Methods and compositions for promoting non-natural amino acid-containing protein production

Abstract

To provide methods for generating cell lines for enhancing the production of non-natural amino acid containing proteins using genome engineering techniques, and to provide cells or cell lines.SOLUTION: There is provided a method for generating a cell line with reduced apoptosis for incorporation into a protein comprising a non-natural amino acid, the method comprising inactivating one or more target sites or regions within a cell or cell line, the one or more target sites or regions being pro-apoptotic genes involved in an apoptotic pathway, the pro-apoptotic genes being Bcl-2 family sites or regions, the cell or cell line expressing a gene of interest containing a selector codon and encoding the protein, and the cell or cell line comprising an orthogonal aminoacyl-tRNA synthetase (O-RS) and an orthogonal suppressor tRNA (O-tRNA).SELECTED DRAWING: Figure 8

Description

Detailed Description of the Invention

[0001] REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 62 / 514,754, entitled "Methods and Compositions for Promoting Non-Natural Amino Acid-Containing Protein Production," filed June 2, 2017, the entire contents of which are incorporated herein by reference.

[0002] [Sequence Listing] This application contains a Sequence Listing that was submitted in ASCII format via EFS-Web and is incorporated herein by reference in its entirety. The ASCII copy was created on May 29, 2018, is named AMBX_0223_PCT_SL.txt, and is 13,172 bytes in size.

[0003] [Technical field] The present disclosure relates to the fields of genome engineering and cell line engineering for producing unnatural amino acid containing polypeptides. The present invention relates generally to the field of cell line engineering, development, and production of unnatural amino acid containing polypeptides and proteins.

[0004] [Background technology] A breakthrough in the genetic production of proteins containing unnatural amino acids is the application of a chemically orthogonal directed engineering system in eukaryotic cells (EuCODE) (Feng et al, (2013), A general approach to site-specific antibody drug conjugates, PNAS 111(5): 1766-1771; Schultz et al, USPN 7,083,970, each of which is incorporated herein by reference). In recent years, this technology has made rapid progress in the field of antibody drug conjugates (ADCs) (see, e.g., U.S. Patent Application Publication Nos. 20150018530, 20150141624, 20150152187, and 20150152190, each of which is incorporated herein by reference). However, the more widespread application of unnatural amino acid-containing proteins in industry has been hindered by the relatively low yields in mammalian cells.

[0005] Observations have shown that a major factor that may be responsible for low yields of protein production may be induced apoptosis caused by excess uncharged tRNA in the system. As known in the art, apoptosis can be caused by various intrinsic or extrinsic factors in cell culture, including the production process. Another challenge that may contribute to low yields of protein production is cell stressors that can activate intrinsic apoptotic pathways during scale-up in bioreactor processes. Thus, there is a need in the industry for improved methods and compositions that promote and increase the production of unnatural amino acid-containing proteins. The present disclosure addresses these and other needs, as will be apparent from the following description.

[0006] Summary of the Invention Disclosed herein are methods and compositions for enhancing the production of unnatural amino acid containing proteins. Also disclosed herein are cells and cell lines for enhancing the production of unnatural amino acid containing proteins. In one embodiment, the present disclosure provides a method for making a cell line for incorporating an unnatural amino acid into a protein, the method comprising one or more sites or regions that can be targeted for inactivation in a cell expressing a gene of interest containing a selector codon, where the cell comprises an orthogonal aminoacyl-tRNA synthetase (O-RS) and an orthogonal suppressor tRNA (O-tRNA). In another embodiment, the cell or cell line is eukaryotic. In another embodiment, the cell or cell line is selected from COS, CHO, VERO, MDCK, WI38, V79, B14AF28-G3, BHK, HaK, NS0, SP2 / 0-Ag14, HeLa, or HEK293. In another embodiment, the cell or cell line is a transient, stable cell population or a stable clonal cell line. In another embodiment, the cell is an isolated cell. The isolated cells are for obtaining a protein that includes the unnatural amino acid.

[0007] In another embodiment, the invention includes a protein or polypeptide that incorporates an unnatural amino acid. In another embodiment, the unnatural amino acid is incorporated site-specifically. In another embodiment, the unnatural amino acid is para-acetylphenylalanine, p-nitrophenylalanine, p-sulfotyrosine, p-carboxyphenylalanine, O-nitrophenylalanine, m-nitrophenylalanine, p-boronylphenylalanine, o-boronylphenylalanine, m-boronylphenylalanine, p-aminophenylalanine, o-aminophenylalanine, m-aminophenylalanine, p-acylphenylalanine, o-acylphenylalanine, m-acylphenylalanine, p-OMephenylalanine, o-OMephenylalanine, m-OMephenylalanine, p-sulfophenylalanine, o-sulfophenylalanine, m-sulfophenylalanine, 5-nitroHis, 3-nitroTyr, 2-nitroTyr, nitro substituted Leu, nitro substituted His, nitro substituted De, nitro substituted Trp, 2-nitroTrp, 4-nitroTrp, 5-nitroTrp, 6-nitroTrp, 7-nitroTrp , 3-aminotyrosine, 2-aminotyrosine, O-sulfotyrosine, 2-sulfooxyphenylalanine, 3-sulfooxyphenylalanine, O-carboxyphenylalanine, m-carboxyphenylalanine, p-acetyl-L-phenylalanine, p-propargyl-phenylalanine, O-methyl-L-tyrosine, L-3-(2-naphthyl)alanine, 3-methyl-phenylalanine, O-4-allyl-L-tyrosine, 4-propyl-L-tyrosine, tri-O-acetyl-Gly lcNAcβ-serine, L-Dopa, fluorinated phenylalanine, isopropyl-L-phenylalanine, p-azido-L-phenylalanine, p-acyl-L-phenylalanine, p-benzoyl-L-phenylalanine, L-phosphoserine, phosphonoserine, phosphonotyrosine, p-iodo-phenylalanine, p-bromophenylalanine, p-amino-L-phenylalanine, isopropyl-L-phenylalanine, or p-propargyloxy-phenylalanine.

[0008] In some embodiments of the invention, the unnatural amino acid is selected from O-methyl-L-tyrosine, L-3-(2-naphthyl)alanine, 3-methyl-phenylalanine, O-4-allyl-L-tyrosine, 4-propyl-L-tyrosine, p-propargyloxy-L-phenylalanine, tri-O-acetyl-GlcNAc β-serine, L-Dopa, fluorinated phenylalanine, isopropyl-L-phenylalanine, p-azido-L-phenylalanine, p-acyl-L-phenylalanine, p-benzoyl-L-phenylalanine, L-phosphoserine, phosphonoserine, phosphonotyrosine, p-iodo-phenylalanine, p-bromophenylalanine p-amino-L-phenylalanine, or isopropyl-L-phenylalanine.

[0009] In other embodiments, the invention provides a gene of interest or a gene of interest containing a selector codon. The selector codon is a nonsense codon, a rare codon, or a four-base codon. In another embodiment, the selector codon comprises an ochre codon, an opal codon, or an amber codon. In certain embodiments, the selector codon is an amber codon.

[0010] In an embodiment of the invention, the gene of interest or the gene of interest containing a selector codon is a biological therapeutic gene or biological therapeutic product, including a vaccine or an antibody. The gene of interest or the gene of interest containing a selector codon is an antibody, an scFv, an scFv fusion protein, an Fc fusion protein, factor VII, factor VIII, or factor IV. In another embodiment, the gene of interest or the gene of interest containing a selector codon is a cytokine, an interleukin, an interferon, a chemokine, a growth factor, a hormone, and their receptors, analogs, bispecifics, or fragments thereof. In another embodiment, the gene of interest is HER2, CD-70, PSMA, 5T4, EGFR, TROP2, CD3, IL-2, IL-3, IL-10, IL-15, GPC3, DLL3, ROR1, leptin, FGF-21, FGF-23, HGH, FcR, insulin, TNFR1, TRAIL, EPO, and their analogs, bispecifics, or fragments thereof. In other embodiments, the gene of interest or the gene of interest containing a selector codon is a cytokine, growth factor, growth factor receptor, interferon, interleukin, inflammatory molecule, oncogene product, peptide hormone, signaling molecule, steroid hormone receptor, erythropoietin (EPO), insulin, human growth hormone, alpha-1 antitrypsin, angiostatin, antibody, apolipoprotein, apoprotein, atrial natriuretic factor, atrial peptide, cXc chemokine, T39765, NAP-2, ENA-78, Gro-a, Gro-b, Gro-c, IP-10, GCP-2, NAP-4, SDF-1, PF4, MIG, calcitonin, c-kit ligand, cytokines, CC chemokine, monocyte chemoattractant protein-1, monocyte chemoattractant protein-2, monocyte chemoattractant protein-3, monocyte inflammatory protein-1α, monocyte inflammatory protein-1β, RANTES, I309, R83915, R91733, HCC1, T58847, D31065, T64262, CD40, CD40 ligand, c-Kit ligand, collagen, colony-stimulating factor (CSF), complement factor 5a, complement inhibitor, complement receptor 1, cytokines, DHFR, epithelial neutrophil-activating peptide-78,Groα / MGSA, Groβ, Groγ, MIP-1α, MIP-1δ, MCP-1, epidermal growth factor (EGF), epidermal neutrophil activating peptide, erythropoietin (EPO), exfoliative toxin, factor IX, factor VII, factor VIII, factor X, fibroblast growth factor (FGF), fibrinogen, G-CSF, GM-CSF, glucocerebrosidase, gonadotropins, growth factors, growth factor receptors, hedgehog proteins, hemoglobin, hepatocyte growth factor (HGF), hirudin, human serum albumin, ICAM -1, ICAM-1 receptor, LFA-1, LFA-1 receptor, insulin, insulin-like growth factor (IGF-1), IGF-I, IGF-II, interferon, IFN-α, IFN-β, IFN-γ, interleukin, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, keratinocyte growth factor (KGF), lactoferrin, leukemia inhibitory factor, luciferase, neurturin, neutrophil inhibitory factor (NIF), oncostatin M, bone morphogenetic protein, oncogene product, parathyroid hormone, PD-ECSF, PDGF, peptide hormone, human growth hormone, pleiotropin, protein A, protein G, streptococcal pyrogen exotoxin A, B or C, relaxin, renin, SCF, soluble complement receptor I, soluble I-CAM 1, soluble interleukin receptor, soluble TNF receptor, somatomedin, somatostatin, somatotropin, streptokinase, superantigen, staphylococcal enterotoxin, SEA, SEB, SEC1, SEC2, SEC3, SED, SEE, steroid hormone receptor, superoxide dismutase (SOD), toxic shock syndrome toxin, thymosin alpha 1, tissue plasminogen activator, These include transforming growth factor (TGF), TGF-α, TGF-β, tumor necrosis factor, tumor necrosis factor α, tumor necrosis factor β, tumor necrosis factor receptor (TNFR), VLA-4 protein, VCAM-1 protein, vascular endothelial growth factor (VEGEF), urokinase, Mos, Ras, Raf, Met, p53, Tat, Fos, Myc, Jun, Myb, Rel, estrogen receptor, progesterone receptor, testosterone receptor, aldosterone receptor, LDL receptor, SCF / C-kit, CD40L / CD40, VLA-4 / VCAM-1, ICAM-1 / LFA-1, hyaluronidase / CD44, and corticosterone.

[0011] In other embodiments, the invention provides one or more sites or regions targeted for inactivation, excision, disruption or knockout, wherein the one or more sites or regions targeted for inactivation are GS, Bcl-2, IGFBP4, AQP1, Maf1, eRF1, FUT8, P53, caspase-3, UPF1, Smg1, Smac / DIABLO, Apaf-1, caspase-6, caspase-7, caspase-9, caspase-10, PARP, alpha fodrin, NuMA, AIF, CAD, Puma, Noxa, 14-3-3, Aven, Myc, or HtrA2 / Omi.

[0012] In one embodiment, the site or region targeted for inactivation is an exogenous selectable marker gene. In another embodiment, the selectable marker gene is Zeocin, hygromycin, or puromycin. In another embodiment, the site or region targeted for inactivation is a Bcl-2 site or region. In another embodiment, the site or region targeted for inactivation is Bax or Bak. In other embodiments, the site or region targeted for inactivation is fully or partially inactivated. Partially inactivated, destroyed, knocked out, or ablated sites or regions were 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51% , 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% of the inactivated, disrupted, knocked out or ablated sites or regions.

[0013] In another embodiment, the invention provides a cell or cell line for incorporating an unnatural amino acid into a protein, where the cell expresses a gene of interest containing a selector codon, the gene of interest comprises an orthogonal aminoacyl-tRNA synthetase (O-RS) and an orthogonal suppressor tRNA (O-tRNA), and the cell comprises one or more sites or regions targeted for inactivation.

[0014] In another embodiment, the invention provides a cell or cell line for incorporating an unnatural amino acid into a protein, comprising an orthogonal aminoacyl-tRNA synthetase (O-RS), an orthogonal suppressor tRNA (O-tRNA), wherein the cell comprises one or more sites or regions targeted for inactivation.

[0015] In other embodiments, the invention provides a cell or cell line expressing a gene of interest, wherein the cell comprises an orthogonal aminoacyl-tRNA synthetase (O-RS), an orthogonal suppressor tRNA (O-tRNA), and the cell comprises one or more sites or regions targeted for inactivation.

[0016] In another embodiment, the invention provides a method of decreasing or reducing apoptosis in a cell comprising an orthogonal aminoacyl-tRNA synthetase (O-RS) and an orthogonal suppressor tRNA (O-tRNA), comprising targeting to inactivate one or more pro-apoptotic sites or regions in the cell. In another embodiment, the invention provides a cell or cell line for decreasing or reducing apoptosis in the cell or cell line.

[0017] In another embodiment, the invention provides a method of generating a cell for incorporating an unnatural amino acid into a protein, comprising providing a nucleic acid molecule capable of inactivating one or more sites or regions targeted for inactivation in a cell expressing a gene of interest containing a selector codon, and introducing the nucleic acid molecule into a cell expressing the gene of interest containing a selector codon, the nucleic acid molecule comprising an orthogonal aminoacyl-tRNA synthetase (O-RS) and an orthogonal suppressor tRNA (O-tRNA). In another embodiment, the nucleic acid molecule is selected from SEQ ID NOs: 1-42. In another embodiment, the nucleic acid molecule inactivates one or more sites or regions targeted for inactivation. In one other embodiment, the one or more sites or regions targeted for inactivation are the same or different.

[0018] In another embodiment, the invention provides a method or a cell or cell line for improving the yield of a protein or polypeptide that incorporates an unnatural amino acid. In some embodiments, the cells are transient, stable cell populations or stable clonal cells. In another embodiment, the invention provides a method for reducing or decreasing apoptosis in a cell. In another embodiment, the invention provides a method for improving the yield of a protein or polypeptide that incorporates an unnatural amino acid site-specifically.

[0019] In another embodiment, the invention provides a method of generating a cell line comprising an unnatural amino acid, comprising providing a cell line that comprises an orthogonal aminoacyl-tRNA synthetase (O-RS) and an orthogonal suppressor tRNA (O-tRNA) and expresses a gene of interest that contains a selector codon, introducing into the cell a nucleic acid molecule capable of inactivating one or more target sites in the cell, and providing the cell with the unnatural amino acid.

[0020] In other embodiments, the invention provides methods of producing a cell for incorporating an unnatural amino acid into a protein, comprising providing a nucleic acid molecule capable of inactivating one or more sites or regions targeted for inactivation in a cell, and introducing the nucleic acid molecule into a cell that comprises an orthogonal aminoacyl-tRNA synthetase (O-RS) and an orthogonal suppressor tRNA (O-tRNA).

[0021] In another embodiment, the present invention provides an isolated cell or cell line according to any one of the claims. In another embodiment, the present invention provides a method for obtaining a stable cell or cell line comprising an orthogonal aminoacyl-tRNA synthetase (O-RS) and an orthogonal suppressor tRNA (O-tRNA). In another embodiment, the stable cell or cell line is a platform or production cell or cell line.

[0022] In another embodiment, the invention provides a method for optimizing the development of a production cell line comprising an orthogonal aminoacyl-tRNA synthetase (O-RS) and an orthogonal suppressor tRNA (O-tRNA). In another embodiment, the invention provides an isolated polypeptide comprising an unnatural amino acid. In another embodiment, the invention provides a cell or cell line that provides a yield of an unnatural amino acid-containing protein that is at least 0.5-fold greater than if one or more sites or regions targeted for inactivation in the cell were not inactivated.

[0023] In one embodiment of the present invention, one or more engineered nucleic acid molecules are introduced into the cell line. One or more engineered nucleic acid molecules can include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more engineered nucleic acid molecules. In other embodiments, one or more engineered nucleic acid molecules are derived from the same or different target sites or regions. In some embodiments, engineered nucleic acid molecules can include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more engineered nucleic acid molecules from the same target site or region in a cell. In some embodiments, engineered nucleic acid molecules can include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more engineered nucleic acid molecules from different target sites or regions.

[0024] In other embodiments, polynucleotides that recognize one or more sites or regions targeted for inactivation, excision, knockout or destruction in a cell can include polynucleotides that recognize 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more sites or regions.

[0025] In other embodiments, a cell or cell line is provided. In certain embodiments, a stable production cell line is provided. In other embodiments, the cell or cell line is a eukaryotic cell or cell line. In other embodiments, the eukaryotic cell or cell line may include, but is not limited to, any of, for example, mammalian cells, yeast cells, fungal cells, plant cells, and insect cells. In some embodiments, the eukaryotic cell or cell line is a vertebrate cell or cell line. In some embodiments, the eukaryotic cell or cell line is a mammalian or human cell or cell line. In other embodiments, the cell or cell line may include, but is not limited to, COS, CHO (e.g., CHO-S, CHO-K1, CHO-DG44, CHO-DUXB11, CHO-DUKX, CHOK1SV), VERO, MDCK, WI38, V79, B14AF28-G3, BHK, HaK, NS0, SP2 / 0-Ag14, HeLa, or HEK293 (e.g., HEK293-F, HEK293-H, HEK293-T) cells or cell lines. In other embodiments, the cell or cell line is a CHO cell or cell line, including, for example, CHO-S, CHO-K1, CHO-DG44, CHO-DUXB11, CHO-DUKX, CHOK1SV. In other embodiments, the cell or cell line is a CHO-K1, MDCK, or HEK293 cell or cell line. In a particular embodiment, the cell or cell line is a CHO-K1 cell or cell line.

[0026] In other embodiments, optimizing or enhancing or increasing or improving the yield of a non-natural amino acid containing polypeptide or protein can include optimizing or enhancing or increasing or improving the yield by at least 0.5-fold, at least 1-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold or more in the absence of a nucleic acid molecule comprising a polynucleotide that recognizes one or more sites or regions targeted for inactivation, excision, disruption or knockout.

[0027] In another embodiment, the invention provides a vaccine produced by any of the methods and cells disclosed herein.

[0028] BRIEF DESCRIPTION OF THE DRAWINGS The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings, in which:

[0029] (Figure 1) Panels A and B. Strategies for utilizing platform cell lines in industry and pharmaceutical companies to produce unnatural amino acid containing proteins. Figure 1 shows the important role of using platform cell lines in industry (Figure 1A) and pharmaceutical companies (Figure 1B).

[0030] (Figure 2) General procedure for utilizing platform cell lines in the development of high-producing cell lines.

[0031] (Figure 3) Panels A, B, C. Strategies for optimizing the development of high-producing cell lines. Figure 3 shows the optimization of high-producing cell line development from several aspects, such as FACS-dependent single-cell deposition (Figure 3A), CRISPR knockout (Figure 3B), and cell line development process optimization (Figure 3C).

[0032] (Figure 4) Panels A and B. Observation of apoptosis in cells derived from platform cell line 4E2. The viability of CHO-S cells (Figure 4A) and platform cell line 4E2 (Figure 4B), which contain genetically engineered orthogonal paired tRNA / aminoacyl-tRNA synthetase specifically incorporating para-acetyl-L-phenylalanine, was assessed by Annexin V assay. As shown in Figure 4, 4E2 showed excessive apoptosis (85% viability) compared to CHO-S cells (96% viability).

[0033] (Figure 5) CRISPR gRNA design of target BAX gene in CHO cells. Figure 5 shows the genomic DNA sequence of BAX gene in CHO cells annotated with three gRNA sequences. The genomic DNA sequence of BAX gene, exon 1 and exon 2 are shown in grey shading. Other sequences of BAX are shown in normal letters. Primers used in PCR and sequencing are shown at the beginning and end of the sequence as forward and reverse primers, respectively.

[0034] (Figure 6) CRISPR gRNA design of targeting BAK gene in CHO cells. Figure 6 shows the genomic DNA sequence of BAK gene in CHO cells annotated with two gRNA sequences. The genomic DNA sequence of BAK gene, exon 2 and exon 3 are shown in grey shading. Other sequences of BAK are shown in normal letters. Primers used in PCR and sequencing are shown at the beginning and end of the sequence as forward and reverse primers, respectively.

[0035] (Figure 7) BAX or BAK CRISPR construct. Figure 7 shows the design of CRISPR plasmid used in BAX or BAK knockout experiments. Geneart CRISPR nuclease vector (pGCNV) is a commercially available vector from Thermo Fisher scientific (San Diego, CA). The completed form of pGCNV plasmid is prepared by inserting oligo duplexes into the cut open pGCNV vector, which contains a slot for oligo duplexes designed with a specific 19 nucleotide long gRNA sequence to target gene sites individually (see Table 1 herein).

[0036] (FIG. 8) Structures of representative unnatural amino acids of the invention.

[0037] (FIG. 9) Surveyor assay of anti-HER2 expressing cell populations with BAX or BAK knockout using CRISPR. FIG. 9 shows Surveyor assay analysis of knockout efficiency during BAX or BAK knockout using CRISPR. Shrinkage of the top band and appearance of a new band at the bottom indicates the efficiency, which can be quantified by densitometric analysis of the scanned image with Image J software. The ratio of the original band before and after CRISPR knockout (KO) was used to measure knockout efficiency. Knockout efficiencies for BAX and BAK were 30% and 70%, respectively, resulting in a double knockout efficiency of approximately 21% as calculated.

[0038] (Figure 10) DNA analysis of anti-HER2 expressing single cell clones with BAX and BAK genes knocked out using CRISPR. Figure 10 shows the DNA sequencing results of 20 single cell clones after BAK knockout using CRISPR. The top DNA sequence (Bak-CHO-gDNA1) is the DNA sequence of the genomic region of the original BAK gene. Only the "ZA_112_K32_BakI-II" clone has a sequence identical to the original BAK gene. The other genes shown in the figure have either deletions or insertions in the sequence.

[0039] (Figure 11) Western blot analysis of BAX knockout confirmation in anti-HER2 expressing BAX knockout cloning using CRISPR. BAX is a 21-KD protein that shows as a band in L082 cells that do not have gene knockout and express wild-type BAX protein. Other clonings did not show detectable expression of BAX protein, except for cloning UBB3, which showed residual BAX expression.

[0040] (Figure 12) Panels A and B. Apoptosis analysis of anti-HER2 expressing BAX / BAK knockout cell lines. Figure 12 shows Annexin V apoptosis analysis of parental cell line L082 (Figure 12A) and BAX / BAK double knockout cell line BB15 (Figure 12B). As shown in the table, cell viability is improved from 40% to 80% after BAX and BAK knockout. At the same time, apoptotic cells are reduced from 53% to 17%.

[0041] (FIG. 13) Panels A-D. Enhanced anti-HER2 antibody production in BAX / BAK knockout cell lines in bulk culture. FIG. 13 shows changes in protein production in BAX / BAK double knockout cell lines. Protein production is analyzed during bulk production. Viable cell density (VCD, FIG. 13A). Cell viability (FIG. 13B). During bulk production (day 7), the BAX / BAK double knockout cell line showed an increase in titer from 150 mg / L to 270 mg / L (FIG. 13C). Specific productivity (Qp) (FIG. 13D).

[0042] (FIG. 14) Panels A-D. Enhancement of anti-HER2 antibody production in BAX / BAK knockout cell line in fed-batch culture. FIG. 14 shows the change in protein production in BAX / BAK double knockout cell line. Protein production is analyzed during fed-batch production. Viable cell density (VCD, FIG. 14A). Cell viability (FIG. 14B). During fed-batch production (day 14), the BAX / BAK double knockout cell line shows an increase in titer from 450 mg / L to 1500 mg / L (FIG. 14C). Specific productivity (Qp) (FIG. 14D).

[0043] (FIG. 15) Surveyor assay of anti-PSMA expressing cell populations with BAX or BAK knockout using CRISPR. FIG. 15 shows Surveyor assay analysis of knockout efficiency during BAX or BAK knockout using CRISPR. The ratio of original bands before and after CRISPR knockout (KO) was quantified by densitometric analysis of scanned images with Image J software and used to measure knockout efficiency. Knockout efficiency for BAX and BAK was 42% and 53%, respectively, resulting in a double knockout efficiency of approximately 20% as calculated.

[0044] (FIG. 16) Panels A and B. Western blot analysis of BAX and BAK knockout confirmation in anti-PSMA expressing clones. BAX knockout confirmation in anti-PSMA expressing clones using CRISPR (FIG. 16A). BAK knockout confirmation in anti-PSMA expressing clones (FIG. 16B). Controls are L082 cells expressing wild type BAX protein, a band at 21-KD, and anti-HER2-BAX / BAK double knockout expressing BB15 cells.

[0045] (FIG. 17) Apoptosis analysis of BAX / BAK knockout anti-PSMA expressing cell lines. FIG. 17 shows Annexin V apoptosis analysis of BAX / BAK double knockout cell lines PSMA-192 and PSMA 719 with approximately 85% cell viability compared to approximately 35-37% in single KO clones (PSMA-882) or non-knockout clones (PSMA-484).

[0046] (FIG. 18) Panels A-C. Enhancement of anti-PSMA antibody production in BAX / BAK knockout cell lines in fed-batch culture. FIG. 18 shows the change in protein production in BAX / BAK double knockout cell lines (e.g., cell line PSMA-BBKO-192). Protein production is analyzed during fed-batch production. Viable cell density (VCD, FIG. 18A). Cell viability (FIG. 18B). During fed-batch production (day 14), the BAX / BAK double knockout cell line showed an increase in titer from 500 mg / L to 1400 mg / L (FIG. 18C).

[0047] (FIG. 19) Surveyor assay of anti-CD70 expressing cell populations with BAX or BAK knockout using CRISPR. FIG. 19 shows Surveyor assay analysis of knockout efficiency during BAX or BAK knockout using CRISPR. The ratio of original bands before and after CRISPR knockout (KO) was quantified by densitometric analysis of scanned images with Image J software and used to measure knockout efficiency. Knockout efficiency for BAX and BAK was 51% and 23%, respectively, resulting in a double knockout efficiency of approximately 10% as calculated.

[0048] (Figure 20) Panels A and B. Western blot analysis of BAX and BAK knockout confirmation in anti-CD70 expressing clones. BAX knockout confirmation in anti-CD70 expressing clones (Figure 20A). BAK knockout confirmation in anti-CD70 expressing clones (Figure 20B). Controls are L082 cells expressing wild type BAX protein, 21-KD band, and BAK wild type protein, 24-KD band.

[0049] (FIG. 21) Apoptosis analysis of BAX / BAK knockout anti-CD70 expressing cell lines. FIG. 21 shows that in an Annexin V apoptosis assay of BAX / BAK double knockout cell lines (e.g., CD70-BBKO-563), cell viability increased from 18% to 60% compared to the parental cell line, CD70-MW-108. Assay apoptotic cells decreased from 80% to 40%.

[0050] (Figure 22) Panels A-C. Enhanced anti-CD70 antibody production of BAX / BAK knockout cell lines in fed-batch culture. Figure 22 shows the production status of BAX / BAK double knockout anti-CD70 expressing cell lines in shake flasks and benchtop bioreactors. Viable cell density (VCD, Figure 22A). Cell viability (Figure 22B). BAX / BAK double knockout cell lines (e.g., CD70-BBKO-563) show high titers of 1000 mg / L. (Figure 22C) Detailed Description Before describing the invention in detail, it should be understood that the invention is not limited to specific methodologies, or compositions, or biological systems, which can, of course, vary. It should also be understood that the terms used herein are for the purpose of describing particular embodiments only, and are not intended to be limiting. As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless expressly indicated otherwise. Thus, for example, reference to a "cell" includes a combination of two or more cells, and the like.

[0051] Although preferred embodiments of the present invention have been disclosed and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Numerous changes, modifications, and substitutions may be made by those skilled in the art without departing from the present invention. It is apparent that various alternatives may be employed to implement the present invention in the embodiments of the present invention described herein. The appended claims define the scope of the present invention, and are intended to cover such methods and structures within the scope of the claims and their equivalents.

[0052] Unless defined otherwise below, either herein or hereinafter, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0053] [Definition] The term "nucleic acid" as used herein refers to deoxyribonucleotides, deoxyribonucleosides, ribonucleosides or ribonucleotides, and their polymers in either single-stranded or double-stranded form.By way of example only, such nucleic acids and nucleic acid polymers include (i) analogs of natural nucleotides that have similar binding properties as reference nucleic acids and are metabolized in a manner similar to naturally occurring nucleotides; (ii) oligonucleotide analogs, including but not limited to PNA (peptide nucleic acid), analogs of DNA used in antisense technology (phosphorothioates, phosphoramidates, etc.); (iii) conservatively modified variants of said nucleic acids (including but not limited to degenerate codon substitutions), and complementary sequences and sequences explicitly shown. By way of example, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (Batzer et al, Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al, J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al, Mol. Cell. Probes 8:91-98 (1994)).

[0054] The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. That is, a description of a polypeptide applies equally to a description of a peptide and a description of a protein, and vice versa. The term applies to naturally occurring amino acid polymers as well as to amino acid polymers in which one or more amino acid residues are unnatural amino acids. Furthermore, such "polypeptides", "peptides" and "proteins" include amino acid chains of any length, including full-length proteins, in which the amino acid residues are linked by covalent peptide bonds.

[0055] As used herein, the term "orthogonal" refers to a molecule (e.g., an orthogonal tRNA (O-tRNA) and / or an orthogonal aminoacyl-tRNA synthetase (O-RS)) that functions with endogenous components of a cell. The molecule functions with a lower efficiency compared to a corresponding molecule that is endogenous to a cell or translation system or does not function with endogenous components of a cell. When referring to tRNA and aminoacyl-tRNA synthetase, orthogonal refers to an inactive or reduced efficiency of an orthogonal tRNA that functions with an endogenous tRNA synthetase compared to an endogenous tRNA that functions with an endogenous tRNA synthetase, or an endogenous tRNA synthetase that functions with an endogenous tRNA compared to an orthogonal aminoacyl-tRNA that functions with an endogenous tRNA. The efficiency may, for example, be less than 20%, less than 10%, less than 5%, or less than 1%. An orthogonal molecule lacks a functional endogenous complementary molecule in a cell. For example, the orthogonal tRNA in a cell is aminoacylated by any endogenous RS of the cell with reduced or zero efficiency when compared to the aminoacylation of the endogenous tRNA by the endogenous RS. In another example, the orthogonal RS aminoacylates any endogenous tRNA in a cell of interest with reduced or zero efficiency when compared to the aminoacylation of the endogenous tRNA by the endogenous RS. A second orthogonal molecule can be introduced into the cell to function with the first orthogonal molecule. For example, the orthogonal tRNA / RS pair includes an introduced complementary component that functions with the efficiency of the corresponding tRNA / RS endogenous pair (e.g., 50% efficiency, 60% efficiency, 70% efficiency, 75% efficiency, 80% efficiency, 90% efficiency, 95% efficiency, or 99% or more efficiency).

[0056] The term "selector codon" refers to a codon that is recognized by the O-tRNA in the translation process, but not by an endogenous tRNA. The O-tRNA anticodon loop recognizes the selector codon on the mRNA and incorporates said amino acid (e.g., an unnatural amino acid) at the site of the anticodon loop in the polypeptide. Selector codons can include, for example, nonsense codons that are stop codons, such as amber, ochre, and opal codons, four or more base codons, rare codons, codons derived from natural or unnatural base pairs and / or analogs.

[0057] The term "suppressor tRNA" refers to a tRNA that alters the reading of a messenger RNA (mRNA) in a given translation system, e.g., by providing a mechanism for incorporating an amino acid into a polypeptide chain in response to a selector codon. By way of example, a suppressor tRNA can read through, e.g., a stop codon, a four-base codon, a rare codon, etc.

[0058] The term "translation system" refers to a collection of components that incorporate naturally occurring amino acids into a growing polypeptide chain (protein). Elements of a translation system can include, for example, ribosomes, tRNAs, synthetases, mRNAs, amino acids, etc. Components of the invention (e.g., ORS, OtRNAs, unnatural amino acids, etc.) can be added to in vitro or in vivo translation systems, e.g., eukaryotic cells, vertebrate cells, e.g., yeast cells, mammalian cells, plant cells, algae cells, fungal cells, insect cells, etc.

[0059] The term "amino acid" refers to naturally occurring and non-naturally occurring amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to naturally occurring amino acids. Naturally encoded amino acids are the 20 common amino acids (alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine) as well as pyrrolysine and selenocysteine. Amino acid analogs refer to compounds that have essentially the same chemical structure as naturally occurring amino acids, and by way of example only, refer to the α-carbon that is bonded to hydrogen, carboxyl group, amino group, and R group. Such analogs may have modified R groups (e.g., norleucine) or may have modified peptide backbones while still retaining the same group chemical structure as naturally occurring amino acids. Amino acid analogs include, but are not limited to, homoserine, norleucine, methionine sulfoxide, and methionine methylsulfonium.

[0060] In amino acid sequences, individual substitutions, additions or deletions to nucleic acids in encoded sequences, substitutions to peptide, polypeptide or protein sequences, additions or deletions of single natural and non-natural amino acids in encoded sequences, or a percentage of natural and non-natural amino acids are "conservatively modified variants" where the changes result in the deletion of an amino acid, the addition of an amino acid, or the substitution of natural and non-natural amino acids with chemically similar amino acids. Conservative substitution tables showing functionally similar natural amino acids are known in the art. The conservatively modified variants are in addition to, and do not exclude, polymorphic variants, interspecies homologs, and alleles of the methods and compositions described herein.

[0061] Conservative substitution tables providing functionally similar amino acids are known in the art. Each of the following eight groups contains one or more conservatively substituted amino acids: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) arginine (R), lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); 6) phenylalanine (F), tyrosine (Y), tryptophan (W); 7) Serine (S), Threonine (T) 8) Cysteine ​​(C), Methionine (M); (See, e.g., Creighton, Proteins: Structures and Molecular Properties (WH Freeman & Co.; 2nd edition (December 1993).) As used herein, the term "unnatural amino acid" refers to an amino acid other than the 20 common amino acids or pyrrolysine or selenocysteine. Other terms that may be used synonymously with the term "unnatural amino acid" are "non-naturally encoded amino acids", "unnatural amino acids", "non-naturally occurring amino acids", and various conjugates and non-conjugates thereof. The term "unnatural amino acid" includes, but is not limited to, amino acids that occur naturally by modification of naturally encoded amino acids (including, but not limited to, the 20 common amino acids or pyrrolysine and selenocysteine) and are not incorporated into elongated polypeptide chains by the translation complex. Examples of non-naturally encoded, naturally occurring amino acids include, but are not limited to, N-acetylglucosaminyl-L-serine, N-acetylglucosaminyl-L-threonine, and O-phosphotyrosine. Additionally, the term "unnatural amino acid" includes, but is not limited to, amino acids that do not occur in nature and can be obtained synthetically or by modification of unnatural amino acids. Note that the reactive groups in unnatural amino acids are not available from the functional groups present in the 20 canonical amino acids, and therefore can be used to specifically and uniformly modify polypeptide sites.

[0062] The term "antibody" as used herein includes, but is not limited to, a polypeptide substantially encoded by an immunoglobulin gene or multiple immunoglobulin genes, or fragments thereof, that specifically binds to and recognizes an analyte (antigen). Examples include polyclonal antibodies, monoclonal antibodies, chimeric antibodies, and single chain antibodies. Fragments of immunoglobulins, including Fab fragments, and fragments produced by expression libraries, including phage display, are also included in the term "antibody" as used herein. For antibody structure and terminology, see, for example, Paul, Fundamental Immunology, 4th Ed., 1999, Raven Press, New York. An antibody fragment refers to any form of an antibody other than the full-length form. Antibody fragments herein include antibodies that are smaller components present in a full-length antibody, and engineered antibodies. Antibody fragments include, but are not limited to, Fv, Fc, Fab, and (Fab')2, single chain Fv (scFv), dimers, trimers, tetramers, bifunctional hybrid antibodies, CDR1, CDR2, CDR3, combinations of CDRs, variable regions, framework regions, constant regions, heavy chains, light chains, and variable regions, as well as alternative scaffold non-antibody molecules, bispecific antibodies, etc. (Maynard & Georgiou, 2000, Annu. Rev. Biomed. Eng. 2:339-76; Hudson, 1998, Curr. Opin. Biotechnol. 9:395-402). Another functional structure is the single chain Fv (scFv), which consists of the variable regions of immunoglobulin heavy and light chains covalently linked by a peptide linker (Sz Hu et al, 1996, Cancer Research, 56, 3055-3061). These small (molecular weight 25,000) proteins generally retain their specificity and affinity for an antigen in a single polypeptide and can provide convenient building blocks for larger antigen-specific molecules. Unless otherwise specified, the description and claims using the term "antibody" or "antibodies" specifically include "antibody fragments" and "antibody fragments."

[0063] The term "isolated" as used herein refers to the separation and removal of a cell or clone from a homogeneous or heterogeneous cell line. In an embodiment of the present invention, the term isolated includes isolated or single cells obtained from a cell line or cell population. A cell or clone may be selected over other cell lines or cloning populations by culturing in a medium that provides some selective advantage to the desired cell or clone of interest. For example, in a given cell culture, a particular cell type may be enriched by adding specific growth factors and cytokines. This may include enriching populations of a particular lineage and differentiation stage to obtain a desired cell or clone, and using selective media by antibiotics or specific growth inhibitors, or combinations of such selections as known to those skilled in the art, that allow certain cells to grow and inhibit the growth of other cells. For example, selective media are often used to isolate transfected cells. Common antibiotics used for mammalian cell selection include, but are not limited to, bleomycin, puromycin, and hygromycin. The term "isolated" as used herein also refers to the separation and removal of components of interest from components that are not of interest. An isolated material may be in either a dry or semi-dry state, or may be in solution (including, but not limited to, an aqueous solution). An isolated component may be in a homogeneous state, or the isolated component may be part of a pharmaceutical composition that includes additional pharma-ceutically acceptable carriers and / or excipients. Purity and homogeneity may be determined using analytical chemistry techniques, including, but not limited to, polyacrylamide gel electrophoresis or high performance liquid chromatography. Furthermore, a component of interest is described herein as being substantially purified if it is both isolated and is the component that is predominantly present in a preparation. As used herein, the term "purified" may refer to a component of interest that is at least 85% pure, at least 90% pure, at least 95% pure, at least 99% or more pure.By way of example only, a nucleic acid, polypeptide, or protein is "isolated" when it is free of at least some cellular components with which it is naturally associated, or when the nucleic acid, polypeptide, or protein is concentrated to a level greater than its in vivo or in vitro production concentration. Also, by way of example, a gene is isolated when it is separated from adjacent open reading frames encoding polypeptides or proteins other than the gene of interest.

[0064] As used herein, the term "eukaryote" refers to organisms belonging to the phylogenetic domain Eucarya, including, but not limited to, animals (including, but not limited to, mammals, insects, worms, birds, etc.), ciliates, plants (including, but not limited to, monocotyledons, dicotyledons, and algae), fungi, yeasts, flagellates, microsporidia, and protists. The terms "vertebrate" and "eukaryote" may be used interchangeably herein.

[0065] In an embodiment of the present invention, a platform cell line is provided that is generated from CHOK1 for the purpose of stably expressing an orthogonal suppressor tRNA / aminoacyl-tRNA synthetase pair for efficient incorporation of unnatural amino acids provided in the culture medium into proteins in CHO cells (see, for example, Tian F et al., 2014). The production cell line can be generated for the production of unnatural amino acid incorporated proteins by transfecting the amber nonsense codon containing gene of interest in the GS (glutamine synthetase) expression system into the host of the platform cell line. To generate the manufacturing cell line, the GS expression system uses glutamine synthetase as a selectable marker gene for selection of stable transfection of the product gene associated with the genome of the host cell while the stable cell line is growing. The platform cell line is well characterized and developed with improved unnatural amino acid incorporation efficiency and clonal selection efficiency. The platform cell line was pre-adapted to growth in suspension for rapid progression to bioreactors.

[0066] From an industrial perspective, platform cell lines can be used to provide step-by-step appropriate material to support every stage in drug development, but also to generate stable and well-characterized production cell lines prior to clinical product introduction and commercialization. Thus, in pharmaceutical companies, cell lines and cell line groups are closely involved in cross-functional activity. For example, discovery teams identify targets and generate candidate molecules. Transient transfections and stable pool generation in platform cell line hosts are performed to evaluate the expression of candidate molecules and provide material for development studies (purification, conjugation and analytical method development) and functional assays to identify lead molecules. Once a lead molecule is selected, a stable cell line is then generated to produce a high yield product with the desired quality characteristics. Selection of the best clones includes cell line, process development and analytical capabilities to identify stable, well-characterized production cell lines that are scalable in industry standard manufacturing to support clinical trials and commercialization. Cell culture process development begins with cell line generation and selection, followed by process and media optimization in small-scale systems including 96-well plates, shake flasks and bench-scale bioreactors for high-throughput screening purposes. Once conditions are defined, the process is often tested for scalability at pilot scale to produce material for preclinical toxicity testing, and then moved to large-scale manufacturing to produce clinical material under current good manufacturing practice (cGMP) regulations. Once commercial cell culture process development for the production of biological products is completed at laboratory and pilot scale, the commercialization process begins with process characterization, scale-up, technology transfer, and validation of the manufacturing process. Most of the above-mentioned methods for cell line development, cell culture process development and manufacturing, or alternatives to these, are well known in the art. See, for example, Weishou Hu, et al, Cell Culture Process Engineering (2013).

[0067] In the present invention, a strategy to develop stable cell lines was undertaken using platform cell lines as parent cells to obtain production cell lines with 5-10 PCD at 3-4 months and 20-30 PCD at 6 months. See also the Examples herein. The production cell lines passed at least 8 weeks of stability testing and were given a bioreactor manufacturing scale up to 12,000 L. Clones used for Master Cell Banks (MCBs) were selected based on growth, productivity and product quality. Further cell line engineering using CRISPR / Cas9 genome editing technology demonstrated improved cell growth and increased volumetric titers up to 1.5 g / L or 1500 mg / L for production cell lines producing 0.5 g / L or 500 mg / L. Fed-batch processes developed for the production cell lines demonstrated scalability at 2000 L single-use bioreactor (SUB) scale for clinical material preparation. Thus, in another embodiment, the present invention provides optimization of the development of high producing cell lines. Such optimization of high-producing cell line development can be achieved by methods and techniques well known in the art, including but not limited to FACS-dependent single-cell deposition, CRISPR knockout procedures, and production scale-up.

[0068] Methods and Techniques The present invention employs many conventional techniques in molecular biology, cell culture, biochemistry, etc., well known in the art. Methods and techniques for cell line development, cell culture process development and manufacturing are fully described, for example, in Weishou Hu, et al, Cell Culture Process Engineering (2013). General texts describing molecular biology techniques include: Berger and Kimmel, Guide to Molecular Cloning Techniques, Methods in Enzymology volume 152 Academic Press, Inc., San Diego, CA (Berger); Sambrook et al, Molecular Cloning - A Laboratory Manual (2nd Ed.), Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989 (“Sambrook”) and Current Protocols in Molecular Biology, FM Ausubel et al, eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc., (supplemented through 1999) (“Ausubel”)). These texts describe the use of vectors, promoters, and many other related items related to the creation of genes that contain selector codons for the production of proteins that contain, for example, unnatural amino acids, orthogonal tRNAs, orthogonal synthetases, and pairs thereof.

[0069] Other procedures can be found in the following publications and references cited therein: :Ling et al, Approaches to DNA mutagenesis: an overview, Anal Biochem. 254(2): 157-178 (1997); Dale et al, Oligonucleotide-directed random mutagenesis using the phosphorothioate method, Methods Mol. Biol. 57:369-374 (1996); Smith, In vitro mutagenesis, Ann. Rev. Genet. 19:423-462 (1985); Botstein & Shortle, Strategies and applications of in vitro mutagenesis, Science 229:1193-1201 (1985); Carter, Site-directed mutagenesis, Biochem. (Eckstein, F. and Lilley, DMJ eds., Springer Verlag, Berlin)) (1987); Kunkel, Rapid and efficient site-specific mutagenesis without phenotypic selection, Proc. Natl. Acad. Sci. USA 82:488-492 (1985); Kunkel et al, Rapid and efficient site-specific mutagenesis without phenotypic selection, Methods in Enzymol.154, 367-382 (1987); Bass et al, Mutant Trp repressors with new DNA-binding specificities, Science 242:240-245 (1988); Methods in Enzymol. 100: 468-500 (1983); Methods in Enzymol. 154: 329-350 (1987); Zoller & Smith, Oligonucleotide-directed mutagenesis using M13-derived vectors: an efficient and general procedure for the production of point mutations in any DNA fragment, Nucleic Acids Res. 10:6487-6500 (1982); Zoller & Smith, Oligonucleotide-directed mutagenesis of DNA fragments cloned into M13 vectors, Methods in Enzymol. 100:468-500 (1983); Zoller & Smith, Oligonucleotide-directed mutagenesis: a simple method using two oligonucleotide primers and a single-stranded DNA template, Methods in Enzymol. 154:329-350 (1987); Taylor et al, The use of phosphorothioate-modified DNA in restriction enzyme reactions to prepare nicked DNA, Nucl. Acids Res.13: 8749-8764 (1985); Taylor et al, The rapid generation of oligonucleotide-directed mutations at high frequency using phosphorothioate-modified DNA, Nucl. Acids Res. 13: 8765-8787 (1985); Nakamaye & Eckstein, Inhibition of restriction endonuclease Nci I cleavage by phosphorothioate groups and its application to oligonucleotide-directed mutagenesis, Nucl. Acids Res. 14: 9679-9698 (1986); Sayers et al, Y-T Exonucleases in phosphorothioate-based oligonucleotide-directed mutagenesis, Nucl. Acids Res. 16:791-802 (1988); Sayers et al, Strand specific cleavage of phosphorothioate-containing DNA by reaction with restriction endonucleases in the presence of ethidium bromide, (1988) Nucl. Acids Res. 16: 803-814; Kramer et al, The gapped duplex DNA approach to oligonucleotide-directed mutation construction, Nucl. Acids Res. 12: 9441-9456 (1984); Kramer & Fritz Oligonucleotide-directed construction of mutations via gapped duplex DNA, Methods in Enzymol.154:350-367 (1987); Kramer et al, Improved enzymatic in vitro reactions in the gapped duplex DNA approach to oligonucleotide-directed construction of mutations, Nucl. Acids Res. 16: 7207 (1988); Fritz et al, Oligonucleotide-directed construction of mutations: a gapped duplex DNA procedure without enzymatic reactions in vitro, Nucl. Acids Res. 16: 6987-6999 (1988); Kramer et al, Point Mismatch Repair, Cell 38:879-887 (1984); Carter et al, Improved oligonucleotide site-directed mutagenesis using M13 vectors, Nucl. Acids Res. 13: 4431-4443 (1985); Carter, Improved oligonucleotide-directed mutagenesis using M13 vectors, Methods in Enzymol. 154: 382-403 (1987); Eghtedarzadeh & Henikoff, Use of oligonucleotides to generate large deletions, Nucl. Acids Res. 14: 5115 (1986); Wells et al, Importance of hydrogen-bond formation in stabilizing the transition state of subtilisin, Phil. Trans. R. Soc. Lond.A 317: 415-423 (1986); Nambiar et al, Total synthesis and cloning of a gene coding for the ribonuclease S protein, Science 223: 1299-1301 (1984); Sakamar and Khorana, Total synthesis and expression of a gene for the a-subunit of bovine rod outer segment guanine nucleotide-binding protein (transducin), Nucl. Acids Res. 14: 6361-6372 (1988); Wells et al, Cassette mutagenesis: an efficient method for generation of multiple mutations at defined sites, Gene 34:315-323 (1985); Grundstrom et al, Oligonucleotide-directed mutagenesis by microscale 'shot-gun' gene synthesis, Nucl. Acids Res. 13: 3305-3316 (1985); Mandecki, Oligonucleotide-directed double-strand break repair in plasmids of Escherichia coli: a method for site-specific mutagenesis, Proc. Natl. Acad. Sci. USA, 83:7177-7181 (1986); Arnold, Protein engineering for unusual environments, Current Opinion in Biotechnology 4:450-455 (1993); Sieber, et al, Nature Biotechnology, 19:456-460 (2001). W. P. C.Stemmer, Nature 370, 389-91 (1994); and, IA Lorimer, I. Pastan, Nucleic Acids Res. 23, 3067-8 (1995). Further details regarding many of the above methods can be found in Methods in Enzymology, Vol. 154, which also describes useful tools for solving problems related to various mutagenesis methods.

[0070] Various techniques and methods for the purification and detection of the polypeptides and proteins of the invention are known in the art. These techniques and methodologies can be applied to the detection and purification of proteins containing unnatural amino acids as described herein. In general, antibodies are useful reagents for ELISA, Western blotting, immunochemistry, affinity chromatography methods, surface plasmon resonance (SPR), Annexin V, FACS and many other methods. References herein provide details on how to perform ELISA assays, Western blots, SPR, etc. Other techniques and methodologies of the invention can include intact mass spectrometry (MS) and size exclusion chromatography (SEC). Intact mass spectrometry provides information about the exact mass of a protein and the relative abundance of its isoforms. Size exclusion chromatography (SEC), also known in the art as molecular sieve chromatography, is a chromatographic method that separates molecules in a solution according to their size, separating out some case weight.

[0071] Genome editing technology In some embodiments, the present invention provides polynucleotides for inactivating, disrupting, excising or knocking out a target site or region in a cell using gene editing tools. As used herein, the terms "target", "targeted", "targeted" or "targeted" knockout, excision, inactivation or disruption refer to a site or region in a cell or gene that is excised, inactivated, destroyed or knocked out. Some gene editing tools can be used to precisely modify genes by inducing targeted DNA double-strand breaks (DSBs). Such gene editing tools known in the art can include, but are not limited to, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and meganucleases (MNs), also known in the art as homing endonucleases (HEs) (Gaj et al., 2013; Guha et al., 2017), and clustered regularly interspaced short palindromic repeats (CRISPRs). In an embodiment of the invention, gene editing tools were used to design constructs to recognize target sites or regions in cells expressing or producing a gene of interest and to generate double-stranded breaks in the target gene after transfection.

[0072] ZFNs are artificial fusion proteins consisting of a zinc finger DNA binding domain and a non-specific DNA cleavage domain from the FokI restriction endonuclease. The zinc finger domain can be engineered to recognize specific DNA sequences to achieve gene editing. TALENs are also artificial fusion proteins, consisting of a DNA binding domain from a TALE protein and a non-specific DNA cleavage domain from the FokI restriction endonuclease. TALEs (transcription activator-like effectors) are proteins from Xanthomonas bacteria, and the DNA binding domain can be engineered to bind to specific DNA sequences. Like ZFNs, TALENs can induce DSBs so that gene inactivation can be achieved. MNs, also known in the art as homing endonucleases, are endonucleases with high site specificity in the creation of double-stranded DNA. MNs have a large site-specific recognition site that can recognize DNA of 18 to 44 base pairs. Among the MN family members, LAGLIDADG has been most widely studied and engineered in genome editing applications. Clustered regularly interspaced short palindromic repeats (CRISPR) technology is a recent genome editing technology that uses RNA-guided nucleases (Cas9 is the most widely used type II nuclease) to form targeted DNA double-strand breaks (DSBs). During the self-repair process of targeted DSBs in cells, deletions and insertions of nucleotides often occur, resulting in frameshifts of the corresponding genomic sequences of the coding regions of targeted proteins and ultimately the loss of their functions. Although CRISPR was first discovered as an immune system of prokaryotic cells in defending against viral invasion, its application in eukaryotic cells as a genome editing tool has been successfully developed (see, for example, Cong et al., 2013; Hsu et al., 2014; Jinek et al., 2012; Ran et al., 2013).Compared to other genome editing technologies such as zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), as well as meganucleases (MNs) (e.g., USPN 8,597,912), which use specific DNA binding domains to induce the formation of DSBs, CRISPR technology catalyzes DNA cleavage with the assistance of guided RNAs (gRNAs) that use Watson-Crick base pairing to specific DNA sequences.

[0073] Any of the gene editing tools described herein can be used with the present invention, but CRISPR technology is exemplified to provide a more efficient and highly specific technology that can be applied to various cells and organisms (Hsu et al., 2014). As exemplified in the examples herein, the gRNA targeting site or region that knocks out, excises, inactivates or destroys in cells expressing a gene of interest can be designed in the CHO-K1 genome using a specific online CRISPR gRNA design tool (see staff.biosustain.dtu.dk / laeb / crispy / on the Internet). Examples of sites or regions that can knock out, excise, inactivate or destroy in a gene of interest target gene are shown in Table 1 below.

[0074] [Table 1] JPEG2025061014000003.jpg87169

[0075] In another embodiment of the invention, oligonucleotides were synthesized and used to amplify the genomic DNA loci of the gRNAs disclosed in the above table, as shown in Table 2 below. All these techniques are explained in the literature. See, for example, Sambrook et al MOLECULAR CLONING: A LABORATORY MANUAL, Second edition, Cold Spring Harbor Laboratory Press, 1989 and Third edition, 2001; Ausubel et al, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987 and regular updates.

[0076] [Table 2] JPEG2025061014000005.jpg73169

[0077] [Gene editing targets] In an embodiment of the present invention, a gene is provided that is targeted for knockout, disruption, ablation, or inactivation in cells expressing the gene of interest. The terms target knockout gene, target or targeted ablation gene, target or targeted inactivation gene, and target or targeted destruction gene, as used herein, refer to a gene that is targeted for knockout, ablation, or inactivation by gene editing. In some aspects of the present invention, the target or targeted site or region is involved in an apoptosis pathway. In another embodiment of the present invention, a target gene is provided that is knocked out, disrupted, ablated, or inactivated in a cell or cell line. The knocked out, disrupted, removed, or inactivated targeted gene may include genes that regulate cell proliferation, differentiation, regulation, and the like. In another embodiment, the target gene for knockout, disruption, ablation, or inactivation in cells expressing the gene of interest includes genes that are involved in an apoptosis pathway, such as proapoptotic genes, oncogenes, and the like. Target genes for knockout, disruption, ablation, or inactivation may include, but are not limited to, GS, Bcl-2 family, IGFBP4, AQP1, Maf1, eRF1, FUT8, P53, caspase 3, UPF1, Smg1, and any exogenously added selective marker genes (if applicable) such as zeocin, hygromycin, puromycin, Smac / DIABLO, Apaf-1, caspase-6, caspase-7, caspase-9, caspase-10, PARP, alpha fodrin, NuMA, AIF, CAD, Puma, Noxa, 14-3-3, Aven, Myc, HtrA2 / Omi, etc. Target genes for knockout, disruption, ablation, or inactivation may include bcl-2 family such as Bcl-x1, Bak, Bax, Bcl-xs, Bid, Bim, Bad, and Bik. In certain embodiments, the target for knockout, disruption, ablation or inactivation is BAX and / or BAK. In other embodiments, the targeted knockout, disruption, removal or inactivation gene is fully or partially knocked out, removed or inactivated.Partially inactivated, disrupted, knocked out, or eliminated genes are 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 109%, 109%, 109%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 1 2%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%.

[0078] [Biological Therapeutic Genes] The present disclosure provides a gene of interest expressed in a platform cell line. The gene of interest may be a biological therapeutic agent, including but not limited to cytokines, growth factors, hormones, interferons, interleukins, other regulatory peptides and proteins, and antibodies. The biological therapeutic agent of the present invention may include any biological product derived from genetically engineered bacteria, yeast, fungi, or cells. The biological therapeutic agent of the present invention includes DNA, RNA, recombinant DNA, proteins, and polypeptides. In some embodiments, the biological therapeutic agent is a vaccine, and the vaccine is obtained by any method or cell of the present invention.

[0079] In other embodiments, the invention provides platform cells or cell lines expressing a gene of interest, such as, but not limited to, alpha-1 antitrypsin, angiostatin, antihemolytic factor, antibodies, apolipoproteins, apoproteins, atrial natriuretic factor, atrial natriuretic peptide, atrial peptide, calcitonin, CD40 ligand, C-kit ligand, collagen, colony stimulating factor (CSF), complement factor 5a, complement inhibitors, complement receptor 1, cytokines (e.g., epithelial neutrophil activating peptide-78, GROα / M, GSA, GROβ, GROγ, MIP-1α, MIP-1δ, MCP-1), epidermal growth factor (EGF), erythropoietin ("EPO"), exfoliative toxin A and B, Factor XI, Factor VII, Factor VIII, but not limited to Factor X, fibroblast growth factor (FGF), fibrinogen, fibronectin, GM-CSF, GM-CSF, CD116, M-CSF, CSF-1R, glucocerebrosidase, gonadotropins, growth factors, hedgehog proteins (e.g., Sonic, Indian, Desert), hemoglobin, hepatocyte growth factor (HGF), hepatocyte growth factor (HGF ... HGF), hirudin, human serum albumin, insulin, insulin-like growth factor (IGF), interferons (e.g., IFN-α, IFN-β, IFN-γ), keratinocyte growth factor (KGF), lactoferrin, leukemia inhibitory factor, luciferase, neurturin, neutrophil inhibitory factor (NIF), oncostatin M, bone morphogenetic proteins, parathyroid hormone, PD-ECSF, PDGF, peptide hormones (e.g., human growth hormone), pleiotropin, protein A, protein G, pyrogenic exotoxins A, B, and C, relaxin, renin, SC F, soluble complement receptor I, soluble I-CAM, soluble interleukin receptors (IL-1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15), soluble TNF receptors, somatomedins, somatostatins, somatotropins, streptokinases, superantigens, i.e., staphylococcal enterotoxins (SEA, SEC1, SEC2, SEC3, SED, SEE), superoxide dismutase (SOD), toxic shock syndrome toxin (TSST-1), thymosin α1, tissue plasminogen activator, TGFβ, and MIF.Also includes vascular endothelial growth factor (VEGF), urokinase, etc.

[0080] In other embodiments, the gene of interest is, but is not limited to, IL-1 and CD121a, IL-2 and CD25 / CD122 / CD137, IL-3 and CD123, IL-5 and CD125, IL-6 and CD126, IL-7 and CD127 / CD132, IL-9 and IL-9R, IL-10 and CRF2-4, IL-11 and IL-11R, IL-12 and IL-12 ... These may include, but are not limited to, interleukins such as Rβ1c / IL-12Rβ2, IL-13 and IL-13R, IL-15 and CD122 / CD132, IL-16 and CD4, IL-17 and CD217, IL-18 and IL-1Rrp, IL-19 and IL-20Rα / 10Rβc, IL-21 and IL-21R / CD132, IL-22 and IL-22Rαc / IL-10Rβc. IL-23 and IL-23R, , IL-24 and IL-22Rαc / IL-10Rβc, IL-25 and IL-17BR, IL-26 and IL-20Rα / IL-10Rβc, IL-27 and and WSX-1 / CD130c, IL-28 and IL-28Rαc / IL-10Rβc, IL-29 and IL-28Rαc / IL-10Rβc, IL-29 and IL-28Rαc / IL-10Rβ c, interleukins such as IL-30 and WSX-1 / CD130c, IL-31 and IL-31A / OSMR, IL-32, IL-33 and ST2 / IL1RAP, IL-34 and CSF-1R, IL-35 and IL-12RB2, IL-36 and IL-1Rrp2, IL-37 and IL-18Rα, TSLP and TSLPR, LIF and LIFR, OSM and OSMR.

[0081] In some embodiments of the present invention, the gene of interest may include, but is not limited to, tumor necrosis factor TNF, including, but not limited to, tumor necrosis factor beta (TNFβ), tumor necrosis factor receptor (TNFR), tumor necrosis factor alpha (TNFα) and p55 / p75, LT-α and p55 / p75, LT-β and p55 / p75, CD40L and CD40, FasL and CD95, CD27L and CD27, CD30L and CD30, 4-1BBL and 4-1BB, Trail and DR4, RANK-L and RNAK, APRIL and TAC1, LIGHT and HVEM, TWEAK and TWEAKR, BAFF and TAC1, etc.

[0082] Genes of interest may include CXC chemokines (e.g., T39765, NAP-2, ENA-78, Gro-a, Gro-b, Gro-C, IP-10, GCP-2, NAP-4, SDF-1, PF4, MIG), CXCL1 and CXCR2, CXCL2 and CXCR2, CXCL3 and CXCR2, CXCL4 and CXCR3B, CXCL5 and CXCR2, CXCL6 and CXCR2, CXCL7 and CXCR1 / CXCR2, CXCL8 and CXCR1 / CXCR2, CXCL9 and CXR3A / 3B, CXCL10 and CXCRA / 3B, CXCL11 and CXCR3A / 3B / CRCR7, CXCR12 and CXCR4 / CXCR7, CXCL13 and CXCR5, CXCL14, CXCL15, CXCL16 and CXCR6, etc. Genes of interest also include CC chemokines (e.g., monocyte chemoattractant protein-1, monocyte chemoattractant protein-2, monocyte chemoattractant protein-3, monocyte inflammatory protein-1α, monocyte inflammatory protein-1β, RANTES, I309, R83915, R91733, HCC1, T58847, D31065, T64262), CCL1 and CCR6, CCL2 and CCR2, CCL3 and CCR1 / 5, CCL4 and CCR5, CCL5 and CCR1 / CCR3, CCR5, CCL6 and CCR1, CCL7 and CCR1 / CCR2 / CCR3 / CCR5, CCL8 and CCR1 / CCR2 / CCR5, CCL9 and CCR1, CCL 11 and CCR3, CCL12 and CCL2, CCL13 and CCR2 / 3, CCL14 and CCR1 / 3 / 5, CCL15 and CCR1 / 3, CCL16 and CCR1 / 2 / 5 / 8, CCL17 and CCR4, CCL18 and PITPNM3, CCL19 and CCR7, CCL20 and CCR6, CCL21 and CCR7, CCL22 and CCR4, CCL23 and CCR1 / FPRL-1, CCL24 and CCR3, CCL25 and CCR9, CCL26 and CCR3, CCL27 and CCR10, CCL28 and CCR10, as well as XCL1 and XCR1, XCL2 and XCR1, CX3CL1 and CX3CR1, etc.

[0083] The methods, compositions, strategies and techniques described herein are not limited to a particular type, class or family of polypeptides or proteins. Indeed, virtually any polypeptide can be designed or modified to include at least one "modified or unmodified" unnatural amino acid as described herein. By way of example only, the polypeptide can be homologous to a biotherapeutic or therapeutic protein as described herein. Proteins or polypeptides of interest having at least one unnatural amino acid are a feature of the invention. The invention also includes polypeptides or proteins having at least one unnatural amino acid produced using the compositions and methods of the invention. An excipient (e.g., a pharma- ceutically acceptable excipient) can also be present with the protein.

[0084] By producing a protein or polypeptide of interest having at least one unnatural amino acid incorporated in a vertebrate cell, the protein or polypeptide typically includes a vertebrate post-translational modification. In certain embodiments, the protein includes at least one unnatural amino acid and at least one post-translational modification that is made in vivo by a vertebrate cell, and that is not made by a prokaryotic cell. For example, post-translational modifications include, by way of example, acetylation, acylation, lipid modification, palmitoylation, palmitate addition, phosphorylation, glycolipid linkage modification, glycosylation, and the like.

[0085] The disclosure of the present invention includes genes or genes of interest that contain a selector codon. The genes of interest can include therapeutic proteins or polypeptides, and the genes are involved in, but are not limited to, cell proliferation, differentiation, regulation, inflammation, oncogenes, and the like. In other embodiments, the disclosure of the present invention includes antibody genes that contain a selector codon. In other embodiments, the antibody can be any antibody of interest, including, but not limited to, anti-Her2, anti-CD-70, anti-PSMA, 5T4, EGFR, TROP2, CD3, interleukins (including but not limited to 2, 3, 10), GPC3, DLL3, ROR1, leptin, FGF family including FGF-21 and FGF-23, HGH, FcR, insulin, TNFR1, TRAIL, erythropoietin, and analogs, bispecifics and fragments thereof, and the like, but not limited thereto. In some embodiments, the present invention includes antibody genes that contain a selector codon. The antibodies of the present invention can be, for example, polyclonal, monoclonal, chimeric, humanized, single chain, Fab fragments, fragments produced by a Fab expression library, and the like. The antibodies of the present invention may include, but are not limited to, tumor-specific MAbs that stop tumor growth by targeting tumor cells for destruction by antibody-dependent cell-mediated cytotoxicity (ADCC) or complement-mediated lysis (CML) (these general types of Abs are sometimes called "Magic bullets"). As an example, Rituximab, an anti-CD20 MAb for the treatment of non-Hodgkin's lymphoma, is an antibody that inhibits a key component of tumor growth (Scott (1998) Rituximab: a new therapeutic monoclonal antibody for non-Hodgkin's lymphoma Cancer Pract 6: 195-7).Herceptin, an anti-HER-2 monoclonal antibody for the treatment of metastatic breast cancer, provides an example of an antibody with this mechanism of action (Baselga et al (1998) Recombinant humanized anti-HER2 antibody (Herceptin) enhances the antitumor activity of paclitaxel and doxorubicin against HER2 / neu overexpressing human breast cancer xenografts [published erratum appears in Cancer Res (1999) 59(8):2020], Cancer Res 58: 2825-31). Another example concerns antibodies for the direct delivery of cytotoxic compounds (toxins, radionuclides, etc.) to tumors or other sites of interest, such as CYT-356, a 90Y-conjugated antibody that directly radiolabels prostate tumor cells (Deb et al (1996) Treatment of hormone-refractory prostate cancer with 90Y-CYT-356 monoclonal antibody Clin Cancer Res 2: 1289-97). Another example is antibody-directed enzyme prodrug therapy, in which an enzyme localized in the tumor activates a prodrug administered systemically to the tumor periphery.For example, anti-Ep-CAM1 antibodies conjugated to carboxypeptidase A have been developed for the treatment of colorectal cancer (Wolfe et al (1999) Antibody-directed enzyme prodrug therapy with the T268G mutant of human carboxypeptidase A1: in vitro and in vivo studies with prodrugs of methotrexate and the thymidylate synthase inhibitors GW1031 and GW1843 Bioconjug Chem 10: 38-48). Other antibodies (e.g., antagonists) designed to specifically inhibit normal cell function for therapeutic benefit may also be included. An example is Orthoclone OKT3, an anti-CD3 Mab from Johnson and Johnson for inhibiting acute organ transplant rejection. (Strate et al (1990) Orthoclone OKT3 as first-line therapy in acute renal allograft rejection Transplant Proc 22: 219-20). Another class of antibodies includes agonists. These MAbs are designed to specifically enhance normal cellular functions for therapeutic purposes. For example, MAb-based agonists of acetylcholine receptors for neurotherapeutics are under development (Xie et al (1997) Direct demonstration of MuSK involvement in acetylcholine receptor clustering through identification of agonist ScFv Nat. Biotechnol. 15: 768-71). Any of these antibodies can be modified to include one or more unnatural amino acids to enhance one or more therapeutic properties (specificity, avidity, serum half-life, etc.). Another example may include catalytic antibodies, such as Ig sequences engineered to mimic the catalytic capabilities of enzymes.(Wentworth and Janda (1998) Catalytic antibodies Curr Opin Chem Biol 2: 138-44). Catalytic antibodies can also be modified to contain one or more unnatural amino acids to improve one or more desired properties.

[0086] The selector codons of the invention extend the gene codon framework of the protein biosynthetic machinery. For example, selector codons include unique three-base codons, nonsense codons such as stop codons such as amber codon (UAG), opal codon (UGA), non-natural codons, at least four-base codons, rare codons, etc. For example, one or more, two or more, three or more, or any other number of selector codons can be introduced into a desired gene. A gene can contain multiple copies of a given selector codon, or multiple different selector codons, or any combination thereof. In one embodiment, the methods and compositions of the invention include the use of a gene or gene of interest containing a selector codon as disclosed herein. In one embodiment, the methods and compositions of the invention include the use of an antibody containing a selector codon, where the selector codon can be present in the heavy chain, the light chain, or both. Thus, the selector codons of the invention include stop codons for incorporation of unnatural amino acids in vivo in eukaryotes.

[0087] [Production cells] In some embodiments, the present disclosure provides producer cells, cell lines, and clones made therefrom that express a gene of interest. Such producer cells or cell lines include, but are not limited to, transiently transfected cell populations, stable bulk cell populations (e.g., cell mixes or pools), stable mini cell populations (e.g., mini pools or master well populations), and stable clonal cell lines (e.g., derived from a single cell). As used herein, a transiently transfected cell population refers to a cell pool in which a gene of interest has been introduced into the genome and has not been stably integrated into the genome. As used herein, a stable cell or stable producer cell line refers to a cell in which a gene of interest has been introduced into the genome and has been stably integrated into the genome. A stable small cell population may be less heterogeneous than a stable bulk cell population.

[0088] In some embodiments, the present disclosure relates to stable production cell lines comprising an orthogonal aminoacyl-tRNA synthetase (O-RS), an orthogonal suppressor tRNA (O-tRNA), and a gene of interest containing a selector codon with an unnatural amino acid incorporated therein, and a targeted knockout, deleted, inactivated or disrupted gene. In other embodiments, the present disclosure relates to production cells, cell lines and clones made therefrom that express the gene of interest and the targeted knockout, deleted, inactivated or disrupted gene. In other embodiments, the targeted knockout, deleted, inactivated or disrupted gene is a gene involved in promoting cell growth and productivity. In other embodiments, the targeted knockout, deleted, inactivated or disrupted gene is a gene involved in an apoptotic pathway, e.g., a pro-apoptotic gene. In exemplary embodiments, the present disclosure provides methods and compositions for generating cells or cell lines expressing a gene of interest with a non-naturally incorporated amino acid and one or more targeted knockout, disrupted, excised or inactivated genes (e.g., BAX and / or BAK). Other target knockout genes may include the Bcl-2 family of proteins, well known in the art for their ability to control apoptotic cell death via the mitochondrial pathway. Bcl-2 and some of its homologs, such as Bcl-x1, are known to inhibit apoptosis. Other known pro-apoptotic Bcl-2 family members include Bak, Bax, Bcl-xs, Bid, Bim, Bad and Bik. With the appropriate stimuli, Bax and / or Bak can induce or promote apoptosis. The Bcl-2 family of proteins share similar sequence and structural homology. This protein family is characterized by up to four regions of sequence homology known as Bcl-2 homology domains. For example, the Bax protein shares a highly conserved domain with Bcl-2. Some of these domains are involved in Bax / Bcl-2 heterodimer formation, which is believed to be important for cell survival or death in response to apoptotic signals.Upon activation, Bax translocates to the outer mitochondrial membrane where it oligomerizes, permeabilizes the membrane, and releases several death-promoting factors, including cytochrome C (Scorrano et al (2003) Biochem. Biophys. Res. Commun. 304:437-444). Bax can be inactivated in normal cells through interaction with the Ku70 protein, which sequesters Bax from mitochondria (Sawada et al (2003) Nat. Cell Biol. 5:320-329). Like Bax, the Bak gene product enhances apoptotic cell death in the presence of an appropriate stimulus. Bak also promotes cell death and inhibits the apoptotic protection of Bcl-2. Bak is a known potent inducer of apoptosis in a variety of cell types. Thus, the present disclosure provides, in an exemplary manner, methods and compositions for making a production cell line with partial or complete inactivation of one or more of the BAK and / or BAX genes in a cell or cell line incorporating a gene of interest and an unnatural amino acid. Inactivating apoptotic agents (e.g., BAX and / or BAK) in cells expressing a gene of interest renders the cells resistant to apoptosis and can be used to generate cell lines with improved production of recombinant proteins (e.g., including but not limited to, antibodies, recombinant viral vectors) and for the manufacture of vaccines.

[0089] The cell lines of the present disclosure may be utilized for recombinant protein production. Recombinant proteins include, but are not limited to, antibodies, antigens, therapeutic proteins as disclosed elsewhere herein. In some embodiments, the present invention includes eukaryotic or vertebrate cells or cell lines (including, but not limited to, mammalian, insect, worm, bird, etc.), or ciliates, plants (including, but not limited to, monocotyledons, dicotyledons, and algae), fungi, yeast, flagellates, microsporidia, and protists. Eukaryotic cells may be used for in vivo incorporation of unnatural amino acids. Cells may be used to genetically engineer (e.g., transform, transduce, or transfect) with the vectors of the present invention, which may be polynucleotides of the present invention or constructs comprising the polynucleotides of the present invention, e.g., cloning vectors or expression vectors. Vectors may be, for example, plasmids, bacteria, viruses, naked polynucleotides, or conjugated polynucleotides. Vectors are introduced into cells and / or microorganisms by standard methods including electroporation (Klein et al, Proc. Natl. Acad. Sci. USA 82, 5824 (1985)), infection with viral vectors, or high velocity ballistic penetration of nucleic acids with microparticles either within the matrix of microbeads or particles, or on the surface (Klein et al, Nature 327, 70-73 (1987)).

[0090] Several well-known methods of introducing nucleic acids into cells are available, any of which can be used in the present invention. These include fusion of recipient cells with bacterial protoplasts containing DNA, electroporation, projectile bombardment, and infection with viral vectors (described further below). Bacterial cells can be used to amplify the number of plasmids containing the DNA constructs of the present invention. Bacteria can be grown to logarithmic phase and plasmids within the bacteria can be isolated by various methods known in the art (see, e.g., Sambrook). In addition, a number of kits are commercially available for purifying plasmids from bacteria (see, e.g., EasyPrep™, FlexiPrep™, both from Pharmacia Biotech, StrataClean™, QIAprep™ from Stratagene, QIAprep™ from Qiagen). The isolated and purified plasmids can then be further manipulated to produce other plasmids and used to transfect cells, or incorporated into related vectors to infect organisms. A typical vector contains transcription and translation terminators, transcription and translation initiation sequences, and a promoter useful for regulating the expression of a particular nucleic acid of interest. A vector optionally contains at least one independent terminator sequence, a sequence that allows the cassette to replicate in eukaryotes or prokaryotes, or both (e.g., shuttle vectors), and a general expression cassette that contains a selection marker for both prokaryotic and vertebrate systems. The vector is suitable for replication and integration in prokaryotes, eukaryotes, and preferably both. See Giliman & Smith, Gene 8:81 (1979); Roberts, et al, Nature, 328:731 (1987); Schneider, B., et al, Protein Expr. Purif. 6435:10 (1995); Ausubel, Sambrook, Berger (all supra).Catalogs of bacteria and bacteriophages useful for cloning are provided, for example, by the ATCC (e.g., The ATCC Catalogue of Bacteria and Bacteriophage (1992) Gherna et al (eds) published by the ATCC). Further basic procedures for sequencing, cloning, and other aspects of molecular biology, as well as underlying theoretical considerations, can also be found in Watson et al (1992) Recombinant DNA Second Edition Scientific American Books, NY. In addition, essentially any nucleic acid (and virtually any labeled nucleic acid, whether standard or non-standard) can be custom ordered or purchased standard from any of a variety of commercial sources (e.g., the Midland Certified Reagent Company (Midland, TX mcrc.com), The Great American Gene Company (Ramona, CA available on the World Wide Web at genco.com), ExpressGen Inc. (Chicago, IL available on the World Wide Web at expressgen.com), Operon Technologies Inc. (Alameda, CA) and many others).

[0091] The cells or cell lines of the present disclosure can be cultured in conventional nutrient media, modified appropriately for activities such as screening steps, promoter activation, or transformant selection.These cells can be cultured in transgenic organisms, if necessary.Other useful references include, for example, Freshney (1994) Culture of Animal Cells, a Manual of Basic Technique, third edition, Wiley- Liss, New York and the references cited therein for cell isolation and culture (e.g., subsequent nucleic acid isolation); Payne et al (1992) Plant Cell and Tissue Culture in Liquid Systems John Wiley & Sons, Inc. New York, NY; Gamborg and Phillips (eds) (1995) Plant Cell, Tissue and Organ Culture; Fundamental Methods Springer Lab Manual, Springer-Verlag (Berlin Heidelberg New York) and Atlas and Parks (eds) The Handbook of Microbiological Media (1993) CRC Press, Boca Raton, FL.

[0092] Conventional medium or media, as used herein, refers to any medium used to grow and harvest cells and / or products expressed and / or secreted by such cells. Such "medium" or "media" includes, but is not limited to, a solution, solid, semi-solid, or rigid support that can support or contain any host cell, including, for example, bacterial host cells, yeast host cells, insect host cells, plant host cells, eukaryotic host cells, mammalian host cells, CHO cells, prokaryotic host cells, E. coli, or Pseudomonas host cells, and cellular contents. "Medium" or "media" as defined above includes, but is not limited to, a medium or medium in which a host cell from which a polypeptide is secreted is grown, including the medium either before or after the growth step. "Medium" or "media" as defined above includes, but is not limited to, a buffer or reagent containing a lysate of a host cell (e.g., a polypeptide produced within the cell), and the host cell is lysed or destroyed to release the polypeptide. In other embodiments of the invention, the medium may be a complete cell culture medium, a conventional cell culture medium, or a chemically defined medium. Complete cell culture media often have two main categories of components: basal media and growth supplements. Basal media are nutrient mixtures consisting of low molecular weight components including sugars, amino acids, vitamins, various salts, etc. Basal media not only provide energy and a source of nutrients to create new cell mass and products, but also provide a balanced salt concentration and osmolality to allow cell growth. However, most cells will not grow if provided in basal media alone, since basal media does not contain growth factors or other factors necessary for "optimal" growth conditions. Growth supplements that may be added to basal media include growth factors, phospholipids, soy hydrolysates, serum, etc. These supplements may promote cell growth by providing components for specific signaling pathways, or may meet special nutritional requirements (e.g., delivering cholesterol) and direct cell differentiation. Traditional cell culture media contain up to 15% animal serum in addition to the basal media. Serum is a fluid with a very complex chemical composition.Such media contain mostly undefined chemical compositions and are called complex media. Many supplements commonly used in industrial processes, e.g., vegetable hydrolysates, soybean phospholipids, also fall into this category. The use of such supplements makes the chemical composition of the media unclear. Chemically defined media contain only components whose chemical composition is known and characterized, and all of their chemical species are specified. The media do not contain any mixture of components with unknown or undefined composition. For example, "lipids" or "phospholipids" are not clearly defined compounds, but mixtures of classes of compounds, and are not chemically specified. Chemically defined media often contain growth factors, cytokines, and carrier proteins. Thus, chemically defined media are not necessarily protein-free.

[0093] In embodiments of the present invention, batch and fed-batch production are utilized. Standard methods for batch and fed-batch production are well understood in the art. In batch processes, osmolarity constraints limit the amount of nutrients that can be added initially. This low nutrient level prevents the culture from achieving high cell and product concentrations. In fed-batch culture, medium is added during the culture to prevent nutrient depletion, thus extending the growth phase and ultimately increasing cell and product concentrations. A variety of fed-batch operations are utilized in current production facilities, ranging from very simple to very complex and automated. The media used in both batch and fed-batch can be commercially available or proprietary media developed in-house. The media types can be complex media containing a largely undefined chemical composition, or chemically defined media containing components that are known, characterized, and have a specified chemical composition for all of their chemicals. In some embodiments, chemically defined media contains only components whose chemical composition is known, characterized, and all of their chemicals are specified. In other embodiments, the media types utilized can be mixtures containing undefined and chemically defined compositions. In another embodiment, the undefined chemical composition and the chemically defined composition are 99%-90% and 1%-10%, respectively, or 89%-80% and 11%-20%, respectively, or 79%-70% and 21%-30%, respectively, or 69%-60% and 31%-40%, respectively, or 59%-50% and 41%-50%, respectively; or any combination of 1%-10% and 99%-90%, 11%-20% and 89%-80%, 21%-30% and 79%-70%, 31%-40% and 69%-60%, 41%-50% and 59%-50%, respectively. Most of the above methods or alternative methods are well known to those skilled in the art. See, for example, Weishou Hu, et al, Cell Culture Process Engineering (2013).

[0094] The methods and compositions of the invention provide highly productive eukaryotic cells or cell lines for the production of proteins or polypeptides that contain or comprise large, useful amounts of unnatural amino acids, hi one embodiment, the composition optionally comprises, for example, at least 10 micrograms, at least 50 micrograms, at least 75 micrograms, at least 100 micrograms, at least 200 micrograms, at least 250 micrograms, at least 500 micrograms, at least 1 milligram, at least 10 milligrams or more of a protein polypeptide that comprises an unnatural amino acid, or an amount that can be achieved by in vivo protein production methods. In another embodiment, the protein is optionally present in the composition at a concentration of, for example, at least 10 micrograms of protein per liter, at least 50 micrograms of protein per liter, at least 75 micrograms of protein per liter, at least 100 micrograms of protein per liter, at least 200 micrograms of protein per liter, at least 250 micrograms of protein per liter, at least 500 micrograms of protein per liter, at least 1 milligram of protein per liter, or at least 10 milligrams of protein per liter or more, e.g., in a cell lysate, buffer, pharmaceutical buffer, or other liquid suspension (e.g., anywhere from about 1 nl to about 100 L in volume). The production of large amounts (e.g., greater than is typically possible with other methods, e.g., in vitro translation) of proteins in eukaryotic or vertebrate cells that contain at least one unnatural amino acid is a feature of the invention.

[0095] In some embodiments, the cells of the present invention are engineered or recombinant host cells or platform cells, also referred to as "host cells". Such platform, engineered or recombinant host cells, or host cells refer to cells containing an exogenous polynucleotide, where the method used to insert the exogenous polynucleotide into the cell includes, but is not limited to, direct uptake, transduction, f-mating, or other methods known in the art for creating recombinant host cells. By way of example only, such exogenous polynucleotides can be non-integrated vectors (including, but not limited to, plasmids) or can be integrated into the host genome. In other aspects of the present invention, a gene of interest can be transfected into the platform, or engineered or recombinant host cells to create a production cell line for making or manufacturing a biotherapeutic agent (including, but not limited to, an antibody). In another embodiment of the present invention, the production cell line is a cell line with a gene of interest. In other embodiments of the present invention, a production cell line with a silenced or knocked out, excised, inactivated, or disrupted gene of interest can be a platform cell line. In some aspects of the present invention, the platform cell can be a cell line with an orthogonal tRNA / RS system that does not have a gene of interest.

[0096] In some embodiments, the compositions of the invention may be substantially purified. As used herein, the term "substantially purified" refers to a component of interest that is substantially or essentially free from other components that normally accompany or interact with the component of interest prior to purification. By way of example only, a component of interest may be "substantially purified" if a preparation of the component of interest contains less than about 30%, less than about 25%, less than about 20%, less than about 15%, less than about 10%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or less than about 1% of contaminating components. Thus, a "substantially purified" component of interest may have a purity level of about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or more. By way of example only, a natural or non-natural amino acid polypeptide may be purified from a natural or host cell in the case of a recombinantly produced natural or non-natural amino acid polypeptide. By way of example, a preparation of a natural or non-natural amino acid polypeptide may be "substantially purified" if the preparation contains less than about 30%, less than about 25%, less than about 20%, less than about 15%, less than about 10%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or less than about 1% of contaminants. By way of example, when a natural or non-natural amino acid polypeptide is recombinantly produced by a host cell, the natural or non-natural amino acid polypeptide may be present at no more than about 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, or 1% of the dry weight of the cells. By way of example, when a natural or non-natural amino acid polypeptide is recombinantly produced by a host cell, the natural or non-natural amino acid polypeptide can be present in the culture medium at about 5 g / L, about 4 g / L, about 3 g / L, about 2 g / L, about 1 g / L, about 750 mg / L, about 500 mg / L, about 250 mg / L, about 100 mg / L, about 50 mg / L, about 10 mg / L, or about 1 mg / L or less of the dry weight of the cells.By way of example, a "substantially purified" natural or non-natural amino acid polypeptide can have a purity level of about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more, as determined by suitable methods, including but not limited to, SDS / PAGE analysis, RP-HPLC, SEC, and capillary electrophoresis. The polypeptides or proteins of the invention can include excipients (e.g., but not limited to, buffers, water, pharma- ceutical acceptable excipients).

[0097] In certain embodiments, the present invention provides a vector (e.g., but not limited to, a plasmid, cosmid, phage, virus) comprising an engineered nucleic acid of the present invention, an orthogonal suppressor tRNA (O-tRNA), an orthogonal aminoacyl-tRNA synthetase (O-RS), an antibody gene containing a selector codon. In one embodiment, the vector is an expression vector. In another embodiment, the expression vector comprises a promoter operably linked to one or more of the polynucleotides of the present invention. In another embodiment, a cell comprises a vector comprising a polynucleotide of the present invention. The vector may further comprise a reporter. As used herein, the term "reporter" refers to a component that can be used to select a target component of a system of interest. For example, the reporter can comprise a fluorescent screening marker (e.g., green fluorescent protein), a luminescent marker (e.g., firefly luciferase protein), an affinity-based screening marker, or a selectable marker gene (e.g., his3, ura3, leu2, lys2, lacZ, β-gal / lacZ (β-galactosidase), Adh (alcohol dehydrogenase), etc.).

[0098] The methods and compositions of the invention may include agents, substances and markers for screening or selecting genes, polypeptides or proteins. A selection or screening agent as used herein refers to an agent that, when present, allows for the selection / screening of a particular component from a population. For example, selection or screening agents include, but are not limited to, nutrients, antibiotics, wavelengths of light, antibodies, expressed polynucleotides (e.g., transcriptional modulator proteins), and the like. Selection agents can be varied, for example, by concentration, intensity, and the like. In other embodiments, the methods and compositions of the invention include a detectable substance. A detectable substance can also be used. The term "detectable substance" as used herein refers to an agent that, when activated, modified, expressed, and the like, allows for the selection / screening of a particular component from a population. For example, a detectable substance can be a chemical, for example, 5-fluoroacid (5-FOA), which is a toxic product that becomes detectable under certain conditions, for example, expression of a URA3 reporter, and kills, for example, cells expressing the URA3 reporter. Additionally, the methods, compositions, cells or cell lines of the invention include positive and / or negative selection or screening markers. As used herein, the term "positive selection or screening marker" refers to a marker which, when present (e.g., expression, activation, etc.), results in the identification of cells having the positive selection marker from those that do not have the positive selection marker. As used herein, the term "negative selection or screening marker" refers to a marker which, when present (e.g., expression, activation, etc.), allows for the identification of cells that do not have a desired characteristic (e.g., compared to cells that have the desired characteristic).

[0099] [Orthogonal tRNA and orthogonal aminoacyl-tRNA synthetases] In some embodiments, the invention relates to stable production cell lines containing an orthogonal aminoacyl-tRNA synthetase (O-RS), an orthogonal suppressor tRNA (O-tRNA), and a gene of interest (e.g., a biological therapeutic, including an antibody) containing a selector codon. In eukaryotic cells, the ability to directly genetically modify the structure of proteins, beyond the chemical constraints imposed by the genetic code, provides a powerful molecular tool for probing and manipulating cellular processes. The invention provides translational components that expand the number of genetically encoded amino acids in vertebrate cells. These include tRNAs (e.g., orthogonal tRNAs (O-tRNAs)), aminoacyl-tRNA synthetases (e.g., orthogonal synthetases (O-RSs)), O-tRNA / O-RS pairs, and unnatural amino acids.

[0100] An orthogonal pair is composed of an O-tRNA, e.g., a suppressor tRNA, a frameshift tRNA, etc., and an O-RS. The O-tRNA is not acylated by endogenous synthetases and can mediate the incorporation of an unnatural amino acid into a protein encoded by a polynucleotide containing a selector codon recognized by the O-tRNA in vivo. The O-RS recognizes the O-tRNA and preferentially aminoacylates the O-tRNA with the unnatural amino acid in vertebrate cells. Orthogonal pairs produced by such methods, as well as methods for producing orthogonal pairs, and compositions of orthogonal pairs for use in vertebrate cells, are described in International Patent Application WO2002 / 086075, entitled "Methods and compositions for the production of orthogonal tRNA-aminoacyltRNA synthetase pairs." See also Forster et al, (2003) Programming peptidomimetic synthetases by translating genetic codes designed de novo PNAS 100(11):6353-6357; and Feng et al, (2003), Expanding tRNA recognition of a tRNA synthetase by a single amino acid change, PNAS 100(10):5676-5681; each of which is incorporated herein by reference. The development of multiple orthogonal tRNA / synthetase pairs may allow for the simultaneous incorporation of multiple unnatural amino acids using different codons in vertebrate cells.

[0101] Orthogonal tRNA and orthogonal aminoacyl-tRNA are known in the art.See, for example, WO2008 / 030612, WO2008 / 030614, WO2008 / 030613, WO2006 / 068802, WO2007 / 021297, WO2007 / 070659, USPN8,420,792, USPN9,133,495; USPN7,736,872; USPN7,846,689; USPN7,883,866; USPN7,838,265; USPN7,829,310; USPN7,858,344; USPN7,632,823; and USPN9,586,988, each of which is incorporated herein by reference. Further details for producing O-RS can be found in WO2002 / 086075, entitled "Methods and compositions for the production of orthogonal tRNA-aminoacyltRNA synthetase pairs."Hamano-Takaku et al, (2000) A mutant Escherichia coli Tyrosyl-tRNA Synthetase Utilizes the Unnatural Amino Acid Azatyrosine More Efficiently than Tyrosine, Journal of Biological Chemistry, 275(51):40324-40328; Kiga et al (2002), An engineered Escherichia coli tyrosyl-tRNA See also synthetase for site-specific incorporation of an unnatural amino acid into proteins in vertebrate translation and its application in a wheat germ cell-free system, PNAS 99(15): 9715-9723; and Francklyn et al, (2002), Aminoacyl-tRNA synthetases: Versatile players in the changing theater of translation; RNA, 8:1363-1372.

[0102] Orthogonal O-tRNA / O-RS pairs in vertebrate cells can be produced by importing pairs, e.g., nonsense suppressor pairs, from different organisms that have inefficient cross-species aminoacylation. The O-tRNA and O-RS are efficiently expressed and processed in vertebrate cells, and the O-tRNA is efficiently transported from the nucleus to the cytoplasm. For example, one such pair is the tyrosyl-tRNA synthetase / tRNA from E. coli. CUA(See, e.g., HM Goodman, et al, (1968), Nature 217:1019-24; and DG Barker, et al, (1982), FEBS Letters 150:419-23.) The E. coli tyrosyl-tRNA synthetase synthesizes its cognate E. coli tRNA when both are expressed in the cytoplasm of S. cerevisiae. CUA tRNA efficiently but does not aminoacylate S. cerevisiae tRNA. See, e.g., H. Edwards, & P. ​​Schimmel, (1990), Molecular & Cellular Biology 10:1633-41; and H. Edwards, et al, (1991), PNAS United States of America 88:1153-6. In addition, tyrosyl-tRNA from E. coli CUA Although TyrRS is a poor substrate for S. cerevisiae aminoacyl-tRNA synthetases (see, e.g., V. Trezeguet, et al, (1991), Molecular & Cellular Biology 11:2744-51), it functions efficiently in protein translation in S. cerevisiae. See, e.g., H. Edwards, & P. ​​Schimmel, (1990) Molecular & Cellular Biology 10:1633-41; H. Edwards, et al, (1991), PNAS United States of America 88:1153-6; and V. Trezeguet, et al, (1991), Molecular & Cellular Biology 11:2744-51. Furthermore, E. coli TyrRS does not have an editing mechanism to proofread unnatural amino acids linked to tRNA.

[0103] [Unnatural Amino Acids] The incorporation of unnatural or artificial amino acids can be performed to tailor changes in protein structure and / or function, including altering size, acidity, nucleophilicity, hydrogen bonding, hydrophobicity, accessibility of protease target sites, targeting to moieties (e.g., for protein arrays), and the like. Proteins containing unnatural amino acids can have enhanced or entirely new catalytic or physical properties. For example, the following properties are optionally altered by the inclusion of an anon-natural amino acid in a protein: toxicity, biodistribution, structural properties, spectroscopic properties, chemical and / or photochemical properties, catalytic ability, half-life (e.g., serum half-life), ability to react with other molecules (e.g., covalently or non-covalently), and the like. Compositions comprising proteins that contain at least one unnatural amino acid are useful, for example, for novel therapeutic agents, diagnostic agents, catalytic enzymes, industrial enzymes, binding proteins (e.g., antibodies), and for example, for studying protein structure and function. See, e.g., Dougherty, (2000) Unnatural Amino Acids as Probes of Protein Structure and Function, Current Opinion in Chemical Biology, 4:645-652.

[0104] The unnatural amino acids used in the methods and compositions described herein have at least one of the following four properties: (1) at least one functional group on the side chain of the unnatural amino acid has at least one characteristic and / or activity and / or reactivity that is orthogonal to the chemical reactivity of the 20 common genetically encoded amino acids (i.e., alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine) or is at least orthogonal to the chemical reactivity of a naturally occurring amino acid present in a polypeptide that includes the unnatural amino acid; (2) the introduced unnatural amino acid is substantially chemically inert toward the 20 common genetically encoded amino acids; (3) the unnatural amino acid can be stably incorporated into a polypeptide, preferably with stability comparable to that of a naturally occurring amino acid or under typical physiological conditions, and more preferably, such incorporation is in and (4) the unnatural amino acid preferably comprises an oxime functional group or a functional group that can be converted to an oxime group by reacting with a reagent under conditions that do not destroy the biological properties of the polypeptide that contains the unnatural amino acid (unless, of course, destruction of such biological properties is the purpose of the modification / conversion), or where the conversion can occur under aqueous conditions at a pH of about 4 to about 8, or where the reactive site on the unnatural amino acid is an electrophilic site. Any number of unnatural amino acids can be introduced into a polypeptide. The unnatural amino acid can also comprise a protected or masked oxime, or a protected or masked group, which can be converted to an oxime group after deprotection of the protected group or unmasking of the masked group. The unnatural amino acid can also comprise a protected or masked carbonyl or dicarbonyl group, which can be converted to a carbonyl or dicarbonyl group after deprotection of the protected group or unmasking of the masked group, and thereby available to react with a hydroxylamine or oxime to form an oxime group.

[0105] Unnatural amino acids that may be used in the methods and compositions described herein include, but are not limited to, amino acids containing amino acids with novel functional groups, amino acids that interact covalently or noncovalently with other molecules, glycosylated amino acids such as sugar-substituted serines, other carbohydrate-modified amino acids, keto-containing amino acids, aldehyde-containing amino acids, amino acids containing polyethylene glycol or other polyethers, heavy atom substituted amino acids, chemically cleavable and / or photocleavable amino acids, amino acids with extended side chains compared to natural amino acids, including, but not limited to, polyethers or long chain hydrocarbons, including, but not limited to, hydrocarbons containing more than about 5 or more than about 10 carbons, carbon-linked sugar-containing amino acids, redox-active amino acids, aminothioacid-containing amino acids, and amino acids containing one or more toxic moieties.

[0106] In some embodiments, the unnatural amino acid comprises a sugar moiety. Examples of such amino acids include N-acetyl-L-glucosaminyl-L-serine, N-acetyl-L-galactosaminyl-L-serine, N-acetyl-L-glucosaminyl-L-threonine, N-acetyl-L-glucosaminyl-L-asparagine and O-mannosaminyl-L-serine. Examples of such amino acids also include those in which the naturally occurring N- or O-bond between the amino acid and the sugar is replaced by a covalent bond not commonly found in nature, including, but not limited to, an alkene, an oxime, a thioether, an amide, etc. Examples of such amino acids also include sugars not commonly found in naturally occurring proteins, such as 2-deoxy-glucose, 2-deoxygalactose, etc.

[0107] Specific examples of artificial amino acids include, but are not limited to, p-acetyl-L-phenylalanine, p-propargyloxyphenylalanine, O-methyl-L-tyrosine, L-3-(2-naphthyl)alanine, 3-methyl-phenylalanine, O-4-allyl-L-tyrosine, 4-propyl-L-tyrosine, tri-O-acetyl-GlcNAcβ-serine, L-Dopa, fluorinated phenylalanine, isopropyl-L-phenylalanine, p-azido-L-phenylalanine, p-acyl-L-phenylalanine, p-benzoyl-L-phenylalanine, L-phosphoserine, phosphonoserine, phosphonotyrosine, p-iodo-phenylalanine, p-bromophenylalanine, p-amino-L-phenylalanine, and isopropyl-L-phenylalanine.

[0108] Chemical moieties incorporated into polypeptides through the incorporation of unnatural amino acids into such polypeptides provide various advantages and manipulation of the polypeptide. For example, the unique reactivity of carbonyl or dicarbonyl functional groups (including keto or aldehyde functional groups) allows for selective modification of proteins with any of a number of hydrazine or hydroxylamine-containing reagents in vivo and in vitro. Heavy atom unnatural amino acids can be useful, for example, for phasing x-ray structural data. Site-specific introduction of heavy atoms using unnatural amino acids also provides selectivity and flexibility when selecting the location of the heavy atoms. Photoreactive unnatural amino acids (including, but not limited to, amino acids with benzophenone and aryl azide (including, but not limited to, phenyl azide) side chains) allow, for example, efficient in vivo and in virto photocrosslinking of polypeptides. Examples of photoreactive unnatural amino acids include, but are not limited to, p-azido-phenylalanine and p-benzoyl-phenylalanine. Polypeptides with photoreactive unnatural amino acids can then be crosslinked by excitation of the photoreactive groups, providing temporal control. In a non-limiting example, the methyl group of an unnatural amino can be substituted with isotopic labels, including but not limited to, the methyl group, as a probe of local structure and dynamics, including but not limited to, using nuclear magnetic resonance and vibrational spectroscopy.

[0109] The uptake of unnatural amino acids by eukaryotic cells is one issue that is typically considered when designing and selecting unnatural amino acids, including but not limited to incorporation into polypeptides or proteins. For example, the high charge density of α-amino acids suggests that these compounds are unlikely to be cell-permeable. Natural amino acids are taken up into eukaryotic cells via a collection of protein-based transport systems. Rapid screening can be performed to evaluate which unnatural amino acids, if any, are taken up by cells. See, for example, toxicity assays in U.S. Patent Application Publication No. 2004 / 198637, entitled "Protein Arrays," and Liu, DR & Schultz, PG (1999) Progress toward the evolution of an organism with an expanded genetic code. Proc. Natl. Acad. Sci. USA., 96:4780-4785, which are incorporated herein by reference in their entirety. Although uptake is easily analyzed in a variety of assays, an alternative to designing unnatural amino acids that can follow cellular uptake pathways is to provide a biosynthetic pathway to make the amino acid in vivo.

[0110] Typically, unnatural amino acids produced via cellular uptake as described herein are produced at concentrations sufficient for efficient protein biosynthesis, including but not limited to natural cellular amounts, but not to an extent that affects the concentrations or excretion cellular resources of other amino acids. Typical concentrations produced in this manner are from about 10 mM to about 0.05 mM.

[0111] Many biosynthetic pathways already exist in cells for the production of amino acids and other compounds. Although biosynthetic methods for certain unnatural amino acids may not exist in nature (including, but not limited to, cells), the methods and compositions described herein provide such methods. For example, biosynthetic pathways for unnatural amino acids can be created in host cells by adding new enzymes or modifying existing host cell pathways. Additional new enzymes include naturally occurring enzymes or artificially evolved enzymes. For example, the biosynthesis of p-aminophenylalanine (as presented in the examples of WO2002 / 085923 entitled "In vivo incorporation of unnatural amino acids") relies on the addition of a combination of known enzymes from other organisms. Genes for these enzymes can be introduced into eukaryotic cells by transforming the cells with plasmids containing the genes. When expressed in the cells, the genes provide an enzymatic pathway for synthesizing the desired compound. Examples of the types of enzymes that are optionally added are provided herein. Additional enzyme sequences can be found, for example, in Genbank. Artificially evolved enzymes can be added to cells in the same manner. In this way, the cellular machinery and resources of the cell are engineered to produce unnatural amino acids.

[0112] A variety of methods are available for producing novel enzymes for use in biosynthetic pathways or for evolution of existing pathways. For example, recursive recombination (including, but not limited to, that developed by Maxygen, Inc. (available on the world wide web at maxygen.com)) can be used to develop novel enzymes and pathways. See, e.g., Stemmer (1994), Rapid evolution of a protein in vitro by DNA shuffling, Nature 370(4):389-391; and Stemmer, (1994), DNA shuffling by random fragmentation and reassembly: In vitro recombination for molecular evolution, Proc. Natl. Acad. Sci. USA., 91:10747-10751. Similarly, DesignPath™ developed by Genencor (available on the world wide web at Gencor.com) is optionally used for metabolic pathway engineering (including, but not limited to, engineering pathways to make unnatural amino acids in cells). This technology reconstructs existing pathways in a host organism using a combination of new genes (including, but not limited to, those identified by functional genomics, molecular evolution, and design). Diversa Corporation (available on the World Wide Web at diversa.com) also provides technology for the rapid screening of libraries of genes and gene pathways (including, but not limited to, creating new pathways for the biosynthetic production of unnatural amino acids).

[0113] Typically, unnatural amino acids produced using engineered biosynthetic pathways as described herein are produced at concentrations sufficient for efficient protein biosynthesis (including, but not limited to, natural cellular amounts, but not to an extent that affects the concentrations of other amino acids or the excretory cellular resources). Typical concentrations produced in vivo in this manner are from about 10 mM to about 0.05 mM. Once cells are transformed with a plasmid containing the genes used to produce the enzymes desired for a particular pathway, and the unnatural amino acid is made, in vivo selection is used to further optimize the production of the unnatural amino acid for both ribosomal protein synthesis and cell growth, as needed. The unnatural amino acids described herein may be synthesized using methodologies described in the art, or using techniques described herein, or by a combination thereof.

[0114] Product Characterization Comprehensive characterization of biological therapeutics is necessary to meet safety standards set by regulatory agencies and help ensure efficacy of protein drugs. Biopharmaceutical characterization is necessary throughout all stages of drug development and manufacturing. Therefore, it is paramount to monitor product quality during each stage of cell line development, manipulation, and cell culture process development to ensure that appropriate clones are selected, as product quality and productivity are often dependent on both the clone and cell culture conditions. During the clone selection process, emphasis is placed on product quality parameters that are likely to be clone specific. These parameters include, but are not limited to, enzymatic processes such as glycosylation and proteolytic clipping, as well as genetic issues such as mutations, frameshifts, and splices. Emphasis is also placed on molecular parameters known to contribute to biological activity. For example, antibody-dependent cellular cytotoxicity (ADCC) depends on fucosylation, and complement-dependent cytotoxicity (CDC) depends on galactosylation. Differences observed between clones in the extent of chemical modifications such as oxidation or deamidation can be narrowed or eliminated by optimization of the purification process or by adjustment of cell culture process parameters, and are less significant (Lewis et al, 2010).

[0115] In an embodiment of the present invention, the effect of CRISPR-Cas9 genome editing and single-cell cloning on the product quality of cells or cell lines expressing biological therapeutic agents is tested. Product quality attributes evaluated during clonal selection of CRISPR-Cas9 engineered cells may include, but are not limited to, molecular integrity, aggregation, glycosylation, and charge heterogeneity. Molecular integrity is clone-dependent and may be caused by genetic problems or proteolytic clipping. Various methodologies, techniques, and assays well known to those skilled in the art can be used to evaluate molecular integrity with criteria to avoid amino acid sequence mutations or truncated antibodies. Such methodologies, techniques, and assays may include, but are not limited to, cDNA sequencing, peptide mapping, CE-SDS or SDS-PAGE. Aggregation can be measured, for example, using size exclusion chromatography (SEC). The criterion for this analysis is to avoid high levels of aggregation, which may be immunogenic. Some levels of aggregation can be reduced by optimization of the cell culture process or eliminated by optimization of the purification process. Glycosylation is another important molecular and post-translational attribute that is highly cell line dependent. HPLC or CE-based glycan assays, well known in the art, are commonly used for glycosylation evaluation during the clonal selection stage, aiming to avoid high levels of abnormal glycosylation forms. Charge heterogeneity that may occur due to chemical modifications is highly dependent on the cell culture process and therefore has a less important role during the clonal selection stage. Thus, in an embodiment of the present invention, the present disclosure provides methods, techniques and assays for determining clone-specific product quality parameters of cells or cell lines expressing the biological therapeutic agents of the present invention, including but not limited to anti-Her2, anti-CD70, or anti-PSMA expressing cells or cell lines.

[0116] Intact mass spectrometry (MS) provides information about the exact mass of a protein and the relative abundance of its isoforms. Size exclusion chromatography (SEC), also known as molecular sieve chromatography, is a chromatographic method in which molecules in solution are separated by their size, and sometimes by molecular weight. In the present invention, MS was used to demonstrate that the primary amino acid sequences of the engineered clones and parent cell lines produced were the same as those predicted from the cDNA sequence in confirming the identity of the mAb. SEC was also used to determine the purity and manufacturing integrity of the modified and produced monoclonal antibodies (mAbs).

[0117] 〔kit〕 A kit is also a feature of the invention, where the kit comprises one or more containers containing any of the components of the invention. The kit may include one or more engineered nucleic acid molecules or polynucleotide sequences that contain or encode an orthogonal aminoacyl-tRNA synthetase (O-RS), and / or an orthogonal suppressor tRNA (O-tRNA), and / or a gene of interest containing a selector codon. The kit may include at least one artificial amino acid. In another embodiment, the kit may include cells or strains together or separately with the orthogonal aminoacyl-tRNA synthetase (O-RS), the orthogonal suppressor tRNA (O-tRNA), or the gene of interest containing a selector codon. Any of the components, materials disclosed herein may be provided separately or together in one or more containers. In another embodiment, the kit further includes instructional materials for producing a polypeptide or protein of interest.

[0118] [Example] It is understood that the examples and embodiments described herein are for illustrative purposes only, and that various modifications or changes thereon may be suggested to those skilled in the art and are to be included within the spirit and scope of this application and the scope of the appended claims.

[0119] Example 1: Strategies for utilizing platform cell line engineering in the drug development industry: from discovery to manufacturing In an industrial perspective, platform cell line development not only supports every stage of drug development by providing stepwise appropriate material, but also generates stable and well-characterized production cell lines before introducing the product into clinical and commercialization (Figure 1). To efficiently support every stage of drug development, we developed multiple methods to provide material, including transient stable bulk pools, and developed stable cell lines, as shown in Figure 1. For the selection of antibody candidate molecules, transient expression was utilized to rapidly provide small amounts of product. Stable bulk pools are an alternative method to provide large amounts of material for developability testing (purification, formulation, analytical method development) up to IND-permitted toxicity testing (100-200 g) in 8 weeks. Once the lead molecule was determined, stable cell lines were generated in 6 months with titers up to 1.5 g / L. This gives support for clinical trials and potential commercialization.

[0120] Example 2: General procedure for utilizing platform cell lines in the development of high producing cell lines. Figure 2 shows a flow chart for stable cell line development. We used this strategy to generate highly productive, stable, well-characterized production cell lines that are scalable to industry standard manufacturing to support clinical trials and commercialization while maintaining the desired safety and efficacy properties of the therapeutic. Mammalian expression vectors carrying the gene of interest (GOI) and selectable markers were transfected into the engineered CHO platform cell line to generate minipools (MPs) in 96-wells. After selection and screening, the best MPs were plated as single cells per well using FACS, followed by high-resolution imaging to derive clonal cell lines. Single-cell derived cell lines were screened and the best clones were transferred to cell culture populations for process development. Final clone selection for producing clinical material was based on growth, productivity and PQ. The entire CLD process took 6 months with cell specific productivity of 20-30 picograms per cell per day. The cell line and fed-batch process, stable for more than 10 weeks to support 12,000 L bioreactor production, can so far be scaled up to 2000 L to support ongoing clinical trials.

[0121] Example 3: Optimization of high-producing cell line development Optimization of high-producing cell line development can be achieved from several aspects, such as FACS-dependent single-cell deposition (Figure 3A), CRISPR knockout procedure (Figure 3B), and cell line development process optimization (Figure 3C).

[0122] Regulatory guidance (ICH Q5D) directs cloning of cell substrates "from single-cell precursors" during cell line development. During the past few years, the expectation that provides high assurance of clonality has been established by the FDA and industry (Kennett, 2014; Novak, 2017; Welch, 2017). The FDA recommends that two rounds of limiting dilution cloning (LDC) at a sufficiently low seeding density (<0.5 cells / well) provide an acceptable probability that the cell line is clonal. More recently, one round of cloning by FACS or LDC with sufficient supporting validity, such as the use of imaging techniques, provides acceptable assurance of clonality when using validated methods. Thus, we have modified and validated FACS single-cell deposition (FACS SCD) combined with high-resolution imaging as one round of cloning steps in the cell line development process to shorten the timeline and meet regulatory requirements for ensuring clonality.

[0123] As shown here (Figure 3A), compared to conventional limiting dilution cloning (LDC), FACS SCD produced comparable deposition and proliferation rates. However, the efficiency of isolating monoclonal proliferation using the FACS approach (ratio of number of wells containing single-cell-derived colonies divided by total number of wells) was 1.5-fold higher than that using LDC (49% vs. 32%), saving significant time and resources in imaging and screening. Extensive optimization in FACS measurement and centrifugation g-force variation, along with thorough image analysis for each well, was performed to validate this approach. The probability of monoclonality of single-cell-derived colonies was observed to be >99.5%.

[0124] Genetic engineering of producing cell lines with CRISRR-cas9 genome editing technology has been tested to target a panel of genes to improve cell growth and productivity while maintaining the desired product quality. The CRISPR knockout procedure is shown in Figure 3B. A web-based target discovery tool, CRISPy, was used to rapidly identify gRNA target sequences, preferably in early exons with zero off targets in CHO-K1 cells. The gRNA was cloned into the mammalian expression vector pGNCV, which co-expresses the CHO codon-optimized version of Cas9. The producing cell lines were transfected with the vector pGNCV to generate pools of cells, which were subsequently cloned to identify single-cell isolates with gene knockout. The indel (insertion / deletion) frequencies from the combined results of multiple projects were 30-90% and 50-80% for pools of cells and single-cell isolates, respectively. Western blot reconfirmed that the knockout efficiency was 50-90% for DNA sequencing to validate the knockout single-cell isolates. The knockout single cell clones were further evaluated for productivity, proliferation, apoptosis assay and product quality, and the producing clones were selected for cGMP manufacturing. The validated targets used for knockout were tested with producing cell lines. This proved to be beneficial to evaluate productivity and proliferation, and was applicable to disruption in platform cell line hosts using CRISPR, increasing the efficiency of isolating high-producing cell lines for future genes of interest.

[0125] The cell line development process has also been optimized along with the platform cell line development. Using the first platform cell line as the host, it takes 3-4 steps (or 9-12 months) to generate a production cell line producing a titer of 0.5-1 g / L (Figure 3C). The current cell line development process has been shortened to 2 steps or 6 months due to the improvement of the platform cell line and one-step cloning as shown in (Figure 2).

[0126] Example 4: Platform cell lines exhibit excessive apoptosis in culture. Using the Annexin V assay, we assessed the viability of CHO-S cells and the platform cell line 4E2, which contains a genetically engineered orthogonal pair of tRNA / aminoacyl-tRNA synthetase specific for para-acetyl-L-phenylalanine. As shown in Figure 4, 4E2 exhibited excessive apoptosis (85% viability) compared to CHO-S cells (96% viability). The observations indicate that 4E2 cells, which have incorporated a tRNA synthetase and tRNA pair (e.g., specific for the unnatural amino acid paraacetylalanine, pAF), exhibited more excessive apoptosis than their counterparts, CHO-S cells.

[0127] Example 5: Design and preparation of BAX- and BAK-CRISPR constructs CRISPR constructs were designed to recognize target sites in the BAX or BAK genes and make double-stranded breaks in CHO cells after transfection. Exemplary designs are shown in Figures 5, 6 and 7.

[0128] Gene knockout can be performed using sequential or simultaneous procedures. Double knockout of BAX and BAK can also be achieved by sequential knockout procedures. In general, the first step is to apply three BAX-targeting gRNA constructs on an anti-HER2 expressing cell line. After similar production used in the simultaneous knockout procedure, a cell line with BAX knockout is isolated. With this cell line, two BAK-targeting gRNA constructs are applied to achieve BAK knockout. After verification by genomic DNA sequencing, the BAX and BAK double knockout cell line is confirmed to have been achieved by such a sequential procedure.

[0129] CRISPR gRNA design of targeting BAX gene in CHO cells is shown in Figure 5. As shown, three gRNA sites targeting BAX gene in CHO cells were designed using an online CRISPR gRNA design tool specific for the CHO-K1 genome (see the world wide web at staff.biosustain.dtu.dk / laeb / crispy / ). The genomic DNA sequence of the BAX gene, exon 1 and exon 2 are shown in grey shading. The rest of the sequence of BAX is shown in plain text. The primers used in PCR sequencing are shown at the beginning and end of the sequence as forward and reverse primers, respectively. As shown in Table 1, the three BAX sites (each having a 19 nucleotide long sequence, the -NGG PAM (protospacer adjacent motif) sequence is omitted during the design due to the nature of the plasmid pGCNV, which has two cohesive ends that are cut open as shown in Figure 7) are as follows: site-I (AGGCACTCGCTCAACTTCG) (SEQ ID NO: 1), site-II (TGAGTGTGACCGGCTGTTG) (SEQ ID NO: 2) and site-III (TTTCATCCATGTATCGAGCT) (SEQ ID NO: 3).

[0130] CRISPR was used to design gRNAs targeting BAK gene in CHO cells, as shown in Figure 6. Figure 6 shows the genomic DNA sequence of BAK gene in CHO cells annotated with two gRNA sequences. The genomic DNA sequence of BAK gene, exon 2 and exon 3 are shown in grey shading. Other sequences of BAK are shown in plain text. Primers used in PCR sequencing are shown at the beginning and end of the sequence as forward and reverse primers, respectively. The three BAK sites shown in Table 1 are as follows: (SEQ ID NO: 4) BAK-IGAACAAATTGTCCATCTCG Exon 2, (SEQ ID NO: 5) BAK-IIATGCTGTAAGAACGGGAGT Exon 3, (SEQ ID NO: 6) BAK-IIIGAAGCCGGTCAAACCACGT Exon 3.

[0131] The CRISPR plasmids used in the BAX or BAK knockout experiments were also designed using a commercially available vector, Geneart CRISPR nuclease vector (pGCNV) (Thermo Fisher Scientific), as shown in Figure 7. The complete pGCNV plasmid was prepared by inserting oligoduplexes into a cut-out pGCNV vector containing slots for the oligoduplexes, and designed with specific 19-nucleotide long gRNA sequences to individually target gene sites (see Table 1 elsewhere herein).

[0132] To form an oligoduplex that can be inserted into pGCNV, five (5) pairs of oligos were synthesized as disclosed in Table 3 below.

[0133] [Table 3]

[0134] To generate double-stranded oligonucleotides, each oligo pair is incubated in oligonucleotide annealing buffer at 95°C for 4 min at a final concentration of 50 uM, followed by cooling to 25°C for 5-10 min. After 10-fold dilution (5 uM), the oligonucleotide duplexes can be used for the ligation procedure. Ligation can be performed using the Roche quick ligation kit (Roche). In a 21 ul reaction, it contains 3 ul of pGCNV vector, 1 ul of oligo duplex, 2 ul of DNA dilution buffer, 4 ul of water, 10 ul of T4 DNA ligase buffer and 1 ul of T4 ligase. The reaction mixture was incubated at room temperature for 5 min. 3 ul of the ligation mixture can be used to transform E. coli to screen for positive clones.

[0135] Example 6: Examples of unnatural amino acids for use in the present invention The present invention encompasses the site-specific incorporation of non-canonical or unnatural amino acids in genes of interest using orthogonal aminoacyl-tRNA synthetase / transfer RNA pairs as discussed elsewhere herein. Figure 8 provides a representative number of unnatural amino acids that can be used. In an exemplary format, one such unnatural amino acid, para-acetyl-L-phenylalanine (pAF), is added to the culture medium to initiate production of a fully assembled gene of interest, such as a biological therapeutic, including a monoclonal antibody, with site-specific incorporation of pAF.

[0136] Example 7: Generation and analysis of BAX / BAK-deficient anti-HER2 expressing cell lines Simultaneous excision of BAX and BAK was performed using CRISPR technology. Transient transfection was performed with three BAX-targeting gRNA constructs and two BAK-targeting gRNA constructs on anti-HER2 expressing cell line L082. Plasmid transfection was performed by electroporation. During electroporation, 6 million cells were mixed with 2ug of DNA plasmid in 100ul of electroporation water solution. Cells were transfected into Amaxa Nucleofector II (Lonza) using program U-023 and collected in 0.5ml of warm medium. Surveyor was performed on the pool of transfected cells to measure knockout efficiency as disclosed in Example 3, Figure 3B. Seven days after simultaneous transfection of three BAX-targeting gRNA constructs with two BAK-targeting gRNA constructs, cells were subcloned into single clones using limiting dilution at a seeding density of 0.5 cells / well in 96-well plates. Each single cell in the 96-well plate was grown for approximately 2–3 weeks to generate sufficient numbers of cells for further genetic analysis. Single-cell derived clones were selected and screened in 96-well, 24-well and 24-deep well plates for productivity, proliferation and genotyping by targeted DNA sequencing.

[0137] Example 8: DNA analysis of BAX and BAK deleted anti-HER2 expressing clones BAX and BAK inactive CHO cells were generated and analyzed at the gene level. Three plasmids encoding three different gRNA sequences targeting the BAK site were co-transfected into a stable cell line derived from CHO cells engineered to carry pAF-RS and pAF-tRNA+anti-HER2 gene or a fragment thereof. 72 hours after transfection, genomic DNA was isolated and a portion of the BAK locus was PCR amplified using oligos KI-II-F and KI-II-R (Table 2; 5'CAGACAGCCTTCTCTTGCT-3' (SEQ ID NO: 45) and 5'AGAGCTCCTGAGAGGCATGA-3' (SEQ ID NO: 46)). PCR was performed using Phusion High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, MA). The conditions were as follows: after an initial denaturation at 95°C for 2 min, 30 cycles of PCR were performed with denaturation at 95°C for 20 s, followed by an annealing step at 60°C for 30 s, followed by an extension at 72°C for 1 min. After the 30 cycles, the reactions were incubated at 72°C for 5 min and then at 4°C indefinitely. To assess knockout efficiency, PCR products were used in Surveyor assay analysis. Surveyor assay detection was performed using the Surveyor Mutation Detection Kit from IDT (Integrated DNA Technology, San Diego, CA). Heteroduplexes were formed using a thermocycler to mimic the natural cooling procedure of the heated oligo mixture. The following procedure was used for heteroduplex formation: 95°C for 10 min, followed by cooling from 95°C to 85°C (-2.0°C / s), incubation at 85°C for 1 min; cooling from 85°C to 75°C (-0.3°C / s), incubation at 75°C for 1 min; cooling from 75°C to 65°C (-0.3°C / s), incubation at 65°C for 1 min; cooling from 65°C to 55°C (-0.3°C / s), incubation at 55°C for 1 min; cooling from 55°C to 45°C (-0.3°C / s), incubation at 45°C for 1 min; cooling from 45°C to 35°C (-0.3°C / s), incubation at 35°C for 1 min; cooling from 35°C to 25°C (-0.3°C / s), incubation at 25°C for 1 min; then at 4°C indefinitely. Heteroduplex DNA (20ul) was incubated with 1ul of Surveyor Enhancer S (2ul) and Surveyor Nuclease S (1ul) for 60 minutes at 42°C. 10ul of digested sample was run on a 1% agarose gel alongside 10ul of undigested sample. Surveyor assay was performed on transfected pools of cells to measure knockout efficiency as disclosed in Example 3, Figure 3B, as shown in Figure 9. Analysis of knockout efficiency was performed on anti-HER2 expressing cell populations. The decrease of the top band and the appearance of a new band at the bottom indicate efficiency, which can be quantified by densitometric analysis of the scanned image with Image J software. The ratio of the original band before and after CRISPR KO was used to measure knockout efficiency. Knockout efficiency for BAX and BAK was 30% and 70%, respectively, resulting in a calculated double knockout efficiency of 21%.

[0138] Genomic DNA isolation and DNA sequencing were performed using single-cell replicate plates containing 96-well plates. QuickExtract aqueous solution was used for high-throughput isolation of genomic DNA. 150ul of cell culture supernatant was removed from the culture, and then 150ul of QuickExtract aqueous solution was added. After lysis at room temperature for 10 minutes, the cell lysate was transferred to a new microtube and heated on a heating block at 65°C for 6 minutes, followed by 98°C for 2 minutes.

[0139] Genomic DNA extracts were used for PCR amplification. The PCR products were then purified and sequenced. Sequencing results were analyzed using the alignment tool in the Vector NTI software suite. The genomic sequence of the gene (in this case, the BAK gene) obtained on the World Wide Web at CHOgenome.org was used as the wild-type sequence during alignment analysis. Figure 10 shows the DNA sequencing results of 20 single-cell clones after BAK knockout using CRISPR. The top DNA sequence (Bak-CHO-gDNA1) is the DNA sequence of the genomic region of the original BAK gene. Only the "ZA_112_K32_BakI-II" clone has a sequence identical to the original BAK gene. The other genes shown have either deletions or insertions in these sequences. Similar observations were observed with BAX (data not shown).

[0140] Example 9: Protein analysis of BAX and BAK knockouts in anti-HER2 expressing clones BAX and BAK knockout anti-HER2 expressing single cell derived cell lines were tested for BAX protein expression using Western blot analysis (Figure 11). Lysates from 6 million BAX / BAK double knockout cell lines were prepared by resuspending in 100ul of RIPA buffer (Abcam) + protease inhibitor (Sigma tablets, Sigma). Lysates were incubated on ice for 1 hour and then centrifuged at 12,000 rpm for 20 minutes. Protein concentration was measured by BCA kit (Pierce). 20ug of protein was used for Western blot. Protein extracts from different cell lines were probed with anti-BAX antibody (Abcam). As shown in Figure 11, BAX / BAK double knockout cell lines such as BB15, BB12 and BBS19 did not express detectable BAX protein. In contrast, as a positive control cell line, L082 showed expression of full-length BAX, a 21-KD protein. Although genetically characterized as BAX deficient by gene sequencing, the UBB3 cell line was found to express residual BAX, and a similar observation was made with BAK (data not shown).

[0141] Example 10: Apoptosis is prevented in BAX / BAK-deficient anti-HER2 expressing cell lines BAX / BAK double knockout cell lines were tested for their resistance to apoptosis. The apoptosis resistance properties were evaluated during the fed-batch procedure. Flow cytometry analysis of Annexin V staining of cells on day 12 in the fed-batch was performed. A standard protocol using the FITC Annexin V Apoptosis Detection Kit from BD Biosciences was followed under the product's recommended conditions. Cells can be divided into four stages and / or populations during the apoptosis assay: normal viable cell stage (quadrant 3, Q3), early stage of apoptosis (quadrant 4, Q4), late stage of apoptosis (quadrant 2, Q2), and dead cell stage (quadrant 1, Q1). As shown in Figure 12A, non-knockout normal (control) L082 cells showed severe apoptosis as shown in Q4 (11.8%) and Q2 (41.8%). In contrast, the BAX / BAK double knockout cell line (BB15) showed much improved viability (Q3, 80.9%) and resistance to apoptosis (Q4, 13.2%; Q2, 3.5%), as shown in Figure 12B. Accordingly, apoptotic cells were observed to decrease from 53% to 17%.

[0142] Example 11: Recombinant protein production is increased in BAX / BAK-deficient anti-HER2 expressing cell lines Antibody production was evaluated in both batch and fed-batch procedures (Figures 13 and 14, respectively). Under batch culture conditions, the unnatural amino acid pAF was added to the culture medium on day 3 to initiate the production of fully assembled anti-HER2 antibodies with site-specific incorporation of pAF. As expected for anti-apoptotic engineering, the peak cell density as measured by viable cell density (VCD) of knockout cells (Figure 13A) was 25% higher than that of the parental cells, and the production time (Figure 13B) was extended from 7 to 10 days for the parental cells. Strikingly, the daily Qp on day 7 of knockout cells (Figure 13D) was improved by 50% over the parental cells, likely due to the maintained cell activity resulting from the anti-apoptotic engineering. The BAX / BAK double knockout cell line showed a 1.8-fold increase in titer (270 mg / L vs. 150 mg / L) compared to the parental cells (Figure 13C) on day 7 of production.

[0143] Under fed-batch conditions (FIG. 14), the combination of improved growth based on peak cell density (VCD) as shown in FIG. 14A, production time (FIG. 14B), and cell specific productivity (FIG. 14D) resulted in a 3.3-fold increase in titer for the BAX / BAK double knockout cell line (FIG. 14C), representing the BB15 clone with a titer of 1500 mg / L compared to the parental cell line (L082, 450 mg / L).

[0144] Example 12: Product quality of BAX / BAK deficient anti-HER2 expressing cell lines The quality of the product was analyzed by intact mass spectrometry (MS) and size exclusion chromatography (SEC) using samples produced by fed-batch production from the anti-HER2 expressing parental cell line and the BAX / BAK double knockout anti-HER2 expressing cell line (Table 4). It was observed by MS that the primary amino acid sequences of the engineered clone and the parental cell line were identical to those predicted from the cDNA sequence confirming the identity of the mAb (data not shown).

[0145] [Table 4]

[0146] Product quality was analyzed using samples produced by fed-batch production from parental and BAX / BAK double knockout anti-HER2 expressing cell lines, as shown in Table 4. Glycotype profiles assessed by MS were comparable before (HER2-L082) and after (HER2-BB15) knockout and were within the normal distribution range of the mAb at the clonal selection stage. SEC showed that the percentage of high molecular weight (HMW) aggregates and low molecular weight (LMW) degradation species were both less than 5% and comparable before and after manipulation, indicating that the knockout and single cell cloning procedures did not negatively impact the purity of the product.

[0147] Example 13: Generation of BAX / BAK-deficient anti-PSMA expressing cell lines Simultaneous excision of BAX and BAK using CRISRP technology was performed by transfection of three BAX-targeting gRNA constructs and two BAK-targeting gRNA constructs into the anti-PSMA expressing cell line KO183. The BAX and BAK constructs used in this experiment were designed and prepared as described in the Examples above and shown in Figures 5-7 and Tables 1-3. The CRISPR plasmid used in the knockout experiments for anti-PSMA was also designed as shown in Figure 7 using a commercially available vector, Geneart CRISPR Nuclease Vector (pGCNV) (Thermo Fisher Scientific). The oligo duplex inserted into pGCNV contained five (5) pairs of synthetic oligos, SEQ ID NO:83 to SEQ ID NO:92.

[0148] Three plasmids encoding three different gRNA sequences targeting the BAX site and two plasmids encoding two different gRNA sequences targeting the BAK site were co-transfected into a stable cell line derived from CHO cells engineered to carry pAF-RS and pAF-tRNA+anti-PSMA gene or fragments thereof. 72 hours after transfection, genomic DNA was isolated and a portion of the BAK locus was PCR amplified using oligos with SEQ ID NOs: 45 and 46 as described in Example 8. The BAX locus was PCR amplified using oligos with SEQ ID NOs: 43 and 44 instead. DNA analysis of BAX and BAK deleted anti-PSMA expressing clones was performed as described in the above examples. Surveyor assay was performed to determine the knockout efficiency in the anti-PSMA expressing cell population based on CRISPR editing technology as shown in Figure 15. The ratio of the original bands before and after CRISPR KO was used to measure the knockout efficiency. The knockout efficiency for Bax and Bak was 42% and 53%, respectively, resulting in a calculated double knockout efficiency of about 20%.

[0149] After 7 days, the transfected pool of cells was subcloned into 40 plates at a seeding density of 1 cell / well using FACS. Approximately 1000 image-confirmed single-cell derived clones were selected and screened in 96-well, 24-well and 24-deep well plates for productivity, proliferation and genotyping by targeted DNA sequencing.

[0150] DNA analysis of BAX and BAK deleted anti-PSMA expressing clones was performed as described in Example 8 (data not shown). The best KO183 BAX / BAK double KO clone (KO183 BB KO) was selected for further evaluation of growth and productivity by a 2-month stability study and for confirmation of the knockout status by Western blotting.

[0151] As shown in Figure 16, protein analysis of BAX and BAK knockout in anti-PSMA expressing clones was evaluated by using Western blot. Lysates from 6 million BAX / BAK double knockout cell lines were prepared by resuspending in 100ul RIPA buffer (Abcam) + protease inhibitor (Sigma tablets; Sigma). Lysates were incubated on ice for 1 hour and then centrifuged at 12,000 rpm for 20 minutes. Protein concentration was measured by BCA kit (Pierce). 20ug of protein was used for Western blot. Protein extracts from different cell lines were probed with anti-BAX antibody (Abcam).

[0152] Figure 16A shows BAX knockout in anti-PSMA expressing clones engineered with CRISPR. Figure 16B, BAK knockout in anti-PSMA expressing clones engineered with CRISPR. Of the top 15 clones shown, 5 clones were BAX / BAK double knockout. L082 is a positive control cell line expressing wild type or full length BAX, 21 KD protein and wild type BAK, 24 KD protein. Anti-HER2 expressing BB15 cells were used as a double knockout control.

[0153] Apoptosis analysis was further performed in the anti-PSMA expressing clones of the present invention by Annexin-V binding apoptosis assay. As shown in Figure 17, BAX / BAK double knockout clones, such as PSMA-192 and PSMA-719, showed approximately 85% cell viability compared to approximately 35-37% observed in single knockout clones, such as PSMA-882 and non-knockout clones, such as PSMA-484.

[0154] Example 14: Recombinant protein production is increased in BAX / BAK-deleted anti-PSMA expressing clones Based on analysis of anti-PSMA expressing BAX and BAK clones by Western blotting and Annexin V analysis, a number of stable clones were selected for further optimization. Three (3) stable clones 192, 719 (both with BAX / BAK knockout) and 882 (BAK knockout) were selected for process optimization to improve titer based on the high productivity, robust growth and 2-month stability observed for each.

[0155] Antibody production was evaluated in a fed-batch process as shown in Figure 18. Under fed-batch conditions, the BAX / BAK double knockout cell line (PSMA-BBKO-192) showed a three-fold increase in product titer at day 10 (1400 mg / L vs. 500 mg / L) (Figure 18C). At the same time, viability was significantly improved to over 90% (Figure 18B). The unengineered cell line PSMA-S-164 was used as a control.

[0156] Example 15: Product quality of BAX / BAK-deficient anti-PSMA expressing cell lines Product quality was analyzed by intact mass spectrometry and size exclusion chromatography (SEC) using samples produced by fed-batch production from an anti-PSMA expressing control cell line (PSMA-S-164), and a BAX / BAK double knockout anti-PSMA expressing cell line (PSMA-BBKO-192) as disclosed in Table 5. It was observed by MS that the primary amino acid sequences of the engineered clones and parental cell line were identical to those predicted from the cDNA sequence confirming the identity of the mAb (data not shown).

[0157] [Table 5]

[0158] As shown in Table 5, glycoform characteristics assessed by MS were comparable between the non-engineered cell line (PSMA-S-164) and the BAX / BAK double knockout cell line (PSMA-BBKO-192) and were within the normal distribution range for the mAb at the clonal selection stage. SEC measured the percentage of high molecular weight (HMW) aggregates, and nrCE-SDS measured the percentage of low molecular weight (LMW) degradation species. Both HMW aggregates and LMW degradation species were less than 5% and comparable between the non-engineered and engineered cell lines of anti-PSMA expression. These quality characteristics indicate that CRISPR-Cas9 engineering and subsequent single-cell cloning did not adversely affect the product quality of the anti-PSMA expressing cell lines.

[0159] Example 16: Generation of BAX / BAK-deficient anti-CD70 expressing cell lines Simultaneous excision of BAX and BAK using CRISRP-Cas9 editing technology was performed by transfection of three BAX-targeting gRNA constructs and two BAK-targeting gRNA constructs into an anti-CD70-expressing minipool cell population (CD70-MW-108). The BAX and BAK constructs used in this experiment were designed and prepared as described in the Examples above and shown in Figures 5-7 and Tables 1-3. The CRISPR plasmids used in the knockout experiments related to anti-CD70 were also designed as shown in Figure 7 using a commercially available vector, Geneart CRISPR Nuclease Vector (pGCNV) (Thermo Fisher Scientific). The oligo duplex inserted into pGCNV contained five (5) pairs of synthetic oligos, SEQ ID NO:83 to SEQ ID NO:92.

[0160] Three plasmids encoding three different gRNA sequences targeting the BAX site and two plasmids encoding two different gRNA sequences targeting the BAK site were co-transfected into a stable cell line derived from CHO cells engineered to carry pAF-RS and pAF-tRNA+anti-PSMA gene or fragments thereof. 72 hours after transfection, genomic DNA was isolated and a portion of the BAK locus was PCR amplified using oligos with SEQ ID NO: 45 and 46 as described in Example 5. Instead, the BAX locus was PCR amplified using oligos with SEQ ID NO: 43 and 44. As shown in Figure 19, a Surveyor assay was performed to determine the knockout efficiency in the anti-CD70 expressing cell population based on the CRISPR editing technology. The ratio of the original bands before and after CRISPR KO was quantified by densitometric analysis of the scanned images with Image J software and used to measure the knockout efficiency. The knockout efficiency for BAX and BAK was 51% and 23%, respectively, resulting in a calculated double knockout efficiency of about 10%. Non-specific bands were observed in this assay. It is believed that this band may be due to the minipool nature of the cell population.

[0161] After 7 days, the transfected pool of cells was subcloned into 40 plates at a seeding density of 1 cell / well using FACS. Approximately 1000 image-confirmed single cell-derived clones were selected and screened in 96-well, 24-well and 24-deep well for productivity, proliferation and genotyping by targeted DNA sequencing. DNA analysis of BAX and BAK deleted anti-CD70 expressing clones was performed as described in Example 8 (data not shown). From the number of anti-CD70 expressing clones generated, BAX / BAK double knockout clones were selected for further evaluation of proliferation and productivity by 2-month stability study and confirmation of knockout status by Western blotting.

[0162] As shown in Figure 20, protein analysis of BAX and BAK knockout in anti-CD70 expressing clones was evaluated by using Western blot. Lysates from 6 million BAX / BAK double knockout cell lines were prepared by resuspending in 100ul of RIPA buffer (Abcam) + protease inhibitor (Sigma tablet; Sigma). Lysates were incubated on ice for 1 hour and then centrifuged at 12,000 rpm for 20 minutes. Protein concentration was measured by BCA kit (Pierce). 20ug of protein was used for Western blot. Protein extracts from different cell lines were probed with anti-BAX antibody (Abcam). Figure 20A shows BAX knockout in anti-CD70 expressing clones engineered with CRISPR. As shown in Figure 20B, BAK knockout in anti-CD70 expressing clones engineered with CRISPR was observed in a large number of clones. Of the top 13 clones shown, 8 clones were BAX / BAK double knockout. Note that the clone 108 parental cell line retained residual BAK protein expression. L082 is a positive control cell line expressing wild-type or full-length BAX, a 21-KD protein, and BAK wild-type protein, a 24-KD band.

[0163] Apoptosis analysis was further performed in the anti-CD70 expressing clones of the present invention by Annexin-V binding apoptosis assay. As shown in Figure 21, BAX / BAK double knockout clones, such as CD70-BBKO-563, showed about 60% cell viability compared to about 18% observed in the parent cell line CD70-MW-108. At the same time, apoptotic cells were reduced from 80% to 40%, as observed from Q2 and Q4 for each cell line.

[0164] Example 17: Recombinant protein production is increased in BAX / BAK-deleted anti-CD70 expressing clones. Based on analysis of anti-CD70 expressing BAX and BAK clones by Western blotting and Annexin V analysis, a number of stable clones were selected for further optimization. As shown in Figure 21, nine (9) of the stable clones with both BAX / BAK knockouts were selected for process optimization to improve titer based on the high productivity, robust growth and two-month stability observed for each.

[0165] The production of the antibody was evaluated in a fed-batch process as shown in FIG. 22. Under fed-batch conditions, the anti-CD70 expressing BAX / BAK double knockout cell line (CD70-BBKO-563) showed a titer of 1000 mg / L (FIG. 22C) in both shake flask and benchtop bioreactor conditions at day 14 of production. The cell viability (FIG. 22B) under both shake flask and benchtop bioreactor conditions was about 90%. Overall, the production characteristics, VCD, viability and titer under shake flask and bioreactor conditions were comparable, supporting that the process is scalable. Further studies were performed under bioreactor conditions and processes based on the comparable productivity and growth characteristics analyzed (data not shown). This study supports an embodiment of the present invention of controlling apoptotic stressors that affect cell growth under bioreactor conditions by using CRISPR technology to knock out genes that control or regulate apoptosis.

[0166] Example 18: Product quality of BAX / BAK-deleted anti-CD70 expressing cell lines Product quality was analyzed by intact mass spectrometry (MS) and size exclusion chromatography (SEC) using samples produced by fed-batch production from an anti-CD70 expressing BAX / BAK double knockout cell line under bioreactor and shake flask conditions as disclosed in Table 6.

[0167] [Table 6]

[0168] As shown in Table 5, glycoform properties assessed by MS were comparable between shake flask and bioreactor conditions and were within the normal distribution range for mAbs during the clonal selection stage. SEC measured the percentage of high molecular weight (HMW) aggregates and the percentage of low molecular weight (LMW) degradation species. Both HMW aggregates and LMW degradation species were within the normal range during the clonal selection stage. HMW slightly higher than 5% was observed to decrease to 2-3% after purification (data not shown). These quality attributes indicate that CRISPR and subsequent single-cell cloning did not adversely affect the product quality of anti-CD70-expressing cell lines. It is also noted that product quality attributes (aggregates, integrity and glycoforms) in bioreactor conditions were consistent with their counterparts in shake flask conditions, proving that this process is scalable.

[0169] It should be understood that the methods and compositions described herein are not limited to the specific methodology, protocols, cell lines, constructs, and reagents described herein, and may vary. It should also be understood that the terminology used herein is used only for the purpose of describing specific embodiments, and is not intended to limit the scope of the methods and compositions described herein. The scope of the methods and compositions described herein is limited only by the appended claims.

[0170] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0171] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention disclosed and described herein belongs. Although any methods, devices, and materials similar or equivalent to those described herein can be used in the practice or testing of the invention described herein, the preferred methods, devices, and materials are described herein.

[0172] All publications and patents mentioned herein are incorporated herein by reference in their entirety for the purpose of describing and disclosing, for example, the constructs and methods described therein that may be used in connection with the presently described invention. The publications discussed herein are solely for the purpose of providing disclosure prior to the filing date of this application. Nothing herein should be construed as an admission that the inventors described herein are not entitled to antedate such disclosure by virtue of prior invention or for any other reason.

[0173] Although the above invention has been described in some detail for purposes of clarity and understanding, it will be apparent to one skilled in the art from reading this disclosure that various changes in form and detail can be made without departing from the true scope of the invention. For example, all techniques and devices described herein can be used in various combinations. It is understood that the examples and embodiments described herein are for illustrative purposes only, and that various modifications or changes thereon will be suggested to those skilled in the art and should be included within the spirit and scope of this application and the scope of the appended claims.

[0174] [Incorporated by reference] All publications, patents, patent applications, and / or other documents cited in this application are incorporated by reference in their entirety for all purposes to the same extent as if the same individual publications, patents, patent applications, and / or other documents were individually indicated to be incorporated by reference for all purposes. [Brief description of the drawings]

[0175] [Figure 1] Panels A and B. Strategies for utilizing platform cell lines in industry and pharmaceutical companies to produce unnatural amino acid containing proteins. Figure 1 shows the important role of using platform cell lines in industry (Figure 1A) and pharmaceutical companies (Figure 1B). [Diagram 2] General procedure for utilizing platform cell lines in the development of high producing cell lines. [Diagram 3] Panels A, B, C. Strategies for optimizing the development of high-producing cell lines. Figure 3 shows the optimization of high-producing cell line development from several aspects, such as FACS-dependent single-cell deposition (Figure 3A), CRISPR knockout (Figure 3B), and cell line development process optimization (Figure 3C). [Figure 4] Panels A and B. Observation of apoptosis in cells derived from platform cell line 4E2. The viability of CHO-S cells (Figure 4A) and platform cell line 4E2 (Figure 4B), which contain genetically engineered orthogonal paired tRNA / aminoacyl-tRNA synthetase specifically incorporating para-acetyl-L-phenylalanine, was assessed by Annexin V assay. As shown in Figure 4, 4E2 showed excessive apoptosis (85% viability) compared to CHO-S cells (96% viability). [Diagram 5]CRISPR gRNA design of target BAX gene in CHO cells. Figure 5 shows the genomic DNA sequence of BAX gene in CHO cells annotated with three gRNA sequences. The genomic DNA sequence of BAX gene, exon 1 and exon 2 are shown in grey shading. Other sequences of BAX are shown in normal text. Primers used in PCR and sequencing are shown at the beginning and end of the sequence as forward and reverse primers, respectively. [Figure 6] CRISPR gRNA design of targeting BAK gene in CHO cells. Figure 6 shows the genomic DNA sequence of BAK gene in CHO cells annotated with two gRNA sequences. The genomic DNA sequence of BAK gene, exon 2 and exon 3 are shown in grey shading. Other sequences of BAK are shown in normal text. Primers used in PCR and sequencing are shown at the beginning and end of the sequence as forward and reverse primers, respectively. [Figure 7] BAX or BAK CRISPR construct. Figure 7 shows the design of CRISPR plasmid used in BAX or BAK knockout experiments. Geneart CRISPR nuclease vector (pGCNV) is a commercially available vector from Thermo Fisher scientific (San Diego, CA). The completed form of pGCNV plasmid is prepared by inserting oligo duplex into the cut open pGCNV vector, which contains a slot for oligo duplex designed with a specific 19 nucleotide long gRNA sequence to target gene site individually (see Table 1 herein). [Figure 8] 1 shows structures of representative unnatural amino acids of the invention. [Figure 9]Surveyor assay of anti-HER2 expressing cell populations with BAX or BAK knockout using CRISPR. Figure 9 shows Surveyor assay analysis of knockout efficiency during BAX or BAK knockout using CRISPR. Shrinkage of the top band and appearance of a new band at the bottom indicates the efficiency, which can be quantified by densitometric analysis of the scanned image with Image J software. The ratio of the original band before and after CRISPR knockout (KO) was used to measure knockout efficiency. Knockout efficiencies for BAX and BAK were 30% and 70%, respectively, resulting in a double knockout efficiency of approximately 21% as calculated. [Figure 10] DNA analysis of anti-HER2 expressing single cell clones with BAX and BAK genes knocked out using CRISPR. Figure 10 shows the DNA sequencing results of 20 single cell clones after BAK knockout using CRISPR. The top DNA sequence (Bak-CHO-gDNA1) is the DNA sequence of the genomic region of the original BAK gene. Only the "ZA_112_K32_BakI-II" clone has a sequence identical to the original BAK gene. The other genes shown in the figure have either deletions or insertions in the sequence. [Figure 11] Western blot analysis of BAX knockout confirmation in anti-HER2 expressing BAX knockout cloning using CRISPR. BAX is a 21-KD protein that shows as a band in L082 cells that do not have gene knockout and express wild-type BAX protein. Other clonings did not show detectable expression of BAX protein, except for cloning UBB3, which shows residual BAX expression. [Figure 12] Panels A and B. Apoptosis analysis of anti-HER2 expressing BAX / BAK knockout cell lines. Figure 12 shows Annexin V apoptosis analysis of parental cell line L082 (Figure 12A) and BAX / BAK double knockout cell line BB15 (Figure 12B). As shown in the table, cell viability is improved from 40% to 80% after BAX and BAK knockout. At the same time, apoptotic cells are reduced from 53% to 17%. [Figure 13] Panels A-D. Enhanced anti-HER2 antibody production in BAX / BAK knockout cell lines in bulk culture. Figure 13 shows the change in protein production in BAX / BAK double knockout cell lines. Protein production is analyzed during bulk production. Viable cell density (VCD, Figure 13A). Cell viability (Figure 13B). During bulk production (day 7), the BAX / BAK double knockout cell line showed an increase in titer from 150 mg / L to 270 mg / L (Figure 13C). Specific productivity (Qp) (Figure 13D). [Figure 14] Panels A-D. Enhancement of anti-HER2 antibody production in BAX / BAK knockout cell line in fed-batch culture. Figure 14 shows the change in protein production in BAX / BAK double knockout cell line. Protein production is analyzed during fed-batch production. Viable cell density (VCD, Figure 14A). Cell viability (Figure 14B). During fed-batch production (day 14), the BAX / BAK double knockout cell line shows an increase in titer from 450 mg / L to 1500 mg / L (Figure 14C). Specific productivity (Qp) (Figure 14D). [Figure 15] Surveyor assay of anti-PSMA expressing cell populations with BAX or BAK knockout using CRISPR. Figure 15 shows Surveyor assay analysis of knockout efficiency during BAX or BAK knockout using CRISPR. The ratio of original bands before and after CRISPR knockout (KO) was quantified by densitometric analysis of scanned images with Image J software and used to measure knockout efficiency. Knockout efficiency for BAX and BAK was 42% and 53%, respectively, resulting in a double knockout efficiency of about 20% as calculated. [Figure 16]Panels A and B. Western blot analysis of BAX and BAK knockout confirmation in anti-PSMA expressing clones. BAX knockout confirmation in anti-PSMA expressing clones using CRISPR (FIG. 16A). BAK knockout confirmation in anti-PSMA expressing clones (FIG. 16B). Controls are L082 cells expressing wild type BAX protein, a band at 21-KD, and anti-HER2-BAX / BAK double knockout expressing BB15 cells. [Figure 17] Apoptosis analysis of BAX / BAK knockout anti-PSMA expressing cell lines. Figure 17 shows Annexin V apoptosis analysis of the BAX / BAK double knockout cell lines PSMA-192 and PSMA 719, which have approximately 85% cell viability compared to approximately 35-37% in the single KO clones (PSMA-882) or non-knockout clones (PSMA-484). [Figure 18] Panels A-C. Enhancement of anti-PSMA antibody production in BAX / BAK knockout cell lines in fed-batch culture. FIG. 18 shows the change in protein production in BAX / BAK double knockout cell lines (e.g., cell line PSMA-BBKO-192). Protein production is analyzed during fed-batch production. Viable cell density (VCD, FIG. 18A). Cell viability (FIG. 18B). During fed-batch production (day 14), the BAX / BAK double knockout cell line showed an increase in titer from 500 mg / L to 1400 mg / L (FIG. 18C). [Figure 19] Surveyor assay of anti-CD70 expressing cell populations with BAX or BAK knockout using CRISPR. Figure 19 shows Surveyor assay analysis of knockout efficiency during BAX or BAK knockout using CRISPR. The ratio of original bands before and after CRISPR knockout (KO) was quantified by densitometric analysis of scanned images with Image J software and used to measure knockout efficiency. Knockout efficiency for BAX and BAK was 51% and 23%, respectively, resulting in a double knockout efficiency of about 10% as calculated. [Figure 20]Panels A and B. Western blot analysis of BAX and BAK knockout confirmation in anti-CD70 expressing clones. BAX knockout confirmation in anti-CD70 expressing clones (Figure 20A). BAK knockout confirmation in anti-CD70 expressing clones (Figure 20B). Controls are L082 cells expressing wild type BAX protein, 21-KD band, and BAK wild type protein, 24-KD band. [Figure 21] Apoptosis analysis of BAX / BAK knockout anti-CD70 expressing cell lines. Figure 21 shows that in an Annexin V apoptosis assay of BAX / BAK double knockout cell lines (e.g., CD70-BBKO-563), cell viability increased from 18% to 60% compared to the parental cell line, CD70-MW-108. Assay apoptotic cells decreased from 80% to 40%. [Figure 22] Panels A-C. Enhanced anti-CD70 antibody production of BAX / BAK knockout cell lines in fed-batch culture. Figure 22 shows the production status of BAX / BAK double knockout anti-CD70 expressing cell lines in shake flasks and benchtop bioreactors. Viable cell density (VCD, Figure 22A). Cell viability (Figure 22B). BAX / BAK double knockout cell lines (e.g., CD70-BBKO-563) show high titers of 1000 mg / L. (Figure 22C).

Claims

1. 1. A method of generating a cell line with reduced apoptosis for incorporation into a protein that comprises an unnatural amino acid, the method comprising inactivating one or more target sites or regions in a cell or cell line, the one or more target sites or regions being pro-apoptotic genes involved in an apoptotic pathway, the pro-apoptotic gene being a Bcl-2 family site or region, the cell or cell line expressing a gene of interest that contains a selector codon, the gene encoding the protein, and the cell or cell line comprising an orthogonal aminoacyl-tRNA synthetase (O-RS) and an orthogonal suppressor tRNA (O-tRNA).

2. 1. A method of reducing apoptosis in a cell or cell line, wherein the cell or cell line expresses a gene of interest that contains a selector codon, wherein the cell or cell line comprises an orthogonal aminoacyl-tRNA synthetase (O-RS) and an orthogonal suppressor tRNA (O-tRNA), the method comprising inactivating one or more target sites or regions in the cell or cell line, wherein the one or more target sites or regions are pro-apoptotic genes involved in an apoptotic pathway, and wherein the pro-apoptotic gene is a Bcl-2 family site or region.

3. 3. The method of claim 1 or 2, further comprising the steps of providing a nucleic acid molecule capable of inactivating the one or more target sites or regions in the cell or cell line, and introducing the nucleic acid molecule into the cell or cell line, wherein the nucleic acid molecule inactivates the one or more target sites or regions.

4. Methods include: Providing a cell or cell line that expresses a gene of interest containing a selector codon and that comprises an orthogonal aminoacyl-tRNA synthetase (O-RS) and an orthogonal suppressor tRNA (O-tRNA), and introducing into the cell or cell line a nucleic acid molecule capable of inactivating one or more target sites or regions in the cell or cell line, wherein the one or more target sites or regions are pro-apoptotic genes involved in an apoptotic pathway, and the pro-apoptotic genes are Bcl-2 family sites or regions, whereby the cell or cell line has reduced apoptosis, and wherein the one or more target sites or regions are inactivated.

5. The method according to claim 3 or 4, wherein the nucleic acid molecule is selected from SEQ ID NOs: 1 to 6.

6. 11. A method of producing a protein that comprises an unnatural amino acid, the method comprising expressing the protein in a cell or cell line, the cell or cell line expressing a gene of interest that contains a selector codon, the gene encoding the protein, the cell or cell line comprising an orthogonal aminoacyl-tRNA synthetase (O-RS) and an orthogonal suppressor tRNA (O-tRNA), the cell or cell line comprising one or more inactivated target sites or regions, the one or more target sites or regions being pro-apoptotic genes involved in an apoptotic pathway, the pro-apoptotic gene being a Bcl-2 family site or region.

7. The method of any one of claims 4 to 6, further comprising providing the cell or cell line with an unnatural amino acid.

8. a) the cell or cell line is a eukaryotic cell or cell line; or b) the cell line is selected from COS, CHO, VERO, MDCK, WI38, V79, B14AF28-G3, BHK, HaK, NS0, SP2 / 0-Ag14, HeLa, or HEK293; and / or c) the cell line is a transient cell line, a stable cell line population, or a stable clonal cell line; The method according to any one of claims 1 to 7.

9. The unnatural amino acid may be para-acetylphenylalanine, p-nitrophenylalanine, p-sulfotyrosine, p-carboxyphenylalanine, o-nitrophenylalanine, m-nitrophenylalanine, p-boronylphenylalanine, o-boronylphenylalanine, m-boronylphenylalanine, p-aminophenylalanine, o-aminophenylalanine, m-aminophenylalanine, p-acylphenylalanine, o-acylphenylalanine, m-acylphenylalanine , p-OMe phenylalanine, o-OMe phenylalanine, m-OMe phenylalanine, p-sulfophenylalanine, o-sulfophenylalanine, m-sulfophenylalanine, 5-nitroHis, 3-nitroTyr, 2-nitroTyr, nitro-substituted Leu, nitro-substituted His, nitro-substituted De, nitro-substituted Trp, 2-nitroTrp, 4-nitroTrp, 5-nitroTrp, 6-nitroTrp, 7-nitroTrp, 3-aminotyrosine, 2-aminotyrosine , O-sulfotyrosine, 2-sulfooxyphenylalanine, 3-sulfooxyphenylalanine, O-carboxyphenylalanine, m-carboxyphenylalanine, p-acetyl-L-phenylalanine, p-propargyl-phenylalanine, O-methyl-L-tyrosine, L-3-(2-naphthyl)alanine, 3-methyl-phenylalanine, O-4-allyl-L-tyrosine, 4-propyl-L-tyrosine, tri-O-acetyl-GlcNAcβ-serine, L-Dopa, phenyl fluoride 9. The method of any one of claims 1 and 6 to 8, wherein the phenylalanine is selected from alanine, isopropyl-L-phenylalanine, p-azido-L-phenylalanine, p-acyl-L-phenylalanine, p-benzoyl-L-phenylalanine, L-phosphoserine, phosphonoserine, phosphonotyrosine, p-iodo-phenylalanine, p-bromophenylalanine, p-amino-L-phenylalanine, isopropyl-L-phenylalanine, and p-propargyloxy-L-phenylalanine.

10. 9. The method of any one of claims 1 and 6-8, wherein the unnatural amino acid is para-acetylphenylalanine.

11. The gene of interest is a) a biological therapeutic gene, optionally wherein said biological therapeutic gene is a vaccine; or b) encoding an antibody, an scFv, an scFv fusion protein, an Fc fusion protein, Factor VII, Factor VIII, or Factor IV; or c) encoding an antibody; or d) encodes a cytokine, interleukin, interferon, chemokine, growth factor, hormone, or receptor thereof; or e) encoding HER2, CD-70, PSMA, 5T4, EGFR, TROP2, CD3, IL-2, IL-3, IL-10, IL-15, GPC3, DLL3, ROR1, leptin, FGF-21, FGF-23, HGH, FcR, insulin, TNFR1, TRAIL, EPO, or an antibody or fragment thereof, said fragment being an Fv, Fc, Fab, or (Fab')2, single chain Fv (ScFv), dimer, trimer, tetramer, bifunctional hybrid antibody, CDR1, CDR2, CDR3, combination of CDRs, variable region, framework region, constant region, heavy chain, light chain, variable region, alternative scaffold non-antibody molecule, or bispecific antibody; The method according to any one of claims 1 to 10.

12. The Bcl-2 family site or region is selected from: a) Bak, Bax, Bcl-xs, Bid, Bim, Bad, and Bik, optionally wherein the gene of interest encodes an antibody; or b) Bax, optionally wherein the gene of interest encodes an antibody; or c) Bak, optionally wherein the gene of interest encodes an antibody; or d) Bax and Bak, optionally wherein the gene of interest encodes an antibody; The method according to any one of claims 1 to 11.

13. The method of any one of claims 1 to 12, wherein the one or more target sites or regions are partially inactivated.

14. The method of any one of claims 1 to 13, wherein the one or more target sites or regions are different.

15. the selector codon is a) is a nonsense codon, a rare codon, or a four-base codon; or b) an ochre codon, an opal codon, or an amber codon; The method according to any one of claims 1 to 14.

16. 15. The method of any one of claims 1-14, wherein the selector codon is an amber codon.

17. 17. The method of any one of claims 1 and 6-16, wherein the yield of the unnatural amino acid containing protein is at least 0.5-fold greater than if the one or more target sites or regions were not inactivated.

18. 18. The method of any one of claims 1 to 17, wherein the one or more target sites or regions are inactivated using a gene editing tool, optionally wherein the gene editing tool is selected from zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases (MNs), and clustered regularly interspaced short palindromic repeats (CRISPR).

19. The method of any one of claims 1 to 18, further comprising culturing the cell or cell line using batch or fed-batch production.

20. The method according to any one of claims 1 to 19, wherein the cell line is selected from CHO-S, CHO-K1, CHO-DG44, CHO-DUXB11, CHO-DUKX, CHOK1SV.

21. An isolated cell or cell line produced by the method of any one of claims 1 to 5 and 7 to 20.

22. 1. A cell or cell line with reduced apoptosis for incorporating an unnatural amino acid into a protein, wherein the cell or cell line expresses a gene of interest that contains a selector codon and encodes the protein, the cell or cell line comprising an orthogonal aminoacyl-tRNA synthetase (O-RS) and an orthogonal suppressor tRNA (O-tRNA), the cell or cell line comprising one or more inactivated sites or regions, the one or more inactivated sites or regions being pro-apoptotic genes involved in an apoptotic pathway, the pro-apoptotic gene being a Bcl-2 family site or region.

23. 23. The cell or cell line of claim 22, comprising a nucleic acid molecule capable of inactivating one or more sites or regions in said cell or cell line, optionally wherein said nucleic acid molecule is selected from SEQ ID NOs: 1-6.

24. The cell or cell line comprising: a) is a eukaryotic cell or cell line; or b) the cell line is selected from COS, CHO, VERO, MDCK, WI38, V79, B14AF28-G3, BHK, HaK, NS0, SP2 / 0-Ag14, HeLa, or HEK293; and / or c) the cell line is selected from a transient cell line, a stable cell line population, or a stable clonal cell line; 24. A cell or cell line according to claim 22 or 23.

25. The cell or cell line comprising: a) the selector codon is: (i) a nonsense codon, a rare codon, or a four-base codon; or (ii) is an ochre, opal, or amber codon; and / or b) the one or more sites or regions are partially inactivated; and / or c) the one or more sites or regions are different; A cell or cell line according to any one of claims 22 to 24.

26. 26. The cell or cell line of any one of claims 22-25, wherein the selector codon is an amber codon.

27. The gene of interest is: a) a biological therapeutic gene, optionally wherein said biological therapeutic gene is a vaccine; or b) encoding an antibody, an scFv, an scFv fusion protein, an Fc fusion protein, Factor VII, Factor VIII, or Factor IV; or c) encoding an antibody; or d) encodes a cytokine, interleukin, interferon, chemokine, growth factor, hormone, or receptor thereof; or e) encoding HER2, CD-70, PSMA, 5T4, EGFR, TROP2, CD3, IL-2, IL-3, IL-10, IL-15, GPC3, DLL3, ROR1, leptin, FGF-21, FGF-23, HGH, FcR, insulin, TNFR1, TRAIL, EPO, or an antibody or fragment thereof, said fragment being an Fv, Fc, Fab, or (Fab')2, single chain Fv (ScFv), dimer, trimer, tetramer, bifunctional hybrid antibody, CDR1, CDR2, CDR3, combination of CDRs, variable region, framework region, constant region, heavy chain, light chain, variable region, alternative scaffold non-antibody molecule, or bispecific antibody; A cell or cell line according to any one of claims 22 to 26.

28. The Bcl-2 family site or region is selected from: a) Bak, Bax, Bcl-xs, Bid, Bim, Bad and Bik, optionally wherein the gene of interest encodes an antibody; or b) Bax, optionally wherein the gene of interest encodes an antibody; or c) Bak, optionally wherein the gene of interest encodes an antibody; or d) Bax and Bak, optionally wherein the gene of interest encodes an antibody; A cell or cell line according to any one of claims 22 to 27.

29. The method according to claim 6, comprising expressing the protein in a cell or cell line according to any one of claims 22 to 28.

Images