Application of GSDME gene SNP molecular marker in judging heat adaptation of dairy cows

Abstract

The application discloses application of a GSDME gene SNP molecular marker in judgment of heat adaptability of dairy cows and belongs to the technical field of animal molecular breeding. The GSDME gene SNP molecular marker is chr4:71097215A>G, a bovine reference genome ARS-UCD2.0; the SNP molecular marker gene polymorphism is A or G, and can be used for judgment of heat adaptability of dairy cows. The chr4:71097215A>G is a missense mutation subjected to positive selection, and the mutation causes a missense mutation (p.Tyr43Cys) of a pore-forming domain at the N terminal of a GSDME protein. The heat tolerance of a short-hair Holstein cow individual with the genotype GG of the molecular marker is significantly higher than that of individuals with the genotypes AA and AG. The marker is derived from a Senepol cow introgression region and subjected to positive selection, the detection method is simple and fast, is suitable for screening of heat-tolerant individuals and gene editing breeding practices, and has a clear biological background and breeding value.

Description

Technical Field

[0001] This invention relates to the field of animal molecular breeding technology, specifically to the application of GSDME gene SNP molecular markers in determining bovine heat fitness. Background Technology

[0002] High temperature and humidity environments can cause heat stress in dairy cows, severely impacting their health, reproductive efficiency, and milk production performance. Therefore, selecting dairy cow breeds with good heat adaptability is crucial for ensuring the profitability of dairy production. The short-haired Holstein cattle, a superior breed developed through multiple generations of backcrossing between ordinary Holstein cattle and the heat-resistant Senepol breed, exhibits low body temperature and high milk production under heat stress, providing important germplasm for heat-adaptive breeding. Traditional breeding methods are time-consuming and inefficient, while marker-assisted selection can significantly improve breeding accuracy and efficiency.

[0003] The genome of short-haired Holstein cattle still retains a small number of Senepol bovine genome fragments, i.e., introgression regions. Among these, the PRLR gene has been identified as being associated with heat tolerance. It is currently unknown whether other genes within these introgression regions are involved in the regulation of heat adaptation in dairy cows.

[0004] The protein encoded by the GSDME (Gasdermin E) gene is an important member of the Gasdermin family and is involved in the pyroptosis process. It plays an important role in the programmed cell death pathway, and its abnormal expression is closely related to a variety of diseases (tumors, inflammation, neurodegenerative diseases, etc.).

[0005] Currently, there are no reports on specific functional studies of GSDME genes or proteins in bovine taurus. Publicly available genomic data (such as Ensembl and NCBI) show that bovine GSDME homologs exist (e.g., ENSBTAG00000037678, encoding a Gasdermin-E-like protein), with sequences highly conserved with those in humans and mice (especially the N-terminal pore-forming domain). However, no experimental studies have been published on its function in bovine immunity, reproduction, mastitis, heat stress, or embryonic development. Bovine GSDME may be involved in inflammatory cell death (based on the conservation of the Gasdermin family in mammals), but the specific mechanisms, expression regulation, and association with economic traits (such as disease resistance) remain areas of research gaps. Summary of the Invention

[0006] The purpose of this invention is to provide the application of the GSDME gene SNP molecular marker in determining the heat adaptability of dairy cows. By detecting the genotype of this molecular marker, the heat adaptability of an individual cow can be determined, and then applied to assisted breeding.

[0007] The technical solution of this invention is as follows: In a first aspect, the present invention provides the application of the GSDME gene SNP molecular marker in determining the heat adaptability of dairy cows, wherein the SNP molecular marker is chr4:71097215A>G, bovine reference genome ARS-UCD2.0; the SNP molecular marker gene polymorphism is A or G.

[0008] The SNP molecular marker is located at position 126 of the sequence shown in SEQ ID NO:1.

[0009] Secondly, this invention provides the application of the GSDME gene SNP molecular marker in the breeding of heat-resistant dairy cows, wherein the SNP molecular marker is chr4:71097215A>G, bovine reference genome ARS-UCD2.0; the SNP molecular marker gene polymorphism is A or G; and the SNP molecular marker genotype with the highest heat adaptability in dairy cows is GG.

[0010] The methods for determining the heat adaptability of dairy cows include the following steps: (1) Extracting bovine genomic DNA; (2) Using the genomic DNA obtained in step (1) as a template, add amplification primer pairs to perform PCR amplification and obtain amplification products containing SNP molecular markers; (3) Sequencing of the amplified products revealed that the SNP molecular marker genotypes of individual dairy cows with high to low heat adaptability were GG, GA, and AA.

[0011] The primer pairs have nucleotide sequences such as SEQ ID NO:6~7, or SEQ ID NO:8~9, or SEQ ID NO:10~11.

[0012] Thirdly, this invention provides the application of a product for detecting GSDME gene SNP molecular markers in determining the heat adaptability of dairy cows or creating gene-edited heat-resistant dairy cows. The SNP molecular marker is chr4:71097215A>G, bovine reference genome ARS-UCD 2.0; the SNP molecular marker gene polymorphism is A or G; the SNP molecular marker genotype with the highest heat adaptability in dairy cows is GG; the product includes primer pairs.

[0013] Compared with the prior art, the present invention has the following beneficial effects: This invention utilizes genome resequencing technology to discover a positively selected missense mutation in the GSDME gene on chromosome 4 (chr4: 71097215A>G) in a gene introgression region of short-haired Holstein cattle. This mutation results in a missense mutation (p.Tyr43Cys) in the pore-forming domain at the N-terminus of the GSDME protein. Further research revealed a significant association between the GSDME gene chr4:71097215A>G site and bovine heat tolerance; Holstein cattle with the GG genotype exhibited significantly higher heat tolerance than dairy cattle with the AA or AG genotypes, providing a novel molecular marker for heat tolerance breeding. This molecular marker originates from the Senepol cattle introgression region and is subject to positive selection, possessing a clear biological background and breeding value. The detection method is simple and rapid, suitable for large-scale population screening and breeding practices. Attached Figure Description

[0014] Figure 1 : Distribution of gene introgression regions from Senepol cattle on different chromosomes in the genome of short-haired Holstein cattle, from left to right: chromosome 1, chromosome 2, chromosome 4 and chromosome 20.

[0015] Figure 2 : Analysis of selection signal (selection clearance statistic Fst) in the region where the GSDME gene is located on chromosome 4.

[0016] Figure 3 Electrophoresis diagram of PCR primers designed for the GSDME gene chr4:71097215A>G site; the electrophoresis diagram is divided into two rows, each row containing the amplification results of 3 sets of primers. Each lane from left to right represents: 2000bp DNA Marker, amplification products at annealing temperatures of 51℃, 53℃, 55℃, 57℃, 59℃, and 61℃, and template-free negative control (NC). The primer pairs labeled 1–6 in the figure are 6 pairs of specific primers. Primer pair 1 corresponds to upstream primer SEQ ID NO:2 and downstream primer SEQ ID NO:3; primer pair 2 corresponds to upstream primer SEQ ID NO:4 and downstream primer SEQ ID NO:5; primer pair 3 corresponds to upstream primer SEQ ID NO:6 and downstream primer SEQ ID NO:7; primer pair 4 corresponds to upstream primer SEQ ID NO:8 and downstream primer SEQ ID NO:9; primer pair 5 corresponds to upstream primer SEQ ID NO:10 and downstream primer SEQ ID NO:11; and primer pair 6 corresponds to upstream primer SEQ ID NO:12 and downstream primer SEQ ID NO:13.

[0017] Figure 4 Example of sequencing peak diagram of the GSDME gene chr4:71097215A>G site. Detailed Implementation

[0018] To enable those skilled in the art to better understand the present application, the present application will be clearly and completely described below with reference to embodiments and accompanying drawings. The described embodiments are merely some, not all, of the embodiments of the present application. Based on the embodiments of the present application, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present application. Unless otherwise specified, the instruments and reagents used in the embodiments are all from commercial sources.

[0019] Example 1: Population Sample Collection 1. DNA extraction from Holstein bovine blood (1) Sample collection and processing Blood samples were collected from short-haired Holstein, regular Holstein, and Senepol cattle using EDTA-K2 anticoagulant vacuum blood collection tubes (5 mL). The samples were immediately and gently inverted 8-10 times to mix. Whole blood samples were then transported to the field laboratory in an icebox at 4°C.

[0020] (2) Genomic DNA extraction and preservation Take 200 μL of anticoagulated whole blood and extract DNA according to the instructions of the DNA extraction kit (Tiangen DP348-03 kit). After concentration testing, the extracted product is aliquoted and stored at -20℃ for later use.

[0021] Whole-genome resequencing was performed on DNA samples. Quality control, sequence alignment, and whole-genome variant detection were conducted on the raw sequencing data. rIBD analysis was then performed, as shown in Figure 1, locating characteristic genetic regions of the genome. Fst selection signal analysis was performed on the target regions, as shown in Figure 2. Combined with Manhattan plot analysis, the GSDME gene, which was subjected to strong natural selection, was identified. Subsequently, variant sites in this gene were annotated and screened one by one. Finally, a missense mutation site chr4:71097215A>G, subjected to strong positive selection, was identified in exon 4 of the GSDME gene. This mutation results in a p.Tyr43Cys amino acid substitution in the N-terminal pore-forming domain of the GSDME protein.

[0022] Example 2: Identification of SNP molecular markers and primer design Based on the bovine reference genome (ARS-UCD2.0), a series of PCR primer pairs were designed using Premier 5.0 targeting the region in exon 4 of the GSDME gene on chromosome 4 containing the chr4:71097215A>G site. The results are shown in the table below. Table 1. Primer pair sequences and expected amplification product lengths used to amplify the region containing the chr4:71097215A>G site. Using the extracted genomic DNA as a template, temperature gradient PCR amplification was performed using the primer pairs in Table 1.

[0023] The amplification system consisted of 25 μL, including: 12.5 μL of 2×PCR Mix (Novizan P112-03), 1 μL each of forward and reverse primers, 2 μL of DNA template, and 8.5 μL of ddH2O.

[0024] The negative control system consisted of 25 μL, including: 12.5 μL of 2×PCR Mix, 1 μL each of forward and reverse primers, and 10.5 μL of ddH2O.

[0025] PCR reaction program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, followed by annealing at 51℃, 53℃, 55℃, 57℃, 59℃, and 61℃ for 30 s, and extension at 72℃ for 45 s, for a total of 35 cycles; final extension at 72℃ for 10 min, and storage at 4℃.

[0026] 5 μL of the product was taken out for electrophoresis, and the results are as follows: Figure 3 As shown. Through verification, primer pairs 3, 4, and 5, namely SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11, were determined to be suitable for SNP site amplification. The remaining sequence products were purified and sent for Sanger sequencing.

[0027] SEQ ID NO:6 and SEQ ID NO:7, the PCR amplified sequences are as follows: GTTGCCAAAGCAACACGAAATTTTCTTAAGGAAGTTGATGCTGGAGGTAACCTGATCGCAGTATCAAACTTGAATGACTCCGATAAATTACAACTTCTAAGTCTGGTGACCAAAAAAAAGAGAT A CTGGTGCTGGCAGAGACCCAAGTACCAGTTTTTATCTGTCACTCTTGGAGATGTACTCACAGAAGACCAGTTTCTGAGTCCAGGTATGTTTCTTTGGT, as shown in SEQ ID NO:1, where the italicized letter at position 126 is an SNP molecular marker with a polymorphism of A or G.

[0028] Based on the sequencing results of the chr4:71097215A>G site, individuals were classified into three genotypes: AA, AG, and GG.

[0029] Table 2. Allele frequencies at the chr4:71097215A>G locus in different cattle breeds Statistical results showed that no G allele was found in ordinary Holstein cattle, while Senepol cattle were mainly GG type. Therefore, the G allele in short-haired Holstein cattle originated from the infiltration of Senepol cattle.

[0030] Example 3: Association analysis between genotype and heat-adaptive phenotype 1. Rectal temperature data of 39 short-haired Holstein cattle (15 genotype AA, 11 genotype AG, and 13 genotype GG) were collected in summer. One-way ANOVA was performed and corrected by Tukey's method. P < 0.05 was considered statistically significant.

[0031] 2. The statistical results of rectal temperature in short-haired Holstein cattle of different genotypes are shown in Table 3 below: Table 3. Statistical results of rectal temperature in short-haired Holstein cattle of different genotypes In Table 3, different letters in the same column indicate significant differences (P < 0.05); the same letter or no letter in the same column indicates no significant differences (P > 0.05).

[0032] The statistical results above indicate that this SNP site of the GSDME gene is significantly associated with heat stress traits in Holstein cattle. Individuals with the GG genotype have significantly lower body temperatures under high-temperature conditions than those with the AA / AG genotype, suggesting stronger heat adaptability. Therefore, the G allele (especially the GG genotype) can serve as a molecular marker for excellent heat adaptability. This marker can be used for heat-adaptive-assisted breeding of cattle (especially Holstein cattle) to improve the production performance and health of the herd under high-temperature conditions.

[0033] This article uses specific examples to illustrate the inventive concept in detail. The description of the above embodiments is only for the purpose of helping to understand the core idea of ​​the present invention. It should be noted that any obvious modifications, equivalent substitutions or other improvements made by those skilled in the art without departing from the inventive concept should be included within the protection scope of the present invention.

Claims

1. The application of GSDME gene SNP molecular markers in determining the heat adaptability of dairy cows, characterized in that, The SNP molecular marker is chr4:71097215A>G, bovine reference genome ARS-UCD2.0; the SNP molecular marker gene polymorphism is A or G.

2. The application according to claim 1, characterized in that, The SNP molecular marker is located at position 126 of the sequence shown in SEQ ID NO:

1.

3. The application of GSDME gene SNP molecular markers in the breeding of heat-resistant dairy cows, characterized by: The SNP molecular marker is chr4:71097215A>G, bovine reference genome ARS-UCD2.0; the SNP molecular marker gene polymorphism is A or G; the SNP molecular marker genotype with the highest heat adaptability in dairy cows is GG.

4. The application according to any one of claims 1 to 3, characterized in that, The methods for determining the heat adaptability of dairy cows include the following steps: (1) Extracting bovine genomic DNA; (2) Using the genomic DNA obtained in step (1) as a template, add amplification primer pairs to perform PCR amplification and obtain amplification products containing SNP molecular markers; (3) Sequencing of the amplified products revealed that the SNP molecular marker genotype with the highest heat adaptability in individual dairy cows was GG.

5. The application according to claim 4, characterized in that, The primer pairs have nucleotide sequences such as SEQ ID NO:6~7, or SEQ ID NO:8~9, or SEQ ID NO:10~11.

6. The application of products detecting GSDME gene SNP molecular markers in determining the heat adaptability of dairy cows or creating gene-edited heat-resistant dairy cows, characterized in that... The SNP molecular marker is chr4:71097215A>G, bovine reference genome ARS-UCD2.0; the SNP molecular marker gene polymorphism is A or G; the SNP molecular marker genotype with the highest heat adaptability in dairy cows is GG; the product includes primer pairs.

7. The application according to claim 6, characterized in that, The primer pairs have nucleotide sequences such as SEQ ID NO:6~7, or SEQ ID NO:8~9, or SEQ ID NO:10~11.

Images