Neurons containing thalamic / diencephalic specific proteins.

[0012] This invention can also convert 3D thalamic / diencephalic organoids into 2D thalamic / diencephalic neurons.

[0013] (1) 3D to 2D (dimensionality reduction culture): This involves digesting mature thalamic / diencephalic organoids into single cells using enzymes, followed by flow cytometry sorting to separate TCF7L2 cells. + Neurons were seeded in petri dishes coated with poly-L-ornithine and laminin, and cultured in a mature thalamic / diencephalic maintenance medium to achieve two-dimensional culture of thalamic / diencephalic neurons. 2D cells facilitate the observation and quantitative analysis of single cells, cell behavior, and cell networks. After enzymatic digestion and dispersal, 2D cells can be cryopreserved and thawed, facilitating long-term storage and transportation. (2) 2D to 3D (dimensional upsizing culture): 2D thalamic / diencephalic neurons are digested with enzymes, centrifuged to enrich them into clusters, and then embedded in matrix gel. After suspension culture using mature thalamic / diencephalic maintenance medium, the neurofilaments intertwine to form new three-dimensional structures, thereby realizing the dimensional upsizing culture of organoids rich in thalamic / diencephalic specific neurons.

[0014] The thalamic / diencephalic organoids differentiated in this invention possess distinct cellular properties and structural characteristics. They have shown potential application value in in vitro simulation of thalamic / diencephalic developmental features, in exploring related disease mechanisms, and have already been preliminarily used as regenerative medicine materials for cell transplantation and other applications.

[0015] Preferably, a low-adsorption 96U well plate is used during the cell aggregation into spheroids stage, which significantly improves the efficiency and uniformity of cell spheroidization. Subsequent neuroectodermal development, modeling, and maturation stages utilize a horizontal shaker integrated into a cell culture incubator, combined with petri dishes of different sizes and rotation speeds for 3D suspension culture, ensuring the formation of the organoid's three-dimensional structure and rapid growth and development.

[0016] In the later stages of culture, fine structure development was promoted by encapsulation with matrix gel, and neural projection function was initially verified. Mature thalamic / diencephalic organoids were co-cultured with other brain region organoids (such as cortical organoids) by embedding them in matrix gel (such as MatriGel). The production of nerve fibers on the outer edge of the thalamic / diencephalic organoids and radial growth were observed, forming "assembled organoids" that interconnected the thalamus and the whole brain, simulating the projection function of thalamic nerve fibers.

[0017] Preferably, the TGF-β / Activin inhibitor includes SB-431542; the bone morphogenetic protein (BMP) inhibitor includes LDN-193189.

[0018] Preferably, the neuroectodermal induction culture medium contains 10 mM SB-431542 and 100 nM LDN-193189.

[0019] Preferably, the WNT activator includes CHIR-99021; the SHH agonist includes Purmorphamine or Smoothened Agonist (SAG).

[0020] Preferably, the regionally patterned culture medium contains 1 μM CHIR-99021 and 0.5 μM Purmorphamine.

[0021] Preferably, the thalamic model culture medium contains 30 μg / mL insulin, 30 ng / mL BMP7, and 20 ng / mL c-JUN.

[0022] Preferably, the mature thalamus / diencephalon maintenance culture medium contains 20 ng / mL basic fibroblast growth factor 2 and 20 ng / mL BDNF.

[0023] Preferably, step (3) uses a marker for the TCF7L2 protein for sorting.

[0024] Secondly, the present invention provides thalamic / diencephalic organoids and neurons cultured by the above-described culture method.

[0025] Thirdly, the present invention provides a method for establishing a brain region interconnection model, comprising the following steps: co-embedding the above-mentioned thalamic / diencephalic organoids with at least one other brain region organoids in matrix gel and performing three-dimensional co-culture.

[0026] Fourthly, the present invention provides the application of the above-mentioned thalamic / diencephalic organoids and neurons in at least one of the following (I)-(V): (I) To conduct basic research on the preparation of in vitro models of human thalamic / diencephalic organoids and neurons; (II) Used to study the developmental mechanisms and / or functions of the nervous system; (III) Used in the preparation of active tissue materials / cell drugs; (IV) Used in the preparation of diagnostic or therapeutic drugs for neurological diseases; (V) Used for screening, drug testing evaluation or quality control of drugs for the prevention, diagnosis or treatment of neurological diseases.

[0027] The thalamic / diencephalic organoids cultured in this invention are integral structures of a specific brain region, containing the hypothalamus. These organoids can serve as research materials for basic research, used to observe the developmental characteristics, structure, and disease simulation of specific brain regions. They can also be used for whole-body transplantation as active tissue materials / cell drugs, showing potential application value in the future field of regenerative medicine.

[0028] The beneficial effects of this invention are as follows: 1. This invention provides a method for efficiently and rapidly differentiating thalamic / diencephalic organoids from human ESCs and iPSCs in vitro. The established thalamic / diencephalic organoids can preliminarily simulate the early neural development process in humans, providing a research model for disease simulation and drug screening.

[0029] 2. This invention, through comparison of c-Jun gene knockout and overexpression, found that c-JUN protein plays an important role in the development of the thalamus / diencephalon. Moderate overexpression of c-JUN can significantly promote the differentiation of neurons in the thalamus and diencephalon, increase the development rate of organoids and the density of internal neural networks, and improve modeling efficiency.

[0030] 3. The method for efficiently differentiating human embryonic stem cells or induced pluripotent stem cells into thalamic / diencephalic specific neurons and organoids provided by this invention supports both 2D and 3D cell model construction. It can be used for 3D development and cell structure research, as well as for observing individual neurons and the networks between neurons. Mature cells can be cryopreserved, facilitating long-term storage and transportation. Attached Figure Description

[0031] Figure 1 Bright-field illustration of the differentiation process of thalamic-diencephalic organoids and each stage (scale bar: 200 μm).

[0032] Figure 2 For identification of cell characteristic signals (scale bar: 100 μm).

[0033] Figure 3 The results were validated for c-Jun knockout (KO#2, KO#10) and normal (WT) control proteins.

[0034] Figure 4 Figure 3D on days 8, 16, and 30 showing growth and volume increase after c-JUN overexpression (KO#2+cJun, KO#10+cJun), c-JUN knockout (KO#2, KO#10), and normal control (WT) (scale bar: 200 μm).

[0035] Figure 5 Results of co-culture of thalamic / diencephalic organoids (ThO) and forebrain cortical organoids (CO) in Matrigel (scale bar: 500 μm).

[0036] Figure 6 hESC differentiates into 2D TCF7L2 via NPC + Thalamic / diencephalic specific nerve fibers (scale bar: 100 μm).

[0037] Figure 7 Results of 2D neural fiber maintenance capacity test for c-JUN overexpression (OE) and c-JUN knockout (KO) and normal control group (WT) (scale bar: 100 μm).

[0038] Figure 8 The results of the 2D nerve fiber shedding test are shown in the figures after enzyme digestion, c-JUN overexpression (OE) and c-JUN knockout (KO), normal group (WT) control group (scale bar: 100 μm). Detailed Implementation

[0039] To better illustrate the purpose, technical solution, and advantages of this invention, the invention will be further described below with reference to specific embodiments. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of protection defined by the claims of this invention. The specific content and concentration of the components in the following reagent list (Tables 1-9) are for ease of description and explanation, and the specific concentration values ​​do not constitute any limitation on the scope of protection defined by the claims of this invention.

[0040] Unless otherwise specified, the experimental methods used in this invention are conventional methods, and the materials and reagents used are commercially available products that can be obtained through commercial channels.

[0041] Example 1: 3D Thalamic / Diencephalic Organoid Culture This embodiment uses hESCs as an example for cultivation. In actual operation, both hESCs and hiSPCs can obtain the same cultivation results using the method described in the example. For ease of description, this example and subsequent examples will use hESCs as an example.

[0042] Reagent preparation: Preparation of the coating matrix gel: Prepare the matrix gel stock solution (e.g., Matrigel). TM Corning (354277) was dissolved in pre-cooled DMEM / F-12 medium.

[0043] Specific method: Melt 300 μL of Matrigel on ice. TM Place a sterile 50 mL conical tube and a bottle of sterile 4°C DMEM / F-12 culture medium in a sterile operating table. Add 25 mL of pre-chilled DMEM / F-12 culture medium to the conical tube. Using a pre-chilled pipette tip, transfer the thawed Matrigel... TMTransfer to 25 mL of DMEM / F-12 medium (Table 1) and mix well. Store at 4°C for use within 2 weeks, or freeze at -20°C.

[0044] Table 1: Coating matrix gel (25 mL system as an example) Prepare the relevant reagents and culture media according to Table 2-6 for the experiment.

[0045] Table 2: 0.5 mM EDTA (1:1000) (50 mL system as an example) Table 3: Neuroectodermal induction medium (50 mL system as an example, the volume of factors 5-8 is ignored) Prepare fresh before use; can be stored for 2 weeks at 4°C.

[0046] Table 4: Regional model culture medium (50 mL system as an example, the volume of some factors is ignored) Prepare fresh before use; can be stored for 2 weeks at 4°C.

[0047] Table 5: Thalamic model culture medium (50 mL system as an example, the volume of some factors is ignored) Prepare fresh before use; can be stored for 2 weeks at 4°C.

[0048] Table 6: Mature thalamus / diencephalon maintenance culture medium (50 mL system as an example, the volume of some factors is ignored) Prepare fresh before use; can be stored for 2 weeks at 4°C.

[0049] Specific methods: 1. Maintenance and predifferentiation preparation of human embryonic stem cells (hESCs) or human induced pluripotent stem cells (hiPSCs): (1.1) Use MatriGel to coat the well plates. For example, add 2 mL of coating MatriGel (Table 1) to each well of a 6-well plate and incubate at 37°C for 1 h. Resuspend the revived hESCs in mTeSR1 and seed them into MatriGel-coated 6-well plates. Add the culture medium to 2 mL and add 10 μM Y-27632 to the culture medium (remove Y-27632 after 12-16 h). Incubate at 37°C with 5% CO2.

[0050] (1.2) Change the mTesR1 medium to fresh daily. Differentiated cells may affect neural induction and subsequent differentiation efficiency. Mark differentiated cells under an inverted microscope and remove differentiated cells with a pipette tip in a clean bench. After multiple passages with 0.5 mM EDTA (Table 2), once the hESCs are in good and stable condition and the cell confluence reaches 70%–80%, differentiation begins.

[0051] 2. Embryoid formation and neuroectodermal induction: When human embryonic stem cells (hESCs) approached 60% confluence, a single-cell suspension was prepared for neural induction. Double SMAD inhibition was used to induce the pluripotent stem cells to differentiate into the neuroectoderm; the treatment time was approximately 6 days.

[0052] method: (2.1) Remove the culture medium from each well and wash the well once with 1 mL of DMEM / F-12 medium; remove the DMEM / F-12 medium and add 1 mL of preheated Accutase to the well plate. Place the culture plate back into the incubator and incubate for 5 minutes. Gently pipette the cell clumps to disperse the cells into single cells to obtain a single-cell suspension.

[0053] (2.2) Transfer the single-cell suspension obtained in step 2.1 to a 15 mL centrifuge tube containing 5 mL of DMEM / F-12 medium, and centrifuge at 200 × 10⁻⁶ at room temperature. g Centrifuge for 3 minutes. Remove the supernatant and resuspend the cells in 1 mL of preheated to room temperature neuroectodermal induction medium. Take a small sample of the cell suspension for cell counting and calculate the viable cell concentration.

[0054] (2.3) Resuspend a certain number of cells in neuroectodermal induction medium to achieve a final concentration of 60,000 viable cells / mL. Add Y-27632 (final concentration 50 mM) to the cell suspension and mix thoroughly. For a 96-well plate, 15 mL of cell suspension is required.

[0055] (2.4) Add the single-cell suspension obtained in step 2.3 to each well of the ultra-low adsorption 96U bottom plate, 150 μL / well, and place the 96U bottom plate in an incubator for static incubation, which is recorded as day 0 of the neural induction period. For multi-throughput preparation, using a multi-channel pipette can significantly reduce the difference in sphericity between wells and improve product uniformity.

[0056] (2.5) On day 1 of culture, gently remove the culture dish from the incubator and observe it under a microscope. Smooth embryoids should have formed in each well. Return the culture plate to the incubator for further culture. Every other day, remove 75 μL of culture medium from each well (do not touch the cell spheroids at the bottom of the well) and add fresh neural induction medium containing 50 mM Y-27632 to each well to a total of 150 μL (after day 4 of culture, the fresh medium added will no longer contain Y-27632).

[0057] 3. Regional pattern formation drives forebrain caudalization and promotes thalamic lineage formation: Starting on day 6, embryoids were collected from the ultra-low adsorption 96U bottom plate and transferred to ultra-low adsorption 24-well plates for suspension culture using regionally patterned media (Table 4). The time was approximately 4 days.

[0058] method: (3.1) On day 6 of embryoid formation and neuroectodermal induction, remove the ultra-low adsorption 96-well plate from the incubator. Using a Pasteur tube (or a large-bore pipette with an opening diameter larger than that of the embryoids), transfer the embryoids from each well to an ultra-low adsorption 24-well plate (no more than 6 embryoids per well; too many will cause adhesion). Handle the transfer carefully to avoid damaging the embryoids. Add 1 mL of regional patterning medium to each well of the ultra-low adsorption 24-well plate. Alternatively, 1 mL of regional patterning medium can be pre-added to the 24-well plate, and the embryoids can be aspirated from the Pasteur tube and suspended above the surface of the new medium, allowing gravity to help them settle into the 24-well plate, thus reducing damage to the embryoids.

[0059] (3.2) After the transfer is complete, place the horizontal shaker in the cell culture incubator and supply power through the pre-drilled opening on the back of the cell culture incubator. Place the 24-well plate on the horizontal shaker pad inside the incubator and rotate it at a speed of 100 revolutions per minute.

[0060] (3.3) Every day, replace half of the patterned culture medium with 1 mL of medium. Perform patterned culture for 4 days to drive forebrain caudalization and promote thalamic lineage formation.

[0061] 4. Thalamic pattern formation and caudal regulation (time approximately 4 days): Starting from day 10 (day 4 of regional pattern formation), cell spheres from the 24-well ultra-low adsorption plates were transferred to 12-well ultra-low adsorption plates and cultured in suspension using thalamic patterned medium (Table 5) at a volume of 2 mL / well. The 12-well plates were placed on a horizontal rocker mat in an incubator and rotated at 80 rpm.

[0062] Every other day, half of the thalamic culture medium was replenished to a final volume of 2 mL. A 4-day culture period was then conducted to determine the thalamic fate.

[0063] 5. Neural maturation and long-term culture (time range: 7 days to 3 months): (5.1) Starting from day 14 (day 4 of thalamic modeling), switch to the mature thalamus / diencephalon maintenance medium (Table 6) and continue horizontal shaker suspension culture. Carefully replace half of the medium every 3-4 days.

[0064] (5.2) For thalamic organoids with increased volume, the organoids can be transferred to larger low-adsorption plates (6-well plates) in a timely manner, or the density of spheres in the plates can be reduced. The number of organoids in each well of the low-adsorption plate should not exceed 6 (preferably to prevent mutual fusion).

[0065] (5.3) Starting from day 21, the organoid volume continues to increase, and the organoids tend to mature between 30 and 35 days. Figure 1 ). Staining with thalamic / diencephalic specific markers revealed TCF7L2+ signaling, neuronal development into mature nerve fibers (TUJ1), and intercellular fibronectin (Nestin, CNTN2) was also observed. Figure 2 Mature thalamic / diencephalic organoids can be used for cell identification or other applications.

[0066] This invention introduces c-Jun gene knockout cells and a control group of cells with c-JUN protein added after knockout, enabling simultaneous differentiation of organoids. c-JUN - / - Stem cells (hESCs) were constructed using CRISPR / Cas9 technology (sgRNA1: acaagtttcggggccgcaac; sgRNA2: gagaacttgacaagttgcga). Protein validation results after gene knockout are as follows: Figure 3 As shown.

[0067] Compared with the c-Jun knockout groups (KO#2, KO#10), the c-Jun non-knockout group (wild-type WT) and the group with c-Jun knockout followed by c-Jun addition (KO#2+cJun, KO#10+cJun) showed significantly increased organoid growth rate and neurosphere volume. c-Jun gene expression plays a crucial role in maintaining the growth and development of thalamic / diencephalic organoids. High expression of c-Jun (or addition of c-Jun protein) helps to significantly increase the growth rate and volume of thalamic / diencephalic organoids. Figure 4 ).

[0068] Thalamic / diencephalic organoids can normally be maintained for 1-3 months under good nutritional conditions, and are expected to be able to maintain them for even longer by improving oxygen and nutrient conditions. Mature organoids are digested by dispersing enzymes to form single cells, which can be cryopreserved. The cryopreservation solution is mature thalamic / diencephalic maintenance medium + 10% DMSO (or commercial cryopreservation solutions, such as CellBanker, amsbio, 11890, etc.).

[0069] Example 2: Co-culture of 3D thalamic / diencephalic organoids and brain organoids The thalamus / diencephalon plays a pivotal role in the central nervous system. Thalamic / diencephalon neurons project to the telecerebral cortex via axons, possessing the functional property of axonal transmission. This cellular property can be simulated through matrix gel embedding, potentially enabling the creation of organoid models connecting different brain regions. This would further enrich in vitro models of the central nervous system and facilitate research on interactions and functional relationships.

[0070] method: 1. Use a stretchable film (such as sealing film) and cut it to a certain size as needed, such as a 2 cm × 3 cm square film. Lay the film flat on the hole holder of a 200 μL pipette tip box (without the pipette tip). Use the smooth rounded end of a glass rod to press the film at each hole to form a depression (do not break the film).

[0071] 2. After melting the matrix collagen solution on ice, use a pre-cooled 200 μL pipette tip to transfer 30 μL of matrix collagen into the film depression to form a dewdrop-shaped liquid hemisphere.

[0072] 3. Transfer mature thalamic / diencephalic organoids (ThO) and forebrain cortical organoids (CO) sequentially into the liquid hemispheres from step 2, spaced a distance apart (e.g., 3-5 mm), and embed them together in a matrix gel. Place the film horizontally in a 37°C incubator for 15 minutes to allow the matrix gel to solidify.

[0073] 4. Carefully wash the solidified matrix gel into the 6-well plate with 1 mL of mature thalamus / diencephalon maintenance medium preheated to 37°C, add 3 mL of mature thalamus / diencephalon maintenance medium, and suspend in the plate on a horizontal shaker (50-80 rpm).

[0074] 5. After suspension culture for a period of time (e.g., 7 days), numerous fibrous neurofilaments (neural axons) can be observed growing from the limbic cells of thalamic / diencephalic organoids (ThO). In contrast, no similar fibrous neurofilaments appear in forebrain cortical organoids (CO), indicating that different brain regions exhibit distinctly different cellular behavioral characteristics. Figure 5 ).

[0075] This phenomenon indicates that the nerve cells contained in the thalamic / diencephalic organoids have the ability to grow and transmit nerve axons, and have initially acquired their unique structural and functional attributes.

[0076] Example 3: 2D thalamic neuron culture Besides 3D organoids, the method used in this invention can also induce and culture 2D thalamus-specific neurons. One culture method and corresponding example are given here. Neural progenitor cells (NPCs) are induced from hESCs (or iPSCs). Under the induction of thalamus-model culture medium (Table 5), the neurons gradually mature, expressing the TCF7L2 specific marker, forming thalamus / diencephalon-specific neurons. The formed TCF7L2... + Thalamic / diencephalic neurons can be cryopreserved using a mature thalamic / diencephalic maintenance medium plus 10% DMSO (or commercial cryopreservation solutions such as CellBanker, amsbio, #11890, etc.).

[0077] Reagent preparation: Prepare the relevant culture media according to Table 7-8 for the experiment.

[0078] Table 7: Neural progenitor cell induction medium (NIM) (50 mL system as an example, the volume of some factors is ignored) Prepare fresh before use; can be stored for 2 weeks at 4°C.

[0079] Table 8: Neural progenitor cell maintenance medium (NMM) (50 mL system as an example, the volume of some factors is ignored) Prepare fresh before use; can be stored for 2 weeks at 4°C.

[0080] method: 1. Preparation for human embryonic stem cell (hESC) differentiation: Preparation of poly-L-ornithine and laminin coated plates: Add 1 mL of 0.01% poly-L-ornithine (Sigma, P4957) to each well of a 6-well culture dish and incubate at 37°C for 4 hours. Collect the coating medium and carefully wash the plate once with DPBS. Dilute 1 mg / mL laminin (Sigma, L2020) stock solution 1:50 with DPBS to a final concentration of 20 μg / mL. Add 1 mL of the diluted laminin to each well of a 6-well culture dish and incubate at 37°C for 4 hours. The coated culture plates can be stored at 4°C for up to 2 weeks. Collect the diluted laminin and carefully wash the culture plate once with DMEM / F12 before adding cells.

[0081] Prepare human stem cells (embryonic stem cells hESCs or induced pluripotent stem cells iPSCs, using hESCs as an example here) by dissociating them using trypsin to create single cells. Add 1 mL of Matrigel coating medium to one well of a 12-well cell culture plate. Seed 1–1.5 × 10^6 cells per well. Ensure the cells reach 100% confluence one day after seeding. If not confluenced, wait one day until the cells reach 100% confluence before initiating neural induction.

[0082] 2. Neural induction (approximately 12 days): (2.1) Day 0: When the cells reach 100% confluence, neuron induction begins. The culture medium is replaced with neural induction medium (NIM) (Table 7).

[0083] (2.2) Days 1-11: Change the neural induction medium (NIM) daily (Table 7). Closely monitor the morphological changes of primitive neural stem cells (PSCs) during differentiation. PSCs with large nuclei should be gradually replaced by closely packed neural epithelial cells with significantly smaller nuclei. A uniform layer of neural epithelial cells should appear between days 8 and 12 after plating.

[0084] (2.3) Day 12: Add 100 μL of 5 U / mL dispersant directly to the culture medium (containing 1 mL NIM) in the 12-well plate. Incubate at 37°C for 5 minutes. Slowly add dispase (stemcell, 07913) to the culture medium (final concentration 0.5 U / mL), incubate at 37°C for 5 minutes, and carefully aspirate the dispase solution. Carefully wash twice with preheated DMEM / F12, being careful not to touch the cell layer, and then remove the washing solution.

[0085] (2.4) Using a 10 μL pipette tip, draw a cross-shaped pattern on the cells, trying to make the pattern as even as possible. Use this method to separate the cells into small clusters (slowly pipette with a 1 mL pipette tip 3 times to form neuroepithelial clumps of 300-500 cells). Collect the floating cell clusters with a 5 mL pipette, slowly aspirating and transferring them up and down 3-5 times. 160× g Centrifuge at room temperature for 2 minutes, discard the supernatant, resuspend in 10 mL NMM medium, and centrifuge again at 160× g Centrifuge at room temperature for 2 minutes, then repeat the washing once.

[0086] (2.5) Gently resuspend the collected cell clumps using 200 μL of neural progenitor cell maintenance medium (NMM) (Table 8).

[0087] (2.6) The cell clusters from each 12-well plate were seeded into 6-well plates coated with poly-L-ornithine and laminin, and 2 mL of neural progenitor cell maintenance medium (NMM) was added (Table 8). Y-27632 (10 μM) was added to promote cell aggregate formation.

[0088] 3. Formation and expansion of neural stem cells (NSCs) (approximately 10 days): (3.1) Day 13: Replace the medium with NMM medium supplemented with 20 ng / mL FGF2. Change the medium daily and remove FGF2 from the medium on day 17 (4 days after FGF2 treatment). The neural rosette structure should be clearly visible approximately 12–17 days after neural induction.

[0089] (3.2) Day 18: The cells were dispersed by the dispersing enzyme and then amplified in a 1:3 ratio into 6-well plates coated with poly-L-ornithine and laminin.

[0090] (3.3) Day 25: Neural progenitor cells have formed. Thalamic / diencephalic induction begins. Remaining cells can be cryopreserved.

[0091] 4. Thalamus / diencephalon TCF7L2 + Neuronal differentiation induction (7-10 days): Day 25: Replace the culture medium with thalamic model medium (Table 5). Change the medium every 2 days, approximately day 7 after thalamic / diencephalic neural induction, TCF7L2 + Neuronal immunofluorescence staining clearly showed ( Figure 6 ).

[0092] 5. Day 35: Replace the culture medium with mature thalamus / diencephalon maintenance medium (Table 6), changing the medium every 2-3 days. Cells at this stage are mature TCF7L2 cells. + Neurons, rich in TUJ1 + / Nestin + These nerve fibers can be used for experimental purposes such as observation and detection.

[0093] On day 43, compared with the c-Jun knockout groups (KO#2, KO#10), the number of nerve fibers in the c-Jun non-knockout group (wild-type WT) and the group that added c-JUN after knockout (overexpressing OE) was significantly increased, neurons adhered well, and aggregation was rare. Figure 7After digestion with enzyme (Accutase, Gibco, A1110501) and incubation at 37°C for 5 minutes, the cell layers in the KO group showed obvious detachment at the edge, while no obvious curling or detachment was observed in the WT and c-Jun overexpression (OE) groups. This suggests that cells induced by adding c-Jun have better adherence and tight junction properties. Figure 8 ).

[0094] Digested cells can be cryopreserved. Cryopreservation method: Wash cells once with PBS. Add 0.4 mL of Accutase to each 6-well plate. Incubate at 37°C for 4-5 minutes. Dissociate cell clumps into single-cell suspensions by pipetting the cells up and down 3 or 4 times in the Accutase solution. Dilute Accutase with 4 times its volume of phosphate-buffered saline (PBS); at room temperature, freeze at 160 mL / min. ×g Centrifuge for 5 minutes to collect cells. Resuspend cells in 1 mL of neural cryopreservation medium (neural maintenance medium containing 10% DMSO + 20 ng / mL FGF2) in each 6-well plate, place at -80°C, and transfer to liquid nitrogen for cryopreservation after 24 hours.

[0095] Example 4: Interconversion culture of three-dimensional organoids and two-dimensional cells 1. 3D to 2D conversion: (1) The thalamic / diencephalic organoids formed in Example 1 were digested using a dispersing enzyme. The organoids were incubated with Accutase (Gibco, A1110501) at 37°C for 5-10 minutes. The organoids were carefully broken into single cells by repeated pipetting with a 1 mL pipette tip. The single cells were then filtered through a 70 μm filter membrane and collected.

[0096] (2) Cells were immunofluorescence stained with TCF7L2 antibody and corresponding secondary antibody, and TCF7L2 cells were collected by flow cytometry. + Cells were seeded in culture dishes coated with poly-L-ornithine (Sigma, P4957) and laminin (Sigma, L2020).

[0097] (3) Using mature thalamus / diencephalon maintenance culture medium (Table 6), thalamus / diencephalon-specific neurons were formed in a two-dimensional plane after about 7 days. This completed the dimensionality reduction transformation of three-dimensional organoids into two-dimensional cells.

[0098] TCF7L2 + Thalamic / diencephalic neurons can be cryopreserved using a mature thalamic / diencephalic maintenance medium plus 10% DMSO (or a commercial cryopreservation medium, such as CellBanker).

[0099] 2. 2D to 3D conversion: (1) Use a stretchable film (e.g., sealing film) and cut it to a certain size as needed, such as a 2 cm × 3 cm square film. Lay the film flat on the hole rack of a 200 μL pipette tip box (without the pipette tip). Use the smooth round head of a glass rod to press the film at each small hole to form a depression (do not break the film).

[0100] (2) After melting the matrix collagen solution on ice, use a pre-cooled 200 μL pipette tip to transfer 30 μL of matrix collagen into the film depression to form a dewdrop-shaped liquid hemisphere.

[0101] (3) After digesting, washing and centrifuging the two-dimensional cultured thalamic / diencephalic neurons, enrich them into clusters, inject the cell clusters into the matrix gel liquid hemispheres, and place the film horizontally in a 37°C incubator for 15 minutes to allow the matrix gel to solidify.

[0102] (4) Carefully wash the solidified matrix gel into the 6-well plate using 1 mL of mature thalamus / diencephalon maintenance medium preheated to 37°C (Table 6), add 3 mL of mature thalamus / diencephalon maintenance medium, and suspend in the medium on a horizontal shaker (50-80 rpm). Replace half of the medium every 2-3 days.

[0103] (5) After suspension culture for a period of time (about 7 days), a large number of fibrous neurofilaments can be seen growing from the thalamus / diencephalon neurons to the periphery. With continued culture, the neurofilaments occupy the matrix gel and eventually form a three-dimensional thalamus / diencephalon organoid. Thus, the transformation from two-dimensional cells to three-dimensional organoids is completed.

[0104] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A method for culturing thalamic / diencephalic organoids and neurons, characterized in that, Human embryonic stem cells or induced pluripotent stem cells are directed to differentiate into thalamic / diencephalic organoids expressing thalamic / diencephalic markers and cellular characteristics by adding inducing factors in stages, including at least one of the following (1)-(3): (1) Thalamic / diencephalic organoids were cultured through the following steps: a. Neuroectodermal induction stage: Human embryonic stem cells or induced pluripotent stem cells are prepared into single-cell suspensions and cultured in a neuroectodermal induction medium containing TGF-β / Activin inhibitors and bone morphogenetic protein BMP inhibitors to form embryoids; b. Regional patterning stage: The embryoids obtained in step (a) are transferred to a regional patterning medium containing WNT activator and SHH agonist for suspension culture to form cell spheres; c. Thalamic modeling stage: The cell spheres obtained in step (b) were transferred to a thalamic modeling medium containing insulin, BMP7, and c-JUN for suspension culture to drive forebrain caudalization; d. Neural maturation and maintenance stage: Replace the culture medium with a mature thalamus / diencephalon maintenance medium containing basic fibroblast growth factor 2 and BDNF and culture in suspension until thalamus / diencephalon organoids are formed; (2) Thalamic / diencephalic neurons are cultured through the following steps: Human pluripotent stem cells or induced pluripotent stem cells are induced to differentiate into neural progenitor cells, and thalamic / diencephalic neurons are obtained by culturing them in the thalamic model culture medium of step (c). (3) Dimensional conversion of thalamic / diencephalic cell culture: After digestion and dispersion of the obtained thalamic / diencephalic organoids, thalamic / diencephalic neurons were sorted and cultured in two dimensions on a plane coated with extracellular matrix. Alternatively, the obtained thalamic / diencephalic neurons can be digested and enriched into cell clusters, then embedded in matrix gel for three-dimensional suspension culture to form a three-dimensional structure rich in thalamic / diencephalic neurons.

2. The cultivation method as described in claim 1, characterized in that, The TGF-β / Activin inhibitor includes SB-431542; the bone morphogenetic protein (BMP) inhibitor includes LDN-193189.

3. The cultivation method as described in claim 2, characterized in that, The neuroectodermal induction medium contains 10 mMSB-431542 and 100 nM LDN-193189.

4. The cultivation method as described in claim 1, characterized in that, The WNT activator includes CHIR-99021; the SHH agonist includes Purmorphamine or Smoothened Agonist.

5. The cultivation method as described in claim 4, characterized in that, The regional modeling culture medium contains 1 μM CHIR-99021 and 0.5 μM Purmorphamine.

6. The cultivation method as described in claim 1, characterized in that, The thalamic model culture medium contains 30 μg / mL insulin, 30 ng / mL BMP7, and 20 ng / mL c-JUN.

7. The cultivation method as described in claim 1, characterized in that, The mature thalamus / diencephalon maintenance culture medium contains 20 ng / mL basic fibroblast growth factor 2 and 20 ng / mL BDNF.

8. Thalamic / diencephalic organoids and neurons cultured by the culture method according to any one of claims 1-7.

9. A method for establishing a brain region interconnection model, characterized in that, The procedure includes the following steps: co-embedding the thalamic / diencephalic organoids of claim 8 with at least one other brain region organoids in a matrix gel and then co-culturing them in three dimensions.

10. The use of the thalamic / diencephalic organoids and neurons as described in claim 8 in at least one of the following (I)-(V): (I) To conduct basic research on the preparation of in vitro models of human thalamic / diencephalic organoids and neurons; (II) Used to study the developmental mechanisms and / or functions of the nervous system; (III) Used in the preparation of active tissue materials / cell drugs; (IV) Used in the preparation of diagnostic or therapeutic drugs for neurological diseases; (V) Used for screening, drug testing evaluation or quality control of drugs for the prevention, diagnosis or treatment of neurological diseases.

Citation Information

Patent Citations

  • Pharmaceutical composition for preventing and treating senile diseases comprising three-dimensional hypothalamic organ-derived neural stem cells and use thereof

    CN119365203A

  • Composition for preparing brain organ, brain organ and application of brain organ

    CN120665813A

  • Method for constructing mouse embryo-derived hypothalamic organ model and application of mouse embryo-derived hypothalamic organ model

    CN120818488A