Colorimetric visual sensor for detecting 17beta-estradiol by regulating MoSe2 nano enzyme based on split aptamer

By using a colorimetric sensor that modulates the MoSe2 nanozyme through aptamer splitting, the complexity and interference problems of existing 17β-estradiol detection methods are solved, enabling highly selective and sensitive on-site detection, suitable for convenient quantitative analysis of food and environmental samples.

CN121899053APending Publication Date: 2026-04-21JILIN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-02
Publication Date
2026-04-21

AI Technical Summary

Technical Problem

Existing methods for detecting 17β-estradiol rely on large instruments, are costly and complex to operate, making it difficult to achieve rapid on-site screening. Furthermore, colorimetric sensors based on nanozymes are susceptible to interference from environmental and operating conditions, and are often affected by matrix interference when applied to complex samples.

Method used

A colorimetric sensing system based on the mitochondrial regulation of MoSe2 nanozymes was constructed. The enzyme activity of MoSe2 was regulated by the mitochondrial structural transition induced by the target. Combined with smartphone image analysis, a highly selective and sensitive detection of 17β-estradiol was achieved.

Benefits of technology

It enables convenient and low-cost detection of 17β-estradiol in complex samples, with good stability and anti-interference ability, and supports integrated detection from visual semi-quantitative to instrument-assisted quantitative.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121899053A_ABST
    Figure CN121899053A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biosensors, and discloses a colorimetric visual sensor for detecting 17 beta-estradiol based on MoSenano enzyme regulated and controlled by a split aptamer, and the colorimetric visual sensor is prepared by the following steps: preparing a MoSenano enzyme solution with peroxidase-like activity; a split aptamer aiming at 17 beta-estradiol is adsorbed on the surface of the MoSe nanosheet under the action of Van der Waals' force, so that the enzyme-like activity of MoSe is enhanced; when a target exists, the target is specifically combined with the split aptamer and induces conformation recombination, the affinity of the compound and MoSe is remarkably reduced, dissociation is caused, and the catalytic activity of MoSe is reduced; the color change is generated by catalyzing the HO oxidation TMB through the MoSe nano-enzyme, so that the quantitative detection of colorimetric signal output is realized. According to the invention, a colorimetric card is prepared through color analysis software of a smart phone, and on-site semi-quantitative analysis is realized; and R channel data of the RGB value is extracted, so that convenient quantitative detection is realized. A practical solution is provided for rapid screening of 17 beta-estradiol in environmental water and food, and the method has a good application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biosensor technology, specifically relating to a colorimetric sensing method based on MoSe2 nanozymes with peroxidase-like activity. This method achieves the detection of 17β-estradiol by regulating the catalytic activity of MoSe2 nanozymes through aptamer splitting. It is applicable to the detection of 17β-estradiol in environmental water bodies and food matrices (such as river water, milk, pork, beef, etc.) and further provides a matching colorimetric card to support visual semi-quantitative detection. At the same time, image analysis can be performed via smartphone to achieve convenient and low-cost on-site quantitative detection, providing a new method for the detection of 17β-estradiol that is simple to operate and highly practical. Background Technology

[0002] 17β-estradiol (E2), a typical endocrine disruptor, can enter the food chain and environmental water bodies through aquaculture, agriculture, and domestic sewage. Its residues in food pose a potential threat to public health. Even at extremely low concentrations, it can disrupt the endocrine system of organisms, and long-term exposure may lead to reproductive abnormalities, developmental disorders, and an increased risk of cancer. Currently, the detection of 17β-estradiol mainly relies on gas chromatography-mass spectrometry, liquid chromatography-tandem mass spectrometry, and enzyme-linked immunosorbent assay (ELISA). While these methods are highly accurate, they have limitations such as reliance on large instruments, high costs, complex operation, and cumbersome sample pretreatment, making rapid on-site screening difficult. Therefore, developing simple, sensitive detection methods suitable for grassroots use is of great significance.

[0003] Nucleic acid aptamers are single-stranded oligonucleotide recognition molecules obtained through in vitro exponential enrichment system evolutionary techniques. In recent years, biosensing technologies based on nucleic acid aptamers have become a research hotspot in the field of rapid food detection due to their advantages such as high specificity, ease of modification, and good stability. In particular, split aptamers, by splitting a complete aptamer into two functional fragments, separate when no target is present; once a target is present, the two fragments can be induced to form a stable complex through structural recombination, thereby triggering subsequent signal output. This achieves dual regulation of the recognition process and signal output, improving the controllability of the recognition process and signal conversion efficiency, and providing a new approach for constructing highly specific and controllable biosensors.

[0004] In terms of signal output, colorimetry has attracted much attention due to its intuitiveness and lack of complex instruments. Nanozyme catalytic materials, with their high catalytic activity, good stability, and simple preparation, provide an efficient signal amplification pathway for colorimetric sensing, showing great application potential. MoSe2 nanosheets, as a graphene-like two-dimensional material, possess excellent peroxidase-like activity. Their catalytic mechanism stems from the exposed selenium vacancies and edge active sites on their surface, which can mimic the catalytic centers of natural peroxidases. Under mild conditions, they can catalyze the oxidation of substrates such as 3,3',5,5'-tetramethylbenzidine with hydrogen peroxide, generating blue oxidation products and producing a significant color change. Furthermore, their catalytic behavior is easily influenced by surface-adsorbed molecules. This characteristic allows MoSe2 nanozymes to be combined with apposition aptamer recognition systems. By controlling the surface state of MoSe2 through target-induced conformational changes in the apposition aptamers, precise control of the catalytic process can be achieved, enabling efficient conversion from recognition events to color signals and constructing a colorimetric sensing platform with good selectivity and intuitive response.

[0005] However, existing nanozyme-based colorimetric sensors mostly rely on a single signal output, are easily affected by environmental and operational conditions, and are often affected by matrix interference in the application of complex samples. Therefore, based on the above theory, this invention proposes a colorimetric sensing system for the detection of 17β-estradiol based on MoSe2 nanozyme-regulated by aptamer splitting. By regulating the enzyme activity of MoSe2 through target-induced aptamer structural transition, precise control of the color signal is achieved, enabling rapid quantitative analysis in conjunction with a smartphone, thus improving the reliability and practicality of the detection. Summary of the Invention

[0006] The purpose of this invention is to overcome the technical bottlenecks of existing 17β-estradiol detection methods, such as expensive equipment and complex operation, and to provide a colorimetric visualization sensing method for the detection of 17β-estradiol based on MoSe2 nanozyme regulation using apposition aptamers. This method utilizes the specific recognition function of apposition aptamers for 17β-estradiol and their precise regulation of the MoSe2 nanozyme catalytic colorimetric process to construct a highly selective and sensitive colorimetric detection system. This system exhibits good stability and anti-interference ability in practical applications. Combined with the image analysis function of smartphones, it achieves integrated detection from semi-quantitative visual detection to instrument-assisted quantification through solution color. Therefore, this invention provides a potential technical approach for the convenient and low-cost detection of 17β-estradiol in food and environmental samples, and has certain practical application value.

[0007] The objective of this invention can be achieved through the following technical solutions:

[0008] A colorimetric visualization sensor for detecting 17β-estradiol based on MoSe2 nanozyme regulated by aptamer splitting, comprising the following steps:

[0009] A. Preparation of MoSe2 nanozyme solution:

[0010] Preparation of MoSe2 powder: Molybdenum powder and selenium powder were accurately weighed and mixed at a stoichiometric ratio of 1:2, and then reacted at 900℃ for 8 hours under argon atmosphere. After the reaction was completed, the reaction system was cooled to room temperature with the furnace to obtain MoSe2 product. MoSe2 powder was obtained by crushing and grinding.

[0011] Preparation of MoSe2 nanozyme solution: 1 g MoSe2 powder was dissolved in a mixed solvent consisting of 5 mL dimethyl sulfoxide and 5 mL anhydrous ethanol and sonicated for 8 hours; the sonicated solution was centrifuged at 5000 rpm for 5 minutes to separate the solid residue and the supernatant, and the supernatant was collected to obtain the MoSe2 nanozyme solution.

[0012] B. Colorimetric analysis of 17β-estradiol:

[0013] First, 25 μL of 1 μM S1 sequence 1 (cgggacgacatgga) and 25 μL of 1 μM S2 sequence 2 (tccatcaacgaagtgcgtccgtcccg) were stored at 95°C for 5 minutes, followed by annealing in an ice bath for 20 minutes. Then, 35 μL of solutions with different concentrations of 17β-estradiol and 100 μL of binding buffer (50 mM Tris-HCl, 5 mM KCl, 100 mM NaCl, 20 mM MgCl2, 10% DMSO, 50 mM Tris-HCl, pH 7.5) were added, and the mixture was incubated at 25°C with shaking at 1000 rpm for 30 minutes. Next, 25 μL of 20 mg / mL MoSe2 nanozyme solution and 100 μL of pH 3.5 acetate-sodium acetate buffer were added, and the mixture was incubated at 25°C with shaking at 1000 rpm for another 20 minutes. Finally, 20 μL of 50 mg / mL DMSO solution was added. A solution of 20 mM H2O2 and 20 μL of 20 mM TMB was reacted with shaking at 25℃ and 1000 rpm for 25 minutes, resulting in a color change. The reaction system was then placed in an ice bath for 2 minutes, centrifuged at 8000 rpm for 2 minutes, and the supernatant was collected for analysis.

[0014] The absorbance of the reaction system was measured at a wavelength of 652 nm to quantitatively detect the concentration of 17β-estradiol.

[0015] C. Smartphone on-site testing technology:

[0016] Using color analysis software on a smartphone, the basic color values ​​of the Red, Green, and Blue channels (RGB values) of the image are automatically extracted by selecting the detection area, and a corresponding colorimetric card is generated to achieve semi-quantitative detection of 17β-estradiol by the naked eye. Furthermore, the R channel value of the extracted RGB values ​​is used as the output signal to establish a fitting curve between it and the concentration of 17β-estradiol, realizing convenient quantitative analysis of 17β-estradiol within the concentration range of 1–10 μg / mL.

[0017] The mechanism of this invention is as follows:

[0018] This invention achieves highly sensitive and selective colorimetric detection of 17β-estradiol by constructing a synergistic regulatory system of a splitting aptamer and MoSe2 nanozyme. The core mechanism lies in the following: MoSe2 nanosheets possess peroxidase-like catalytic activity, efficiently catalyzing the oxidation of the substrate TMB by H2O2 to generate the blue oxidation product ox-TMB, which exhibits characteristic absorption near 652 nm in the UV-Vis spectrum; the splitting aptamer, composed of two sequences S1 and S2, can adsorb onto the surface of MoSe2 nanosheets via van der Waals forces, altering the local microenvironment and charge distribution on the MoSe2 nanosheet surface, thereby promoting the catalytic activity of MoSe2. When the target analyte 17β-estradiol is present, its specific binding to the splitting aptamer induces conformational recombination between S1 and S2, forming a stable aptamer-target complex. This complex exhibits a significantly reduced affinity for MoSe2 nanosheets, leading to its dissociation from the material surface. This reduces the enzyme-like catalytic activity of MoSe2, weakens the color development of the TMB-H2O2 system, and causes the solution to become lighter in blue. The absorbance near 652 nm in the UV-Vis spectrum decreases, thus enabling the detection of 17β-estradiol. Furthermore, the solution color depth is negatively correlated with the 17β-estradiol concentration. By capturing the color image of the reaction system using a smartphone and extracting the R channel values ​​in the RGB color space, a quantitative relationship between the R value and the 17β-estradiol concentration can be established, enabling convenient quantitative detection without the need for complex instruments.

[0019] This system utilizes the conformational transformation of splitting aptamers to achieve precise control of the catalytic activity of nanozymes. Combined with the amplification effect of color signals, the portable analysis capabilities of colorimetric cards and smartphones, it constitutes a new method for the detection of 17β-estradiol that is simple to operate and suitable for on-site screening. Attached Figure Description

[0020] Figure 1 Example 3 is a schematic diagram of the principle of a colorimetric visualization sensor for detecting 17β-estradiol based on MoSe2 nanozyme regulated by appositional aptamers.

[0021] Figure 2Example 1: A diagram showing the state of the MoSe2 nanozyme solution under natural light.

[0022] Figure 3 Example 2 describes the peroxidase-like activity verification of MoSe2 nanozymes, including the absorption spectra of MoSe2+TMB+H2O2, MoSe2+TMB, MoSe2+H2O2, and TMB+H2O2.

[0023] Figure 4 Example 3 describes the absorption spectra of the S1+S2, MoSe2, S1+S2+MoSe2, and S1+S2+estradiol+MoSe2 catalytic systems to verify the feasibility of this method.

[0024] Figure 5 As described in Example 3, a colorimetric visualization sensor based on the aptamer-regulated MoSe2 nanozyme was used to detect 17β-estradiol, showing the absorption spectra of different concentrations of 17β-estradiol (0, 1, 2, 2.5, 4, 5, 6, 7.5, 10 μg / mL) in the MoSe2+S1+S2+estradiol system.

[0025] Figure 6 Example 3 shows a linear relationship between the absorbance change (ΔA) at 652 nm and the concentration of 17β-estradiol.

[0026] Figure 7 Example 3 describes the stability of 17β-estradiol detected by this sensing system.

[0027] Figure 8 Example 3 illustrates the specificity of this sensing system for detecting 17β-estradiol. (Concentration: 10 μg / mL)

[0028] Figure 9 Example 3 illustrates the anti-interference capability of this sensing system for detecting 17β-estradiol. (The concentration of interfering substances was 10 μg / mL.)

[0029] Figure 10 Example 5 describes a colorimetric card output by smartphone image analysis software based on a colorimetric visualization sensor that regulates MoSe2 nanozymes using a splitting aptamer.

[0030] Figure 11 Example 5 shows the linear relationship between the R value and the concentration of 17β-estradiol at different concentrations (0, 1, 2, 2.5, 4, 5, 6, 7.5, 10 μg / mL) in a smartphone image color analysis software based on a colorimetric visualization sensor regulated by apposition aptamers for MoSe2 nanozymes.

[0031] Figure 12 Example 5 describes a convenient analysis module for 17β-estradiol concentration based on a colorimetric visualization sensor of MoSe2 nanozymes regulated by appositional aptamers. Detailed Implementation

[0032] The invention will now be further described with reference to the accompanying drawings.

[0033] Example 1: Preparation of MoSe2 nanozyme solution

[0034] Preparation of MoSe2 powder: Molybdenum powder and selenium powder were accurately weighed and mixed at a stoichiometric ratio of 1:2, and then reacted at 900℃ for 8 hours under argon atmosphere. After the reaction was completed, the reaction system was cooled to room temperature with the furnace to obtain MoSe2 product. MoSe2 powder was obtained by crushing and grinding.

[0035] 1 g of MoSe2 powder was dissolved in a mixed solvent of 5 mL dimethyl sulfoxide and 5 mL anhydrous ethanol, and sonicated for 8 hours. The sonicated solution was centrifuged at 5000 rpm for 5 minutes to separate the solid residue from the supernatant. The supernatant was collected to obtain the MoSe2 nanozyme solution. Figure 2 );

[0036] Example 2: Verification of the peroxidase-like activity of MoSe2 nanozymes

[0037] First, 25 μL of 30 mg / mL MoSe2 nanozyme solution was mixed with 100 μL of acetate-sodium acetate buffer (pH=4.0) and incubated with shaking at 25℃ and 1000 rpm for 20 minutes. Then, 20 μL of 50 mM H2O2 solution and 20 μL of 20 mM TMB solution were added sequentially, and the volume was brought up to 350 μL with deionized water. The reaction was continued with shaking for 30 minutes under the same conditions, and the color change was observed. After the reaction, the system was placed in an ice bath for 2 minutes, then centrifuged at 8000 rpm for 2 minutes. The supernatant was then measured at a wavelength of 652 nm.

[0038] Catalyzed by MoSe2 nanozymes, H2O2 oxidizes the substrate TMB to generate the blue oxidation product ox-TMB, which exhibits characteristic absorption near 652 nm in the UV-Vis spectrum. Figure 3 The study verified the peroxidase-like activity of the MoSe2 nanozyme.

[0039] Example 3: Detection of 17β-estradiol using a colorimetric visualization sensor based on MoSe2 nanozymes regulated by apposition aptamers.

[0040] First, 25 μL of 1 μM S1 sequence 1 (cgggacgacatgga) and 25 μL of 1 μM S2 sequence 2 (tccatcaacgaagtgcgtccgtcccg) were stored at 95°C for 5 minutes, followed by annealing in an ice bath for 20 minutes. Then, 35 μL of solutions with different concentrations of 17β-estradiol and 100 μL of binding buffer (50 mM Tris-HCl, 5 mM KCl, 100 mM NaCl, 20 mM MgCl2, 10% DMSO, 50 mM Tris-HCl, pH 7.5) were added, and the mixture was incubated at 25°C with shaking at 1000 rpm for 30 minutes. Next, 25 μL of 20 mg / mL MoSe2 nanozyme solution and 100 μL of pH 3.5 acetate-sodium acetate buffer were added, and the mixture was incubated at 25°C with shaking at 1000 rpm for another 20 minutes. Finally, 20 μL of 50 mg / mL DMSO solution was added. A solution of 20 mM H2O2 and 20 μL of 20 mM TMB was reacted with shaking at 25℃ and 1000 rpm for 25 minutes, resulting in a color change. The reaction system was then placed in an ice bath for 2 minutes, centrifuged at 8000 rpm for 2 minutes, and the supernatant was collected for analysis.

[0041] The absorbance of the reaction system was measured at a wavelength of 652 nm to quantitatively detect the concentration of 17β-estradiol.

[0042] The detection principle of this method has been experimentally verified to be feasible. Figure 4 Within a final 17β-estradiol concentration range of 1–10 μg / mL, the absorbance of the system at 652 nm gradually decreased with increasing concentration. Figure 5 This method enables quantitative colorimetric detection of 17β-estradiol. Within a final 17β-estradiol concentration range of 1–10 μg / mL, the absorbance change (ΔA) at 652 nm is linearly correlated with the 17β-estradiol concentration, with the linear equation: ΔA = 0.0416C1 7β-雌二醇 + 0.0036 (R) 2 =0.9976), and the limit of detection (LOD) was 0.016 μg / mL ( Figure 6 ), and has good detection stability ( Figure 7 This method can meet the detection requirements of 17β-estradiol in actual samples. The method developed in this invention produces virtually no significant non-specific signals in the presence of structural analogs such as bisphenol A, chloramphenicol, 2,4-dichlorophenoxyacetic acid, medroxyprogesterone acetate, diethylstilbestrol, and estriol. Figure 8Furthermore, common matrix interfering substances in food and environmental samples, including glucose, glycine, tyrosine, phosphate, sulfate, vitamin B1, cysteine, arginine, glutamic acid, L-histidine, L-lysine, phenol, L-serine, and L-tryptophan, almost do not cause false positive reactions. This indicates that this method has good resistance to common matrix interfering substances, and non-target substances in complex matrices basically do not interfere with the detection of 17β-estradiol. Figure 9 This indicates that the proposed colorimetric detection strategy has high selectivity for the analysis of 17β-estradiol in complex samples.

[0043] Example 4: Determination of 17β-estradiol content in actual samples

[0044] This invention utilizes a spiked recovery method to detect 17β-estradiol in actual samples, exploring its applicability and accuracy. Specific samples included environmental samples (Songhua River water) and food samples (milk, pork, and beef). The raw material samples underwent pretreatment as follows: Different concentrations of 17β-estradiol were added to the water sample, followed by filtration through a 0.45 μm water filter membrane. 5 g of milk was dispersed in 10 mL of ethyl acetate, continuously sonicated for 10 minutes, and then centrifuged at 8000 rpm for 5 minutes to collect the supernatant. The supernatant was then filtered through a 0.45 μm filter membrane. Meat samples (pork and beef) were minced, and 5 g of the meat sample was enzymatically hydrolyzed using β-glucuronidase / arylsulfatase at approximately 37°C for several hours to release the bound hormone into a free state. Then, 10 mL of ethyl acetate was added to the above solution, and subsequent operations were performed following the same steps as for the milk sample.

[0045] 17β-estradiol at final concentrations of 1, 5, and 10 μg / mL in actual samples was detected using the colorimetric method developed in this invention. Within the concentration range of 1–10 μg / mL, a good linear relationship was observed between the absorbance change (ΔA) at 652 nm and the 17β-estradiol concentration. As shown in Table 1, the recoveries of 17β-estradiol in different samples ranged from 92.71% to 105.27%, and the relative standard deviations (RSDs) of the detection results for each actual sample ranged from 3.593% to 10.672%. These data demonstrate that the colorimetric sensing method developed in this study has reliable quantitative detection capabilities in actual samples and is suitable for the accurate analysis of 17β-estradiol in environmental and food samples.

[0046]

[0047] Example 5: Smartphone On-site Testing Technology

[0048] Using color analysis software on a smartphone, the system automatically extracts the basic color values ​​(RGB values) of the Red, Green, and Blue channels of an image by selecting a detection area, and generates the corresponding colorimetric chart. Figure 10 This enables semi-quantitative detection of 17β-estradiol by visual inspection; furthermore, using the R channel value from the extracted RGB values ​​as the output signal, a fitting curve between the R channel value and the 17β-estradiol concentration is established. Figure 11 For concentrations ranging from 1 to 10 μg / mL, the equation for R value and mercury ion concentration is: R value = 4.65235C. 17β-雌二醇 + 157.57898 (R 2 = 0.9912), enabling convenient quantitative analysis of 17β-estradiol ( Figure 12 ).

Claims

1. A colorimetric visualization sensor for detecting 17β-estradiol based on MoSe2 nanozyme regulated by aptamer splitting, characterized in that, The steps are as follows: A. Preparation of MoSe2 nanozyme solution: Preparation of MoSe2 powder: Molybdenum powder and selenium powder were accurately weighed and mixed at a stoichiometric ratio of 1:2, and then reacted at 900℃ for 8 hours under argon atmosphere. After the reaction was completed, the reaction system was cooled to room temperature with the furnace to obtain MoSe2 product. MoSe2 powder was obtained by crushing and grinding. Preparation of MoSe2 nanozyme solution: 1 g MoSe2 powder was dissolved in a mixed solvent consisting of 5 mL dimethyl sulfoxide and 5 mL anhydrous ethanol and sonicated for 8 hours; the sonicated solution was centrifuged at 5000 rpm for 5 minutes to separate the solid residue and the supernatant, and the supernatant was collected to obtain the MoSe2 nanozyme solution. B. Colorimetric analysis of 17β-estradiol: First, 25 μL of 1 μM S1 sequence 1 (cgggacgacatgga) and 25 μL of 1 μM S2 sequence 2 (tccatcaacgaagtgcgtccgtcccg) were stored at 95°C for 5 minutes, followed by annealing in an ice bath for 20 minutes. Then, 35 μL of solutions with different concentrations of 17β-estradiol and 100 μL of binding buffer (50 mM Tris-HCl, 5 mM KCl, 100 mM NaCl, 20 mM MgCl2, 10% DMSO, 50 mM Tris-HCl, pH 7.5) were added, and the mixture was incubated at 25°C with shaking at 1000 rpm for 30 minutes. Next, 25 μL of 20 mg / mL MoSe2 nanozyme solution and 100 μL of pH 3.5 acetate-sodium acetate buffer were added, and the mixture was incubated at 25°C with shaking at 1000 rpm for another 20 minutes. Finally, 20 μL of 50 mg / mL DMSO solution was added. A solution of 20 mM H2O2 and 20 μL of 20 mM TMB was reacted with shaking at 25℃ and 1000 rpm for 25 minutes, resulting in a color change. The reaction system was then placed in an ice bath for 2 minutes, centrifuged at 8000 rpm for 2 minutes, and the supernatant was collected for analysis. The absorbance of the reaction system was measured at a wavelength of 652 nm to quantitatively detect the concentration of 17β-estradiol. C. Smartphone on-site testing technology: Using color analysis software on a smartphone, the basic color values ​​of the Red, Green, and Blue channels (RGB values) of the image are automatically extracted by selecting the detection area, and a corresponding colorimetric card is generated to achieve semi-quantitative detection of 17β-estradiol by the naked eye. Furthermore, the R channel value of the extracted RGB values ​​is used as the output signal to establish a fitting curve between it and the concentration of 17β-estradiol, realizing convenient quantitative analysis of 17β-estradiol within the concentration range of 1–10 μg / mL.

2. The colorimetric visualization sensor for detecting 17β-estradiol based on MoSe2 nanozyme regulated by aptamer as described in claim 1, characterized in that, The 1 g MoSe2 powder described in step A was dissolved in 5 mL of dimethyl sulfoxide and 5 mL of anhydrous ethanol.

3. The colorimetric visualization sensor for detecting 17β-estradiol based on MoSe2 nanozyme regulated by aptamer as described in claim 1, characterized in that, The 100 μL binding buffer (50 mM Tris-HCl, 5 mM KCl, 100 mM NaCl, 20 mM MgCl2, 10% DMSO, 50 mM Tris-HCl, pH 7.5) described in step B.

4. The colorimetric visualization sensor for detecting 17β-estradiol based on MoSe2 nanozyme regulated by aptamer as described in claim 1, characterized in that, The 25 μL 20 mg / mL MoSe2 nanozyme solution and 100 μL pH 3.5 acetate-sodium acetate buffer solution mentioned in step B.

5. The colorimetric visualization sensor for detecting 17β-estradiol based on MoSe2 nanozyme regulated by aptamer as described in claim 1, characterized in that, The 20 μL 50 mM H2O2 solution and 20 μL 20 mM TMB solution mentioned in step B.