KASP molecular marker related to soybean seed size and application of KASP molecular marker
By using KASP molecular markers at four SNP sites in the downstream regulatory region of the GmW82.09G173900 gene during the soybean seedling stage, combined with specific primers, early and precise screening of soybean seed size was achieved. This solved the problems of long cycle and low efficiency in traditional breeding, and promoted the rapid breeding and yield increase of large-seed soybean varieties.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- NORTHEAST INST OF GEOGRAPHY & AGRIECOLOGY C A S
- Filing Date
- 2026-01-29
- Publication Date
- 2026-05-01
AI Technical Summary
In traditional soybean breeding, the screening of seed size traits relies on phenotypic observation, which leads to long breeding cycles, low efficiency, and difficulty in quickly cultivating large-grained, high-yielding soybean varieties.
We developed KASP molecular markers based on four SNP sites (SNP1, SNP2, SNP3, and SNP4) in the downstream regulatory region of the GmW82.09G173900 gene. Combined with specific primers, we used KASP-PCR technology to screen genotypes in soybean seedlings and achieve accurate identification of seed size.
It enables early and precise screening of soybean seed size, significantly shortens the breeding cycle, improves screening efficiency, is suitable for large-scale high-throughput screening, supports the breeding of large-seed soybean varieties, and improves yield and food security.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
KASP molecular markers related to soybean seed size and their applications Technical Field
[0001] This invention belongs to the field of crop molecular breeding technology, specifically, it relates to KASP molecular markers related to soybean seed size and their applications. Background Technology
[0002] Soybean (Glycine max) is a crucial oilseed crop and source of plant protein globally. Seed size, as a core agronomic trait, directly determines soybean yield and commercial quality. Seed size-related traits such as 100-seed weight, seed length, width, area, and perimeter are significantly positively correlated with soybean yield. Therefore, breeding large-seed soybean varieties has become a key path to increasing soybean yield per unit area and ensuring national food security.
[0003] In traditional soybean breeding, the selection of seed size traits mainly relies on phenotypic observation and measurement after soybean maturity. This method suffers from numerous problems, including a long breeding cycle, low selection efficiency, and susceptibility to environmental interference, severely hindering the development of large-seed, high-yield soybean varieties. Molecular marker-assisted breeding (MAS) technology, by detecting molecular markers closely linked to target traits, can achieve precise screening of superior genotypes in the early stages of crop growth, significantly shortening the breeding cycle and improving selection efficiency. It has now become a core technology in the field of crop genetic improvement.
[0004] KASP (Competitive Allele-Specific PCR) technology, as a highly efficient SNP genotyping technique, possesses significant advantages such as high specificity, high throughput, simple operation, and no need for gel electrophoresis, and has been widely used in crop genetic breeding research. T2T genome assembly technology enables gapless resolution of the entire chromosome, providing a reliable reference for the accurate identification of gene sequences and SNP loci. The GmW82.09G173900 gene (corresponding to the Glyma.09G181100 gene annotated in the traditional reference genome Wm82.a2.v1 version) encodes a bifunctional inhibitor / lipoprotein / seed storage 2S albumin superfamily protein. This gene plays a crucial regulatory role in soybean seed size by participating in dry matter accumulation and lipid transport processes during seed development. Summary of the Invention
[0005] The purpose of this invention is to provide KASP molecular markers related to soybean seed size and their applications.
[0006] Studies have revealed several SNP sites in the downstream regulatory region of the GmW82.09G173900 gene that are significantly associated with soybean seed size. SNP2 and SNP3 show a tight linkage relationship, and their allele combinations are highly correlated with seed size phenotypes. However, to date, no specific KASP molecular markers based on the linkage characteristics of this gene and related sites have been developed and applied to the precise screening and molecular breeding practices for soybean seed size. Therefore, developing efficient and accurate KASP molecular markers and supporting detection systems is of significant practical importance for promoting the breeding of large-grained soybean varieties.
[0007] To achieve the objectives of this invention, in a first aspect, this invention provides a KASP molecular marker related to soybean seed size, consisting of four SNP sites located in the downstream regulatory region of the GmW82.09G173900 gene, namely SNP1 at physical location 42109039bp, SNP2 at 42109150bp, SNP3 at 42109166bp, and SNP4 at 42110442bp; wherein SNP1 has C / T nucleotide polymorphism, SNP2 has C / T nucleotide polymorphism, SNP3 has T / C nucleotide polymorphism and is closely linked to SNP2, and SNP4 has A / T nucleotide polymorphism; the GmW82.09G173900 gene is a soybean genome assembled based on T2T (telomere-to-telomere) assembly, corresponding to the Glyma.09G181100 gene in soybean reference genome version Wm82.a2.v1.
[0008] Furthermore, based on the genotype combinations of the four SNP loci, soybeans were divided into three haplotypes: Hap001, Hap002, and Hap003. The Hap001 haplotype is SNP1-C / SNP2-T / SNP3-C / SNP4-T (SNP1 nucleotide polymorphism is C, SNP2 nucleotide polymorphism is T, SNP3 nucleotide polymorphism is C, and SNP4 nucleotide polymorphism is T); the Hap002 haplotype is SNP1-C / SNP2-C / SNP3-T / SNP4-A (SNP1 nucleotide polymorphism is...). The Hap003 haplotype is SNP1-T / SNP2-C / SNP3-T / SNP4-A (SNP1 nucleotide polymorphism is T, SNP2 nucleotide polymorphism is C, SNP3 nucleotide polymorphism is T and SNP4 nucleotide polymorphism is A). The 100-seed weight, seed length, width, area and perimeter of soybeans carrying the Hap001 and Hap003 haplotype components are significantly better than those of the Hap002 haplotype.
[0009] Secondly, the present invention provides primers for detecting the molecular markers.
[0010] The KASP primers include the following three sets: (1) For SNP1 sites: the KASP primers include allele-specific upstream primers K-9S-SNP1-FAM and K-9S-SNP1-HEX and universal downstream primer K-9S-SNP1-Common, with sequences as shown in SEQ ID NO:1-3; (2) For SNP2 / SNP3 linked sites: the KASP primers include allele-specific downstream primers K-9S-SNP2 / 3-FAM and K-9S-SNP2 / 3-HEX and universal upstream primer K-9S-SNP2 / 3-Common, with sequences as shown in SEQ ID NO:4-6; (3) For SNP4 sites: the KASP primers include allele-specific upstream primers K-9S-SNP4-FAM and K-9S-SNP4-HEX and universal downstream primer K-9S-SNP4-Common, with sequences as shown in SEQ ID NO:7-9.
[0011] Thirdly, the present invention provides detection reagents or kits containing the primers.
[0012] Fourthly, the present invention provides any of the following applications of the molecular markers, primers, or detection reagents or kits: 1) for identification of soybean 100-seed weight and seed size phenotypes; 2) for early prediction of large-seed soybean seed resources; 3) for molecular marker-assisted breeding related to soybean 100-seed weight and seed size traits.
[0013] Fifthly, the present invention provides a method for identifying large-grained soybean varieties, comprising the following steps: (1) extracting genomic DNA from the soybean to be tested; (2) using the DNA extracted in step (1) as a template, performing KASP-PCR amplification with the three sets of KASP primers mentioned above, and simultaneously detecting SNP1, SNP2 / SNP3 linkage sites and SNP4 sites; (3) after PCR, detecting the fluorescence signal using a fluorescence quantitative PCR instrument, and determining the result as follows: if only one fluorescence signal, FAM or HEX, is detected, the soybean to be tested is homozygous for alleles; if both FAM and HEX are detected simultaneously... If the fluorescence signal is positive, the soybean to be tested is heterozygous; (4) Determine the haplotype based on the genotype combination of each locus: SNP1 is homozygous C, SNP2 / SNP3 is homozygous T / C, and SNP4 is homozygous T and is determined to be haplotype Hap001; SNP1 is homozygous C, SNP2 / SNP3 is homozygous C / T, and SNP4 is homozygous A and is determined to be haplotype Hap002; SNP1 is homozygous T, SNP2 / SNP3 is homozygous C / T, and SNP4 is homozygous A and is determined to be haplotype Hap003; the rest are heterozygous haplotypes; (5) Screen superior individuals of large-grained soybeans based on the haplotype determination results.
[0014] Preferably, the KASP-PCR amplification reaction system used in step (2) is: 1 μl of 5 ng / μl DNA template, 1 μl of 2×KASPMaster Mix (e.g., 2×Master Mix for ASPCR V1), and 0.02 μl of KASP Assay Mix; in the KASP Assay Mix, the molar ratio of the two upstream primers and the one universal primer is 1:1:3.
[0015] Preferably, the reaction conditions for KASP-PCR amplification in step (2) are: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 20 sec, annealing at 61~55℃ for 40 sec, decreasing by 0.6℃ per cycle, for 10 cycles; denaturation at 95℃ for 20 sec, annealing at 55℃ for 40 sec, for 30 cycles.
[0016] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: (i) High specificity: the molecular marker targets the functional region of the GmW82.09G173900 gene precisely annotated in the T2T genome, and primers designed in combination with the tight linkage characteristics of SNP2 and SNP3 can accurately distinguish the three haplotypes Hap001, Hap002 and Hap003, with no false positive results and high genotype-phenotype fit.
[0017] (ii) High detection efficiency: Four key SNP sites are detected simultaneously using three sets of primers. The detection time for a single sample does not exceed 2 hours. No subsequent processing such as gel electrophoresis is required, making it suitable for large-scale high-throughput screening and significantly improving detection efficiency.
[0018] (iii) Early screening: Detection can be completed through leaf tissue during the soybean seedling stage, without waiting for maturity to determine seed size phenotype, effectively shortening the breeding cycle and reducing breeding costs.
[0019] (iv) Wide range of applications: It can be widely used in soybean germplasm resource seed size evaluation, early generation screening of hybrid breeding, and large-grain soybean variety breeding, providing technical support for the precise improvement of soybean seed size traits, which is of great significance for increasing soybean yield and ensuring food security.
[0020] (V) This invention fully utilizes the linkage characteristics of SNP sites and the precise sequence information of the T2T genome to solve the core pain points of "long phenotypic identification cycle, cumbersome detection process and low screening efficiency" in soybean seed size breeding. It fills the application gap of efficient molecular markers for soybean seed size traits and has clear innovation, outstanding practicality and broad industrial promotion value. Attached Figure Description
[0021] Figure 1 shows the single nucleotide polymorphisms and haplotype distribution of the GmW82.09G173900 gene in a preferred embodiment of the present invention. The figure shows the allelic composition of four SNP sites (42109039, 42109150, 42109166, 42110442) and the frequency distribution of three haplotypes (Hap001, Hap002, Hap003).
[0022] Figure 2 shows a comparison of seed size phenotype between the EMS mutant line (SQJ3617) of the GmW82.09G173900 gene and its wild-type W82 in a preferred embodiment of the present invention. The top image shows wild-type W82 seeds, and the bottom image shows mutant SQJ3617 seeds. The scale bar is 1 cm, showing that the mutant seeds are significantly smaller than the wild-type seeds.
[0023] Figure 3 is a schematic diagram of the design of three sets of KASP primers in a preferred embodiment of the present invention. The primer binding regions and fluorescent labeling types for SNP1, SNP2 / SNP3 linkage sites, and SNP4 sites are shown respectively. Detailed Implementation
[0024] This invention aims to provide a KASP molecular marker that is significantly associated with soybean seed size, as well as a matching specific primer combination and detection method, which can rapidly and accurately screen individuals with the target seed size trait in the early stages of soybean growth, providing an efficient and reliable technical tool for soybean molecular marker-assisted breeding.
[0025] The present invention adopts the following technical solution: The present invention provides a KASP molecular marker related to soybean seed size. The molecular marker targets four SNP sites in the downstream regulatory region of the GmW82.09G173900 gene (corresponding to the Glyma.09G181100 gene annotated in the traditional reference genome Wm82.a2.v1 version) in the soybean genome assembled by T2T (telomere to telomere). These are SNP sites at physical locations of 42109039bp (SNP1), 42109150bp (SNP2), 42109166bp (SNP3), and 42110442bp (SNP4). SNP1 exhibits C / T nucleotide polymorphism, SNP2 exhibits C / T nucleotide polymorphism, SNP3 exhibits T / C nucleotide polymorphism and the two are closely linked, and SNP4 exhibits A / T nucleotide polymorphism. Based on the genotype combinations of four SNP loci, soybean varieties can be classified into three haplotypes: the Hap001 haplotype consists of SNP1 with the C allele, SNP2 with the T allele, SNP3 with the C allele, and SNP4 with the T allele; the Hap002 haplotype consists of SNP1 with the C allele, SNP2 with the C allele, SNP3 with the T allele, and SNP4 with the A allele; and the Hap003 haplotype consists of SNP1 with the T allele, SNP2 with the C allele, SNP3 with the T allele, and SNP4 with the A allele. This haplotype is significantly correlated with soybean seed size. Soybean varieties carrying the Hap001 and Hap003 haplotypes have significantly higher 100-seed weight, seed length, width, area, and perimeter than those carrying the Hap002 haplotype. This molecular marker can be directly used for genotype identification of large-seed traits in soybeans and for marker-assisted breeding.
[0026] This invention also provides primer combinations for detecting the KASP molecular marker, including three sets of KASP primers, with the specific sequences as follows: The first set of primers (targeting the SNP1 site): (1) Allele-specific upstream primer K-9S-SNP1-FAM (corresponding to the C allele of SNP1), the sequence of which is shown in SEQ ID NO:1: 5'- GAAGGTGACCAAGTTCATGCT CTCCGCAAAACTGTAAAATTTCATTTTTGC-3' (fluorescently labeled FAM); (2) allele-specific upstream primer K-9S-SNP1-HEX (corresponding to the T allele of SNP1), the sequence of which is shown in SEQ ID NO:2: 5'- GAAGGTCGGAGTCAACGGATTCTCCGCAAAACTGTAAAATTTCATTTTTGT-3' (fluorescently labeled HEX); (3) universal downstream primer K-9S-SNP1-Common (targeting SNP1 site), sequence as shown in SEQ ID NO:3: 5'-TTTGAATCCATATTGAGCTTACGGATTCA-3'; second set of primers (targeting SNP2 / SNP3 linked sites): (1) allele-specific downstream primer K-9S-SNP2 / 3-FAM (corresponding to SNP2-C / SNP3-T linked alleles), sequence as shown in SEQ ID NO:4: 5'- GAAGGTGACCAAGTTCATGCT TAATTGGTTAGAACGTTGTGTTAATAATG-3' (fluorescently labeled FAM); (2) allele-specific downstream primer K-9S-SNP2 / 3-HEX (corresponding to SNP2-T / SNP3-C linked alleles), sequence as shown in SEQ ID NO:5: 5'- GAAGGTCGGAGTCAACGGATT TAATTGGTTAGAGCGTTGTGTTAATAATA-3' (fluorescently labeled HEX); (3) universal upstream primer K-9S-SNP2 / 3-Common (targeting SNP2 and SNP3 linkage sites), sequence as shown in SEQ ID NO:6: 5'-TGAATCCGTAAGCTCAATATGGATTCAAA-3'; third set of primers (targeting SNP4 site): (1) allele-specific upstream primer K-9S-SNP4-FAM (corresponding to the A allele of SNP4), sequence as shown in SEQ ID NO:7: 5'- GAAGGTGACCAAGTTCATGCT AATAAACACTATAATCGTATTCTATCAA-3' (fluorescently labeled FAM); (2) allele-specific upstream primer K-9S-SNP4-HEX (corresponding to the T allele of SNP4), the sequence of which is shown in SEQ ID NO:8: 5'- GAAGGTCGGAGTCAACGGATT AATAAACACTATAATCGTATTCTATCAT-3' (fluorescent HEX); (3) Universal downstream primer K-9S-SNP4-Common (for SNP4 site), sequence as shown in SEQ ID NO:9: 5'-CTACAAAACTAGTATGTATTATGC-3'.
[0027] The first set of primers is designed based on the flanking sequences of the SNP1 site, with the 3' ends of the specific upstream primers containing the C and T alleles of SNP1, respectively. The second set of primers is designed based on the conserved flanking sequences of the SNP2 / SNP3 linked sites, with the 3' ends of the specific upstream primers containing the characteristic sequences of the corresponding linked allele combinations, respectively. The third set of primers is designed based on the flanking sequences of the SNP4 site, with the 3' ends of the specific upstream primers containing the A and T alleles of SNP4, respectively. The universal primers of the three sets of primers bind to the conserved sequences below / upstream of the corresponding target sites, respectively, to ensure specific amplification of the target fragment.
[0028] This invention also provides a method for detecting soybean seed size-related genotypes, comprising the following steps: (1) extracting genomic DNA from the soybean sample to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing KASP-PCR amplification using the three sets of KASP primer combinations mentioned above, and simultaneously detecting SNP1, SNP2 / SNP3 linkage sites and SNP4 sites; (3) after PCR amplification, detecting fluorescence signals using a fluorescence quantitative PCR instrument, and determining the genotype based on the fluorescence type: only detecting FAM fluorescence signals indicates homozygotes of the corresponding FAM marker allele (or linked allele combination); only detecting HEX fluorescence signals indicates homozygotes of the corresponding HEX marker allele (or linked allele combination); and simultaneously detecting both fluorescence signals indicates homozygotes. (4) Determine haplotype based on genotype combination: When SNP1 is homozygous for C, SNP2 / SNP3 linkage site is homozygous for T / C, and SNP4 site is T, it is determined to be homozygous for Hap001 (large haplotype); when SNP1 is homozygous for C, SNP2 / SNP3 linkage site is homozygous for C / T, and SNP4 site is homozygous for A, it is determined to be homozygous for Hap002 (small haplotype); when SNP1 is homozygous for T, SNP2 / SNP3 linkage site is homozygous for C / T, and SNP4 site is A, it is determined to be homozygous for Hap003 (large haplotype); other genotype combinations are heterozygous haplotypes; (5) Screen large soybeans based on haplotype: prioritize the selection of individuals homozygous for Hap001 or Hap003 for breeding or germplasm resource preservation.
[0029] Further, in step (2), the KASP-PCR amplification system is a 2 μl reaction system: 1 μl of soybean sample DNA template (5 ng / μl), 1 μl of 2×Master Mix for ASPCR V1, and 0.02 μl of KASP Assay Mix (corresponding group specific primer 1: specific primer 2: universal primer = 1:1:3). The reaction conditions include: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 sec, annealing at 61~55℃ for 40 sec, decreasing by 0.6℃ for each cycle, for 10 cycles; 95℃ denaturation for 20 sec, annealing at 55℃ for 40 sec, for 30 cycles.
[0030] This invention also provides the application of the KASP molecular marker in marker-assisted breeding of soybean.
[0031] The present invention also provides the application of the KASP molecular marker in the screening of soybean germplasm resources for seed size.
[0032] The present invention also provides the application of the primer combination in the preparation of a soybean seed size detection kit.
[0033] The present invention also provides a soybean seed size detection kit, comprising the above three sets of KASP primer combinations, KASPMaster Mix, positive control (Hap001 or Hap003 homozygous genomic DNA), negative control (sterile water) and PCR reaction buffer.
[0034] The determination of KASP molecular markers in this invention: Based on the complete sequence information of the GmW82.09G173900 gene in the soybean genome assembled by T2T (corresponding to the Glyma.09G181100 gene annotated in the traditional reference genome Wm82.a2.v1 version), combined with the GWAS analysis, WGCNA analysis and haplotype analysis results of 220 soybean natural populations, four SNP sites in the downstream regulatory region of this gene that are significantly associated with seed size were determined. The specific information is as follows: (1) SNP1: physical location 42109039bp, with C / T nucleotide polymorphism; (2) SNP2: physical location 42109150bp, with C / T nucleotide polymorphism; (3) SNP3: physical location 42109166bp, with T / C nucleotide polymorphism; (4) SNP4: physical location 42110442bp, with A / T nucleotide polymorphism.
[0035] Linkage disequilibrium analysis confirmed that SNP2 and SNP3 are closely linked, and their allele combinations are highly consistent, making them suitable for joint detection as linkage sites.
[0036] The allele combinations of the four SNP loci form three haplotypes, as follows: (1) Hap001 haplotype: SNP1-C / SNP2-T / SNP3-C / SNP4-T, which is a large-particle allele combination; (2) Hap002 haplotype: SNP1-C / SNP2-C / SNP3-T / SNP4-A, which is a small-particle allele combination; (3) Hap003 haplotype: SNP1-T / SNP2-C / SNP3-T / SNP4-A, which is a large-particle allele combination.
[0037] After years of field trials at multiple locations, soybean varieties carrying the Hap001 and Hap003 haplotypes showed significantly higher 100-seed weight, seed length, width, area, and perimeter than those carrying the Hap002 haplotype. This molecular marker can effectively distinguish soybean materials with different seed size genotypes, providing a basis for the precise screening of large-seed soybeans.
[0038] Based on the above KASP molecular markers, the following KASP primer combinations were designed and synthesized: According to the sequence characteristics of the four SNP sites and the linkage relationship between SNP2 and SNP3, three sets of specific KASP primer combinations were designed, targeting SNP1 site, SNP2 / SNP3 linkage site and SNP4 site respectively. The specific sequences are as follows: The first set of primers (targeting SNP1 site) (1) Allele-specific upstream primer K-9S-SNP1-FAM (corresponding to the C allele of SNP1), the sequence is shown in SEQ ID NO:1: 5'-GAAGGTGACCAAGTTCATGCTCTCCGCAAAACTGTAAAATTTCATTTTTGC-3' (fluorescent label FAM);(2) Allele-specific upstream primer K-9S-SNP1-HEX (corresponding to the T allele of SNP1), the sequence of which is shown in SEQ ID NO:2: 5'-GAAGGTCGGAGTCAACGGATTCTCCGCAAAACTGTAAAATTTCATTTTTGT-3' (fluorescently labeled HEX); (3) Universal downstream primer K-9S-SNP1-Common (targeting the SNP1 site), the sequence of which is shown in SEQ ID NO:3: 5'-TTTGAATCCATATTGAGCTTACGGATTCA-3'; Second set of primers (targeting SNP2 / SNP3 linked sites) (1) Allele-specific downstream primer K-9S-SNP2 / 3-FAM (corresponding to the SNP2-C / SNP3-T linked alleles), the sequence of which is shown in SEQ ID NO:2. NO:4 shows: 5'-GAAGGTGACCAAGTTCATGCTTAATTGGTTAGAACGTTGTGTTAATAATG-3' (fluorescently labeled FAM); (2) Allele-specific downstream primer K-9S-SNP2 / 3-HEX (corresponding to SNP2-T / SNP3-C linked alleles), the sequence of which is shown in SEQ ID NO:5: 5'-GAAGGTCGGAGTCAACGGATTTAATTGGTTAGAGCGTTGTGTTAATAATA-3' (fluorescently labeled HEX); (3) Universal upstream primer K-9S-SNP2 / 3-Common (for SNP2 and SNP3 linked sites), the sequence of which is shown in SEQ ID NO:6: 5'-TGAATCCGTAAGCTCAATATGGATTCAAA-3'; The third set of primers (for SNP4 sites) (1) Allele-specific upstream primer K-9S-SNP4-FAM (corresponding to the A allele of SNP4), the sequence of which is shown in SEQ ID NO:6: (1) The sequence of the allele-specific upstream primer K-9S-SNP4-HEX (corresponding to the T allele of SNP4) is shown in SEQ ID NO:8: 5'-GAAGGTGACCAAGTTCATGCTAATAAACACTATAATCGTATTCTATCAA-3' (fluorescently labeled FAM); (2) The sequence of the allele-specific upstream primer K-9S-SNP4-HEX (corresponding to the T allele of SNP4) is shown in SEQ ID NO:8: 5'-GAAGGTCGGAGTCAACGGATTAATAAACACTATAATCGTATTCTATCAT-3' (fluorescently labeled HEX); (3) The sequence of the universal downstream primer K-9S-SNP4-Common (targeting the SNP4 site) is shown in SEQ ID NO:9: 5'-CTACAAAACTAGTATGTATTATGC-3'.
[0039] During primer design, software prediction was used to avoid primer dimers and non-specific binding. Validated by BLAST comparison with the soybean genome database, the three primer sets showed good specificity with no obvious non-specific amplification sites, ensuring accurate amplification of the target fragment.
[0040] Furthermore, the detection method based on KASP molecular markers is as follows: This detection method includes the following key steps: 1) Genomic DNA extraction: Genomic DNA is extracted from soybean leaves, seeds, and other tissues using the CTAB method or a commercial DNA extraction kit. The purity and concentration of the DNA are detected to ensure OD. 260 / OD 280 The concentration should be between 1.8 and 2.0, around 50 ng / μL, to meet the requirements of PCR amplification.
[0041] 2) KASP-PCR amplification: Using extracted genomic DNA as a template, PCR amplification was performed using the three sets of KASP primers mentioned above. The reaction volume for each set was 2 μl, and the specific formulation was as follows: 1 μl of soybean sample DNA template (5 ng / μl), 1 μl of 2×Master Mix for ASPCRV1, and 0.02 μl of the corresponding KASP Assay Mix (F:R = 2:3). The reaction conditions were: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 sec, annealing at 61~55℃ for 40 sec, decreasing by 0.6℃ per cycle, for 10 cycles; and 95℃ denaturation for 20 sec, annealing at 55℃ for 40 sec, for 30 cycles.
[0042] 3) Genotype and Haplotype Interpretation: After PCR amplification, the fluorescence signals of the three sets of primers were detected using a real-time PCR instrument. The genotype was determined based on the fluorescence type: a. Only FAM fluorescence signal was detected: homozygous for the corresponding FAM marker allele (or linked allele combination); b. Only HEX fluorescence signal was detected: homozygous for the corresponding HEX marker allele (or linked allele combination); c. Both fluorescence signals were detected simultaneously: heterozygous for the corresponding locus.
[0043] Based on the genotype detection results of the three sets of primers, the haplotypes were determined by combination as follows: a. SNP1 is homozygous for C, SNP2 / SNP3 linkage sites are homozygous for T / C, and SNP4 is homozygous for T: Hap001 homozygous (large haplotype); b. SNP1 is homozygous for C, SNP2 / SNP3 linkage sites are homozygous for C / T, and SNP4 is homozygous for A: Hap002 homozygous (small haplotype); c. SNP1 is homozygous for T, SNP2 / SNP3 linkage sites are homozygous for C / T, and SNP4 is homozygous for A: Hap003 homozygous (large haplotype); d. Other genotype combinations: heterozygous haplotypes.
[0044] 4) Screening for large-grained soybeans: In soybean breeding practice, prioritizing the selection of homozygous individuals of Hap001 or Hap003 as parents or breeding materials can significantly improve the seed size and yield of offspring populations. In germplasm resource screening, large-grained genotype materials can be quickly identified, providing support for breeding resource innovation.
[0045] This invention also provides a soybean seed size detection kit, which comprises: ① the above three sets of KASP primer combinations (SEQ ID NO:1-9); ② 2×KASP Master Mix; ③ positive control: Hap001 or Hap003 homozygous genomic DNA; ④ negative control: sterile water; ⑤ PCR reaction buffer; ⑥ instructions for use (including reaction system, reaction conditions and interpretation criteria).
[0046] This kit can be used directly for large-scale laboratory testing. It is easy to operate, provides reliable results, and is suitable for high-throughput screening scenarios.
[0047] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.
[0048] Example 1: SNP Locator and Haplotype Validation. Genotypic and phenotypic data from 220 natural soybean populations were analyzed using GWAS, combined with transcriptome data analysis and haplotype analysis using WGCNA. Four SNP loci (SNP1-SNP4) in the downstream regulatory region of the GmW82.09G173900 gene (Figure 1) were identified as significantly associated with soybean seed size. Linkage disequilibrium analysis showed that the linkage coefficient r between SNP2 and SNP3 was... 2 >0.9, indicating a close linkage.
[0049] Haplotype analysis of 220 soybean accessions showed that, among the three haplotypes (Figure 1), the average 100-seed weight of haplotypes Hap001 and Hap003 was significantly higher than that of haplotype Hap002; the same trend was observed in traits such as seed length, width, area, and perimeter. EMS mutant validation showed that the 100-seed weight and seed area of the mutant line SQJ3617 were significantly lower than those of the wild-type W82, corroborating the regulatory role of this gene and related SNP sites on seed size (Figure 2).
[0050] Example 2: Optimization and Validation of KASP Primer Combinations. Three sets of designed KASP primers (SEQ ID NO: 1-9) were synthesized with HPLC-grade purity. The PCR reaction system and conditions were optimized for different soybean materials. The results showed that under the following 2μl reaction system and reaction conditions, all three sets of primers could achieve specific amplification of the target fragment, with clear fluorescence signals and no primer dimers or non-specific amplification products (Figure 3).
[0051] The KASP-PCR amplification system consisted of a 2 μl reaction mixture: 1 μl soybean sample DNA template (5 ng / μl), 1 μl 2×MasterMix for ASPCR V1, and 0.02 μl KASP Assay Mix (specific primer 1:specific primer 2:universal primer = 1:1:3). The reaction conditions included: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 sec, followed by annealing at 61–55℃ for 40 sec, decreasing the temperature by 0.6℃ per cycle for 10 cycles; and 95℃ denaturation for 20 sec, followed by annealing at 55℃ for 40 sec for 30 cycles.
[0052] Thirty soybean materials with known haplotypes (10 Hap001, 10 Hap002, and 10 Hap003) were selected for verification. The results showed that the genotype interpretation results of the primer combination were completely consistent with the known haplotypes, with an accuracy rate of 100%, proving that the primer combination has good specificity and reliability.
[0053] Example 3: Application and Verification of KASP Molecular Markers. Large-grained soybeans were screened from 60 natural soybean varieties with unknown phenotypes. Genomic DNA was extracted from leaves using the CTAB method, and genotype identification was performed using the three primer combinations and detection methods of this invention. Based on haplotype interpretation results, 22 homozygous Hap001 accessions, 18 homozygous Hap003 accessions, and 20 homozygous Hap002 accessions were selected.
[0054] All materials were planted in the field, and seed size-related traits were measured after maturity. The results showed that the average 100-seed weight of the homozygous Hap001 and Hap003 materials was 21.8 g and 22.1 g, respectively, which was significantly higher than the 15.9 g of the homozygous Hap002 material. Seed length, width, area, and perimeter also highly matched the haplotype interpretation results, verifying the practical application effect of this molecular marker and detection method.
[0055] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.
Claims
1. A KASP molecular marker associated with soybean seed size, characterized in that, It consists of four SNP sites located in the downstream regulatory region of the GmW82.09G173900 gene, namely SNP1 at 42109039bp, SNP2 at 42109150bp, SNP3 at 42109166bp, and SNP4 at 42110442bp. SNP1 has a C / T nucleotide polymorphism, SNP2 has a C / T nucleotide polymorphism, SNP3 has a T / C nucleotide polymorphism and is closely linked to SNP2, and SNP4 has an A / T nucleotide polymorphism. The GmW82.09G173900 gene is a soybean genome assembled based on T2T (telomere-to-telomere) assembly, corresponding to the Glyma.09G181100 gene in soybean reference genome version Wm82.a2.v1.
2. The molecular marker according to claim 1, characterized in that, Based on the genotypic combinations of the four SNP loci, soybeans were divided into three haplotypes: Hap001, Hap002, and Hap003. The Hap001 haplotype is SNP1-C / SNP2-T / SNP3-C / SNP4-T; the Hap002 haplotype is SNP1-C / SNP2-C / SNP3-T / SNP4-A; and the Hap003 haplotype is SNP1-T / SNP2-C / SNP3-T / SNP4-A. The 100-seed weight, seed length, width, area, and perimeter of soybeans carrying the Hap001 and Hap003 haplotype components were significantly better than those of the Hap002 haplotype.
3. Primers for detecting the molecular markers of claim 1 or 2.
4. The primer according to claim 3, characterized in that, The KASP primers include the following three sets: (1) For SNP1 sites: the KASP primers include allele-specific upstream primers K-9S-SNP1-FAM and K-9S-SNP1-HEX and universal downstream primer K-9S-SNP1-Common, with sequences as shown in SEQ ID NO:1-3; (2) For SNP2 / SNP3 linked sites: the KASP primers include allele-specific downstream primers K-9S-SNP2 / 3-FAM and K-9S-SNP2 / 3-HEX and universal upstream primer K-9S-SNP2 / 3-Common, with sequences as shown in SEQ ID NO:4-6; (3) For SNP4 sites: the KASP primers include allele-specific upstream primers K-9S-SNP4-FAM and K-9S-SNP4-HEX and universal downstream primer K-9S-SNP4-Common, with sequences as shown in SEQ ID NO:7-9.
5. A detection reagent or kit containing the primers described in claim 3 or 4.
6. Any of the following applications of the molecular marker of claim 1 or 2, the primer of claim 3 or 4, or the detection reagent or kit of claim 5: 1) for identification of soybean 100-seed weight and seed size phenotype; 2) for early prediction of large-seed soybean seed resources; 3) for marker-assisted breeding of soybean 100-seed weight and seed size traits.
7. A method for identifying large-grained soybean varieties, characterized in that, Includes the following steps: (1) Extract genomic DNA from the soybean to be tested; (2) Using the DNA extracted in step (1) as a template, perform KASP-PCR amplification using the three sets of KASP primers described in claim 4, and simultaneously detect SNP1, SNP2 / SNP3 linkage sites and SNP4 sites; (3) After PCR, detect the fluorescence signal using a real-time PCR instrument. The determination method is as follows: if only one fluorescence signal, FAM or HEX, is detected, the soybean to be tested is homozygous for alleles; if both FAM and HEX fluorescence signals are detected simultaneously, the soybean to be tested is heterozygous. (4) Determine haplotypes based on the genotype combinations at each locus: SNP1 is homozygous for C, SNP2 / SNP3 is homozygous for T / C, and SNP4 is homozygous for T, and is classified as haplotype Hap001; SNP1 is homozygous for C, SNP2 / SNP3 is homozygous for C / T, and SNP4 is homozygous for A, and is classified as haplotype Hap002; SNP1 is homozygous for T, SNP2 / SNP3 is homozygous for C / T, and SNP4 is homozygous for A, and is classified as haplotype Hap003; the rest are heterozygous haplotypes; (5) Screen superior individuals of large-grained soybeans based on the haplotype determination results.
8. The method according to claim 7, characterized in that, The KASP-PCR amplification reaction system used in step (2) is as follows: 1 μl of 5 ng / μl DNA template, 1 μl of 2×KASP Master Mix, and 0.02 μl of KASP Assay Mix.
9. The method according to claim 7, characterized in that, Step (2) KASP-PCR amplification reaction conditions are: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 sec, 61~55℃ annealing for 40 sec, decreasing by 0.6℃ per cycle, 10 cycles; 95℃ denaturation for 20 sec, 55℃ annealing for 40 sec, 30 cycles.