Application of LRP1 in preparation of osteoarthritis drugs

Abstract

The invention discloses application of LRP1 in preparation of osteoarthritis medicines, and belongs to the technical field of biological medicines. The m6A methylase can regulate the immune homeostasis of macrophages and regulate chondrogenic differentiation of bone marrow mesenchymal stem cells through LRP1 mediated lipid metabolism reprogramming, so that repair and regeneration of articular cartilage are promoted, and a potential new immune metabolism dual regulation strategy is provided for treatment of osteoarthritis patients.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a method for identifying therapeutic targets and screening drugs for osteoarthritis. Background Technology

[0002] Osteoarthritis (OA) is a refractory chronic disease characterized primarily by damage to articular cartilage. With the increasing aging of the global population and the rising proportion of obese individuals, the incidence of OA continues to climb. Due to the lack of blood vessels, nerves, and lymphatic tissue in articular cartilage, it is difficult for it to repair itself once damaged. Currently, the main clinical treatments for cartilage damage include intra-articular drug injection and surgical intervention. Intra-articular drug injection has advantages such as being minimally invasive and easy to perform, and can relieve pain and slow disease progression, but it cannot achieve cartilage regeneration. Surgical intervention can achieve cartilage regeneration to some extent, but it is more invasive, does not conform to the principles of minimally invasive treatment, and its prognosis is closely related to individual recovery. Therefore, exploring minimally invasive and efficient cartilage regeneration treatment strategies is of great significance for the clinical treatment of OA.

[0003] Recent studies have shown that epigenetic mechanisms play an important regulatory role in tissue regeneration. Among them, N6-methyladenine (m... 6 A) As one of the most common RNA epigenetic modifications, it has been proven to be widely involved in the regulation of disease progression and tissue regeneration. In cartilage biology, m 6 A can significantly affect the proliferation, migration, and differentiation of chondrocytes. Meanwhile, m 6 Alpha-lipoproteins (ALPs) are also deeply involved in cellular metabolic regulation, playing a crucial role, especially in lipid metabolism. Metabolic reprogramming is not only fundamental to maintaining immune microenvironment homeostasis but also a core element in regulating cell differentiation, and abnormal lipid metabolism is significant in the development and progression of osteoarthritis (OA). As a key receptor family in lipid metabolism, the low-density lipoprotein receptor-associated protein (LRP) family plays a vital role in tissue regeneration-related metabolic reprogramming. However, m 6 The specific mechanism by which A plays a role in cartilage regeneration through lipid metabolism reprogramming remains unclear.

[0004] Therefore, in-depth exploration of the immunometabolic regulatory mechanisms of OA epigenetics and the development of drug treatment strategies targeting these mechanisms have significant clinical value and application prospects. Summary of the Invention

[0005] The purpose of this invention is to provide an application of LRP1 in the preparation of osteoarthritis drugs and a drug screening method based on this target, aiming to provide a potential new strategy for epigenetic immune metabolic regulation in the treatment of osteoarthritis patients.

[0006] This invention discovers that WTAP (Wilsonblastoma 1-associated protein) mediates m 6 A regulates macrophage anti-inflammatory polarization through the LRP1-lipid metabolism axis, promotes bone marrow mesenchymal stem cell chondrogenic differentiation, and participates in the regulation of OA cartilage damage repair.

[0007] This invention further identifies silibinin and estradiol benzoate, two small molecule drugs that highly bind to LRP1, through molecular docking targeted drug screening, providing a new strategy for minimally invasive targeted drug therapy for OA.

[0008] Silymarin has the CAS number 65666-07-1, and its structural formula is shown below:

[0009] .

[0010] The CAS number for estradiol benzoate is 50-50-0, and its structural formula is shown below:

[0011] .

[0012] The technical solution of the present invention is as follows:

[0013] In a first aspect, the present invention provides a target for the treatment of osteoarthritis.

[0014] Application of LRP1 as a molecular target in the preparation of drugs for the prevention or treatment of osteoarthritis.

[0015] This invention primarily focuses on the epigenetic level m 6 The relationship between A modification and the regulation of LRP1-mediated lipid metabolism pathways, thereby promoting the regulation of OA cartilage regeneration, is centered on the regulatory axis of "WTAP-LRP1-lipid metabolism-cartilage regeneration".

[0016] This invention demonstrates that WTAP-mediated m 6 A modification is an important epigenetic regulator of cartilage regeneration; WTAP is m 6A key subunit of the METTL3 / METTL14 methyltransferase complex, it is primarily responsible for ligand recruitment and plays a crucial regulatory role in RNA metabolism and tissue regeneration. Transcriptomic analysis revealed significant differences in the expression levels of chondrogenic genes before and after WTAP knockdown. Further analysis showed that differentially expressed genes were enriched in cartilage regeneration and lipid metabolism. Multi-omics analysis of transcription and metabolism revealed that LRP1-mediated lipid metabolism reprogramming plays a vital target role in WTAP-related cartilage regeneration. LRP1 belongs to the LRP family of lipid receptors and participates in regulating lipid metabolism reprogramming and maintaining regenerative microenvironment homeostasis through the Wnt signaling pathway or autophagy. Based on these cartilage regeneration mechanisms, an epigenetic targeting strategy is provided for minimally invasive and highly effective treatment of osteoarthritis (OA).

[0017] In a second aspect, the invention provides an application for drug screening in the treatment of osteoarthritis.

[0018] A drug screening method for osteoarthritis by detecting the binding activity of target compounds to candidate compounds includes the following steps:

[0019] 1) Target protein pretreatment and binding site prediction: LRP1 was selected as the target protein for osteoarthritis treatment. The UCSF Chimera software was used to assign Amber14SB charge to the LRP1 protein. The H++ tool was used to determine the protonation state of the LRP1 protein. The SiteMap tool was used to predict the optimal binding site for the interaction between the LRP1 protein and small molecule compounds.

[0020] 2) Candidate compound library construction and preprocessing: A candidate compound library was constructed using small molecule drugs approved by the U.S. Food and Drug Administration (FDA). The structural information of the candidate compounds was obtained from the ZINC database. The AM1-BCC method was used to assign local charges to the candidate compounds, and the GAFF force field was used to complete the topological transformation of the candidate compounds.

[0021] 3) Virtual screening and preliminary screening of binding activity: The pretreated LRP1 target protein was molecularly docked with the candidate compounds. The molecular docking results were scored using two scoring methods, Autodock Vina and Glide SP, to screen out candidate compounds with preliminary binding activity.

[0022] 4) Molecular dynamics simulation and binding stability verification: A simulation system of the "LRP1 target protein-candidate compound" complex was constructed using the GROMACS 5.1.5 package. Energy minimization, isothermal-barometric equilibration, and formal molecular dynamics simulations for 50 ns were performed on the simulation system sequentially. The simulation results were analyzed using the gmx rmsd, gmx rmsf, ​​and gmx covar modules in GROMACS 5.1.5 to screen candidate compounds with conformational stability to the LRP1 target protein.

[0023] 5) Combining free energy calculation and identification of highly active candidate drugs: The molecular force field / generalized Born surface area (MM / GBSA) method was used to calculate the binding free energy ΔGbind of LRP1 target protein and candidate compounds based on molecular dynamics simulation trajectory files using the gmx_MMPBSA program. Candidate compounds with the lowest binding free energy were screened as potential drugs for the treatment of osteoarthritis.

[0024] An osteoarthritis prevention or treatment drug, wherein the drug highly binds to LRP1; the drug binds to LRP1 and activates related pathways to exert its effect, the main pathway being the aforementioned lipid metabolism pathway.

[0025] The osteoarthritis mentioned above is mainly characterized by cartilage damage. The core mechanism of this study is to promote cartilage repair and regeneration.

[0026] The drugs include silymarin and estradiol benzoate.

[0027] Preferably, the drugs all have well-defined pharmacokinetic characteristics and biological safety.

[0028] The LRP1-targeting drugs silymarin and estradiol benzoate of this invention have a good ability to promote cartilage regeneration.

[0029] The application of silibinin in the preparation of drugs for the repair of OA cartilage damage. The drug targets LRP1 as a site and promotes the anti-inflammatory polarization of macrophages and the chondrogenic differentiation of bone marrow mesenchymal stem cells by binding to LRP1 and regulating the LRP1-lipid metabolism axis.

[0030] The application of estradiol benzoate in the preparation of drugs for the repair of OA cartilage damage. The drug targets LRP1 as a site and regulates the LRP1-lipid metabolism axis by binding to LRP1, thereby promoting the anti-inflammatory polarization of macrophages and the chondrogenic differentiation of bone marrow mesenchymal stem cells.

[0031] A targeted pharmaceutical composition for repairing OA cartilage damage comprises the active ingredients silibinin and / or estradiol benzoate, and pharmaceutically acceptable excipients; the pharmaceutical composition targets LRP1.

[0032] A drug that regulates the repair of OA cartilage damage, wherein the drug modulates m6A through WTAP-mediated modification, regulates macrophage anti-inflammatory polarization via the LRP1-lipid metabolism axis, and promotes chondrogenic differentiation of bone marrow mesenchymal stem cells, thereby exerting a cartilage repair effect in OA.

[0033] We used cellular experiments to demonstrate at both the gene and protein levels that knocking down LRP1 reduced the expression levels of chondrogenic genes / proteins stimulated by silymarin and estradiol benzoate, indicating that silymarin and estradiol benzoate exert their cartilage regeneration-promoting effects by binding to LRP1. After binding to the lipid receptor LRP1 on the cell membrane, silymarin and estradiol benzoate activate the cholesterol metabolism pathway in lipid metabolism, stimulate macrophages to release anti-inflammatory factors, promote chondrogenic differentiation of BMSCs, and promote cartilage regeneration. Animal experiments using micro-CT and immunohistochemistry revealed that the silymarin and estradiol benzoate groups produced more newly formed cartilage and had a significantly increased number of chondrocytes.

[0034] The application of LRP1 as a target in screening drugs for OA cartilage damage repair involves screening small molecule compounds that highly bind to LRP1 using molecular docking technology. These small molecule compounds can promote OA cartilage damage repair by regulating the LRP1-lipid metabolism axis.

[0035] This invention discloses m 6 A methyltransferase can mediate lipid metabolism reprogramming through LRP1, regulate the immune homeostasis of macrophages, regulate the chondrogenic differentiation of bone marrow mesenchymal stem cells, and thus promote the repair and regeneration of articular cartilage, providing a potential new strategy for the treatment of osteoarthritis patients with dual immuno-metabolic regulation.

[0036] Beneficial effects:

[0037] This invention describes m 6 The methylase WTAP plays a positive role in promoting cartilage regeneration, a process that is significantly regulated through lipid metabolism mediated by the key target LRP1. Silymarin and estradiol benzoate, small molecule drugs with high affinity for LRP1 selected using molecular docking drug screening, exhibit good biocompatibility and excellent ability to promote cartilage regeneration, providing a new strategy for minimally invasive and highly effective targeted therapy of osteoarthritis (OA) cartilage injury. Attached Figure Description

[0038] Figure 1 Figure showing the results of successfully constructing Wtap knockdown mouse bone marrow macrophages (BMDMs) using lentiviral transfection; RT-qPCR results showed that the mRNA expression level of the Wtap knockdown group was significantly reduced.

[0039] Figure 2 For m 6 Figure 1 shows the results of WTAP methyltransferase promoting cartilage regeneration in vitro and in vivo; where A: statistical results of the expression levels of chondrogenic genes Acan, Sox9, Col2α1, and Prg4 in the control group and WTAP knockdown group; B: representative images of H&E and Safranin-Fix Green staining of knee cartilage in mice in the control group and WTAP knockdown group; *: P < 0.05; **: P < 0.01.

[0040] Figure 3 This is a transcriptomics analysis; specifically, a volcano plot showing differentially expressed genes between the control group and the Wtap knockdown group.

[0041] Figure 4 Transcriptomics enrichment pathways; where A: GO enrichment analysis of differentially expressed genes; B: KEGG enrichment analysis results of differentially expressed genes.

[0042] Figure 5 The transcriptome shows the expression of genes related to the cholesterol metabolism pathway. Among them, A: GSEA results of cholesterol metabolism; B: heatmap of differentially expressed genes in the cholesterol metabolism pathway; C: core gene analysis diagram of the volcano map of differentially expressed genes in the cholesterol metabolism pathway; D: analysis results of the relative abundance and relative expression level of Lrp1.

[0043] Figure 6 The transcriptome analysis shows the expression of cartilage-related genes; the relative expression levels of cartilage differentiation-related genes in the control group and the Wtap knockdown group are shown in the figure.

[0044] Figure 7 For metabolomics analysis; including a cluster heatmap of differentially expressed metabolites between the control group and the Wtap knockdown group.

[0045] Figure 8 This section shows the enrichment pathways for metabolomics; where A: a diagram of KEGG enrichment analysis of differentially metabolites; and B: a diagram of the KEGG enrichment analysis results of differentially metabolites.

[0046] Figure 9 This study included a combined analysis of transcription and metabolism; A: Venn diagram of differentially expressed genes and metabolites compared to the control group and the Wtap knockdown group; B: Correlation analysis of cholesterol metabolism and cartilage regeneration-related genes.

[0047] Figure 10This is a graph showing the correlation analysis results between key genes, key metabolites, and chondrogenic genes.

[0048] Figure 11 WTAP regulates the downregulation of LRP1 expression; A: Analysis of Lrp1 mRNA expression levels in the control group and WTAP knockdown group; B: Representative Western blot results of the control group and WTAP knockdown group; **: P < 0.01.

[0049] Figure 12 To screen for drugs that highly bind to LRP1, silymarin and estradiol benzoate were used. A: RMSD results of kinetic simulations for kanamycin C, silymarin, estradiol benzoate, and fosetyl-Alphabet B; B: Statistical graph of the binding free energy of the four drugs to LRP1.

[0050] Figure 13 This study demonstrates the biocompatibility of silymarin and estradiol benzoate. A: Representative results of live and dead cell staining experiments for the control group, silymarin, and estradiol benzoate; B: CCK-8 analysis of the control group, silymarin, and estradiol benzoate.

[0051] Figure 14 To successfully construct Lrp1 knockdown BMDMs using lentiviral transfection; RT-qPCR results showed that the mRNA expression level of the Lrp1 knockdown group was significantly reduced.

[0052] Figure 15 Silymarin and estradiol benzoate bind to LRP1 to induce chondrogenic activity; A: Schematic diagram of cell culture; B: RT-qPCR results showed that the RNA expression levels of chondrogenic genes Sox9, Col2α1, Acan, and Prg4 were significantly reduced after Lrp1 KO BMDM stimulation by silymarin and estradiol benzoate; *: P < 0.05; **: P < 0.01; ***: P < 0.001.

[0053] Figure 16 The study aimed to promote cartilage regeneration in vivo using silymarin and estradiol benzoate. A: Micro-CT and 3D reconstruction results showed that the silymarin and estradiol benzoate treatment groups significantly increased new bone formation in cartilage defect areas compared to the control group. B: Quantitative analysis using Micro-CT: BMD, BV / TV, and Tb.Th results. C: H&E and Safranin-Fixed Green staining showed that the cartilage defect area in the silymarin and estradiol benzoate treatment groups was significantly smaller than that in the control group, and new bone tissue covered the defect surface. *: P < 0.05; **: P < 0.01; ***: P < 0.001. Detailed Implementation

[0054] Example 1

[0055] The purpose of this embodiment is to construct a BMDM with Wtap knockdown, such as Figure 1 As shown:

[0056] 1) Prepare a complete culture medium with a density of 3-5 × 10⁻⁵. 4 A cell suspension of 1 cell / mL was seeded into 6-well plates. The cells were incubated at 37°C in a 5% CO2 incubator for 16-24 h, until cell confluence reached 20-30%.

[0057] 2) Based on the preliminary experimental results, the cell MOI was determined to be 100. The calculation formula was: Virus volume = (MOI × cell number) / virus titer. The old culture medium was discarded from the 6-well plates, and residual culture medium was gently washed away with PBS. The PBS was then discarded. 200 μL of virus and 40 μL of HiTransGP infection solution were added to each well of the experimental group, and the volume was increased to 1 mL with high-glucose DMEM complete culture medium. The control group was cultured with fresh culture medium. Cells were incubated at 37℃ and 5% CO2 for 12-16 h, then the medium was changed to standard, and cultured for another 3 days. Cells could be passaged with different medium during this period to maintain cell viability. 72 h after infection, the infection efficiency was observed under a fluorescence microscope. Successfully transfected cells showed green fluorescence.

[0058] 3) For viruses carrying the puromycin gene, stable strains can be obtained through screening with appropriate concentrations of puromycin. Based on preliminary experiments, the screening concentration of puromycin was determined to be 10 μg / mL. 48-72 h after lentiviral infection, when cell confluence reached 70-80%, the cells were continued to be cultured in 10 μg / mL puromycin medium, with the medium being changed every 3-4 days until the control cells were completely dead. At this point, the fluorescence efficiency of the virus-infected group should reach above 95%. The puromycin concentration was then reduced to a maintenance concentration (1 / 2 to 1 / 4 of the screening concentration), and screening and amplification continued. After amplification, cells were collected for qRT-PCR or Western blot identification, and cells with normal identification results were selected for cryopreservation. Figure 1 The qRT-PCR results of B showed that Wtap knockdown BMDM was successfully constructed through lentiviral transfection.

[0059] Example 2

[0060] The purpose of this embodiment is to explore the role of WTAP in cartilage regeneration, such as Figure 2 As shown:

[0061] 1) GelMA (GM60) photopolymerizable hydrogel was used as a carrier, and cells were cultured in 12-well Transwell plates. First, Wtap WT / KO BMDM cells were digested and centrifuged at 1000 rpm for 5 min, and the supernatant was discarded. Wtap WT / KO BMDM cells were then resuspended in GelMA hydrogel working solution (prepared with high-glucose DMEM complete medium) to a cell density of 3 × 10⁶ cells / well. 6 Cells / mL. Transfer 200 μL of cell suspension to the upper chamber of the well plate and irradiate with an EFL-LS-1601 portable light source for 20 s to ensure complete solidification of the hydrogel. Add 500 μL of high-glucose DMEM complete culture medium to the hydrogel.

[0062] 2) Similarly, mBMSCs cells were digested and centrifuged, the supernatant was discarded, and the cells were resuspended in α-MEM complete medium at 3×10⁻⁶ ppm. 4 Cells were seeded at a density of [number] cells / mL into the lower chamber of a plate. The plate was then incubated at 37°C with 5% CO2. When the confluence of mBMSCs in the lower chamber reached 60%, the culture medium was replaced with chondrogenic medium (CM). The culture medium in both chambers was changed every 2 days. When the confluence of cells in the lower chamber reached 90%, the cells were passaged to maintain cell viability. After 14 days of continuous culture, the cells were harvested.

[0063] 3) After 14 days of chondrogenic induction, discard the upper chamber of the plate. Remove the old culture medium from the lower chamber and wash three times with PBS. In a fume hood, add 1 mL of Trizol to each well, pipette the cells at the bottom of the plate, and transfer the cell suspension to a labeled 1.5 mL EP tube. Let it stand for 5 min, then add 200 μL of chloroform to each EP tube and shake vigorously up and down for 20 s. The liquid will turn a milky pink color. Let it stand for 10 min. Centrifuge the EP tubes at 12,000 rpm for 15 min at 4°C. Gently remove the EP tubes. The liquid will separate into three layers. Carefully transfer the supernatant from the top layer to a newly labeled EP tube, avoiding aspirating the white precipitate at the bottom. Add an equal volume of isopropanol to the new EP tube, invert to mix, and let it stand on ice for 10 min. Centrifuge at 12000 rpm for 10 min at 4°C. Carefully remove the EP tube; a white precipitate will be observed at the bottom. Discard the supernatant. Add pre-chilled 75% ethanol (diluted with DEPC water) to the tube to wash the RNA precipitate. Mix well by pipetting and centrifuge at 7500 rpm for 5 min at 4°C. Repeat the ethanol washing step twice. Discard the supernatant. Carefully remove the remaining ethanol from the tube with a pipette. Open the tube cap and let it stand until the ethanol has completely evaporated; at this point, the precipitate will be translucent. Add 20 μL of pre-chilled DEPC water to each EP tube to dissolve the RNA precipitate. Mix well by pipetting and place on ice. Finally, use NanoDrop. TM RNA concentration was determined using an 8000 spectrophotometer. An OD260 / OD280 ratio between 1.8 and 2.0 indicates high RNA purity. The extracted RNA was then subjected to reverse transcription or stored at -80°C.

[0064] 4) RNA Reverse Transcription: Based on the measured RNA concentration, calculate the volume required to reverse the same mass of RNA for each sample. Perform reverse transcription according to the Takara kit instructions to reverse the RNA into cDNA (as shown in Table 1).

[0065] Table 1: 20 μL reverse transcription system

[0066] reagents Volume (μL) 5×PrimeScript Buffer 4 PrimeScript RT Enzyme Mix I 1 Oligo dT Primers 1 Random Primers 1 Total RNA 2 μg DEPC water Make up to a total volume of 20 μL

[0067] 4) For real-time quantitative PCR, prepare a 20 μL reaction system, and set up three auxiliary wells for each sample and each gene. The specific sample loading volume is shown in Table 2.

[0068] PCR reaction conditions: hot start—95℃, 10 min; denaturation—95℃, 30 s; annealing extension—60℃, 1 min, for a total of 40 cycles. Relative Ct values ​​were obtained, with Gapdh as an internal control. The relative expression level of the target gene was calculated using the ΔΔCt method, and graphs were plotted and statistical analysis performed.

[0069] Table 2: Reagents and dosages used in a 20 μL reaction system

[0070] reagents Volume (μL) <![CDATA[SYBR ® Green Master]]> 10 cDNA 1 DEPC water 8 upstream primer 0.5 Downstream primer 0.5

[0071] Table 3 Primer sequences for RT-qPCR-related genes

[0072] Gene Chain of Justice (5'-3') Antisense chain (5'-3') Gapdh CATGCCATCACTGCCACCCA CCAGTGAGCTTCCCGTTCAG Sox9 CAGCAGGCACACACGCTCA CTGTAGTCGCTGGGGCTCA Col2α1 AGCAGCAAGAGCAAGGAA TGGACAGTAGACGGAGGAA Acan CGAGTCAACAGCATCTACC GAGTCATTGGAGCGAAGG Prg4 ATGATGTGGTAGATCCTGGG TGTTGCCACCTCTCTTGAAG Wtap TCCAGTACCTCAAGCAAGT TCCAGGCACTCAGTTCAT Lrp1 GAGGAGCAGGTTGTTAGTC CAGAAGCAGCAGGAGAAG

[0073] 6) Thirty-two mice were randomly divided into two groups: ① Control group (implanted with GelMA hydrogel-coated Wtap WT BMDM); ② Wtap KO group (implanted with GelMA hydrogel-coated Wtap KO BMDM). Each mouse weighed approximately 20 g on average. Anesthesia was administered via intraperitoneal injection of 10 mg / mL sodium pentobarbital solution, 0.15 mL per mouse. The surgical area was shaved and prepared, disinfected with povidone-iodine, and local anesthesia was achieved via subcutaneous injection of lidocaine hydrochloride. The skin was incised along the medial aspect of the knee joint to expose the patellar tendon. The mucosa was incised along the medial aspect of the patellar tendon, pushing the tendon to one side to expose the patellar groove. A hole approximately 0.8 mm in diameter and 1 mm deep was made in the patella using a prepared abrasive-tipped syringe needle (0.8 mm in diameter, with a positioning ring 1 mm from the tip). The patellar tendon was repositioned and sutured, and the skin was closed. Mice were marked by ear clipping. Pre-prepared GelMA hydrogel was used to coat 3D-cultured Wtap WT / KO BMDM mice before implantation into the cavity. Layered sutures were performed, and mice were marked by ear clipping. Postoperatively, oral penicillin was administered to prevent infection.

[0074] 7) Samples were collected at 2 and 4 weeks. The 32 mice were euthanized by cervical dislocation, and tissue samples of the healed cartilage defects in the femoral and knee joints were collected. The collected samples were numbered and blinded. Twenty mouse samples were frozen in liquid nitrogen for transcriptome and metabolome sequencing, and 12 mouse samples were used for histological section analysis.

[0075] 8) After collection, bone samples were fixed in 4% paraformaldehyde solution for 24 h, followed by rinsing with PBS solution to remove excess fixative. Next, the samples were immersed in 10% EDTA decalcification solution for 7 days, with fresh decalcification solution changed daily. Afterwards, they were dehydrated using an ethanol gradient and cleared with xylene to remove residual alcohol. After soaking in clean paraffin, the samples were embedded in paraffin and cut into 4 μm tissue sections using a microtome. The resulting sections were laid flat on microscope slides and heat-treated in a desiccator to flatten the paraffin. Subsequently, the sections were treated with xylene and alcohol to complete dewaxing and gradient dehydration.

[0076] 9) H&E staining: Immerse the sections in hematoxylin staining solution for 3-5 min. Wash away excess hematoxylin staining solution with distilled water, differentiate the sections with differentiation solution, wash again with distilled water, then perform blueing treatment with blueing solution and rinse with running water. Afterward, dehydrate the sections with alcohol gradient and stain in eosin staining solution for 5 min. Finally, after alcohol gradient dehydration and xylene clearing, mount the treated sections with neutral resin and observe and photograph under a microscope.

[0077] 10) Safranin-Fixed Green Staining: After dewaxing and dehydration, the sections were stained with bone tissue fast green staining solution for 1-5 min. Excess stain was rinsed with running water until the cartilage was colorless. The sections were then rapidly treated with 1% hydrochloric acid for 10-15 s, followed by gentle rinsing with running water. Next, the sections were stained with bone tissue safranin staining solution for 5-10 s, followed by rapid dehydration with anhydrous ethanol four times, 3-5 s each time, until the cartilage was red and the background was colorless. Finally, the sections were cleared twice with xylene, 5 min each time. Finally, the sections were mounted with neutral resin and observed and photographed under a microscope. The H&E and safranin-fast green staining results showed that Wtap knockdown reduced the cartilage repair capacity of the mouse knee joint.

[0078] Example 3

[0079] The purpose of this embodiment is to identify key pathways and genes using transcriptomics sequencing, such as... Figures 3-6 As shown:

[0080] 1) Samples were collected from the aforementioned mouse models at 2 and 4 weeks of age, respectively. The mice were euthanized by cervical dislocation, and samples of healed tissue from the cartilage defects in the femoral and knee joints were collected. The collected samples were numbered, frozen in liquid nitrogen, and sent to the transcriptome for analysis.

[0081] 2) Transcriptome sequencing: RNA from animal samples was isolated and purified using TRIzol, and then analyzed using NanoDrop. TM Total RNA concentration and purity were determined using an 8000 nmol / L filter, and RNA integrity was assessed using a Bioanalyzer 2100. Samples with RNA concentrations >50 ng / μL, RIN values ​​>7.0, and total RNA >1 μg were used for subsequent experiments. Two rounds of purification were performed using Oligo(dT) magnetic beads (ThermoFisher, USA) to specifically capture polyA (polyadenylated acid) mRNA. The RNA was purified under high-temperature conditions (94℃ for 5–7 min) using NEBNext. ®The RNA magnesium ion fragmentation module fragments the captured mRNA and synthesizes cDNA using reverse transcriptase. Double-strand synthesis is performed using E. coli DNA polymerase I and RNase H to convert the DNA-RNA complex into a DNA double strand. dUTP solution is added to blunt the ends of the double-stranded DNA, adding an A base to each end for ligation with T-base adapters. Fragments of specific sizes are then screened and purified using magnetic beads. After treating the double-stranded DNA with UDG enzyme, PCR is performed with a pre-denaturation at 95°C for 3 min, followed by 8 cycles of denaturation at 98°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 30 s, and final extension at 72°C for 5 min to form a library (strand-specific library) with fragment sizes of 300 bp ± 50 bp. Finally, paired-end sequencing is performed using an Illumina Novaseq™ 6000 (Lianchuan Company, Hangzhou) according to standard procedures, with the sequencing mode set to PE150.

[0082] 3) Subsequent data analysis and graphing were all conducted on the Lianchuan Bio Cloud Platform (OmicStudio).

[0083] After Wtap knockdown, differentially expressed genes were enriched in metabolic and cartilage regeneration-related pathways, and the relative expression levels of cartilage regeneration-related genes were reduced after Wtap knockdown.

[0084] Example 4

[0085] The purpose of this embodiment is to identify the key gene LRP1 using a combined transcriptional and metabolic analysis, such as... Figures 7-10 As shown:

[0086] 1) Metabolite Extraction: Collected animal samples were ground with liquid nitrogen, and 120 μL of 50% methanol solution was added and shaken thoroughly to mix. The mixture was allowed to stand at room temperature for 10 min to extract metabolites. The extract was then placed in a -20°C freezer overnight to precipitate proteins. After centrifugation at 4000 rcf for 20 min, the metabolites in the supernatant were transferred to a 96-well plate. 10 μL of the extract from each sample was diluted and mixed as a quality control (QC) sample. All metabolic samples were stored at -80°C before loading.

[0087] 2) Liquid Chromatography (LC): The ultra-high pressure liquid chromatography (HPLC) system used for data acquisition was a Thermo Scientific UltiMate 3000 HPLC system. The analytical column was an ACQUITY UPLC BEH C18 (100 mm * 2.1 mm, 1.8 µm, Waters, UK). During data acquisition, the column temperature was maintained at 35°C, and the flow rate was set to 0.4 mL / min. The mobile phases used for analysis were: Phase A—water (0.1% formic acid), and Phase B—acetonitrile (0.1% formic acid). The HPLC gradient was set as shown in Table 4.

[0088] Table 4 Liquid phase gradient settings

[0089] Time (min) Mobile phase composition 0-0.5 5% B 0.5-7 5%-100% B 7-8 100% B 8-8.1 100%-5% B 8.1-10 5% B

[0090] 3) Mass Spectrometry (MS): Metabolite detection was performed using a high-resolution mass spectrometer (Q-Exactive, Thermo Scientific), which can operate in both positive and negative ion modes. The acquisition resolution for precursor spectra (70-1050 m / z) was set to 70,000 to achieve the automatic gain control (AGC) target value of 3e⁻¹. 6 The longest injection time is 100 ms. In Data Dependent Acquisition (DDA) mode, the first three configurations for data acquisition are set. Fragmented spectral collection resolution is 17500 to achieve the AGC target value of 1e. 5 The maximum injection time was adjusted to 80 ms. After analyzing every 10 samples, a quality control sample (composed of all test samples) was collected to monitor the stability of the entire LC-MS process. Subsequent data analysis and plotting were performed in OmicStudio.

[0091] 4) Combined Transcriptome and Metabolome Analysis: Low-quality sequences were removed from both transcriptome and metabolome data, and data standardization was performed to complete initial quality control and preprocessing steps. Significantly differentially expressed genes, metabolites, and their regulatory mechanisms were screened. KEGG metabolic pathway analysis was used to integrate transcriptome and metabolome data, identifying genes and metabolites that undergo significant changes in the same biological process (KEGG pathway). Network analysis techniques were employed to establish interaction networks between transcriptome and metabolome data. Correlation analysis was performed using the Cor tool on OmicStudio, and Pearson correlation coefficients were applied to confirm correlations, thereby revealing the complex relationships between differentially expressed genes and metabolites and enabling targeted studies of key genes.

[0092] Results analysis showed that combined transcriptional and metabolic analysis revealed that differential metabolites after WTAP knockdown were mainly enriched in lipid metabolism-related pathways, and LRP1 played a key target role in the process of WTAP regulating cartilage regeneration through lipid metabolism.

[0093] Example 5

[0094] The purpose of this embodiment is to clarify the regulatory relationship between LRP1 and WTAP, such as Figure 11 As shown:

[0095] 1) Digest and centrifuge Wtap WT / KO BMDM cells separately, discard the supernatant, and resuspend the WtapWT / KO BMDM cells in GelMA working solution at a density of 3 × 10⁻⁶ cells / mL. 6 Cells were cultured at a density of 500 μL / mL and transferred to 24-well plates. The cells were then irradiated with an EFL-LS-1601 portable curing light source for 20 seconds to allow the hydrogel to fully solidify. 500 μL of high-glucose DMEM complete medium was then added on top of the hydrogel. The medium was replaced with fresh medium every 2 days, and the cells were harvested after 7 days of culture.

[0096] 2) Real-time quantitative PCR: Add 500 μL of GelMA lysis buffer (0.3 mg / mL) to each well of a 24-well plate to submerge the GelMA block. Use a pipette to repeatedly pipette and dissolve the block, ensuring it is completely broken up. Smaller blocks are more conducive to lysis. Incubate aseptically at 37°C, observing the lysis progress under a microscope every 15 minutes until complete lysis into a liquid state. Transfer the cell suspension to a centrifuge tube, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, resuspend in high-glucose DMEM complete medium, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, and obtain the cell pellet. RNA extraction, reverse transcription, and PCR experiments were performed as before. qRT-PCR results showed that Wtap knockdown significantly reduced LRP1 gene expression.

[0097] 3) Western blot

[0098] ① Prepare SDS-PAGE gel: Select intact, undamaged glass plates of varying lengths and a comb. Wash away surface stains with detergent and deionized water, then rinse thoroughly with deionized water. Secure the glass plates to the gel preparation rack, add deionized water to a certain height, and test for leaks for 10 minutes. If no significant change in the liquid level is observed, subsequent experiments can proceed. Dry the glass plates and comb with a hairdryer, and reposition the glass plates. Add the pre-prepared 10% separating gel between the glass plates, with the liquid level approximately 1.5-2 cm above the shorter glass plate. Use isopropanol to press out air bubbles and let stand at room temperature for 30 minutes. After the separating gel has completely solidified, pour out the isopropanol and absorb any remaining isopropanol with lens paper. Prepare a 5% stacking gel, add it above the separating gel, carefully insert the comb to avoid air bubbles, and let stand at room temperature for 30 minutes. After the stacking gel solidifies, remove the prepared glass plate and gel as a whole for subsequent experiments or soak them in 1× electrophoresis buffer and store at 4°C for later use (no more than one week).

[0099] ② Total protein extraction: Add 500 μL of GelMA lysis buffer (0.3 mg / mL) to each well of a 24-well plate to submerge the GelMA block. Use a pipette to repeatedly pipette and break up the block from the plate. Smaller blocks are more conducive to lysis. Incubate aseptically at 37°C, observing the lysis progress under a microscope every 15 minutes until complete lysis into a liquid state. Transfer the cell suspension to a centrifuge tube, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, resuspend in high-glucose DMEM complete medium, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, and obtain the cell pellet. Add 30 μL of RIPA lysis buffer containing 1% protease inhibitor to the centrifuge tube, gently pipette to mix, and then transfer the RIPA containing cells to a pre-labeled 1.5 mL EP tube. Place the EP tubes on ice and use a pulsed sonicator to fully lyse the cells. Place the lysed EP tubes in a pre-cooled high-speed centrifuge at 4°C and centrifuge at 12,000 rpm for 30 min. Transfer the supernatant to a new, labeled EP tube.

[0100] ③ Protein concentration determination (BCA method): Prepare gradient protein standard solutions (2 mg / mL, 1.5 mg / mL, 1 mg / mL, 0.75 mg / mL, 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, 0.625 mg / mL, 0 mg / mL) with physiological saline according to the instructions, and prepare BCA working solution (reagent A: reagent B = 50:1). Add 10 μL of protein standard solution to each well of a 96-well plate; dilute the sample 5 times with physiological saline when adding the sample to the 96-well plate (2 μL sample and 8 μL physiological saline per well). Add 200 μL of BCA chromogenic solution to each well, and gently tap to mix the sample and working solution evenly. Incubate at 37℃ for 30 min. Remove the plate and use a microplate reader (wavelength set to 562 nm) to detect the absorbance (OD) value of each well, record the OD value, plot a standard curve, and calculate the concentration and loading amount of each sample. Add a certain amount of 6× protein loading buffer to the sample in the EP tube according to the dilution ratio, and heat at 100°C for 5 min to denature the protein. Place the resulting protein sample on ice for subsequent experiments or store at -80°C.

[0101] ④ Western blot procedure: Electrophoresis: Rinse the electrophoresis tank with deionized water. Add the pre-prepared electrophoresis buffer to the mark. Mount the gel glass plate on the vertical electrophoresis system rack and place it in the electrophoresis tank. Carefully remove the comb, ensuring the gel is perpendicular to both sides of the sample wells and free of residue. Add the protein marker and protein sample to the sample wells sequentially, ensuring consistent sample loading. Connect the power supply, set a constant voltage of 90 V, and electrophoresis for 30 min. After observing the protein marker and sample entering the separating gel, increase the voltage to 120 V until the bromophenol blue reaches the bottom of the glass plate, then stop electrophoresis. Electrotransfer: Based on the molecular weight of the target protein and the position of the marker on the gel, gently cut the gel in the transfer buffer to prevent breakage, keeping the gel moist throughout. Cut the PVDF membrane to the appropriate size according to the gel size, immerse it in anhydrous methanol for 5 min to activate, and place it in the transfer clamp in a sandwich-like order (sponge-filter paper-gel-PVDF membrane-filter paper-sponge) in transfer buffer, taking care to prevent air bubbles from forming during the process. Place the fixed transfer clamp in the electroporation tank and add the prepared 1× transfer buffer. Perform transfer at a constant current of 300 mA under ice bath conditions, adjusting the transfer time according to the molecular weight of the target protein, generally between 1-3 h. Blocking and antibody incubation: After transfer, remove the PVDF membrane and place it in 5% skim milk for 1 h on a shaker. Dilute the primary antibody with 5% milk according to the antibody instructions, immerse the blocked membrane in the primary antibody dilution buffer, and incubate overnight at 4°C. Remove the primary antibody and wash three times with TBST on a shaker for 10 min each time. Dilute the secondary antibody with TBST according to the antibody instructions, transfer the membrane to the secondary antibody dilution buffer, and incubate on a shaker at room temperature for 1 h. Remove the secondary antibody and wash three times with TBST for 10 min each time. Development: ECL chemical developing solution was prepared according to the instructions. The PVDF membrane was incubated in the dark for 3 min, and then exposed and developed using a chemiluminescence imager. Western blotting results showed that LRP1 protein expression was significantly reduced after WTAP knockdown.

[0102] Example 6

[0103] The purpose of this embodiment is to screen for drugs targeting LRP1, such as silymarin and estradiol benzoate. Figures 12-13 As shown:

[0104] 1) In this study, Amber14SB charges were assigned to proteins using UCSF Chimera software, and H++ was used to determine their protonation state. SiteMap was used to predict optimal binding sites for small molecule interactions. For the virtual screening process, Autodock Vina and Glide SP scoring methods were used. The screening library for this study consisted of FDA-approved small molecule drugs, and the pre-processed structural information was obtained from the ZINC database, containing a total of 3180 small molecules.

[0105] 2) Molecular dynamics simulation: (1) System preparation: The target protein in this study is LRP1, and the GROMACS5.1.5 program package is used for dynamic simulation. Amber14SB is used as the protein force field parameter and TIP3P water model is used as the display solvent model. After the small molecule is distributed with local charge by AM1-BCC (austin model 1 - bond charge correction) method, the topological structure is transformed by GAFF (general amber force field). Chloride ions are added to neutralize the charge of the simulated system according to the amount of charge in each system. (2) Minimize energy: Gradient descent method and conjugate gradient method are used to minimize energy to obtain static equilibrium structure. (3) Simulation stage: Langeevin-thermostat (temperature control) and Berendsen barostat (pressure control) are used to conduct isothermal and isobaric equilibrium of the system (temperature: 300 K, pressure: 101.325 kPa), each stage lasts for 100 ps, ​​and then each system is subjected to formal simulation for 50 ns. (4) Data analysis: In this study, the root mean square deviation (RMSD) and root mean square fluctuation (RMSF) in GROMACS 5.1.5 were analyzed, and the composition of the α carbon atoms of the complex was analyzed using the gmx rmsd and gmx rmsf modules in GROMACS 5.1.5.

[0106] 3) Binding Free Energy Calculation: This study used molecular force field / generalized born surface area (MM / GBSA) to calculate the binding free energy ΔGbind of the target protein LRP1 and the candidate drug. The binding energy was calculated using the gmx_MMPBSA program based on the kinetic simulation trajectory file according to the following formula:

[0107] ΔG bind =ΔH - TΔS ≈ΔGsolv + ΔGGAS - TΔS (S1)

[0108] ΔGGAS =ΔEint + ΔEvdw +ΔEele (S2)

[0109] ΔGsolv =ΔEsurf +ΔEGB (S3)

[0110] ΔGGAS is the difference in kinetic energy in vacuum before and after receptor-ligand binding:

[0111] Eint represents the energy changes of bonds, bond angles, and dihedral angles;

[0112] Evdw represents the van der Waals energy change before and after the combination;

[0113] Eelec is a change due to electrostatic interaction.

[0114] ΔGsolv is the solvent effect term, which is divided into the polar term ΔEGB and the nonpolar term ΔEsurf.

[0115] TΔS is the entropy change, which is the most time-consuming and difficult to calculate, has low calculation accuracy, and has a negligible impact on the calculation. Therefore, when calculating the combined free energy, this term is considered to be 0.

[0116] 4) Based on the free energy calculation results, select the candidate molecules with the lowest binding free energy (indicating the highest affinity). Silymarin and estradiol benzoate, which are highly bound to LRP1, are screened based on molecular docking.

[0117] 5) Cell viability / dead staining: The in vitro cytotoxicity of silymarin and estradiol benzoate was assessed using a cell viability / dead staining assay. BMDM cells were digested and centrifuged to obtain cell suspensions. The experiment was divided into three groups: ① control group (1% DMSO); ② silymarin group (5 mg / mL); ③ estradiol benzoate group (4 μg / mL). The drugs were diluted with high-glucose DMEM complete medium, and BMDM cells were resuspended in the drug dilution buffer at a concentration of 3 × 10⁶ cells / mL. 4 Cells / mL were seeded into 24-well plates, with 3 replicates per group, and incubated at 37°C in a 5% CO2 incubator for 1, 2, and 3 days, respectively. The old culture medium was discarded, and the cells were washed three times with PBS. 4 mM calcein AM and 16 mM propidium iodide (PI) diluted in 500 μL PBS were added to each well, and the plates were incubated at room temperature for 30 min. The staining solution was discarded, and the cells were washed three times with PBS. Dead cells (PI, red) and live cells (AM, green) were observed using a fluorescence microscope and photographed.

[0118] 6) Cell proliferation assay: The proliferation of cells stimulated by silymarin and estradiol benzoate was detected using a CCK-8 assay kit. BMDM cells were digested and centrifuged to obtain cell suspensions. The experiment was divided into three groups: ① control group (1% DMSO); ② silymarin group (5 mg / mL); ③ estradiol benzoate group (4 μg / mL). The drugs were diluted with high-glucose DMEM complete medium, and BMDM cells were resuspended in the drug dilution buffer at a concentration of 3 × 10⁶ cells / mL. 4 Cells were seeded at a density of 1 / mL in 96-well plates, with 500 μL of cell suspension added to each well, and three replicates per group. After incubation at 37°C and 5% CO2 for 1, 2, and 3 days, CCK-8 assays were performed. The old culture medium was discarded, and the cells were washed three times with PBS. The CCK-8 reagent and complete culture medium were mixed at a ratio of 1:10 to prepare the working solution. 300 μL of the CCK-8 working solution was added to each well, and the cells were incubated at 37°C and 5% CO2 for 2 h. The culture medium was then transferred to new 96-well plates, 100 μL per well (3 sub-wells). The absorbance (optical density, OD) was measured at 450 nm using a microplate reader, and the OD values ​​were statistically analyzed. The results showed that silymarin and estradiol benzoate had good biocompatibility.

[0119] Example 7

[0120] The purpose of this embodiment is to construct a BMDM with Lrp1 knocked low, such as Figure 14 As shown:

[0121] Lrp1 lentivirus (Jikai Gene, Shanghai) was used for transfection, and stable strains were screened. The transfection and screening steps were the same as in Example 1. The expression level of Lrp1 was identified by RT-qPCR.

[0122] Example 8

[0123] The purpose of this embodiment is to investigate the in vitro chondrogenic properties of silymarin and estradiol benzoate, such as... Figure 15 As shown:

[0124] 1) Chondrogenic induction: In this study, GelMA (GM60) photocurable hydrogel was used as a carrier, and cells were cultured in 12-well Transwell plates. First, Lrp1 WT / KO BMDM cells were digested and centrifuged at 1000 rpm for 5 min, and the supernatant was discarded. Silymarin (5 mg / mL) and estradiol benzoate (4 μg / mL) were diluted with GelMA hydrogel working solution (prepared with high-glucose DMEM complete medium), and then the Lrp1 WT / KO BMDM cells were resuspended in the drug-containing GelMA hydrogel working solution to a cell density of 3 × 10⁶ cells / mL. 6Cells / mL. Transfer 200 μL of cell suspension to the upper chamber of the well plate and irradiate with an EFL-LS-1601 portable light source for 20 s to ensure complete solidification of the hydrogel. Add 500 μL of high-glucose DMEM complete culture medium to the hydrogel.

[0125] 2) Digest and centrifuge the mBMSCs cells, discard the supernatant, resuspend them in α-MEM complete medium, and then increase the concentration by 3×10⁻⁶. 4 Cells were seeded at a density of [number] cells / mL into the lower chamber of a plate. The plate was then incubated at 37°C with 5% CO2. When the confluence of mBMSCs in the lower chamber reached 60%, the culture medium was replaced with chondrogenic medium (CM). The culture medium in both chambers was changed every 2 days. When the confluence of cells in the lower chamber reached 90%, the cells were passaged to maintain cell viability. After 14 days of continuous culture, the cells were harvested. Figure 15 A).

[0126] 3) Real-time quantitative PCR: The expression levels of chondrogenesis-related genes Sox9, Col2α1, Acan, and Prg4 were detected by RNA extraction, reverse transcription, and PCR, following the same steps as before. Results showed that silymarin and estradiol benzoate, when combined with LRP1, significantly promoted the chondrogenic differentiation of bone marrow mesenchymal stem cells (mBMSCs).

[0127] Example 9

[0128] The purpose of this embodiment is to investigate the in vivo chondrogenic properties of silymarin and estradiol benzoate, such as... Figure 16 As shown:

[0129] 1) Establishment of a mouse model of knee cartilage defect: To investigate the effects of silymarin and estradiol benzoate on cartilage damage in vivo, 6-8 week old C57 mice were used to establish a knee cartilage defect model. The experimental animals used in this study were purchased from the Animal Department of Peking University School of Medicine, and the feeding and experimental procedures were all carried out at the SPF-grade Animal Experiment Center of Peking University Medical Science and Technology Building.

[0130] 2) Thirty mice were randomly divided into three groups: ① control group (1% DMSO); ② silymarin group (100 mg / mL); ③ estradiol benzoate group (6 mg / mL). Each mouse had an average weight of approximately 20 g. Mice were anesthetized by intraperitoneal injection of 10 mg / mL sodium pentobarbital solution, with 0.15 mL injected per mouse. The surgical area was shaved and prepared, disinfected with povidone-iodine, and local anesthesia was achieved with a subcutaneous injection of lidocaine hydrochloride. The skin was incised along the medial side of the knee joint to expose the patellar tendon. The mucosa was incised along the medial side of the patellar tendon, pushing the tendon to one side to expose the patellar groove. A hole approximately 0.8 mm in diameter and 1 mm deep was made in the patella using a prepared abrasive-tipped syringe needle (0.8 mm in diameter, with a positioning ring 1 mm from the tip). The patellar tendon was repositioned and sutured, and the skin was closed. Mice were marked by ear clipping. Postoperatively, oral penicillin was administered to prevent infection. The day after surgery, 10 μL of silymarin (100 mg / mL) and estradiol benzoate (6 mg / mL) were injected into the joint cavity of the surgical area, and the injections continued for 7 days.

[0131] 3) Micro-CT scan and histological staining analysis

[0132] (1) Micro-CT: Samples were collected at 2 and 4 weeks post-surgery. The 30 mice were euthanized by cervical dislocation, and tissue samples from the cartilage defect sites of the femoral knee joint were collected. The samples were fixed in 4% paraformaldehyde for 24 h, rinsed with PBS to remove the fixative, and then soaked in PBS. They were stored at 4°C. The knee joint defect samples were scanned using micro-computed tomography (micro-CT), and three-dimensional reconstruction of the samples was performed using Cobra software. The scan results of the samples were analyzed using an Inveon Research Workplace V 2.2.0 workstation, and the parameters of bone mineral density (BMD), bone volume / tissue volume (BV / TV), and trabecular thickness (Tb.Th) of the defect area were calculated.

[0133] (2) Histological staining: After Micro-CT scanning and sampling, bone samples were fixed in 4% paraformaldehyde solution for 24 hours, followed by rinsing with PBS solution to remove excess fixative. Next, the samples were immersed in 10% EDTA decalcification solution for 7 days, with fresh decalcification solution changed daily. Afterwards, the samples were dehydrated using an ethanol gradient and cleared with xylene to remove residual alcohol. After being immersed in clean paraffin, the samples were embedded in paraffin and cut into 4 μm tissue sections using a microtome. The resulting sections were laid flat on microscope slides and heat-treated in a desiccator to flatten the paraffin. Subsequently, the sections were treated with xylene and alcohol to complete dewaxing and gradient dehydration. H&E staining and safranin-fast green staining were performed as before. The results showed that silymarin and estradiol benzoate had good in vivo cartilage regeneration-promoting abilities.

Claims

1. Application of LRP1 as a molecular target in the preparation of drugs for the prevention or treatment of osteoarthritis.

2. Application of LRP1 as a molecular target in the preparation of drugs that promote cartilage repair and regeneration.

3. The application according to claim 1 or 2, characterized in that, LRP1 participates in regulating lipid metabolism reprogramming and maintaining regenerative microenvironment homeostasis through the Wnt signaling pathway or autophagy, and plays a role in WTAP-mediated m 6 A plays a target role in the process of cartilage regeneration.

4. The application according to claim 1 or 2, characterized in that, WTAP-mediated m-cell blastoma 1-associated protein 6 A regulates macrophage anti-inflammatory polarization through the LRP1-lipid metabolism axis, promotes bone marrow mesenchymal stem cell chondrogenic differentiation, and participates in the regulation of OA cartilage damage repair.

5. A drug for the prevention or treatment of osteoarthritis, characterized in that, The drug binds strongly to LRP1 and activates related lipid metabolism pathways to exert its effects.

6. The osteoarthritis prevention or treatment drug according to claim 5, characterized in that, The drug includes at least one of silymarin and estradiol benzoate.

7. The application of silymarin in the preparation of drugs for the repair of OA cartilage damage, characterized in that, The drug targets LRP1 and regulates the LRP1-lipid metabolism axis by binding to LRP1, thereby promoting anti-inflammatory polarization of macrophages and chondrogenic differentiation of bone marrow mesenchymal stem cells.

8. The use of estradiol benzoate in the preparation of drugs for the repair of OA cartilage damage, characterized in that, The drug targets LRP1 and regulates the LRP1-lipid metabolism axis by binding to LRP1, thereby promoting anti-inflammatory polarization of macrophages and chondrogenic differentiation of bone marrow mesenchymal stem cells.

9. The application of LRP1 as a target in screening drugs for the repair of OA cartilage damage, characterized in that, Small molecule compounds that highly bind to LRP1 were screened using molecular docking technology. These small molecule compounds can promote the repair of OA cartilage damage by regulating the LRP1-lipid metabolism axis.

Images