A bovine FSH recombinant protein, a recombinant expression vector and its preparation method

Abstract

This invention provides a bovine FSH recombinant protein, a recombinant expression vector, and a method for preparing the same. The bovine FSH recombinant protein has the amino acid sequence shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, or SEQ ID NO.4. A method for preparing the bovine FSH recombinant protein involves expressing the coding gene shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, or SEQ ID NO.8 in a host bacterium or host cell to obtain a low-glycemic FSH recombinant protein. This invention, through genetic engineering, obtains a bovine FSH recombinant protein by first constructing a vector and then artificially regulating post-translational N-glycosylation modification by introducing the Asn-X-Thr mutation of the N-glycosylation motif, achieving stable and efficient expression of low-glycemic FSH with significantly enhanced biological activity.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a bovine FSH recombinant protein, a recombinant expression vector, and a method for preparing the same. Background Technology

[0002] Follicle-stimulating hormone (FSH) is a highly glycosylated protein synthesized and secreted by follicular cells in the anterior pituitary gland, composed of α and β subunits. The main function of FSH is to promote follicle growth and development by stimulating granulosa cell proliferation, endometrial cell differentiation, follicular fluid formation, and follicular cavity expansion, thereby increasing the efficiency of mature follicles and ultimately improving ovulation and pregnancy rates. Differential glycosylation modification is one of the main factors affecting FSH's biological activity. After translation, FSH peptides undergo N-glycosylation modification, primarily forming two glycoforms: full-glycoform (FSH24) and low-glycoform FSH (FSH18 / 21). The ratio of these two glycoforms in vivo varies with physiological state and age. In vitro experiments have also shown that FSH18 / 21 can more efficiently activate ovarian RTKs and their downstream PI3K / AKT and MAPK / ERK signaling pathways. Simultaneously, FSH18 / 21 also has a positive effect on oocyte quality. In vivo studies have shown that, compared to FSH24, FSH18 / 21 can promote the development and maturation of more follicles and improve follicle health index.

[0003] Currently, commercially available veterinary FSH formulations are mainly derived from animal pituitary tissue extraction, which presents challenges such as limited sourcing, natural contamination with LH, high production costs, and heavy reliance on imports. Furthermore, the glycoform of animal-derived FSH is significantly affected by animal age, resulting in highly unstable biological activity between batches. In the veterinary drug field, there are no commercially available recombinant FSH protein formulations. Although many companies are attempting to produce recombinant FSH using genetic engineering, they have not focused on the crucial impact of FSH glycoform on its biological activity, instead focusing more on FSH half-life.

[0004] The inventors conducted FSH glycoform identification on some commercially available FSH preparations from various companies. The results showed that most commercially available FSH preparations are mixed glycoform FSH, with a few being pure, all-glycoform FSH24 (high-glycoform FSH24). Currently, there are no commercially available pure low-glycoform FSH preparations. At present, domestic veterinary FSH mainly comes from foreign companies such as Vetoquinol, ICPbio, Calier, Ningbo SecondHormone, and Reprobiol, resulting in a heavy reliance on imports. This leads to high FSH prices and high costs for treating livestock and poultry, which to some extent limits the widespread use of FSH in animal husbandry. Compared to all-glycoform FSH, low-glycoform FSH has a better effect on promoting follicle development in female animals and has a very broad prospect in the application of estrus synchronization in cattle.

[0005] Although genetic engineering technology can produce recombinant FSH with a single component, high biological activity, and controllable production costs, it is a key alternative to the original tissue extraction method, a breakthrough in existing industrial bottlenecks, and a future trend in biopharmaceutical development. However, due to problems such as different glycosylation modification amino acids or incorrect glycosylation sites, which may lead to reduced or affected biological activity, excessively low expression levels, or significant instability and variability, no low-glycemic FSH18 / 21 recombinant protein or its expression system has been publicly disclosed. Summary of the Invention

[0006] The purpose of this invention is to provide a bovine follicle-stimulating hormone recombinant protein.

[0007] The present invention also aims to provide a recombinant expression vector that stably expresses bovine FSH18 and FSH21 mutants for the preparation of bovine low-sugar FSH recombinant protein, replacing tissue-extracted veterinary FSH.

[0008] To achieve the above objectives, the present invention adopts the following technical solution: A bovine FSH recombinant protein, the amino acid sequence of which is shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4.

[0009] The gene encoding the bovine FSH recombinant protein as described above.

[0010] Furthermore, the nucleotide sequence of the gene corresponds to SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO.8.

[0011] The recombinant expression vector for expressing the bovine FSH recombinant protein as described above contains a gene with a nucleotide sequence as shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO.8.

[0012] Furthermore, the recombinant expression vector also carries a Strep-Tag II tag, and the recombinant expression vector is a PiggyBac transposon vector.

[0013] A cell line for expressing the bovine FSH recombinant protein as described above, the cell line containing the recombinant expression vector as described above.

[0014] Furthermore, the cell line is CHO cells.

[0015] A bovine FSH PMD19-T vector containing genes with nucleotide sequences corresponding to those shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO.8.

[0016] The PMD19-T vector for bovine FSH as described above is used for the preparation of bovine low-glucose FSH mutant genes.

[0017] Biological materials related to the bovine FSH recombinant protein as described above, wherein the biological material is the coding gene of the porcine FSH recombinant protein as described above or an expression cassette, recombinant vector, recombinant bacteria or recombinant cell line containing the coding gene.

[0018] As described above, the nucleotide sequences of the gene encoding the bovine FSH recombinant protein correspond to SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, or SEQ ID NO.8.

[0019] A method for preparing bovine FSH recombinant protein includes the following steps: expressing the encoding gene of the recombinant protein as described above in a host bacterium or host cell to obtain a low-glucose FSH recombinant protein.

[0020] The method described above, preferably, uses the Piggybac transposon system to transfect CHO suspension cell lines with recombinant vectors containing the genes encoded as described above for recombinant protein expression; after 5-7 days, the supernatant is collected and the protein is purified using a Strep-TagII tag gravity column purification system to obtain four low-glucose recombinant proteins.

[0021] A method for preparing a recombinant FSH protein includes the following steps: constructing a PMD19T-bFSH wild-type recombinant vector containing a Twin-Strep-Tag II tag using a bovine FSH (bFSH) sequence based on a homologous recombination strategy; and then targeting the N-glycosylation motif Asn... 7 Asn 24 Thr 9 Thr 26 These four sites were used to construct four recombinant vectors, PMD19T-bFSH, PMD19T-bFSH-β, each containing a different point mutation of the Twin-Strep-Tag II tag. N7G PMD19T-bFSH-β N24Q PMD19T-bFSH-β T9A PMD19T-bFSH-β T26 / AFurther, using enzyme digestion and ligation, Piggybac (PB) transposon vectors with different mutant bFSH genes were constructed, ultimately forming PB-bFSH and PB-bFSH-β transposon vectors containing Twin-Strep-Tag II tags. N7G PB-bFSH-β N24Q PB-bFSH-β T9A PB-bFSH-β T26 / A Five recombinant vectors were used to transfect CHO suspension cell lines for recombinant protein expression. After 5-7 days, the supernatant was collected and the protein was purified using a Strep-Tag II gravity column purification system to obtain wild-type and four low-glucose FSH recombinant proteins.

[0022] The beneficial effects of this invention are as follows: The bovine FSH recombinant protein provided by this invention has the amino acid sequence shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, or SEQ ID NO.4, and the recombinant protein is a low-glycemic FSH recombinant protein. This invention also provides a recombinant expression vector for the FSH recombinant protein and its preparation method. The novel FSH vector obtained through genetic engineering, by introducing a mutation at the Asn-X-Thr site of the N-glycosylation motif, allows for the artificial regulation of the polypeptide translation modification process, achieving efficient expression of low-glycemic FSH. Four single low-glycemic FSH recombinant proteins can be obtained, exhibiting high stability, minimal differences, and significantly enhanced biological activity and receptor affinity. Attached Figure Description

[0023] Figure 1 To utilize MOE software to analyze bFSHβ and bFSHβ N7Q bFSHβ T9A bFSHβ N24Q bFSHβ T26A Protein structure prediction simulation.

[0024] Figure 2 The image shows the plasmid map of the PB-bFSH-strep-tag II transposon vector. Figure 3 This is a schematic diagram of the vector construction process, where M1, M2, M3, and M4 represent bFSH-β, respectively. N7Q -twin-strep-tag II, bFSH-β T9A -twin-strep-tag II, bFSH-β N24Q -twin-strep-tag II and bFSH-β T26Q -twin-strep-tag II.

[0025] Figure 4 Electrophoresis diagrams of the PB-bFSH-twin-strep-tag II plasmid and four mutant FSH recombinant vectors Figure 5 To detect the expression of bFSH-twin-strep-tag II and four mutant FSH recombinant proteins 3 days after CHO transfection.

[0026] Figure 6 The results are for FSH N-glycosylation detection.

[0027] Figure 7 Coriolis staining for purification of different glycoforms of bovine FSH Figure 8 Immunoblotting for purification of different glycoforms of bovine FSH.

[0028] Figure 9 Comparison of expression levels of different recombinant bovine FSH proteins.

[0029] Figure 10 To determine the biological activity of bovine FSH mutant recombinant protein.

[0030] Figure 11 The results show the in vivo biological activity of different FSH protein mutants.

[0031] Figure 12 The results show the stability of different FSH protein mutants. Detailed Implementation

[0032] This invention controls the macroscopic heterogeneity of FSH protein after translation by constructing different FSH mutant vectors, and can obtain the expected low-glycemic, high-purity recombinant FSH protein without the need for glycoform separation. It can also effectively separate and obtain two low-glycemic FSH proteins, FSH18 and FSH21. This invention obtains two low-glycemic pure products with high biological activity and high stability through a conventional mammalian eukaryotic expression system.

[0033] It should be noted that in this invention, bFSH represents bovine FSH; Asn 7 It refers to the 7th amino acid of the β subunit of FSH, which is an asparagine; it is also the first amino acid of the first glycosylation motif (Asn-Ile-Thr) of the β subunit of FSH.

[0034] Thr 9 It refers to the 9th amino acid of the β subunit of FSH, which is threonine; it is also the 3rd amino acid of the first glycosylation motif (Asn-Ile-Thr) of the β subunit of FSH.

[0035] Asn 24It refers to the 24th amino acid of the β subunit of FSH, which is asparagine; it is also the first amino acid of the second glycosylation motif (Asn-Thr-Thr) of the FSH β subunit.

[0036] Thr 26 It refers to the 26th amino acid of the β subunit of FSH, which is threonine; it is also the 3rd amino acid of the 2nd glycosylation motif (Asn-Thr-Thr) of the β subunit of FSH.

[0037] N7G refers to the mutation of asparagine (Asn) at position 7 of the β subunit of FSH to glutamine (Gln). T9A refers to the mutation of the 9th threonine (Thr) in the β subunit of FSH to alanine (Ala); N24Q refers to the mutation of the 24th asparagine (Asn) in the β subunit of FSH to glutamine (Gln); T26A refers to the mutation of the 26th threonine (Thr) in the β subunit of FSH to alanine (Ala).

[0038] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the present invention without departing from its spirit and essence are within the scope of the present invention.

[0039] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, all reagents used in this method are of analytical grade or higher.

[0040] Example 1: Vector Construction By analyzing the structure and N-glycosylation modification sites of bovine FSHβ subunit protein, and based on the conserved amino acid motif Asn-X-Thr (X ≠ P) of N-glycosylation modification, and according to the principle of amino acid substitution, the amino acids selected for point mutation should be those with similar physicochemical properties. Based on the BLOSUM matrix, amino acids similar to Asn include Thr, Lys, His, Gly, Glu, Gln, Asp, and Arg; amino acids similar to Thr include Ala, Asn, Val, and Ser. The conserved amino acid motif of N-glycosylation is Asn-X-Thr / Ser (X is all amino acids except Pro). The FSH β subunit contains two conserved amino acid motifs, Asn7-Ile-Thr and Asn24-Thr-Thr. Single-point mutations can achieve de-N-glycosylation at a single N-glycosylation site. However, mutations to Pro at Ile8 and Thr25 would significantly impact protein structural stability. Therefore, potential site mutations are Asn7, Thr9, Asn24, and Thr26. Based on amino acid substitution principles, Asn7 and Asn24 can be replaced with Thr, Lys, His, Gly, Glu, Gln, Asp, and Arg; Thr and Thr26 can be replaced with Ala, Asn, and Val. The AlphaFold algorithm was then used to predict the FSH protein structure after the amino acid mutations, analyze its structural stability, and select sites potentially affecting N-glycosylation modification for mutation. The protein stability, solubility, hydrophobicity, and hydrophilicity were predicted using the ProtParam online website to select optimal mutation sites and amino acids. Due to space limitations, only the optimal post-mutation data is shown below: bFSH-β T7Q Isoelectric point: 7.67; Molecular weight: 33128.94; Instability index: 44.92; Aliphatic index: 56.01; Average hydrophilicity: -0.244; bFSH-β T9A Isoelectric point: 7.67; Molecular weight: 33084.89; Instability index: 46.14; Aliphatic index: 56.34; Average hydrophilicity: -0.244; bFSH-β T24Q Isoelectric point: 7.67, molecular weight: 33128.94, instability index: 46.43, aliphatic index: 56.01, average hydrophilicity: -0.252; bFSH-β T26AThe isoelectric point of bFSHβ is 7.67, molecular weight 33084.89, instability index 46.65, aliphatic index 56.34, and average hydrophilicity -0.244. The isoelectric point of bFSHβ is 7.67, molecular weight 33114.92, instability index 46.14, aliphatic index 56.01, and average hydrophilicity -0.252. The instability index assesses protein stability; a higher index indicates greater instability of the amino acids. The aliphatic index assesses protein solubility and hydrophobicity; a higher index indicates lower polarity of amino acids and greater hydrophobicity. The average hydrophilicity is calculated by increasing the negative value (greater hydrophilicity) and increasing the positive value (greater hydrophobicity). MOE software was used to analyze the hydrophilicity of bFSHβ and bFSHβ. N7Q bFSHβ T9A bFSHβ N24Q bFSHβ T26A Protein structure prediction fitting comparisons showed high fit for five proteins, indicating that the designed point mutations do not affect the protein secondary structure. MOE software was used to analyze the protein structure of bFSHβ and bFSHβ... N7Q bFSHβ T9A bFSHβ N24Q bFSHβ T26A Protein structure prediction simulation, such as Figure 1 As shown.

[0041] Therefore, the motif N of the bovine FSHβ subunit was selected for mutation. 7 IT and N 24 TT, Asn 7 Mutation to Gln 7 Or Thr 9 Mutation to Ala 9 Asn 24 Mutation to Gln 24 Or Thr 26 Mutation to Ala 26 Optimized recombinant protein bFSH-β was obtained. N7Q The amino acid sequence of (BM1) is shown in SEQ ID NO.1, and the recombinant protein bFSH-β is... T9A The amino acid sequence of (BM2) is shown in SEQ ID NO.2, and the recombinant protein bFSH-β is also described. N24Q The amino acid sequence of (BM3) is shown in SEQ ID NO.3; recombinant protein bFSH-β T26AThe amino acid sequence of (BM4) is shown in SEQ ID NO.4, and its corresponding gene sequences are SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8, respectively. First, different mutant primers were designed for the FSHβ gene sequence using snapGene software (see Table 1), and expression vectors of different mutant FSH recombinant PB transposons were constructed using molecular cloning technology.

[0042] 1. Cloning of the bovine FSH gene sequence The original gene sequences of bFSHα (GenBank: NM_173901.3, Gene ID: 28074, sequence as shown in SEQ ID NO.9) and bFSHβ (GenBank: NM_174060.1, Gene ID: sequence as shown in SEQ ID NO.10) were synthesized by Shanghai Ruimingda Pharmaceutical Technology Co., Ltd. The bFSHα and bFSHβ genes are linked by a P2A peptide; that is, the coding sequences of FSHα, P2A linker peptide, and FSHβ are sequentially linked to form a fusion gene, the sequence of which is shown in SEQ ID NO.11. The amino acid sequence of its corresponding recombinant protein FSH (BWT) is shown in SEQ ID NO.12. This fusion gene was synthesized into the Piggybac-CMV-EF1-mCherry-T2A-Puro (PB) transposon expression vector (purchased from Shanghai Ruimingda Pharmaceutical Technology Co., Ltd.), obtaining PB-bFSH. Using PB-bFSH plasmid as template, the plasmid concentration was diluted to 1 ng / µl, and the template volume was 1 ng. Amplification was performed using Pig-FSHA-F and bovine-strep-R primers as shown in Table 1. The amplification system is shown in Table 1-1, and the amplification program is shown in Table 1-2, resulting in bFSH with a Twin-Strep-Tag II tag (abbreviated as bFSH-twin-strep-tag-II). After amplification, gel electrophoresis was performed to verify the band size. Figure 4 Figure A shows the gel electrophoresis results of the bFSH-twin-strep-tag II gene. The gel electrophoresis results of the amplified product show that the band size is consistent with the bFSH-twin-strep-tag II sequence.

[0043] Table 1. Cloning process of the bFSH-twin-strep-tag II gene sequence and primer sequences.

[0044] Table 1-1 PCR amplification system (20µl)

[0045] Table 1-2 PCR reaction procedures After purification, the PCR product was ligated into the pMD19-T vector to construct the pMD19-T-bFSH-twin-strep-tagII plasmid vector. After sequencing verification, the bacterial culture was preserved.

[0046] 2. Construction of bFSH-strep-tag II mutant vector Using the pMD19-T-bFSH-twin-strep-tag II plasmid vector obtained above as a template, the plasmid concentration was diluted to 1 ng / µl, and the template volume was 1 ng. The plasmid was then used with bFSH-β... N7Q -F, bFSH-β N7Q -R, bFSH-β T9A -F, bFSH-β T9A -R, bFSH-β N24Q -F, bFSH-β N24Q -R, and bFSH-β T26A -F, bFSH-β T26A -R represents the primers, and the primer sequences are shown in Table 2. Amplification yielded pMD19-T-bFSH-β. N7Q -twin-strep-tag-II, pMD19-T-bFSH-β T9A -twin-strep-tag-II, pMD19-T-bFSH-β N24Q -twin-strep-tag-II, pMD19-T-bFSH-β T26Q -Twin-strep-tag-II linear sequence. The amplification system is shown in Table 2-1, and the PCR reaction procedure is shown in Table 2-2. After amplification, gel electrophoresis was performed to verify the band size.

[0047] Table 2 Primer sequences used in the construction of bovine FSH gene mutant vectors

[0048] Table 2-1 PCR Amplification System

[0049] Table 2-2 PCR Reaction Procedure The gel electrophoresis results of the amplified products showed that the band size was consistent with the pMD19-T-bFSH-twin-strep-tag-II sequence, approximately 3.7K, with good band specificity. The PCR products were pMD19-T-bFSH-β.N7Q -twin-strep-tag-II, pMD19-T-bFSH-β T9A -twin-strep-tag-II, pMD19-T-bFSH-β N24Q -twin-strep-tag-II, pMD19-T-bFSH-β T26Q -twin-strep-tag-II linear sequences. For example... Figure 4 Figure B shows the gel electrophoresis results of the pMD19-T-bFSH-twin-strep-tag-II mutant gene.

[0050] After purification and recovery using PCR reaction solution, the samples were digested with restriction endonuclease Dpn I for 1 hour. The Dpn I methylation digestion program is shown in Table 2-3. The digestion products were then subjected to homologous recombination, and the homologous recombination system is shown in Table 2-4, yielding pMD19-T-bFSH-β. N7Q -twin-strep-tag II, pMD19-T-bFSH-β T9A -twin-strep-tag II, pMD19-T-bFSH-β N24Q -twin-strep-tag II, pMD19-T-bFSH-β T26Q -Twin-strep-tag II vector. Take 100µl from 5 tubes. Ecoli The competent cells were placed on ice and allowed to thaw. They were then gently mixed by pipetting with a 200µl pipette. 10µl of each of the above homologous recombination products were added to 5 tubes respectively. Ecoli Competent cells were gently mixed and incubated on ice for 30 min. They were then heat-activated at 42°C for 45 s, quickly transferred to ice, and incubated for 2 min. The mixture was then added to 1 ml of antibiotic-free LB broth, mixed well, and incubated at 37°C with shaking at 160 rpm for 1 h to allow cell recovery. After gentle mixing, 200 µl of the bacterial culture was evenly spread onto LB solid medium containing Amp using a spreader. The plates were inverted and incubated at 37°C for 12-16 h. Three to four single colonies were picked from each plate and aliquoted into LB medium. Plasmids were extracted in small quantities and sent for sequencing. After successful sequencing and alignment, the obtained pMD19-T-bFSH-twin-strep-tag II and bMD19-T-bFSH-β plasmids were analyzed. N7Q -twin-strep-tag II, pMD19-T-bFSH-β T9A -twin-strep-tag II, pMD19-T-bFSH-β N24Q-twin-strep-tag II, pMD19-T-bFSH-β T26Q The -twin-strep-tag II vector was used for bacterial culture preservation, and the extracted plasmids were used... XbaI and NotI Restriction endonuclease was used to digest the enzyme at 37℃ for 1 hour. The digestion products were then subjected to agarose gel electrophoresis. The relative size and position of the digested bands and the target band were identified. For DNA markers, positive clones were confirmed. Figure 5 The images shown are pMD19-T-bFSH-twin-strep-tag II and pMD19-T-bFSH-β. N7Q -twin-strep-tag II, pMD19-T-bFSH-β T9A -twin-strep-tag II, pMD19-T-bFSH-β N24Q -twin-strep-tag II, pMD19-T-bFSH-β T26Q Electrophoresis image of the -twin-strep-tag II transposon vector after enzyme digestion. The gel results showed that bFSH-twin-strep-tag II and its different mutant FSH genes were detected in the enzyme digestion products. Further sequencing showed that four pMD19-T recombinant mutant vectors and one wild-type vector were successfully constructed.

[0051] Table 2-3 Dnp I methylation digestion template program

[0052] Table 2-4 Homologous Recombination System

[0053] Homologous recombination procedure: react at 50°C for 15 minutes.

[0054] pMD19-T-bFSH-twin-strep-tag II plasmid and pMD19-T-bFSH-β N7Q -twin-strep-tagII, pMD19-T-bFSH-β T9A -twin-strep-tag II, pMD19-T-bFSH-β N24Q -twin-strep-tag II, pMD19-T-bFSH-β T26Q -twin-strep-tag II mutant vector, PB transposon empty vector, via XbaI , NotI Restriction endonucleases After enzyme digestion at 37°C for 1 hour, gel recovery was performed to obtain bFSH-twin-strep-tag II and bFSH-β, respectively. N7Q -twin-strep-tag II, bFSH-β T9A -twin-strep-tag II, bFSH-β N24Q -twin-strep-tag II, bFSH-β T26Q -twin-strep-tag II gene fragment and PB transposon restriction enzyme fragment, gel recovery products bFSH-twin-strep-tag II, bFSH-β N7Q -twin-strep-tag II, bFSH-β T9A -twin-strep-tag II, bFSH-β N24Q -twin-strep-tag II, bFSH-β T26Q The -twin-strep-tag II gene fragment was ligated with the PB transposon digestion fragment using T4 DNAligase to obtain overexpression of PB-bFSH-twin-strep-tag II (see diagram below). Figure 2 (as shown), PB-bFSH-β N7Q -twin-strep-tag II, PB-bFSH-β T9A -twin-strep-tag II, PB-bFSH-β N24Q -twin-strep-tag II and PB-bFSH-β T26Q -twin-strep-tag II vector. For example... Figure 3 A schematic diagram of the above-mentioned carrier construction.

[0055] The T4 DNA ligase ligase was used, and the mixture was incubated at 4 degrees Celsius for 30 minutes. The ligation system (10 µl) is shown in Table 3.

[0056] Table 3. Ligation system using T4 DNA ligase ligase (10 µl)

[0057] 3. Validation using recombinant PB transposon vectors overexpressing bFSH-strep-tag II and different mutant FSH genes. The specific steps are as follows: (1) Take 100µl of Ecoli competent cells and place them on ice to thaw. Gently mix them by pipetting with a 200µl pipette. Add the ligation product (bFSH-twin-strep-tag II / bFSH-β) N7Q -twin-strep-tag II / bFSH-β T9A -twin-strep-tag II / bFSH-β N24Q -twin-strep-tag II / bFSH-β T26Q 10 µl of each of the -twin-strep-tag II gene fragments and the PB transposon digestion fragments were ligated, and the mixture was gently mixed and placed on ice for 30 min. (2) Activate at 42°C for 45 seconds, then quickly transfer to ice and let stand for 2 minutes; (3) Add 1 ml of antibiotic-free LB liquid medium, mix well, and place at 37°C, 160 rpm / min, shake and culture for 1 h to allow the cells to recover; (4) After gently mixing, take 200µl and use a spreading stick to spread the bacterial solution evenly on LB solid medium containing Amp. Invert the plate and place it in a 37°C constant temperature incubator to continue culturing for 12-16h. (5) In the clean bench, pick multiple single colonies and put them into 200µl EP tubes containing 20µl sterile water for colony PCR verification. The PCR amplification primers CMV–F (SEQ ID NO.23): CGCAAATGGGCGGTAGGCGTG and bovine-strep-R (SEQ ID NO.14) are used. The PCR amplification system and reaction procedure are shown in Table 4 and Table 5.

[0058] Table 4 PCR amplification system

[0059] Table 5 PCR reaction procedure (6) Take 10µl of the amplified product of a single clone with a value of about 1K and send it to the bacterial culture for sequencing. Store the rest in a 4℃ refrigerator. After the sequencing is correct, inoculate it into 1ml of LB liquid medium containing 50µg / ml Amp and culture at 37℃ with shaking at 220rpm / min for 4h. Then inoculate it into 10ml of LB liquid medium containing 50µg / ml Amp at a ratio of 1:1000 and culture for 12h. (7) Collect the bacterial culture by centrifugation at 12,000 rpm at room temperature, and extract PB-bFSH-strep-tag II and PB-bFSH-β using a plasmid mini-extraction kit. N7Q-strep-tag II, PB-bFSH-β T9A -strep-tag II, PB-bFSH-β N24Q -strep-tag II and PB-bFSH-β T26Q -strep-tag II vector plasmid; (8) The above-extracted plasmids were respectively subjected to XbaI , NotI The sequence was verified by double enzyme digestion. The plasmid concentration was diluted to 200 µg / µl, and the reaction volume (20 µl) per tube is shown in Table 6 below: Table 6 Reaction system (20µl)

[0060] Enzyme digestion was performed at 37℃ for 1 hour. The digestion products were then subjected to agarose gel electrophoresis to determine the relative size and position of the digested bands and the target band. For DNA markers, positive clones were identified. Figure 4 D represents PB-bFSH-twin-strep-tagII and PB-bFSH-β. N7Q -strep-tag II, PB-bFSH-β T9A -twin-strep-tag II, PB-bFSH-β N24Q -twin-strep-tag II and PB-bFSH-β T26Q Electrophoresis image of the -twin-strep-tag II transposon vector after enzyme digestion. The gel results show that bFSH-twin-strep-tag II and its different mutant FSH genes were detected in the enzyme digestion products, indicating that the recombinant PiggyBac transposon vector was successfully constructed.

[0061] To further validate the construction of the PiggyBac transposon vector overexpressing bFSH-twin-strep-tag II and its different mutant FSH genes, the extracted overexpression PiggyBac transposon vector was sent for plasmid sequencing. The sequencing results were compared with the sequences of bFSH-twin-strep-tag II and its different mutant FSH genes. The sequencing results indicated that PB-bFSH-twin-strep-tag II and PB-bFSH-β... N7Q -twin-strep-tag II, PB-bFSH-β T9A -twin-strep-tag II, PB-bFSH-β N24Q -twin-strep-tag II and PB-bFSH-β T26QThe construction of five recombinant transposon vectors of the -twin-strep-tag II has been completed.

[0062] (9) Take the corresponding positive bacterial solution and inoculate it at a ratio of 1:1000 into 150ml of LB liquid medium containing 50µg / ml Amp and culture for 16h. Extract the plasmid using an endotoxin-free plasmid extraction kit and store the resulting recombinant PB transposon vector for later use.

[0063] Example 2: Overexpression of bFSH-twin-strep-tag II and its different mutant FSH gene recombinant PB transposon vector expression 1. Expression of bFSH-twin-strep-tag II and its different mutant FSH gene recombinant PB transposon vectors Using the recombinant PB transposon plasmid (i.e., the overexpression recombinant PiggyBac transposon vector obtained after large-scale culture of positive bacterial solution in the above steps), and CHO-K1-Hi suspension cells from Zhuhai Kairui Biotechnology Co., Ltd. were used as expression cells to express different recombinant FSH proteins. Because the core plasmid carries the independent CMV promoter mCherry tag, when the PiggyBac transposon vector is expressed, CHO-K1-Hi suspension cells express red fluorescent protein, which can be observed under a microscope. PB-bFSH-twin-strep-tag II and PB-bFSH-β were also expressed. N7Q -twin-strep-tag II, PB-bFSH-β T9A -twin-strep-tag II, PB-bFSH-β N24Q -twin-strep-tag II and PB-bFSH-β T26Q The -twin-strep-tag II transposon vector was transfected into CHO-K1 suspension cells to express the secreted protein bFSH-twin-strep-tag II and four protein mutants, namely bFSH-β. N7Q -twin-strep-tag II, bFSH-β T9A -twin-strep-tag II, bFSH-β N24Q -twin-strep-tag II and bFSH-β T26Q -twin-strep-tag II.

[0064] CHO-K1-Hi cell culture: CHO-K1 suspension cells were cultured at 5 × 10⁻⁶ 5Seeds were prepared by seeding 20 ml of chemically defined ultra-high density CHO cell culture medium into 250 ml shake flasks. Cells were cultured at 37°C, 5% CO2, and 125 rpm on a shaker. After 3-4 days of culture, cells were passaged at least twice until cell viability recovered before transfection. During passage, 200 µl of cell suspension was collected in a culture dish to observe cell growth. Cells with normal morphology, no contamination, and in the logarithmic growth phase (6-15 × 10⁶ cells / ml) were selected. 6 ).

[0065] Preparation of plasmids and transfection reagents: PB-bFSH-twin-strep-tag II, PB-bFSH-β N7Q -twin-strep-tag II, PB-bFSH-β T9A -twin-strep-tag II, PB-bFSH-β N24Q -twin-strep-tag II and PB-bFSH-β T26Q The -twin-strep-tag II plasmid DNA solution and CHO-K1-Hi cell suspension chemical transfection reagent (purchased from Zhuhai Kairui Biotechnology Co., Ltd.) were removed from -20℃ and left at room temperature until they thawed and returned to room temperature.

[0066] Plasmid transfection, product expression, and detection: Specific steps are described in the Zhuhai Kairui CHO serum-free culture recombinant protein high-density expression system user guide (version 3.0). (1) Take 10µl of CHO-K1-Hi cell suspension into a 1.5ml EP tube, add 10µl of 0.4% trypan blue solution, mix well, and then add to a cell counting chamber. Use a cell counter to calculate cell viability and density. Select cells in the logarithmic growth phase with viability greater than 97% for transfection. Calculate and transfer the required volume of cell suspension into a centrifuge tube, centrifuge at 1000rpm for 5 minutes, discard the supernatant, and resuspend the cells in fresh Hi-KDCHO culture medium to achieve a density of 2×10⁻⁶ cells / mL. 7 cell / ml; (2) Seed 10 ml of cells into a 250 ml shake flask and cultured at 37°C, 5% CO2, and 125 rpm for 1 h. (3) Remove the cells for transfection. During transfection, add plasmid DNA to the cells at a concentration of 17 µg / ml (17 µg plasmid per ml of cells) and mix thoroughly. Then add transfection reagent (HiKDCHO-TA) at a concentration of 35 µg / ml while mixing thoroughly. After thorough mixing, put the cells back into the shaker and shake for 5 hours. (4) After culturing in a shaker for 5 hours, add two volumes of Hi-KDCHO culture medium to each shake flask to dilute the transfected cells, and put them back into the shaker to continue culturing. (5) 24 h after transfection, add 2% (2 ml / 100 ml) of CHO cell protein expression enhancer Hi-KEplus; at the same time, add a nutritional supplement HiKDCHO-Feed (addition amount is 2%; 2 ml / 100 ml), and transfer the cells to a 32 ℃ shaker incubator for low temperature induction expression to obtain high expression effect; (6) 72 h after transfection, add HiCHO-Feed once (2%; 2 ml / 100 ml) to increase the expression level of the product; and take 200 µl of cell suspension, centrifuge at 1000 rpm for 5 minutes to prepare protein samples from the cells and supernatant separately for Western blot detection of protein expression and glycoform detection. Incubate with strep-tagged antibody. The detection results are shown in […]. Figure 7 Wild-type bFSH-twin-strep-tag II is predominantly composed of high-sugar FSH24; bFSH-β N7Q -twin-strep-tag II, bFSH-β T9A -twin-strep-tag II is a low-sugar FSH18; bFSH-β N24Q -twin-strep-tag II and bFSH-β T26Q The -twin-strep-tag II protein mutant is a low-glycosylated FSH21, and the glycosylation is as expected. (7) 5-7 days after transfection, before the cell viability is lower than 70%, collect the cell suspension and centrifuge at 12000 rpm at 4℃ for 10 minutes to collect the cell supernatant.

[0067] 2. Detection of overexpression of bFSH-twin-strep-tag II and its different mutant FSH gene recombinant PB transposon expression: Protein extraction: (1) Prepare cell lysis buffer (1 ml system): 950 µl RIPP lysis buffer, 20 µl 50× Cocktail protease inhibitor, 10 µl each of phosphorylated protease inhibitors A and B, and 10 µl PMSF; (2) Collection of cell protein samples: Take 200µl of cell suspension after 72h of transfection into a 1.5ml EP tube, centrifuge at 12000rpm for 5 minutes, transfer the supernatant to a new 1.5ml EP tube, add 50µl of 5× loading buffer, and boil in a metal bath at 100℃ for 10 minutes; wash the cell pellet with pre-cooled PBS, centrifuge at 1000rpm for 5 minutes and discard the supernatant, repeat the operation twice, and thoroughly aspirate the residual liquid. Add 100µl of protein lysis buffer to each tube, mix by pipetting and incubate on ice for 5 minutes to fully lyse, and use an ultrasonic disruptor to disrupt the cells for 10s each time, disrupting 3 times. After full lysis, centrifuge at 12000rpm at 4℃ for 10 minutes, collect 80µl of the supernatant into a new EP tube, add 20µl of 5× loading buffer, and boil in a metal bath at 100℃ for 10 minutes.

[0068] PNGase-F deglycosylation enzyme de-glycosylates: (1) Take 10µg of 45µl glycoprotein solution and add 5µl of 10x Denatuning Buffer; (2) Heat at 100℃ for 15 minutes, then remove and cool to room temperature; (3) Add 10µl of 10×Reaction Buffer, 10µl of 10×NP-40 and 30µl of H2O, and mix well; (4) Add 5µl of PNGase F, mix gently, and digest at 37℃ for 1h; (5) The enzyme digestion product was subjected to Western blot for further verification of the glycoform. The product was incubated with strep-tagged antibody. The verification results are shown in [see attached table]. Figure 6 The results indicate that wild-type bFSH-twin-strep-tag II is predominantly high-sugar FSH24; bFSH-β N7Q -twin-strep-tag II, bFSH-β T9A -twin-strep-tag II is a low-sugar FSH18; bFSH-β N24Q -twin-strep-tagII and bFSH-β T26Q The -twin-strep-tag II protein mutant is a low-glycogen type of FSH21, further indicating that the glycogen type is as expected.

[0069] Preparation of protein purification wash buffer (1×buffer W): Add 100 ml of 1000 mM Tris-HCl (pH 8.0), 100 ml of 1500 mM NaCl, and 2 ml of 0.5 M EDTA to a beaker, mix well, and then transfer the solution to a 1 L volumetric flask and bring the volume to 1 L. The specific steps for preparing 1000 mM Tris-HCl (pH 8.0) and 1500 mM NaCl are as follows: Preparation of 1000mM Tris-HCl (pH 8.0): Weigh 121g Tris-base powder into a beaker, add 800ml ddH2O, dissolve completely, then add concentrated hydrochloric acid to adjust the pH to 8.0, and transfer the solution to a 1L volumetric flask and bring the volume to 1L. 1500mM NaCl: Weigh 87.7g of NaCl powder into a beaker, add 800ml of ddH2O, dissolve thoroughly, and transfer the solution to a 1L volumetric flask and bring the volume to 1L.

[0070] Elution buffer 1×BXT-Buffer preparation: IBA 10×BXT-Buffer, which is converted to 1×BXT-Buffer with ddH2O before use; Buffer Regeneration: Take 142.865g of MgCl2 powder, add 300ml of ddH2O, mix well, and then transfer the solution to a 500ml volumetric flask and make up to 500ml to prepare 3M MgCl2.

[0071] The specific steps for protein purification are as follows: (1) Packing the packing material: Remove the top cap of the 12ml purification column, install the bottom and top pads, add 2ml of Strep-TactinXT 4Flow solution to the 12ml purification column and let stand for 30min until the Strep-Tactin XT 4Flow packing material sinks. Remove the bottom cap of the purification column and remove buffer W. Wet the top pad with 1×buffer W, place it horizontally at the mouth of the purification column, and move the top pad vertically down until the top pad flattens the Strep-Tactin XT 4Flow packing material. If the packing material is not used after packing, close the top and bottom caps, add 2×1 CV (packing material volume) of 1×Buffer W, close the top cap, and store at 4 degrees for later use. (2) When purifying the protein, remove the top cap and then unscrew the bottom cap. Remove the preservation solution and add 2×1 CV of 1×BufferW to the equilibration column of Strep-Tactin XT 4Flow; (3) Before loading the sample, to remove any precipitates that may form, the frozen cell extract should be centrifuged once (18000xg, 5min, 4℃). Add the clarified protein sample (cell supernatant collected 5-7 days after transfection) to the purification column. Collect the flow-through components and perform SDS-PAGE analysis.

[0072] (4) Wash the purification column with 1×Buffer W: 5×1 CV. Collect the wash buffer components separately for SDS-PAGE analysis. (5) Add 1×Buffer BXT: Collect the eluted fractions, then elute with 0.6 CV (E1), followed by 1.6 CV (E2), and finally 0.8 CV (E3). The protein content was highest at E2. After elution, the protein purification results were analyzed by SDS-PAGE as follows: Figure 8 As shown.

[0073] (6) Regeneration of purification column: For Strep-Tactin XT 4Flow, use 6CV Buffer XT-R for regeneration. HABA (Buffer R) can be used to detect whether the packing material is successfully regenerated. If the packing material is orange, it indicates that the regeneration is successful.

[0074] (7) Immediately add 8CV 1×Buffer W to remove the regeneration solution. (8) Finally, retain 2 ml of Buffer W into the purification packing material, cover the top and bottom of the purification column, and store it in a 4°C refrigerator.

[0075] Purification results showed that the protein was highly purified with no impurities observed (see [link to purification results]). Figure 8 ).

[0076] 4. Protein expression efficiency determination The purified protein was concentrated using a 15ml Millipore ultrafiltration tube with a protein molecular weight cutoff greater than 10kDa. The protein was then centrifuged at 5000rpm for 20 minutes at 4 degrees Celsius, and the protein concentrate was recovered.

[0077] The concentration of the concentrated protein was determined using the Bradford kit from Abbkine, as follows: (1) Preparation of standard solution: Dilute BSA standard with PBS to a working solution of 1 mg / mL. Dilute to 50, 100, 200, 400, 600, 800, 1000 ug / ml; PBS is used as a negative control.

[0078] (2) Take 20 μL of standard (0, 50, 100, 200, 400, 600, 800, 1000 μg / ml BSA) or sample and add it to the bottom of a 96-well plate, two wells for each sample.

[0079] (3) Add 200 μL Bradford working fluid to the above-mentioned well.

[0080] (4) Gently shake to mix for 5 minutes. Incubate at room temperature.

[0081] (5) 595nm OD measured at wavelength.

[0082] Data analysis was performed using ELISACalc and Graphpad software. Results are shown below. Figure 9 The results showed that bFSH-β N24Q The expression level of the -twin-strep-tag II recombinant protein was higher than that of the bFSH-twin-strep-tag II recombinant protein (34.71 µg higher per ml of protein), but the difference was not significant. Meanwhile, the expression level of bFSH-β... T26Q -twin-strep-tag II, bFSH-β N7Q The expression level of -twin-strep-tag II recombinant protein was significantly lower than that of bFSH-twin-strep-tag II recombinant protein (87.09 µg and 130.7 µg lower per ml of protein, respectively).

[0083] 5. Detection of biological activity of overexpression bFSH-twin-strep-tag II and its different FSH protein mutants The biological activities of bFSH-twin-strep-tag II and its different FSH protein mutants were detected using HEK-293T cells overexpressing bovine FSHR (i.e., 293T-FSHR, a stable cell line provided by the Department of Animal Reproduction and Special Economics, College of Animal Science and Technology, and College of Veterinary Medicine, Huazhong Agricultural University). The specific steps are as follows: (1) 293T-FSHR cell culture: Cells passaged after resuscitation were cultured and their growth status was observed. Cells with normal morphology, no contamination, and in the logarithmic growth phase were selected. They were seeded in 24-well plates and cultured in a 37°C, 5% CO2 incubator. (2) When the confluence of 293T-FSHR cells reaches 70%-90%, the cells are treated by gently rinsing them 2-3 times with serum-free DMEM high-glucose medium. 500µl of serum-free DMEM high-glucose medium is added to each well for 2h starvation. Different concentration gradients of bFSH-twin-strep-tag II protein (0, 10, 100, 200 ng / ml) are set up, with RD FSH as a positive control. 293T-FSHR cells are treated for 30min. The supernatant is discarded, and the cells are gently rinsed 2-3 times with pre-cooled PBS. The residual liquid is aspirated after the last rinse. 50µl of protein lysis buffer is added to each well (preparing a 1250µl system: 950µl RIPP lysis buffer, 20µl 50×Cocktail protease inhibitor, 10µl each of phosphorylated protease inhibitors A and B, 10µl PMSF, and 250µl...). Add the 5X loading buffer (mix well) and freeze at -80°C. Repeat the freeze-thaw cycle 2-3 times. Transfer the lysed cell suspension from each well to a 200µl EP tube and boil in a metal bath at 100°C for 10 min. Perform Western blot to detect the expression level of p-CREB, a downstream signaling pathway of FSHR. Results are shown in [Figure 1]. Figure 10 The results showed that 10 ng / ml FSH protein effectively stimulated the expression of p-CREB, a downstream signaling pathway of FSHR. The same procedure was then performed with different concentration gradients of bFSH-strep-tag II protein (0, 5, 10, 20, 40, 50 ng / ml), and the results showed that 10 ng / ml FSH protein effectively stimulated the expression of p-CREB, a downstream signaling pathway of FSHR. Treatment of 293T-FSHR with 50 µg / ml bFSH and its different FSH protein mutants, followed by the same procedure, showed that wild-type bFSH-twin-strep-tag II and its different FSH protein mutants all effectively stimulated the expression of p-CREB, a downstream signaling pathway of FSHR. Figure 10 As shown. This indicates wild-type bFSH-twin-strep-tag II and different FSH recombinant protein mutants: bFSH-β N7Q -twin-strep-tag II (low-sugar FSH18), bFSH-β T9A -twin-strep-tag II (low-sugar FSH18), bFSH-β N24Q -twin-strep-tag II (low-sugar FSH21) and bFSH-β T26Q Both -twin-strep-tag II (low-sugar FSH21) and other compounds possess biological activity.

[0084] 6. Detection of in vivo biological activity of bFSH-twin-strep-tag II overexpression and its different FSH protein mutants Four-week-old female Kunming white mice were used to induce superovulation by injecting wild-type bFSH (BWT) and different glycoform bFSH recombinant protein mutants. PMSG served as a positive control. The experiment involved intraperitoneal injection every 12 hours for four consecutive injections, followed by HCG injection. Oviducts were collected 16 hours after HCG injection, and the number of mature oocytes was counted to evaluate the ovulation induction effect of different FSH mutants. Results showed that wild-type bFSH induced 25 oocytes in all mice, with a non-response rate of 25%. Mutations at sites 1 and 2 resulted in significantly lower ovulation induction efficiency and a higher non-response rate compared to wild-type. Mutations at sites 3 and 4 resulted in ovulation induction effects similar to PMSG, but slightly lower than wild-type bFSH. Mutations at site 3 showed more stable ovulation induction effects and the lowest non-response rate. Figure 11 These results indicate that the pattern and degree of FSH glycosylation modification significantly affect its biological activity in vivo, and that specific low-glycosylation mutants have advantages in maintaining ovulation induction function, providing important experimental evidence for subsequent targeted optimization of FSH glycosylation and development of highly consistent ovulation induction agents.

[0085] 7. Stability determination of overexpression of bFSH-twin-strep-tag II and its different FSH protein mutants HEK293T cells were selected for CHX cyclohexylimide (CHX) tracking assay to determine the half-life of FSH recombinant protein mutants.

[0086] (1) Cell seeding: HEK293T cells were seeded at an appropriate density in 12-well plates and cultured at 37°C in a 5% CO2 incubator until 70-80% confluence.

[0087] (2) Plasmid transfection: Using PEI transfection reagent, bFSH-twin-strep-tag II and its FSH mutant plasmids were transfected into cells. The cells were cultured in serum-free medium for 8 hours. After 8 hours of transfection, the medium was replaced with fresh complete medium for further culture.

[0088] (3): CHX treatment: 36 hours after transfection, discard the original culture medium and add fresh culture medium containing 100 ng / ml CHX working solution to each well.

[0089] (4) Time gradient sampling: Cell culture samples were collected at 0, 2, 4, 6, 8 and 12 hours after CHX addition.

[0090] (5) Cell sample processing: After washing with pre-cooled PBS, add RIPA lysis buffer (containing protease inhibitor) to lyse the cells, centrifuge and collect the supernatant for detection of cell FSH protein.

[0091] (6) Sample processing: Add an appropriate amount of SDS-PAGE loading buffer to the cell lysate or culture supernatant and denature in a boiling water bath for 5-10 minutes.

[0092] (7) Western Blot detection: The fusion protein was directly detected using anti-Strep-tag II antibody. GAPDH was also detected as an internal control to correct for differences in loading amount.

[0093] (8) Signal quantification: ImageJ and other software were used to perform grayscale analysis on the Western Blot bands and calculate the ratio of the target protein to the internal reference at each time point.

[0094] (9) Data Analysis and Half-Life Calculation: The relative protein expression level at 0 hours (before CHX treatment) was taken as 100%, and the relative remaining amount of protein at each time point was calculated. Protein degradation kinetic curves (time-relative protein amount) were plotted. The half-life (t1 / 2) of each FSH protein variant was calculated by fitting the curves using a single-phase exponential decay model, with the formula: t1 / 2 = ln(2) / k, where k is the degradation rate constant. Statistical analysis was performed using GraphPad Prism to compare the differences in half-life between each mutant and wild-type bFSH protein.

[0095] The results showed that the stability of the four FSH recombinant protein mutants was higher than that of the wild-type FSH recombinant protein, among which bFSH-β T9A -twin-strep-tag II (low-sugar FSH18), bFSH-β N24Q The stability of the -twin-strep-tag II protein mutant was significantly higher than that of the wild-type FSH recombinant protein. Figure 12 ).

Claims

1. A bovine FSH recombinant protein, characterized in that, Its amino acid sequence is shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.

4.

2. The gene encoding the bovine FSH recombinant protein as described in claim 1.

3. The gene as claimed in claim 2, characterized in that, The nucleotide sequence of the gene corresponds to SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO.

8.

4. A recombinant expression vector for expressing the bovine FSH recombinant protein as described in claim 1, characterized in that, It contains genes with nucleotide sequences such as those shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO.

8.

5. The recombinant expression vector as described in claim 4, characterized in that, The recombinant expression vector also carries a Strep-Tag II tag, and the recombinant expression vector is a PiggyBac transposon vector.

6. A cell line for expressing the bovine FSH recombinant protein as described in claim 1, characterized in that, The cell line contains the recombinant expression vector as described in claim 4 or 5.

7. A recombinant bacterium for expressing the bovine FSH recombinant protein as described in claim 1, characterized in that, The cell line contains the recombinant expression vector as described in claim 4 or 5.

8. A bovine FSH-derived PMD19-T vector, characterized in that, It contains genes with nucleotide sequences such as those shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO.

8.

9. A method for preparing bovine FSH recombinant protein, characterized in that, It includes the following steps: expressing the gene encoding the recombinant protein as described in claim 1 in a host bacterium or host cell to obtain a low-sugar FSH recombinant protein.

10. The method as described in claim 9, characterized in that, Using the Piggybac transposon system, recombinant vectors containing coding genes such as the Twin-Strep-Tag II tag gene were transfected into CHO suspension cell lines for recombinant protein expression. After 5-7 days, the supernatant was collected and the protein was purified using the Twin-Strep-Tag II tag gravity column purification system to obtain four low-glucose recombinant proteins.

Images