Application of CmBt and CmBr genes in regulation and control of bitter taste of muskmelon fruits

Abstract

The invention relates to the technical field of plant genetic engineering and molecular breeding, in particular to application of CmBt and CmBr genes in regulation and control of bitter taste of muskmelon fruits. Physical interaction exists between muskmelon fruit bitter taste regulation factors CmBt and CmBr proteins, and expression of a bitter taste synthesis key gene CmBi is synergistically activated; the CmbtCmbr double mutants are constructed through a gene editing technology, it is proved that double-gene knockout has a synergistic effect, and the content of cucurbitacine B in all tissue of muskmelon can be more remarkably reduced; field trials show that under induction of forchlorfenuron, bitter taste of fruits of the CmbtCmbr double mutant completely disappears, the effect of the CmbtCmbr double mutant is remarkably superior to that of a single-gene mutant, and quality characters such as fruit weight and sugar degree are not negatively influenced; effective gene resources and germplasm materials are provided for solving the industrial problem that fruits become bitter due to the fact that plant growth regulators are used in muskmelon production.

Description

Technical Field

[0001] This invention relates to the fields of plant genetic engineering and molecular breeding technology, specifically to a... CmBt and CmBr Application of genes in regulating the bitterness of melon fruit. Background Technology

[0002] melon( Cucumis melo Cucurbita (L.), X=2n=24, is an annual herbaceous plant belonging to the Cucurbitaceae family and the Cucurbita genus. It is an important economic crop widely cultivated worldwide. In greenhouse melon production, to overcome the difficulties in fruit setting caused by unfavorable environmental conditions such as low temperature and weak light, the plant growth regulator chlorpyrifos (CPPU) is often used to promote fruit setting and increase yield. However, CPPU treatment often induces abnormal accumulation of cucurbitacin B in the fruit. Since the bitterness of melon fruit is mainly caused by cucurbitacin B (CuB), CPPU treatment leads to bitterness in the melon fruit, which seriously affects the quality of the melon, reduces consumer acceptance, and lowers its commercial value.

[0003] Existing research indicates that the biosynthesis of cucurbitacin B is regulated by multiple transcription factors. Previous studies suggested that the bHLH transcription factor... CmBt It is believed to primarily regulate the bitterness of fruits, and its homologous gene CmBr It is believed to primarily regulate bitterness in roots. Although it targets a single gene (such as...) CmBr While improvements to CPPU can reduce bitterness to some extent, under extreme conditions such as high-concentration CPPU treatment, single-gene mutants may still exhibit a certain percentage of bitter fruit or residual bitterness, failing to completely eliminate bitterness. Therefore, elucidating the fine regulatory mechanism of CPPU-induced bitterness and identifying gene combinations that can completely block bitterness synthesis is of great significance for breeding high-quality melon varieties. Summary of the Invention

[0004] To address the shortcomings of the prior art, the present invention aims to provide a... CmBt and CmBr The application of genes in regulating the bitterness of melon fruits to eliminate bitterness and to cultivate high-quality melon varieties.

[0005] To solve the above problems, the present invention adopts the following technical solution: CmBt and CmBr Application of genes in regulating the bitterness of melon fruit.

[0006] CmBt and CmBr Genes containing targeted CmBt and CmBrApplication of gene editing vectors, expression cassettes, or transgenic cell lines in the cultivation of non-bitter melon germplasm.

[0007] Furthermore, by simultaneously inhibiting, silencing, or knocking out [the virus] in melon plants... CmBt and CmBr Gene; Alternatively, it could cause loss-of-function mutations in the CmBt and CmBr proteins.

[0008] Furthermore, the applications include: To reduce or eliminate the bitterness of melon fruit; or, to reduce or eliminate the bitterness induced by the plant growth regulator chlorpyrifos.

[0009] CmBt and CmBr proteins regulate the gene for cucurbitacin B synthesis in melon. CmBi Application in expression.

[0010] A method for cultivating melon germplasm without bitterness includes gene editing, mutagenesis, or hybridization breeding to induce the presence of certain genes in the melon plant genome. CmBt and CmBr When genes simultaneously lose function, a melon is produced. CmbtCmbr Double mutant materials.

[0011] The method described above for cultivating non-bitter melon germplasm produces melons that... CmbtCmbr Double mutant materials.

[0012] The melon mentioned CmbtCmbr Application of double mutant materials in CPPU-induced bitterness breeding.

[0013] The beneficial effects of this invention are as follows: (1) Corrected CmBt Functions CmBt It is a major regulator of bitterness in leaves. Current technology generally considers it... CmBt It is a fruit-specific regulatory factor, which was discovered in this invention through high-throughput transcriptome sequencing and RT-qPCR analysis. CmBt The gene was highly expressed in young melon leaves, and its expression level was significantly higher than that of its homologous gene. CmBr. CmBt Single-gene knockout not only reduced fruit bitterness but also led to a sharp decrease in cucurbitacin B (CuB) content in leaves, resulting in a phenotype of leaves without bitterness. This discovery corrects a long-standing misconception in the field that "..." CmBt The cognitive bias of "only regulating the fruit" provides a theoretical basis for the precise improvement of the bitterness trait in melons. The double mutant strategy of this invention is based on... CmBt and CmBr Precise analysis of tissue-specific functions enabled the regulation of CuB content in melons.

[0014] (2) CmBt and CmBr This invention achieves synergistic effects and removes bitterness more efficiently without affecting the quality of the melon. Compared with existing technologies, this invention utilizes... CmBt and CmBr The synergistic effect. Field trial data showed that under CPPU induction, the bitter fruit rate of wild-type (WT) was 58.57%. Cmbt Single mutants accounted for 27.27%. Cmbr The single mutant rate was 4.17%, while the one created in this invention... CmbtCmbr The bitter fruit rate of the double mutant decreased to 0%. This demonstrates that simultaneous knockout of two genes can more thoroughly block the bitterness synthesis pathway. Meanwhile, the invention obtained... CmbtCmbr The double mutant showed no significant differences from the wild type in key agronomic traits such as fruit weight, pulp and placental soluble solids (SSC), proving that the technique can eliminate bitterness without affecting the yield and quality of melons, and has extremely high breeding application value. Attached Figure Description

[0015] Figure 1 To obtain using CRISPR / Cas9 technology CmBt A schematic diagram of gene-edited mutants, where A represents... CmBt The sgRNA target location of the gene and the verification results of gene editing sequencing peaks are shown in the figure. Cmbt-18 A 1bp insertion at the target site, Cmbt-19 (1bp deletion at the target site), BG represents wild type (WT). Cmbt-18 and Cmbt-19 Phenotypic observation and CuB content detection of mutant plants showed that the CuB level in the leaves was significantly reduced; Figure 2 This diagram validates the physical interaction and co-activation function of CmBt and CmBr proteins; where A, B, and C are the results of the yeast two-hybrid (Y2H) experiment, showing co-expression. CmBt and CmBr The yeast strain can grow normally on auxotrophic culture medium. Figure D shows the results of the luciferase complementation (LCI) experiment. CmBt and CmBr The interaction in tobacco leaves produced a strong fluorescent signal. E is the in vitro pull-down experiment diagram, showing that the CmBt-GST protein can specifically pull down the CmBr-His protein, confirming a direct physical interaction between the two. F is the Dual-LUC experiment diagram, showing... CmBt and CmBr Co-expression of key genes for bitterness synthesis CmBi The activation efficiency of promoters is significantly higher than that of single gene expression; Figure 3The figures show the results of cucurbitacin B (CuB) content detection in different tissues of wild-type and mutant strains; where A is the CuB content in fruit; B is the CuB content in leaves; and C is the CuB content in roots. The results show... CmbtCmbr The content of bitter substances in all tissues of the double mutant was significantly lower than that of the wild type and any single mutant, confirming the synergistic effect of reducing bitterness. Figure 4 The graphs show the bitterness and quality analysis of wild-type and mutant fruits under CPPU treatment. A and B are phenotypic observations and CuB content determination of young fruits 3 days after flowering after CPPU treatment, showing that no obvious accumulation of bitter substances was detected in the double mutant. C and D are phenotypic and bitter fruit rate statistics of fruits of each genotype at the 35-day maturity period. The results show that the wild type has a higher bitter fruit rate under CPPU treatment, while the bitter fruit rate of the double mutant is 0%. E, F, and G are statistical graphs of single fruit weight, pulp and placental soluble solids (SSC) content of mature fruits, respectively. The results show that there is no significant difference in quality traits between the double mutant and the wild type. Detailed Implementation

[0016] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments.

[0017] The following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. These embodiments are provided to enable a more thorough understanding of the invention and to fully convey its scope to those skilled in the art.

[0018] Unless otherwise specified, the techniques used in the embodiments are conventional methods well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used are commercially available.

[0019] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0020] Unless otherwise stated, the implementation of this invention will utilize conventional botanical techniques, microbiological techniques, tissue culture techniques, molecular biology techniques, chemical techniques, biochemical techniques, DNA recombination techniques, and bioinformatics techniques that are readily apparent to those skilled in the art. These techniques have been fully explained in the published literature. Furthermore, the methods employed in this invention, including DNA extraction, phylogenetic tree construction, gene editing methods, gene editing vector construction, gene-edited plant acquisition, and protein interaction verification (such as yeast two-hybrid, LCI, pull-down, etc.), except for the methods used in the examples below, can all be implemented using methods already disclosed in the existing literature.

[0021] As used herein, the terms “nucleic acid,” “nucleic acid sequence,” “nucleotide,” “nucleic acid molecule,” or “polynucleotide” mean, but are not limited to, isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), naturally occurring, mutant, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, and single-stranded or double-stranded structures. These nucleic acids or polynucleotides include, but are not limited to, gene coding sequences, antisense sequences, and regulatory sequences of non-coding regions. These terms include a gene. “Gene” or “gene sequence” is broadly used to refer to a functional DNA nucleic acid sequence. Therefore, a gene may include introns and exons in a genomic sequence, and / or include coding sequences in cDNA, and / or include cDNA and its regulatory sequences. In particular embodiments, such as concerning isolated nucleic acid sequences, cDNA is preferred by default.

[0022] Furthermore, to provide a more intuitive understanding of the technical solution of this invention, some technical terms involved in this invention are explained as follows: "Mutant" refers to an individual that has undergone a mutation and possesses phenotypic characteristics different from the wild type; in this invention, it specifically refers to... CmBt and / or CmBr Plants with gene loss of function. A "double mutant" refers to a plant containing two target genes (in this invention, ). CmBt and CmBr Simultaneous mutations in individuals. "Expression vector" refers to a vector that adds expression elements (such as promoters, RBS, terminators, etc.) to the basic framework of a cloning vector, enabling the target gene to be expressed. "Synergistic effect" in this invention refers to... CmBt and CmBr When both are present or absent, the effect on traits (such as bitterness synthesis) is significantly greater than the sum of the effects of either alone.

[0023] In this invention, CRISPR-Cas9 gene editing technology is used to simultaneously knock out CmBt and CmBr Genes, acquired CmbtCmbrA homozygous mutant strain with two genes was developed. Biochemical experiments verified the physical interaction between CmBt and CmBr proteins and their synergistic regulation of key genes involved in cucurbitacin B synthesis. CmBi The molecular mechanism of this invention was demonstrated by the double mutant. This invention utilizes this double mutant to confirm its crucial role in eliminating CPPU-induced fruit bitterness, providing core germplasm resources for cultivating new melon varieties that are free of bitterness and of excellent quality.

[0024] Plant materials were selected from the muskmelon inbred line 'ivf05' (a wild-type bitter-tasting variety) and its derived mutants, and grown in a greenhouse. CPPU treatment involved preparing a 20 mg / L chlorpyrifos (CPPU) solution. On the day of flowering (0 DAA), the ovaries of female flowers were dipped in the solution, with untreated naturally pollinated fruits serving as a control. Cucurbitacin B (CuB) content was determined by grinding samples in liquid nitrogen, extracting with methanol, and sonicating for 15 minutes. The supernatant was collected by centrifugation, filtered, and the Cucurbitacin B content was determined using liquid chromatography-mass spectrometry (LC-MS / MS).

[0025] Example 1 1 CmBt Creation and identification of single-gene knockout mutants In order to analyze CmBt The gene's function and the basic materials for subsequent construction of double mutants were first created using CRISPR-Cas9 gene editing technology. CmBt Single gene knockout mutant: 1.1 Construction of gene editing vector: targeting melons CmBt The coding region sequence of the gene was determined, and a specific sgRNA was designed. Using primers (SEQ ID NO. 1 and 2), it was cloned into the pBSE402 vector to construct the recombinant plasmid pBSE402-sgRNA-CmBt. The plasmid was identified using primers (SEQ ID NO. 3-5) and transformed into Agrobacterium GV3101.

[0026] 1.2 Genetic transformation Using cotyledonary nodes of melon 'ivf05' as explants, infection was carried out using Agrobacterium-mediated transformation. After co-culture, selection culture, adventitious bud differentiation, and rooting induction, T0 generation regenerated plants were obtained.

[0027] 1.3 Obtaining the Cmbt mutant Genomic DNA was extracted from T0 generation regenerated plants. PCR amplification of sequences near the target site was performed using primers (SEQ ID NO. 6 and 7), and the amplified products were analyzed by Sanger sequencing. Two edited lines, Cmbt-18 (1 bp insertion at the target site) and Cmbt-19 (1 bp deletion at the target site), were successfully obtained. Both mutations resulted in frameshift mutations and loss of protein function, becoming the Cmbt mutant (see [link to article]). Figure 1 (Section A). Simultaneously, primers (SEQ ID NO. 8-33) were used to confirm that the edited strain did not exhibit off-target effects.

[0028] 1.4 Phenotypic identification of Cmbt mutants The obtained homozygous mutant Cmbt-18 and Cmbt-19 Phenotypic observation throughout the entire developmental period and detection of cucurbitacin B (CuB) content showed that... Cmbt The mutant showed no significant differences from the wild type in agronomic traits such as plant height, stem diameter, and leaf morphology. The CuB content in the roots, leaves, and fruits of the mutant was determined using LC-MS, and the results showed... Cmbt The CuB content in the mutant fruit and roots was significantly reduced (see Figure 1 (B, C, F, G), while Cmbt The CuB content in the mutant leaves dropped sharply to almost zero (see Figure 1 (D and E in the middle).

[0029] 2. Verification of the co-regulatory mechanism of CmBt and CmBr proteins 2.1 In Cmbt In mutants, CmBr There was no significant difference in expression levels. Cmbr In mutants, CmBt There was no significant difference in expression levels (see Figure 2 (A and B in the text) indicates that CmBt and CmBr may not have an upstream-downstream relationship.

[0030] 2.2 Yeast two-hybrid (Y2H) experiment: Using primers (SEQ ID NO.34-37), ... CmBr The full-length CDS sequence was constructed into the pGBKT7 vector. CmBt The full-length CDS was constructed into the pGADT7 vector. The Y2HGold yeast strain was co-transformed, and the results showed that the co-transformed strain could grow normally on the deficient medium (see...). Figure 2 The C in the middle indicates that there is a physical interaction between the two.

[0031] 2.3 LCI and Pull-down Experiments: In the LCI experiment, CmBr-nLUC and CmBt-cLUC vectors were constructed using primers (SEQ ID NO.38-41). Significant fluorescence signals were detected in tobacco leaves co-injected with CmBr-nLUC and CmBt-cLUC (see [link to LCI experiment]). Figure 2 In the pull-down experiment, CmBr-pCold and CmBt-pGEXT4-2 vectors were constructed using primers (SEQ ID NO. 42-45). The in vitro purified CmBt-GST protein successfully pulled down the CmBr-His protein (see [D]). Figure 2 The interaction between the two countries was further confirmed by the E-column.

[0032] 2.4 Co-activation Validation: The proCmBi-LUC reporter vector and 35S:CmBt and 35S:CmBr effector vectors were constructed using primers (SEQ ID NO.46-51). Dual-LUC experiments conducted in tobacco leaves showed that simultaneous expression... CmBt and CmBr right CmBi The activation fold of the promoter was significantly higher than that of expression alone. CmBt or CmBr (See Figure 2 (F). This indicates... CmBt and CmBr The formation of heterodimeric complexes can synergistically activate key genes involved in bitterness synthesis. CmBi The expression.

[0033] 3 CmbtCmbr Creation of double mutant melon germplasm Table 1 Primers and their sequences Primer uses Primer name Primer sequence SEQ ID NO Constructing gene editing vectors CmBt-monotarget-pKSE402-F ATTGGAACTCGCCAACCAAACTA 1 Constructing gene editing vectors CmBt-monotarget-pKSE402-R AAACTAGTTTGGTTGGCGAGTTC 2 Gene editing vector identification U626-IDF TGTCCCAGGATTAGAATGATTAGGC 3 Gene editing vector identification U629-IDF TTAATCCAAACTACTGCAGCCTGAC 4 Gene editing vector identification U629-IDR AGCCCTCTTCTTTCGATCCATCAAC 5 Detection of mutation sites in gene-edited plants CmBt-test-F121 AATCAAGTGTCTATCATATATCTCAGTGACT 6 Detection of mutation sites in gene-edited plants CmBt-test-R1829 GCCTATGTTTCGTTGCTGTGTC 7 Off-target detection CmBt-potential off-target 1-F GCAGTCAAAGACAGGCCCAA 8 Off-target detection CmBt-potential off-target 1-R AGGTAGCCGACATTCCAACGT 9 Off-target detection CmBt-potential off-target 2-F ATTGATGTTGTGTGGAAGTGATT 10 Off-target detection CmBt-potential off-target 2-R GCTTATAGACTCGTACAAAACTTATGA 11 Off-target detection CmBt-potential off-target 3-F TGTGCCGTTGACATAGACTCA 12 Off-target detection CmBt-potential off-target 3-R CTAGCGAGCGACAGAGAAGGA 13 Off-target detection CmBt-potential off-target 4-F GCCCTCAATATGCGTCTCCA 14 Off-target detection CmBt-potential off-target 4-R TCGTATGAGTGGTCTCGTAGGAA 15 Off-target detection CmBt-potential off-target 5-F TGGCTGACTGTGATTCGTGG 16 Off-target detection CmBt-potential off-target 5-R TTGTTGATGAGAGGACGGCCA 17 Off-target detection CmBt-potential off-target 6-F AGCAGCCATTCATGCAGACT 18 Off-target detection CmBt-potential off-target 6-R CGTTCTCCGTCAGTCTTCCCA 19 Off-target detection CmBt-potential off-target 7-F AGGAAGGAAGCTCTTTTATGAGGG 20 Off-target detection CmBt-potential off-target 7-R GCGATATTGGTCGGTGGGTTT 21 Off-target detection CmBt-potential off-target 8-F CCACATCGGGCAACTCCTTA 22 Off-target detection CmBt-potential off-target 8-R ACGTAGAGAAAGGCAGAGGCA 23 Off-target detection CmBt-potential off-target 9-F TTTAGTGCACAGCTGAATGC 24 Off-target detection CmBt-potential off-target 9-R TGCACAGACACAACTACTCTCTT 25 Off-target detection CmBt-potential off-target 10-F TGGTTCGACCAGAGATGTGT 26 Off-target detection CmBt-potential off-target 10-R TGGTCAAAACTTTCGTGCTGTC 27 Off-target detection CmBt-potential off-target 11-F CCCTCCCCAAAAGGCAGATT 28 Off-target detection CmBt-potential off-target 11-R CTCTGTGGTGCAGGATCGTTG 29 Off-target detection CmBt-potential off-target 12-F GAGGTACAGAGTACACCGCG 30 Off-target detection CmBt-potential off-target 12-R TGTGTGTTGGCAACCATCTGA 31 Off-target detection CmBt-potential off-target 13-F GGAACGCTGATACGCCAGTA 32 Off-target detection CmBt-potential off-target 13-R TCGCCCCAACCATGAATCTCA 33 Yeast two-hybrid (Y2H) experiment CmBt-pGADT7-F GGAGGCCAGTGAATTCATGGAATTCTTCAATGTTGAGT 34 Yeast two-hybrid (Y2H) experiment CmBt-pGADT7-R CGAGCTCGATGGATCCATCTAAAGGATAATATTCCAA 35 Yeast two-hybrid (Y2H) experiment CmBr-pGBKT7-EcoRI-F CATGGAGGCCGAATTCATGGATTTGAATAATGTTGAGTCAC 36 Yeast two-hybrid (Y2H) experiment CmBr-pGBKT7-BamHI-R GCAGGTCGACGGATCCTTAATCCAAAGGACAATACTCCA 37 LCI experiment CmBt-CLuc-F TCCCGGGGCGGTACCATGGAATTCTTCAATGTTGAGT 38 LCI experiment CmBt-CLuc-R TCCATTGTTGGATCCCTAATCTAAAGGATAATATTCCAA 39 LCI experiment CmBr-NLuc-F CTCGGTACCCGGGATCCAATGGATTTGAATAATGTTGAGTC 40 LCI experiment CmBr-NLuc-R CGCGTACGAGATCTGGTCGACATCCAAAGGACAATACTCC 41 Pull-down experiment CmBr-pCold-BamHI-F TACCCTCGAGGGATCCATGGATTTGAATAATGTTGAGTC 42 Pull-down experiment CmBr-pCold-SalI-R TAGACTGCAGGTCGACTTAATCCAAAGGACAATACTCC 43 Pull-down experiment CmBt-pGEX-4T-2-BamH-F GGTTCCGCGTGGATCCATGGAATTCTTCAATGTTGAGT 44 Pull-down experiment CmBt-pGEX-4T-2-Sal-R GGCCGCTCGAGTCGACCCCTAATCTAAAGGATAATATTCCAAATTGG 45 Tobacco activation experiment CmBr-PBI121-F GGACTCTAGAGGATCCATGGATTTGAATAATGTTGAGTCAC 46 Tobacco activation experiment CmBr-PBI121-R GATCGGGGAAATTCGAGCTCTTAATCCAAAGGACAATACTCCA 47 Tobacco activation experiment CmBt-pBI121-BamHI-F GGACTCTAGAGGATCCATGGAATTCTTCAATGTTGAGT 48 Tobacco activation experiment CmBt-pBI121-Sac1-R GATCGGGGAAATTCGAGCTCCTAATCTAAAGGATAATATTCCAA 49 Tobacco activation experiment CmBi-0800LUC-Kpn1-F TATAGGGCGAATTGGGTACCCGAGATTCTGGGTTAAATGGCGG 50 Tobacco activation experiment CmBi-0800LUC-BamH1-R TAGAACTAGTGGATCCCCACGTAACCAAATATTAGGACACC 51 Double mutant screening CmBr-test-F1 ATGGATTTGAATAATGTTGAGTCAC 52 Double mutant screening CmBr-test-R504 GTGTGAAGAAGTCTATAAACACACA 53

[0034] 3.4 Creation of Double Mutants Utilizing the previously created CmBr Gene-edited materials were hybridized with the Cmbt-18 mutant, then self-crossed, and screened using primers (SEQ ID NO. 52 and 53) to obtain... CmbtCmbr Homozygous double mutant line.

[0035] 4. Analysis of the bitter taste phenotype of the double mutant in different tissues Using LC-MS technology to analyze wild-type (WT) Cmbt Single mutant, Cmbr Single mutants and CmbtCmbr CuB content was determined in the roots, leaves, and fruits of the double mutant (see...). Figure 3 ).

[0036] Fruit (0 DAA): The wild type has a higher CuB content, while the double mutant has a CuB content that is reduced to below the detection limit, significantly lower than either single mutant (see [link to relevant documentation]). Figure 3 (A)

[0037] blade: CmBt A single mutation resulted in a significant decrease in leaf CuB, while a double mutant further reduced CuB content (see...). Figure 3 (B)

[0038] Roots: CmBr Single mutations primarily reduce bitterness in the roots, but double mutants have the lowest CuB content in the roots (see...). Figure 3 (C)

[0039] Simultaneously knock out CmBt and CmBr It has a significant synergistic effect and can more thoroughly block the synthesis of bitterness in the whole melon plant (especially the fruit).

[0040] 5 CmbtCmbr The double mutant completely eliminates CPPU-induced fruit bitterness. 5.1 Detection of CuB content after CPPU induction For wild type (WT), Cmbt Single mutant, Cmbr A single mutant was developed, and female flowers on the day of flowering were treated with 20 mg / L CPPU. The CuB content in the fruit was determined using LC-MS. The results showed that, 3 days after treatment (3 DAA), the CuB content in WT fruit surged to approximately 37.72 μg / g due to CPPU induction. Cmbt-18 Although the single mutant showed a decrease (21.43 μg / g), it still had a noticeable bitter taste; while CmbtCmbr No significant CuB accumulation was detected in the fruits of the double mutant (see...) Figure 4 (A, B)

[0041] The bitter fruit rate was calculated at fruit maturity (35 DAA). The bitter fruit rate in the WT group was as high as 58.57%. Cmbt The single mutant group accounted for 27.27%; Cmbr The single mutant group accounted for 4.17%; while the one created in this invention... CmbtCmbr No bitter fruits were found in the double mutant group, and the bitter fruit rate was 0% (see...). Figure 4 (C, D)

[0042] 5.3 Quality Characteristics Survey The quality traits of mature fruit were investigated. Results showed that under CPPU treatment, CmbtCmbr The single fruit weight, center soluble solids (SSC) of the pulp, and placental SSC of the double mutant were not significantly different from those of the wild type (see [link to relevant documentation]). Figure 4 (E, F, G).

[0043] In summary, this invention corrects previous findings regarding " CmBt Only regulate the fruit, CmBr The cognitive bias of "regulating only the root" has been clarified. CmBt Mainly regulates the blade, CmBr It mainly regulates the functional division of the fruit and root, and clarifies... CmBt and CmBr The gene exhibits partial functional redundancy in different tissues and can synergistically regulate the CuB content in melons. The gene created using this invention... CmbtCmbr The double mutant material can more thoroughly block the bitterness synthesis pathway, thereby completely eliminating CPPU-induced bitterness. At the same time, it can maintain the excellent fruit quality of melons, and has important application value in melon breeding and safe and efficient production.

[0044] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described with reference to preferred embodiments, those skilled in the art should understand that various changes in form and detail can be made without departing from the spirit and scope of the invention as defined in the appended claims.

Claims

1. CmBt and CmBr Application of genes in regulating the bitterness of melon fruit.

2. CmBt and CmBr Genes containing targeted CmBt and CmBr Application of gene editing vectors, expression cassettes, or transgenic cell lines in the cultivation of non-bitter melon germplasm.

3. The application according to claim 1 or 2, characterized in that, By simultaneously inhibiting, silencing, or knocking out the melon plant CmBt and CmBr Gene; Alternatively, it could cause loss-of-function mutations in the CmBt and CmBr proteins.

4. The application according to claim 1 or 2, characterized in that, The applications include: To reduce or eliminate the bitterness of melon fruit; or, to reduce or eliminate the bitterness induced by the plant growth regulator chlorpyrifos.

5. CmBt and CmBr proteins play a role in regulating the cucurbitacin B synthesis gene in melon. CmBi Application in expression.

6. A method for cultivating non-bitter melon germplasm, characterized in that, This includes using gene editing, mutagenesis, or hybridization breeding to modify the genome of melon plants. CmBt and CmBr When genes simultaneously lose function, a melon is produced. CmbtCmbr Double mutant materials.

7. The melon cultivated by the method for cultivating non-bitter melon germplasm according to claim 6. CmbtCmbr Double mutant materials.

8. The melon according to claim 7 CmbtCmbr Application of double mutant materials in CPPU-induced bitterness breeding.

Images