Small interfering RNA targeting CFB and uses thereof

Targeting CFB mRNA with siRNA reduces CFB expression, addressing excessive production and dysregulation, offering therapeutic benefits for complement-related disorders.

JP2025542234APending Publication Date: 2025-12-25セーンジーン バイオ ユーエスエー インコーポレイティド
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025536071
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-12-19
Filing Date
2023-12-19
Publication Date
2025-12-25

AI Technical Summary

Technical Problem

Excessive production and dysregulation of complement factor B (CFB) lead to various diseases and disorders, including type 2 diabetes, cardiovascular, neurological, hematological, ocular, renal, and autoimmune diseases, and infectious diseases, necessitating treatments to reduce CFB expression.

Method used

Development of isolated oligonucleotides, specifically small interfering RNA (siRNA), targeting specific regions of the CFB mRNA sequence to attenuate its expression by forming double-stranded regions with complementary antisense strands, thereby reducing CFB protein levels.

Benefits of technology

The siRNA effectively attenuates CFB mRNA expression by 20% to 100%, providing therapeutic potential for treating complement-related disorders such as paroxysmal nocturnal hemoglobinuria, rheumatoid arthritis, and neurodegenerative diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025542234000001_ABST
    Figure 2025542234000001_ABST
Patent Text Reader

Abstract

The present disclosure relates to isolated oligonucleotides comprising a duplex region that targets human CFB mRNA, as well as delivery systems, kits and compositions comprising same, and methods of using same to inhibit or downregulate CFB gene expression.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Related Applications This application claims priority to and benefit of U.S. Provisional Patent Application No. 63 / 433,735, filed December 19, 2022, the contents of which are incorporated herein by reference in their entirety.

[0002] Electronic Sequence Listing Reference The contents of the electronic sequence listing (SANB_018_001WO_SeqList_ST26.xml; size: 454,399 bytes; and creation date December 15, 2023) are incorporated herein by reference in their entirety. [Background technology]

[0003] The complement system is part of the innate immune system, consisting of multiple soluble proteins present in serum as inactive precursors. Upon activation, these complement components form an amplifying cascade that leads to the generation of bioactive effector compounds. This cascade plays a central role in maintaining cellular integrity and tissue homeostasis through the removal of damaged or dead cells, immune complexes, and cellular debris. It also plays a role in immunoregulation, metabolism, inflammation, and host defense against pathogens. The complement system has three activation pathways, all of which revolve around the proteolytic cleavage of C3, a central component that serves as a convergence point for downstream effector functions. Upon cleavage, the active subunit of complement factor B, Bb, combines with the complement factor 3b component of C3 to form the alternative pathway C3 or C5 convertase. The central role of complement factor B (CFB) in the function of the alternative complement cascade makes it an ideal target for therapeutic modulation of complement.

[0004] Deficiencies or loss-of-function mutations in common complement components can result in dysregulation of normal complement system function and the potential for overproduction of complement components. Excessive production and / or dysregulation is associated with an increasing number of diseases, including, but not limited to, type 2 diabetes, cardiovascular, neurological, hematological, ocular, renal, and autoimmune diseases and / or disorders, and infectious diseases. Thus, there is a need for treatments for subjects with diseases, disorders, and conditions associated with elevated levels of complement CFB expression. The present disclosure provides compositions targeting CFB and methods for reducing CFB expression for the treatment of subjects with complement-related diseases, disorders, or conditions. Summary of the Invention

[0005] The present disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence substantially identical to a region comprising 19 to 25 nucleotides from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region.

[0006] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising 19 to 25 nucleotides from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468.

[0007] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region comprising 19 to 25 nucleotides from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468.

[0008] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is substantially identical to a region between any one of nucleotide positions selected from a) 503-523; and b) 2190-2210 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO:1.

[0009] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region between any one of nucleotide positions selected from a) 503-523; and b) 2190-2210 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO:1.

[0010] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 503-523; and b) 2190-2210 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO:1.

[0011] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is substantially identical to a region from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 493-534; b) 991-1054; c) 1384-1500; d) 1666-1686; e) 1821-1881; f) 2116-2136; g) 2232-2307; and h) 2394-2468.

[0012] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region from the 5' end of the human CFB mRNA sequence according to SEQ ID NO:1 to any one of nucleotide positions selected from a) 493-534; b) 991-1054; c) 1384-1500; d) 1666-1686; e) 1821-1881; f) 2116-2136; g) 2232-2307; and h) 2394-2468.

[0013] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 493-534; b) 991-1054; c) 1384-1500; d) 1666-1686; e) 1821-1881; f) 2116-2136; g) 2232-2307; and h) 2394-2468 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO:1.

[0014] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is substantially identical to a region from the 5' end of the human CFB mRNA sequence according to SEQ ID NO:1 to any one of nucleotide positions selected from a) 995-1019; b) 1606-1626; c) 1860-1880; and d) 2382-2402.

[0015] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region from the 5' end of the human CFB mRNA sequence according to SEQ ID NO:1 to any one of nucleotide positions selected from a) 995-1019; b) 1606-1626; c) 1860-1880; and d) 2382-2402.

[0016] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between the 5' end of the human CFB mRNA sequence according to SEQ ID NO:1 and any one of nucleotide positions selected from a) 995-1019; b) 1606-1626; c) 1860-1880; and d) 2382-2402.

[0017] In some embodiments of the isolated oligonucleotide of the present disclosure, the isolated oligonucleotide is capable of inducing degradation of CFB mRNA.

[0018] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand is a single-stranded RNA molecule.In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand is a single-stranded RNA molecule.In some embodiments of the isolated oligonucleotide of the present disclosure, both the sense strand and the antisense strand are single-stranded RNA molecules.

[0019] In some embodiments of the isolated oligonucleotide of the present disclosure, the single-stranded RNA molecule of the sense strand comprises a 3' overhang.In some embodiments, in the single-stranded RNA molecule of the sense strand, the 3' overhang comprises at least one nucleotide.In some embodiments, in the single-stranded RNA molecule of the sense strand, the 3' overhang comprises two nucleotides.

[0020] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense single-stranded RNA molecule comprises a 3' overhang. In some embodiments, in the antisense single-stranded RNA molecule, the 3' overhang comprises at least one nucleotide. In some embodiments, in the antisense single-stranded RNA molecule, the 3' overhang comprises two nucleotides.

[0021] In some embodiments of the isolated oligonucleotides of the present disclosure, the 3' overhang comprises any one of thymidine-thymidine (dTdT), adenine-adenine (AA), cysteine-cysteine ​​(CC), guanine-guanine (GG), or uracil-uracil (UU).

[0022] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises an RNA sequence at least 20 nucleotides in length. In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises an RNA sequence 20 nucleotides in length.

[0023] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises an RNA sequence at least 22 nucleotides in length. In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises an RNA sequence 22 nucleotides in length.

[0024] In some embodiments of the isolated oligonucleotide of the present disclosure, the double-stranded region is 19-21 nucleotides in length. In some embodiments of the present disclosure, the double-stranded region is 20 nucleotides in length.

[0025] In some embodiments of the isolated oligonucleotides of the present disclosure, the double-stranded region comprises an antisense strand and a sense strand according to any one of the antisense and sense strand sequence pairs in Table 1, as described herein.

[0026] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2-35.

[0027] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 36-69.

[0028] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2-35, and the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 36-69, wherein the antisense and sense strand sequences have sufficient complementarity to allow formation of a double-stranded region between the antisense and sense strands.

[0029] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 493-534; b) 991-1054; c) 1384-1500; d) 1606-1686; e) 1821-1881; f) 2116-2307; and g) 2382-2468 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region. Attenuate mRNA expression by at least 50% (e.g., 50%-55%, 55%-60%, 60%-65%, 65%-70%, 70%-75%, 75%-80%, 80%-85%, 85%-90%, 90%-95%, or 95%-99%, 99%-100%) at a dose of 0.1 nM.

[0030] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 493-534; b) 991-1054; c) 1384-1500; d) 1606-1686; e) 1821-1881; f) 2116-2307; and g) 2382-2468 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region. Attenuate mRNA expression by at least 50% (e.g., 50%-55%, 55%-60%, 60%-65%, 65%-70%, 70%-75%, 75%-80%, 80%-85%, 85%-90%, 90%-95%, or 95%-99%, 99%-100%) at a dose of 0.02 nM.

[0031] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 493-534; b) 991-1054; c) 1384-1500; d) 1606-1686; e) 1821-1881; f) 2116-2307; and g) 2382-2468 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by 20%-50% (e.g., 20%-25%, 25%-30%, 30%-35%, 35%-40%, 40%-45%, or 45%-50%) at a dose of 0.02 nM.

[0032] The present disclosure also provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence substantially identical to a region comprising 19 to 25 nucleotides from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1815 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand, such that the sense strand and the antisense strand together form a double-stranded region.

[0033] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region comprising 19 to 25 nucleotides from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1815 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by 20% to 50% at a dose of 0.1 nM.

[0034] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region comprising 19 to 25 nucleotides from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1 and between any one of nucleotide positions selected from a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1815 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by at least 50% at a dose of 0.1 nM.

[0035] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region comprising 19 to 25 nucleotides from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1815 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by 20% to 50% at a dose of 0.02 nM.

[0036] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region comprising 19 to 25 nucleotides from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1 and between any one of nucleotide positions selected from a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1815 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by at least 50% at a dose of 0.02 nM.

[0037] The present disclosure also provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand, the antisense strand, or both comprise one or more modified nucleotides. In some embodiments, the antisense strand comprises a monomethyl-protected phosphate mimic (5'-MeEP). In some embodiments, the sense strand, the antisense strand, or both are linked to a targeting ligand at a terminal or internal nucleotide. In some embodiments, the targeting ligand comprises at least one GalNAc G1b moiety.

[0038] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the antisense strand comprises nucleotides modified with 2'-F modifications and nucleotides modified with 2'-O-methyl modifications according to the formula: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15'.

[0039] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises nucleotides modified with 2'-F modifications and nucleotides modified with 2'-O-methyl modifications according to the formula: 5'(M)o(F)o(M)5(F)1(M)1(F)4(M)93'.

[0040] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the antisense strand is i) the antisense strand of a nucleic acid sequence according to SEQ ID NO: 370 (5'[MeEPmUs][fGs][fU][mC][fA][mU][fA][mA][mA][fA][mU][mU][mC][fA][mG][fG][mA][mA][mU][mUs][mCs][mC]3'); ii) the antisense strand of a nucleic acid sequence according to SEQ ID NO: 371 (5'[MeEPmUs][fUs][fA][mA][fA][mA][fU][mU][mC][fA][ mG][mG][mA][fA][mU][fU][mC][mC][mU][mGs][mCs][mU] 3'); iii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 372 (5'[MeEPmUs][fGs][fG][mA][fA][mA][fG][mA][mG][fA][mU][mC][mU][fC][mA][fU][mC][mA][mC][mU][mCs][mA] 3'); iv) the antisense strand of the nucleic acid sequence of SEQ ID NO: 373 (5'[MeEPmUs][fAs][fA][mU][fU] [mC][fA][mG][mG][fA][mA][mU][mU][fC][mC][fU][mG][mC][mU][mUs][mCs][mU]3'); v) the antisense strand of the nucleic acid sequence of SEQ ID NO: 374 (5'[MeEPmUs][fAs][fA][mC][fA][mC][fA][mU][mG][fU][mU][mG][mC][fU][mC][fA][mU][mU][mG][mU][mCs][mU]3'); vi) the antisense strand of the nucleic acid sequence of SEQ ID NO: 375 (5'[MeEPmU vii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 376 (5'[MeEPmUs][fAs][fU][mA][fG][mC][fA][mG][mU][fG][mG][mA][mA][fA][mG][fA][mG][mA][mU][mCs][mUs][mC]3'); vii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 376 (5'[MeEPmUs][fAs][fU][mA][fG][mC][fA][mG][mU][fG][mG][mA][mA][fA][mG][fA][mG][mA][mU][mCs][mUs][mC]3');viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 377 (5'[mUs][fGs][fU][mC][fA][mU][fA][mA][mA][fA][mU][mU][mC][fA][mG][fG][mA][mA][mU][mU][mUs][mCs][mC]3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 378 (5'[mUs][fUs][fA][mA][fA][mA][fU][mU][mC][fA][mG][mG][mA][fA][mU][fU][mC][mC][mU][mGs][mCs][mU]3'). or x) the antisense strand of a nucleic acid sequence according to SEQ ID NO: 379 (5'[mUs][fGs][fG][mA][fA][mA][fG][mA][mG][fA][mU][mC][mU][fC][mA][fU][mC][mA][mC][mUs][mCs][mA]3'), wherein "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate internucleotide linkage, and "MeEP" is a monomethyl protected phosphate mimic;

[0041] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand is i) the sense strand of a nucleic acid sequence according to SEQ ID NO: 381 (5'[mAs][mAs][mU][mU][mC][fC][mU][fG][fA][fA][fU][mU][mU][mU][mA][mU][mG][mAs][mCs][mA][Glb][Glb][Glb]3'); ii) the sense strand of a nucleic acid sequence according to SEQ ID NO: 382 (5'[mCs][mAs][mG][mG iii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 383 (5'[mAs][mGs][mU][mG][mA][fU][mG][fA][fG][fA][fU][mC][mU][mC][mU][mU][mU][mCs][mCs][mA][G1b][G 1b][G1b]3'); iv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 384 (5'[mAs][mAs][mG][mC][mA][fG][mG][fA][fA][fU][fU][mC][mC][mU][mG][mA][mA][mUs][mUs][mA][G1b][G1b]3'); v) the sense strand of the nucleic acid sequence according to SEQ ID NO: 385 (5'[mAs][mCs][mA][mA][mU][fG][mA][fG][fC][ vi) the sense strand of the nucleic acid sequence of SEQ ID NO: 386 (5'[mAs][mCs][mU][mG][mC][fU][mA][fU][fG][fA][fC][mG][mG][mU][mU][mA][mC][mAs][mCs][mA][G1b][G1b][G1b]3');or vii) comprising any one of the sense strands of the nucleic acid sequence according to SEQ ID NO: 387 (5'[mGs][mAs][mU][mC][mU][fC][mU][fU][fC][fC][mA][mC][mU][mG][mC][mU][mAs][mUs][mA][Glb][Glb][Glb]3'), wherein "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate internucleotide linkage, and "Glb" is a GalNAc Glb moiety;

[0042] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the double-stranded region comprises i) the antisense strand of a nucleic acid sequence according to SEQ ID NO: 370 (5'[MeEPmUs][fGs][fU][mC][fA][mU][fA][mA][mA][fA][mU][mU][mC][fA][mG][fG][mA][mA][mU][mUs][mCs][mC]3'), and ii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 371 (5'[MeEPmUs][fUs][fA][mA][fA][mA][fU][mU][mU][mU][mC][fA][mG][mG][mA][fA][mU][fU][mC][mC][mU][mGs][mCs] [mU]3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 382 (5'[mCs][mAs][mG][mG][mA][fA][mU][fU][fC][fC][fU][mG][mA][mA][mU][mU][mU][mUs][mAs][mA][G1b][G1b][G1b]3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 372 (5'[MeEPmUs][fGs][fG][mA][fA][mA][fG][mA][ an antisense strand of a nucleic acid sequence according to SEQ ID NO: 383 (5'[mAs][mGs][mU][mG][mA][fU][mG][fA][fG][fA][fU][mC][mU][mC][mU][mU][mU][mCs][mCs][mA][G1b][G1b][G1b]3');iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 373 (5'[MeEPmUs][fAs][fA][mU][fU][mC][fA][mG][mG][fA][mA][mU][mU][fC][mC][fU][mG][mC][mU][mU][mCs][mU]3'), and the antisense strand of the nucleic acid sequence according to SEQ ID NO: 384 (5'[mAs][mAs][mG][mC][mA][fG][mG][fA][fA][fU][fU][mC][ mC][mU][mG][mA][mA][mUs][mUs][mA][Glb][Glb][Glb]3'); v) the sense strand of the nucleic acid sequence according to SEQ ID NO: 374 (5'[MeEPmUs][fAs][fA][mC][fA][mC][fA][mU][mG][fU][mU][mG][mC][fU][mC][fA][mU][mU][mG][mUs][mCs][mU]3'); and vi) the sense strand of the nucleic acid sequence according to SEQ ID NO: 385 (5'[mAs][mCs][mA][mA][mU][fG][mA][fG][fC][fA][fA][mC][mA][mU][mG][mU][mG][mUs][mUs][mA][G1b][G1b][G1b]3'); an antisense strand of a nucleic acid sequence according to SEQ ID NO: 386 (5'[mAs][mCs][mU][mG][mC][fU][mA][fU][fG][fA][fC][mG][mG][mU][mU][mA][mC][mAs][mCs][mA][G1b][G1b][G1b]3');vii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 376 (5'[MeEPmUs][fAs][fU][mA][fG][mC][fA][mG][mU][fG][mG][mA][mA][fA][mG][fA][mG][mA][mU][mCs][mU][mC]3') and the antisense strand of the nucleic acid sequence of SEQ ID NO: 387 (5'[mGs][mAs][mU][mC][mU][fC][mU][fU][fC][fC][mA [mC][mU][mG][mC][mU][mAs][mUs][mA][Glb][Glb][Glb]3'); viii) the sense strand of the nucleic acid sequence of SEQ ID NO: 377 (5'[mUs][fGs][fU][mC][fA][mU][fA][mA][mA][fA][mU][mU][mC][fA][mG][fG][mA][mA][mU][mU][mCs][mC]3'). ix) the sense strand of the nucleic acid sequence according to SEQ ID NO: 381 (5'[mAs][mAs][mU][mU][mC][fC][mU][fG][fA][fA][fU][mU][mU][mU][mA][mU][mG][mAs][mCs][mA][G1b][G1b][G1b]3'); ix) the sense strand of the nucleic acid sequence according to SEQ ID NO: 378 (5'[mUs][fU][fA][mA][fA][mA][fU][mU][mC][fA][mG][m the antisense strand of the nucleic acid sequence according to SEQ ID NO: 382 (5'[mCs][mAs][mG][mG][mA][fA][mU][fU][fC][fC][fU][mG][mA][mA][mU][mU][mU][mU][mAs][mA][G1b][G1b][G1b]3');or x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 379 (5'[mUs][fGs][fG][mA][fA][mA][fG][mA][mG][fA][mU][mC][mU][fC][mA][fU][mC][mA][mC][mUs][mCs][mA]3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 383 (5'[mAs][mGs][mU][mG][mA][fU][mG][fA][fG][fA][fU][mC][mU][mC][mU][mU][mCs][mCs][mA][Glb][Glb]3');

[0043] The present disclosure also provides vectors encoding the isolated oligonucleotides disclosed herein.

[0044] The present disclosure also provides a delivery system comprising the isolated oligonucleotide or vector disclosed herein.

[0045] The present disclosure also provides a pharmaceutical composition comprising an isolated oligonucleotide, vector, or delivery system disclosed herein and a pharmaceutically acceptable carrier, diluent, or excipient.

[0046] The present disclosure also provides kits comprising the isolated oligonucleotides, vectors, delivery systems, or pharmaceutical compositions disclosed herein.

[0047] The present disclosure also provides a method for inhibiting or downregulating the expression or level of CFB in a subject in need thereof, comprising administering to the subject an effective amount of at least one isolated oligonucleotide, vector, delivery system or pharmaceutical composition disclosed herein.

[0048] The present disclosure also provides methods for treating or preventing a disease or disorder associated with aberrant or increased expression or activity of CFB, or a disease or disorder in which CFB plays a role in a subject in need thereof, comprising administering to the subject an effective amount of at least one isolated oligonucleotide, vector, delivery system, or pharmaceutical composition disclosed herein. [Brief explanation of the drawings]

[0049] [Figure 1] Figure 1 is a graph showing the efficacy of the siRNA compounds listed in Table 2 in silencing human CFB in cultured Huh-7 cells. Compounds were transfected into cells at 0.02 nM concentrations. Data are presented as the percentage of remaining human CFB mRNA compared to mock transfections, normalized to Gapdh mRNA levels (mean, + / - SEM). Each bar represents a single compound tested.

[0050] [Figure 2] Figure 2 is a graph showing the efficacy of the siRNA compounds listed in Table 2 in silencing human CFB in cultured Huh-7 cells. Compounds were transfected into cells at 0.1 nM concentrations. Data are presented as the percentage of remaining human CFB mRNA compared to mock transfection, normalized to Gapdh mRNA levels (mean, + / - SEM). Each bar represents a single compound tested.

[0051] [Figure 3] Figure 3 is a graph showing the in vivo efficacy of a subset of the compounds listed in Table 2 in mouse HDI liver at 1 mg / kg on day 4 post-dose. Data are presented as % of remaining human CFB mRNA relative to PBS when normalized to NeoR mRNA levels (mean, + / - SEM).

[0052] [Figure 4]Figure 4 is a graph showing the in vivo dose response of a subset of the compounds listed in Table 2 in mouse HDI livers at 0.25, 0.5, or 1 mg / kg on day 4 post-dose. Data are presented as % of remaining human CFB mRNA relative to PBS when normalized to NeoR mRNA levels (mean, + / - SEM).

[0053] [Figure 5A] Figure 5A is a graph showing the in vivo efficacy evaluation of the compounds listed in Table 3 in cynomolgus monkeys (Macaca fascicularis) after a single subcutaneous dose of 3 mg / kg. Cyno CFB mRNA remaining in the liver was measured over time. Data were normalized to pre-dose mRNA levels for each animal. [Figure 5B] Figure 5B is a graph showing the in vivo efficacy evaluation of the compounds listed in Table 3 in cynomolgus monkeys (Macaca fascicularis) after a single subcutaneous dose of 3 mg / kg. Residual serum CFB protein was measured over time. Data were normalized to pre-dose protein levels for each animal. DETAILED DESCRIPTION OF THE INVENTION

[0054] The present disclosure provides an isolated oligonucleotide (or oligonucleotides) that form a double-stranded region, preferably a small interfering RNA (siRNA), that can reduce complement CFB mRNA expression, resulting in a subsequent reduction in the level of CFB protein expression in target cells. The oligonucleotides disclosed herein may have therapeutic applications in modulating CFB expression for the treatment of diseases involving complement component-associated disorders, such as, but not limited to, paroxysmal nocturnal hemoglobinuria (PNH), rheumatoid arthritis, ischemia-reperfusion injury, multiple sclerosis (MS), Guillain-Barré syndrome, systemic lupus erythematosus, C3 glomerulonephritis, atypical hemolytic uremic syndrome (aHUS), myasthenia gravis (MG), neuromyelitis optica (NMOSD), dense deposition disease (DDD), age-related macular degeneration (AMD), IgA nephropathy, multifocal motor neuropathy (MMN), organ transplantation, and neurodegenerative diseases.

[0055] In some aspects, the present invention provides compositions and methods for treating a subject having a disorder that would benefit from reduced complement CFB expression. In some aspects, the methods disclosed herein prevent at least one symptom in a subject having a disease or disorder that would benefit from reduced complement CFB expression.

[0056] The present disclosure has identified specific regions within CFB mRNA that provide targets for binding double-stranded oligonucleotides, such as siRNA, that result in reduced expression levels of CFB mRNA.

[0057] The complement factor B (CFB) mRNA sequence described herein is the mRNA sequence encoded by the CFB gene according to GenBank accession number NM_001710.6.

[0058] The present disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence substantially identical to a region comprising 19 to 25 nucleotides from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region.

[0059] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising 19 to 25 nucleotides from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468.

[0060] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region comprising 19 to 25 nucleotides from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468.

[0061] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is substantially identical to a region between any one of nucleotide positions selected from a) 503-523; and b) 2190-2210 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO:1.

[0062] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region between any one of nucleotide positions selected from a) 503-523; and b) 2190-2210 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO:1.

[0063] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 503-523; and b) 2190-2210 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO:1.

[0064] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is substantially identical to a region from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 493-534; b) 991-1054; c) 1384-1500; d) 1666-1686; e) 1821-1881; f) 2116-2136; g) 2232-2307; and h) 2394-2468.

[0065] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 493-534; b) 991-1054; c) 1384-1500; d) 1666-1686; e) 1821-1881; f) 2116-2136; g) 2232-2307; and h) 2394-2468.

[0066] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence identical to a region between any one of nucleotide positions selected from a) 493-534; b) 991-1054; c) 1384-1500; d) 1666-1686; e) 1821-1881; f) 2116-2136; g) 2232-2307; and h) 2394-2468 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO:1.

[0067] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence substantially identical to a region from the 5' end of the human CFB mRNA sequence according to SEQ ID NO:1 to any one of nucleotide positions selected from a) 995-1019; b) 1606-1626; c) 1860-1880; and d) 2382-2402.

[0068] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region from the 5' end of the human CFB mRNA sequence according to SEQ ID NO:1 to any one of nucleotide positions selected from a) 995-1019; b) 1606-1626; c) 1860-1880; and d) 2382-2402.

[0069] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence identical to a region between any one of nucleotide positions selected from a) 995-1019; b) 1606-1626; c) 1860-1880; and d) 2382-2402 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO:1.

[0070] The CFB mRNA sequence according to SEQ ID NO: 1 described herein is any heterologous mRNA sequence having sufficient identity to the CFB sequence according to Accession No. NM_001710.6 described herein to allow binding to the antisense strand of an oligonucleotide of the present disclosure.

[0071] In some embodiments of the isolated oligonucleotide of the present disclosure, the isolated oligonucleotide is capable of inducing degradation of CFB mRNA.

[0072] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand is a single-stranded RNA molecule.In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand is a single-stranded RNA molecule.In some embodiments of the isolated oligonucleotide of the present disclosure, both the sense strand and the antisense strand are single-stranded RNA molecules.

[0073] In some embodiments, the isolated oligonucleotide of the present disclosure is a small interfering RNA (siRNA). Accordingly, the present disclosure provides an siRNA, wherein the siRNA comprises a sense region and an antisense region complementary to the sense region, which together form an RNA duplex, and the sense region comprises a sequence that is at least 70% to 100% identical to a CFB mRNA sequence.

[0074] definition "RNAi" or "RNA interference" refers to the process of sequence-specific post-transcriptional gene silencing mediated by double-stranded RNA (dsRNA). The double-stranded RNAs siRNA (small interfering RNA), miRNA (microRNA), shRNA (short hairpin RNA), ddRNA (DNA-directed RNA), piRNA (Piwi-interacting RNA), or rasiRNA (repeat-associated siRNA), as well as modified forms thereof, can all mediate RNA interference. These dsRNA molecules may be commercially available or may be designed and prepared based on known sequence information. The antisense strand of these molecules may comprise RNA, DNA, PNA, or a combination thereof. These DNA / RNA chimeric polynucleotides include, but are not limited to, double-stranded polynucleotides composed of DNA and RNA that inhibit the expression of a target gene. These dsRNA molecules may also contain one or more modified nucleotides, which can be incorporated into either strand, as described herein.

[0075] In RNAi gene silencing or knockdown process, dsRNA is introduced into organism, which comprises a first (antisense) strand that is complementary to a part of target gene, and a second (sense) strand that is completely or partially complementary to the first antisense strand.After being introduced into organism, target gene-specific dsRNA is processed into relatively small fragments (siRNA), and then distributed throughout organism, which can reduce the messenger RNA of target gene, and can cause the phenotype that can closely resemble the phenotype that results from the complete or partial deletion of target gene.

[0076] Certain dsRNA in cells can be acted upon by the Dicer enzyme, a ribonuclease III enzyme. Dicer can process dsRNA into shorter dsRNA fragments, i.e., siRNA. RNAi also involves an endonuclease complex known as the RNA-induced silencing complex (RISC). Following cleavage by Dicer, siRNA enters the RISC complex and directs the cleavage of single-stranded RNA targets that have sequences complementary to the antisense strand of the siRNA duplex. The other strand of the siRNA is the passenger strand. Cleavage of target RNA occurs in the center of the region complementary to the antisense strand of the siRNA duplex. Therefore, siRNA can downregulate or knock down gene expression by mediating RNA interference in a sequence-specific manner.

[0077] As used herein, " target gene " or " target sequence " refers to a gene or gene sequence whose corresponding RNA is targeted for degradation by the RNAi pathway using dsRNA or siRNA as described herein.For example, to target a gene using siRNA, the siRNA comprises an antisense region that is complementary or substantially complementary to at least a portion of the target gene or sequence, and a sense strand that is complementary to the antisense strand.When introduced into a cell, the siRNA instructs the RISC complex to cleave the RNA that contains the target sequence, thereby degrading the RNA.

[0078] As used herein, "oligonucleotide," "nucleic acid," "nucleotide sequence," and "polynucleotide" are used interchangeably and encompass both RNA and DNA, including cDNA, genomic DNA, mRNA, synthetic (e.g., chemically synthesized) DNA or RNA, and chimeras of RNA and DNA. The terms polynucleotide, nucleotide sequence, or nucleic acid refer to a chain of nucleotides regardless of chain length. A nucleic acid can be double-stranded or single-stranded. If single-stranded, the nucleic acid can be the sense strand or the antisense strand. Nucleic acids can be synthesized using oligonucleotide analogs or derivatives (e.g., inosine or phosphorothioate nucleotides). Such oligonucleotides can be used, for example, to prepare nucleic acids with altered base-pairing abilities or increased nuclease resistance. The present disclosure further provides nucleic acids that are complements (which can be either full complements or partial complements) of the nucleic acids, nucleotide sequences, or polynucleotides of the present disclosure. When dsRNA is produced synthetically, less common bases such as inosine, 5-methylcytosine, 6-methyladenine, and hypoxanthine can also be used in antisense, dsRNA, and ribozyme pairing. Other modifications, such as modifications to the phosphodiester backbone or to 2'-fluoro, 2'-hydroxy, or 2'O-methyl in the ribose sugar group of the RNA, can also be made.

[0079] The term "isolated" can refer to a nucleic acid, nucleotide sequence, or polypeptide that is substantially free of cellular material, viral material, and / or culture medium (if produced by recombinant DNA technology), or chemical precursors or other chemicals (if chemically synthesized). Furthermore, an "isolated fragment" is a fragment of a nucleic acid, nucleotide sequence, or polypeptide that is not naturally occurring as a fragment and would not be found in the natural state. "Isolated" does not imply that the preparation is technically pure (homogeneous), but rather that the polypeptide or nucleic acid is sufficiently pure to provide a form that can be used for its intended purpose.

[0080] The terms "region" or "fragment" are used interchangeably and apply to oligonucleotides.

[0081] A CFB mRNA sequence as described herein is understood to mean a nucleotide sequence that is shorter in length compared to the nucleotide sequence of a reference nucleic acid or CFB mRNA sequence and that comprises, consists essentially of, and / or consists of a nucleotide sequence of contiguous nucleotides that is identical or nearly identical (e.g., 60%, 70%, 80%, 90%, 92%, 95%, 98%, or 99% identical) to the reference nucleic acid or nucleotide sequence. Such nucleic acid fragments according to the present disclosure may, where appropriate, be included in the larger polynucleotide of which they are a component. In some embodiments, such fragments may comprise, consist essentially of, and / or consist of an oligonucleotide having a length of at least about 8, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200, or more contiguous nucleotides of a nucleic acid or nucleotide sequence according to the present disclosure.

[0082] As used herein, a "complementary" polynucleotide is one that can base-pair according to standard Watson-Crick complementarity rules. Specifically, purines base-pair with pyrimidines, forming combinations such as guanine paired with cytosine (G:C) and adenine paired with either thymine (A:T) in the case of DNA, or adenine paired with uracil (A:U) in the case of RNA. For example, the sequence "AGT" binds to the complementary sequence "TCA." It is understood that two polynucleotides can hybridize to each other even if they are not completely complementary to each other, so long as each has at least one region that is substantially complementary to the other.

[0083] As used herein, the term "substantially complementary" refers to at least 90% (e.g., 91, 92, 93, 94, 95, 96, 97, 98, or 99%) complementary to the sense strand that is substantially identical to a nucleotide sequence within a defined region of SEQ ID NO: 1. As used herein, the term "substantially complementary" means that two nucleic acid sequences are complementary over at least about 90%, 95%, or 99% of their nucleotides.

[0084] In some embodiments, two nucleic acid sequences can be complementary over at least 90%, 95%, 96%, 97%, 98%, 99% or more of their nucleotides. In some embodiments, two nucleic acid sequences can be 90%-95% complementary, 70%-100% complementary, 95%-96% complementary, 90%-100% complementary, 96%-97% complementary, 60%-80% complementary, 97%-98% complementary, 70%-90% complementary, 98%-99% complementary, 80%-100% complementary, or 99%-100% complementary.

[0085] The term "substantially complementary" can also mean that two nucleic acid sequences, a sense strand and an antisense strand, have sufficient complementarity to allow binding between the sense strand and the antisense strand to form a double-stranded region comprising 19 to 25 nucleotides in length. The term "substantially complementary" can also mean that two nucleic acid sequences can hybridize under high stringency conditions, and such conditions are well known in the art.

[0086] As used herein, the terms "substantially identical" or "sufficient identity," used interchangeably herein, refer to a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% (e.g., 70% to 80%, 8% to 90%, or 90% to 95%, or 95% to 99%, or 99% to 100%) identical to a nucleotide sequence within a defined region of SEQ ID NO:1.

[0087] As used herein, the term "identity" refers to the following comparison of sequences: To determine the percent identity of two nucleic acid sequences, the sequences can first be aligned to each other to allow for comparison of these sequences. For this purpose, for example, gaps can be inserted into the sequence of the first nucleic acid sequence, and the nucleotide can be compared with the corresponding position of the second nucleic acid sequence. If a position in the first nucleic acid sequence is occupied by the same nucleotide as in the position in the second sequence, the two sequences are identical at this position. The percent identity between two sequences is a function of the number of identical positions divided by the number of all positions compared in the examined sequences.

[0088] "Percent identity" or "% identity," as used interchangeably herein with respect to aligned segments of a test sequence and a reference sequence, is the percentage of identical components shared by the two aligned sequences divided by the total number of components in the reference sequence segment, i.e., the entire reference sequence or a smaller, defined portion of the reference sequence.

[0089] The percent identity of two sequences can be determined using a mathematical algorithm. A preferred, but non-limiting, example of a mathematical algorithm that can be used to compare two sequences is the algorithm of Karlin et al. (1993), PNAS USA, 90:5873-5877. Such an algorithm is incorporated into the NBLAST program, which can identify sequences with a desired identity to the sequences disclosed herein. To obtain gapped alignments, the "Gapped BLAST" program can be used, as described herein, as described in Altschul et al. (1997), Nucleic Acids Res, 25:3389-3402. When using BLAST and Gapped BLAST programs, the preset parameters of the particular program (e.g., NBLAST) can be used. Sequences can be further aligned using the Genetic Computing Group's GAP (Global Alignment Program) version 9, using a preset (BLOSUM62) matrix (values ​​-4 to +11), with a gap open penalty of -12 (for the first zero in a gap) and a gap extension penalty of -4 (for each additional consecutive zero in a gap). After alignment, percent identity is calculated by expressing the number of matches as a percentage of the nucleic acid content in the claimed sequence. The methods described for determining percent identity of two nucleic acid sequences can also be used accordingly for encoded amino acid sequences, if desired.

[0090] Useful methods for determining sequence identity are also disclosed in Guide to Huge Computers (Martin J. Bishop, ed., Academic Press, San Diego (1994)), and Carillo, H., and Lipton, D., (Applied Math 48:1073 (1988)). More specifically, preferred computer programs for determining sequence identity include, but are not limited to, the Basic Local Alignment Search Tool (BLAST) program, publicly available from the National Center for Biotechnology Information (NCBI), National Library of Medicine, National Institutes of Health, Bethesda, Md. 20894; see BLAST Manual, Altschul et al., NCBI, NLM, NIH; (Altschul et al., J. Mol. Biol. 215:403-410 (1990)); BLAST program version 2.0 and above allows for the introduction of gaps (deletions and insertions) into the alignment; for peptide sequences, BLASTX can be used to determine sequence identity, and for polynucleotide sequences, BLASTN can be used to determine sequence identity. The percent identity can be 70% identity or more, for example, at least 70% identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 98% identity, at least 99% identity, or 100% identity.

[0091] As used herein, "heterologous" refers to a nucleic acid sequence that originates from another species, or that originates from the same species or organism but that has been modified from either its original form or the form primarily expressed in the cell. Thus, a nucleotide sequence that originates from an organism or species different from the cell into which it is introduced is heterologous with respect to that cell and its progeny. Furthermore, heterologous nucleotide sequences include nucleotide sequences that originate from and are inserted into the same native cell type of origin, but that exist in a non-native state, e.g., in a different copy number and / or under the control of regulatory sequences different from those found in nature.

[0092] Double-stranded RNA targeting human complement factor B (CFB)

[0093] The present disclosure provides an isolated oligonucleotide comprising a double-stranded RNA (dsRNA) duplex region that targets a CFB mRNA sequence for degradation. The double-stranded RNA molecule of the present disclosure can be in the form of any type of RNA interference molecule known in the art. In some embodiments, the double-stranded RNA molecule is a small interfering RNA (siRNA). In other embodiments, the double-stranded RNA molecule is a short hairpin RNA (shRNA) molecule. In other embodiments, the double-stranded RNA molecule is a Dicer substrate that is processed in cells to generate siRNA. In other embodiments, the double-stranded RNA molecule is part of a microRNA precursor molecule.

[0094] In some embodiments, the dsRNA is a small interfering RNA (siRNA) that targets the CFB mRNA sequence for degradation. In some embodiments, the siRNA that targets CFB is packaged in a delivery system (e.g., nanoparticle) as described herein.

[0095] The isolated oligonucleotides of the present disclosure that target CFB for degradation can comprise a sense strand that is at least 70% identical to any fragment of CFB mRNA, for example, the CFB mRNA of SEQ ID NO: 1. In some embodiments, the sense strand comprises or consists essentially of a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or 100% identical to any fragment of SEQ ID NO: 1. The siRNA that targets CFB for degradation can comprise an antisense strand that is at least 70% identical to a sequence complementary to any fragment of CFB mRNA, for example, the CFB mRNA of SEQ ID NO: 1. In some embodiments, the antisense strand comprises or consists essentially of a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or 100% identical to a sequence complementary to any fragment of SEQ ID NO: 1. In some embodiments, the sense and antisense regions are complementary and base-pair to form an RNA duplex structure. The fragment of the CFB mRNA that has percent identity to the sense region of the siRNA and is complementary to the antisense region of the siRNA can be the protein coding sequence of the mRNA, the untranslated region (UTR) of the mRNA (5'UTR or 3'UTR), or both.

[0096] In some embodiments, the isolated oligonucleotide of the present disclosure comprises a sense region and an antisense region complementary to the sense region that together form an RNA duplex, and the sense region comprises a sequence that is at least 70% identical to a CFB mRNA sequence. In some embodiments, the sense region is identical to a CFB mRNA sequence.

[0097] As used herein, the term "sense strand" or "sense region" refers to the nucleotide sequence of an siRNA molecule that is partially or completely complementary to at least a portion of the corresponding antisense strand or antisense region of the siRNA molecule. The sense strand of the isolated oligonucleotide of the disclosed molecule can comprise a nucleic acid sequence that has a certain percent identity with a target nucleic acid sequence, such as a CFB mRNA sequence. In some cases, the sense region can have 100% identity, i.e., complete identity or homology, with the target nucleic acid sequence. In other cases, there can be one or more mismatches between the sense region and the target nucleic acid sequence. For example, there can be 1, 2, 3, 4, 5, 6, or 7 mismatches between the sense region and the target nucleic acid sequence.

[0098] As used herein, the term "antisense strand" or "antisense region" refers to the nucleotide sequence of an isolated oligonucleotide of the present disclosure that is partially or completely complementary to at least a portion of a target nucleic acid sequence. The antisense strand of an isolated oligonucleotide of the disclosed molecule can comprise a nucleic acid sequence that is complementary to at least a portion of the corresponding sense strand of the isolated oligonucleotide.

[0099] In some embodiments, the sense region comprises a sequence that is at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% identical, or 100% identical to the sequence of SEQ ID NO:1 or a region of SEQ ID NO:1 disclosed herein. In some embodiments, the sense region consists essentially of a sequence that is at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% identical, or 100% identical to the sequence of SEQ ID NO:1 or a region of SEQ ID NO:1 disclosed herein. In some embodiments, the sense region comprises a sequence that is identical to the sequence of SEQ ID NO:1 or a region of SEQ ID NO:1 as disclosed herein.

[0100] In some embodiments, the sense region of an isolated oligonucleotide of the present disclosure targeting CFB has one or more mismatches between the sequence of the isolated oligonucleotide and the CFB sequence. For example, the sequence of the sense region may have 1, 2, 3, 4, or 5 mismatches between the sequence of the sense region of the isolated oligonucleotide and the CFB sequence. In some embodiments, the CFB sequence is the CFB 3' untranslated region sequence (3'UTR). Without wishing to be bound by theory, siRNAs targeting the 3'UTR are believed to have a higher mismatch tolerance compared to mismatches in isolated oligonucleotides targeting the coding region of a gene. Furthermore, the isolated oligonucleotide RNA may be tolerant of mismatches outside the seed region. As used herein, the "seed region" of an isolated oligonucleotide refers to base pairs 2 to 8 of the antisense region of the isolated oligonucleotide, i.e., the strand of the isolated oligonucleotide that is complementary to and hybridizes to the target mRNA.

[0101] In some embodiments, the antisense region comprises a sequence that is at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% identical, or 100% identical to the sequence of SEQ ID NO:1 or a sequence complementary to a region of SEQ ID NO:1 disclosed herein. In some embodiments, the antisense region consists essentially of a sequence that is at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% or 100% identical to the sequence of SEQ ID NO:1 or a sequence complementary to a region of SEQ ID NO:1. In some embodiments, the sense region consists essentially of the sequence of SEQ ID NO:1 or a sequence complementary to a region of SEQ ID NO:1.

[0102] The antisense region of the CFB-targeting isolated oligonucleotide of the present disclosure is complementary to the sense region. In some embodiments, the sense region and the antisense region are fully complementary (no mismatches). In some embodiments, the antisense region is partially complementary to the sense region, i.e., there are 1, 2, 3, 4, or 5 mismatches between the sense region and the antisense region.

[0103] Generally, the isolated oligonucleotides of the present disclosure comprise an RNA duplex about 16 to about 25 nucleotides in length. In some embodiments, the RNA duplex is about 17 to about 24 nucleotides in length, about 18 to about 23 nucleotides in length, or about 19 to about 22 nucleotides in length. In some embodiments, the RNA duplex is 19 nucleotides in length. In some embodiments, the RNA duplex is 20 nucleotides in length.

[0104] In some embodiments of the isolated oligonucleotide of the present disclosure, sense strand is a single-stranded RNA molecule.In some embodiments of the isolated oligonucleotide of the present disclosure, antisense strand is a single-stranded RNA molecule.In some embodiments, both sense strand and antisense strand are single-stranded RNA molecules.In some embodiments, the isolated oligonucleotide of the present disclosure is an siRNA that targets CFB, which comprises two different single-stranded RNAs, the first one comprises a sense region, and the second one comprises an antisense region, and they hybridize to form an RNA duplex.

[0105] In some embodiments, the isolated oligonucleotides of the present disclosure can have one or more overhangs from the double-stranded region. In some embodiments, the overhangs, which are single-stranded regions that are not base-paired, can be 1 to 8 nucleotides in length or longer. In some embodiments, the overhangs can be 3' overhangs, where the 3' end of the strand has a single-stranded region of 1 to 8 nucleotides. In some embodiments, the overhangs can be 5' overhangs, where the 5' end of the strand has a single-stranded region of 1 to 8 nucleotides. In some embodiments, the overhangs of the isolated oligonucleotides are the same length. In some embodiments, the overhangs of the isolated oligonucleotides are different lengths.

[0106] In some embodiments of the isolated oligonucleotide of the present disclosure, the single-stranded RNA molecule of the sense strand comprises a 3' overhang. In some embodiments, the 3' overhang of the single-stranded RNA molecule of the sense strand comprises at least one nucleotide. In some embodiments, the 3' overhang of the single-stranded RNA molecule of the sense strand comprises two nucleotides.

[0107] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense single-stranded RNA molecule comprises a 3' overhang. In some embodiments, the 3' overhang of the antisense single-stranded RNA molecule comprises at least one nucleotide. In some embodiments, the 3' overhang of the antisense single-stranded RNA molecule comprises two nucleotides.

[0108] In some embodiments of the isolated oligonucleotide of the present disclosure, both ends of the isolated oligonucleotide have overhangs, for example, 3' dinucleotide overhangs at each end. In some embodiments, the overhangs at the 5' and 3' ends are different lengths. In some embodiments, the overhangs at the 5' and 3' ends are the same length.

[0109] In some embodiments of the isolated oligonucleotides of the present disclosure, the overhangs can comprise one or more deoxyribonucleotides, one or more ribonucleotides, or a combination of deoxyribonucleotides and ribonucleotides. In some embodiments, one or both of the overhanging nucleotides of the siRNA can be 2'-deoxyribonucleotides.

[0110] In some embodiments of the isolated oligonucleotide of the present disclosure, the first single-stranded RNA molecule comprises a first 3' overhang. In some embodiments, the second single-stranded RNA molecule comprises a second 3' overhang. In some embodiments, the first and second 3' overhangs comprise a dinucleotide.

[0111] In some embodiments of the isolated oligonucleotides of the present disclosure, the 3' overhang comprises any one of thymidine-thymidine (dTdT), adenine-adenine (AA), cysteine-cysteine ​​(CC), guanine-guanine (GG), or uracil-uracil (UU). In some embodiments, the isolated oligonucleotides of the present disclosure, the 3' overhang comprises a thymidine-thymidine (dTdT) or uracil-uracil (UU) overhang. In some embodiments, the 3' overhang comprises a uracil-uracil (UU) overhang. Without wishing to be bound by theory, it is believed that 3' overhangs, such as dinucleotide overhangs, enhance siRNA-mediated mRNA degradation by increasing the rate of siRNA-RISC complex formation and / or cleavage of the target mRNA by the siRNA-RISC complex.

[0112] In some embodiments, the isolated oligonucleotide of the present disclosure can have one or more blunt ends, where the double-stranded region ends without overhang, and the strand forms base pairs with the end of the double-stranded region.In some embodiments, the isolated oligonucleotide of the present disclosure can have one or more blunt ends, or can have one or more overhangs, or can have a combination of blunt ends and overhang ends.For example, the 5' end of siRNA can be blunt, and the 3' end of the same isolated oligonucleotide can comprise overhang, or vice versa.

[0113] In some embodiments, both ends of the isolated oligonucleotide of the present disclosure are blunt ended.

[0114] In some embodiments of the isolated oligonucleotides of the present disclosure, the double-stranded region comprises an antisense strand and a sense strand according to any one of the antisense and sense strand sequence pairs in Table 1, as described below.

[0115] complement system

[0116] The complement system is a key component of the innate immune system and comprises a group of proteins that are normally present in an inactive state. These proteins are organized into three activation pathways: the classical pathway, the lectin pathway, and the alternative pathway.

[0117] Molecules from microorganisms, antibodies, or cellular components can activate these pathways, leading to the formation of protease complexes known as C3 and C5 convertases. The first enzyme activation cascade, known as the classical pathway, is a calcium / magnesium-dependent cascade that is usually activated by the formation of antigen-antibody complexes. It can also be activated antibody-independently by the binding of ligand-complexed C-reactive protein and by many pathogens, including gram-negative bacteria.

[0118] As described in U.S. Patent No. 8,703,136, the classical pathway includes several components: C1, C4, C2, C3, and C5 (listed in order within the pathway). Initiation of the classical pathway of the complement system occurs after binding and activation of the first complement component (C1) by both immune and non-immune activators. C1 comprises a calcium-dependent complex of components C1q, C1r, and C1s and is activated by binding of the C1q component. C1q contains six identical subunits, and each subunit contains three chains (A, B, and C chains). Each chain has a globular head region connected to a collagen-like tail. Binding and activation of C1q by antigen-antibody complexes occurs via the C1q headgroup region. Many non-antibody C1q activators, including proteins, lipids, and nucleic acids, bind and activate C1q through distinct sites on the collagen-like stalk region. The C1qrs complex then catalyzes the activation of complement components C4 and C2 to form the C4b2a complex, which functions as a C3 convertase.

[0119] The second enzymatically activated cascade, known as the alternative pathway, is a rapid, antibody-independent pathway for complement system activation and amplification. The alternative pathway is a magnesium-dependent cascade activated by the deposition and activation of C3 on certain sensitive surfaces (e.g., yeast and bacterial cell wall polysaccharides and certain biopolymer materials). The alternative pathway involves several components, including C3, complement factor B (CFB), and factor D (listed in order within the pathway). Activation of the alternative pathway occurs when C3b (the proteolytically cleaved, active form of C3) binds to an activating surface, such as bacteria. CFB then binds to C3b and is cleaved by factor D to yield the active enzyme Bb. The resulting complement complex C3bBb is the alternative pathway C3 convertase. The enzyme C3b-Bb cleaves C3 to generate C3b, leading to widespread deposition of the C3b-Bb complex on activating surfaces.

[0120] Thus, both the classical and alternative complement pathways produce C3 convertases, which cleave factor C3 into C3a and C3b. At this point, both C3 convertases further assemble into C5 convertases (C4b2a3b and C3b3bBb). These complexes then cleave complement component C5 into two components: the C5a polypeptide (9 kDa) and the C5b polypeptide (170 kDa). The C5a polypeptide binds to a seven-transmembrane G protein-coupled receptor, which was originally associated with leukocytes and is now known to be expressed on various tissues, including hepatocytes and neurons. The C5a molecule is the primary chemotactic component of the human complement system and can trigger various biological responses, including leukocyte chemotaxis, smooth muscle contraction, activation of intracellular signaling pathways, neutrophil-endothelial adhesion, cytokine and lipid mediator release, and oxidant formation.

[0121] The larger C5b fragment sequentially binds to subsequent components of the complement cascade, C6, C7, C8, and C9, to form the C5b-9 membrane attack complex ("MAC"). The lipophilic C5b-9 MAC can directly lyse red blood cells, and in larger amounts, it is lytic to white blood cells and damages tissues such as muscle, epithelial, and endothelial cells. At sublytic doses, the C5b-9 MAC can stimulate upregulation of adhesion molecules, intracellular calcium increases, and cytokine release. Furthermore, at sublytic concentrations, the C5b-9 MAC can stimulate cells such as endothelial cells and platelets without causing cell lysis. The nonlytic effects of C5a and C5b-9 MAC are comparable and interchangeable.

[0122] The lectin pathway is initiated when pattern recognition molecules (MBL, CL-K1 and ficolins) bind to so-called pathogen-associated molecular patterns (PAMPs) (D-mannose, N-acetyl-D-glucosamine, or acetyl groups) on the surface of pathogens or apoptotic or necrotic cells (Beltrame et.al, 2015).

[0123] The complement system plays an important role in maintaining health, but can also cause or contribute to disease.

[0124] Complement-targeting drugs have been approved for routine clinical use by the U.S. Food and Drug Administration (FDA) and the European Medicines Agency for four diseases (Garred et al., 2021). Eculizumab (Soliris), a mAb that inhibits C5 cleavage, was shown to be highly effective in protecting against hemolysis in PNH in 2007 (Brodsky et al., 2008; Parker, 2009) and subsequently for the treatment of atypical hemolytic uremic syndrome (aHUS) (Tschumi et al., 2011; Loirat et al., 2016). More recently, it has also been approved for the neurological disorders generalized myasthenia gravis (Dhillon, 2018) and neuromyelitis optica spectrum disorder (Selmaj and Selmaj, 2019).

[0125] Eculizumab was the only complement inhibitor approved for routine use until the recent introduction of ravulizumab (Ultomiris) and zilucoplan. Ravulizumab is a second-generation eculizumab, which incorporates several small amino acid modifications to the eculizumab molecule, thereby substantially increasing its half-life and allowing treatment intervals to be increased from every 2 weeks to every 8 weeks. It shares the same binding site for C5 as eculizumab (i.e., blocking its cleavage and thereby preventing the release of C5a and the formation of C5b-9) (Kulasekararaj et al., 2019; Lee et al., 2019; McKeage, 2019; Stern and Connell, 2019; Lee and Kulasekararaj, 2020).

[0126] Zilucoplan is a drug that is structurally distinct from the antibodies mentioned above but shares the same primary function. It is a self-administered synthetic macrocyclic peptide inhibitor for subcutaneous administration that primarily functions similarly to eculizumab, blocking C5 cleavage (Beecher et al., 2019; Albazli et al., 2020; Howard et al., 2020). A phase 2, randomized, double-blind, placebo-controlled, multicenter clinical trial demonstrated that zilucoplan administration resulted in rapid, significant, and sustained improvement over 12 weeks in a broad population of patients with moderate to severe acetylcholine receptor antibody-positive generalized myasthenia gravis (Howard et al., 2020). A closely related analog of zilucoplan (RA101495), RA101295, has been used in animal studies and has been shown to increase survival in baboon Escherichia coli sepsis (Keshari et al., 2017).

[0127] Thus, the isolated oligonucleotides disclosed in this disclosure are useful for treating or preventing diseases or disorders associated with aberrant or increased expression or activity of CFB, or diseases or disorders in which CFB plays a role. Exemplary isolated oligonucleotides of this disclosure are listed in Table 1.

[0128] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence selected from any one of the group of sense strand / passenger strand sequences listed in Table 1, Table 2, or Table 3. In some embodiments, the antisense strand comprises a sequence selected from any one of the group of antisense strand / guide strand sequences listed in Table 1, Table 2, or Table 3. In some embodiments, the sense and antisense regions comprise complementary sequences selected from the groups listed in Table 1, Table 2, and Table 3.

[0129] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2-35.

[0130] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 36-69.

[0131] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2-35, and the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 36-69, wherein the antisense and sense strand sequences have sufficient complementarity to allow formation of a double-stranded region between the antisense and sense strands.

[0132] Sequences of the present disclosure

[0133] The present disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence substantially identical to a region between any one of nucleotide positions selected from a) 493-534; b) 991-1054; c) 1384-1500; d) 1606-1686; e) 1821-1881; f) 2116-2307; and g) 2382-2468 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand, such that the sense strand and the antisense strand together form a double-stranded region.

[0134] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising 19 to 25 nucleotides from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468.

[0135] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence identical to a region comprising 19 to 25 nucleotides from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468.

[0136] The present disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence substantially identical to a region between any one of nucleotide positions selected from a) 503-523; and b) 2190-2210 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO:1.

[0137] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region between any one of nucleotide positions selected from a) 503-523; and b) 2190-2210 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO:1.

[0138] The present disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 503 to 523; and b) 2190 to 2210 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO:1.

[0139] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 503 to 523; and b) 2190 to 2210 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5'UAUAGCAGUGGAAAGAGAUCUC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5'GAUCUCUUUCCACUGCUAUA3'); or ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5'UAAGUAUUGGGGUCAGCAUAGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5'UAUGCUGACCCCAAUACUUA3').

[0140] The present disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a sequence substantially identical to a region between any one of nucleotide positions selected from a) 493-534; b) 991-1054; c) 1384-1500; d) 1666-1686; e) 1821-1881; f) 2116-2136; g) 2232-2307; and h) 2394-2468 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1.

[0141] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region between any one of nucleotide positions selected from a) 493-534; b) 991-1054; c) 1384-1500; d) 1666-1686; e) 1821-1881; f) 2116-2136; g) 2232-2307; and h) 2394-2468 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1.

[0142] The present disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 493-534; b) 991-1054; c) 1384-1500; d) 1666-1686; e) 1821-1881; f) 2116-2136; g) 2232-2307; and h) 2394-2468 from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1.

[0143] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 493-534; b) 991-1054; c) 1384-1500; d) 1666-1686; e) 1821-1881; f) 2116-2136; g) 2232-2307; and h) 2394-2468 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1, and the double-stranded region is selected from i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5'UAAAGAGAUCUCAUCACUCACA3'), and ii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5'UGAGUGAUGAGAUCUCUUUA3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UGGAAAGAGAUCUCAUCACUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'AGUGAUGAGAUCUCUUUCCA3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5'UCAGUGGAAAGAGAUCUCAUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5'AUGAGA iv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5'UGUGUAACCGUCAUAGCAGUGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 389 (5'ACUGCUAUGACGGUUACACA3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5'UUUGACUAGACACUUUUUGGCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5'CCAAAAAGUGUCUAGUCAAA3') ) the sense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5'UAAUUAAGUUGACUAGACACUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5'GUGUCUAGUCAACUUAAUUA3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5'UAUAUCUUGGCUUCACACCAUA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5'UGGUGUGAAGCCAAGAUAUA3');viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5'UUAGACAUCCAGAUAAUCCUCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5'AGGAUUAUCUGGAUGUCUAA3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5'UAAGCAUUGAUGUUCACUUGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5'CAAGUGAACAUCAAUGCUUA3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5'UAAAGCAUUGAUG xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5'UAACACAUGUUGCUCAUUGUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5'ACAAUGAGCAACAUGUGUUA3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UUUGACUUUGAACACAUGUUGC3'). strand and the sense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5'AACAUGUGUUCAAAGUCAAA3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5'UAUAUCCUUGACUUUGAACACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5'UGUUCAAAGUCAAGGAUAUA3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5'UAAGUACUCAGACACCACAGCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5'CUGUGGUGUC xv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5'UAUUCAGGAAUUCCUGCUUCUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5'GAAGCAGGAAUUCCUGAAUA3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5'UAAUUCAGGAAUUCCUGCUUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'AAGCAGGAAUUCCUGAAUUA3');xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5'UUAAAAUUCAGGAAUUCCUGCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5'CAGGAAUUCCUGAAUUUUAA3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5'UAUAAAAUUCAGGAAUUCCUGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5'AGGAAUUCCUGAAUUUUAUA3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5'UGUCAUAAAA xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5'UUUAUUCUUGAGCUUGAUCAGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5'UGAUCAAGCUCAAGAAUAAA3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5'UUUGACUUUGUCAUAGCCUGGG3'). xxii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5'UUUCUCUUGUGAACUAUCAAGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 63 (5'UUGAUAGUUCACAAGAGAAA3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UAAACGACUUCUCUUGUGAACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5'UUCACAAGAG xxiv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5'UUUUUUGCAGACAUCCACUACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5'UAGUGGAUGUCUGCAAAAAA3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5'UAACCCAAAUCCUCAUCUUGGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5'CAAGAUGAGGAUUUGGGUUA3');xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5'UAAACCCAAAUCCUCAUCUUGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5'AAGAUGAGGAUUUGGGUUUA3'); or xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAGCUGUUUUAAUUCAAUCCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5'GAUUGAAUUAAAACAGCUGA3');

[0144] The present disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a sequence substantially identical to a region between any one of nucleotide positions selected from a) 995-1019; b) 1606-1626; c) 1860-1880; and d) 2382-2402 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO:1.

[0145] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region between any one of nucleotide positions selected from a) 995-1019; b) 1606-1626; c) 1860-1880; and d) 2382-2402 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO:1.

[0146] The present disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 995-1019; b) 1606-1626; c) 1860-1880; and d) 2382-2402 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO:1.

[0147] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence identical to a region between any one of nucleotide positions selected from a) 995-1019; b) 1606-1626; c) 1860-1880; and d) 2382-2402 from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1, and the double-stranded region is selected from i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5'UUAAGUUGACUAGACACUUUUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5'AAAGUGUCUAGUCAACUUAA3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5'UCAAUUAAGUUGACUAGACACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5'UGUCUAGUCAACUUAAUUGA3'). strand; iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5'UGAGAUCUUGGCCUGCCAUGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5'CAUGGCAGGCCAAGAUCUCA3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5'UUAUUCUUGAGCUUGAUCAGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5'CUGAUCAAGCUCAAGAAUAA3'); or v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5'UCAUCUUGGAGUUUCUCCUUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 66 (5'AAGGAGAAACUCCAAGAUGA3').

[0148] At least 50% knockdown of CFB at 0.1 nM

[0149] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence identical to a region between any one of nucleotide positions selected from a) 493-534; b) 991-1054; c) 1384-1500; d) 1606-1686; e) 1821-1881; f) 2116-2307; and g) 2382-2468 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region. Attenuate mRNA expression by at least 50% (e.g., 50%-55%, 55%-60%, 60%-65%, 65%-70%, 70%-75%, 75%-80%, 80%-85%, 85%-90%, 90%-95%, or 95%-99%, 99%-100%) at a dose of 0.1 nM.

[0150] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence identical to a region between any one of nucleotide positions selected from a) 493-534; b) 991-1054; c) 1384-1500; d) 1606-1686; e) 1821-1881; f) 2116-2307; and g) 2382-2468 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide is capable of detecting CFB at a dose of 0.1 nM. The double-stranded region attenuates mRNA expression by at least 50%, and the double-stranded region is selected from the group consisting of: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5'UAAAGAGAUCUCAUCACUCACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5'UGAGUGAUGAGAUCUCUUUA3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UGGAAAGAGAUCUCAUCACUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'AGUGAUGAGAUCUCUUUCCA3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5'UCAGUGGAAAGAGAUCUCAUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5'AUGAGAUCUCUUUCCACUGA3'); iv) SEQ ID NO: 6 (5'UGUGUAACCGUCAUAGCAGUGG3'). and the sense strand of the nucleic acid sequence according to SEQ ID NO: 389 (5'ACUGCUAUGACGGUUACACA3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5'UUUGACUAGACACUUUUUGGCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5'CCAAAAAGUGUCUAGUCAAA3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5'UAAUUAAGUUGACUAGACACUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5'GUGUCUAGUCAACUUAAUUA3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5'UAUAUCUUGGCUUCACACCAUA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5'UGGUGUGAAGCCAAGAUAUA3');viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5'UUAGACAUCCAGAUAAUCCUCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5'AGGAUUAUCUGGAUGUCUAA3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5'UAAGCAUUGAUGUUCACUUGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5'CAAGUGAACAUCAAUGCUUA3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5'UAAAGCAUUGAUG xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5'UAACACAUGUUGCUCAUUGUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5'ACAAUGAGCAACAUGUGUUA3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UUUGACUUUGAACACAUGUUGC3'). strand and the sense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5'AACAUGUGUUCAAAGUCAAA3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5'UAUAUCCUUGACUUUGAACACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5'UGUUCAAAGUCAAGGAUAUA3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5'UAAGUACUCAGACACCACAGCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5'CUGUGGUGUC xv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5'UAUUCAGGAAUUCCUGCUUCUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5'GAAGCAGGAAUUCCUGAAUA3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5'UAAUUCAGGAAUUCCUGCUUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'AAGCAGGAAUUCCUGAAUUA3');xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5'UUAAAAUUCAGGAAUUCCUGCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5'CAGGAAUUCCUGAAUUUUAA3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5'UAUAAAAUUCAGGAAUUCCUGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5'AGGAAUUCCUGAAUUUUAUA3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5'UGUCAUAAAA xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5'UUUAUUCUUGAGCUUGAUCAGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5'UGAUCAAGCUCAAGAAUAAA3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5'UUUGACUUUGUCAUAGCCUGGG3'). xxii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5'UUUCUCUUGUGAACUAUCAAGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 63 (5'UUGAUAGUUCACAAGAGAAA3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UAAACGACUUCUCUUGUGAACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5'UUCACAAGAG xxiv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5'UUUUUUGCAGACAUCCACUACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5'UAGUGGAUGUCUGCAAAAAA3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5'UAACCCAAAUCCUCAUCUUGGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5'CAAGAUGAGGAUUUGGGUUA3');xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5'UAAACCCAAAUCCUCAUCUUGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5'AAGAUGAGGAUUUGGGUUUA3'); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAGCUGUUUUAAUUCAAUCCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5'GAUUGAAUUAAAACAGCUGA3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5'UUAAGUUGACU xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5'UCAAUUAAGUUGACUAGACACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5'UGUCUAGUCAACUUAAUUGA3'); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5'UGAGAUCUUGGCCUGCCAUGGU3'). , and the sense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5'CAUGGCAGGCCAAGAUCUCA3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5'UUAUUCUUGAGCUUGAUCAGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5'CUGAUCAAGCUCAAGAAUAA3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5'UCAUCUUGGAGUUUCUCCUUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 66 (5'AAGGAGAAACUCCAA xxxiii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5'UAUAGCAGUGGAAAGAGAUCUC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5'GAUCUCUUUCCACUGCUAUA3'); or xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5'UAAGUAUUGGGGUCAGCAUAGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5'UAUGCUGACCCCAAUACUUA3');

[0151] At least 50% knockdown of CFB at 0.02nM

[0152] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence identical to a region between any one of nucleotide positions selected from a) 493-534; b) 991-1054; c) 1384-1500; d) 1606-1686; e) 1821-1881; f) 2116-2307; and g) 2382-2468 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region. Attenuate mRNA expression by at least 50% (e.g., 50%-55%, 55%-60%, 60%-65%, 65%-70%, 70%-75%, 75%-80%, 80%-85%, 85%-90%, 90%-95%, or 95%-99%, 99%-100%) at a dose of 0.02 nM.

[0153] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence identical to a region between any one of nucleotide positions selected from a) 493-534; b) 991-1054; c) 1384-1500; d) 1606-1686; e) 1821-1881; f) 2116-2307; and g) 2382-2468 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region. The double-stranded region of the compound of formula (I) was selected from the group consisting of: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5'UAAAGAGAUCUCAUCACUCACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5'UGAGUGAUGAGAUCUCUUUA3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UGGAAAGAGAUCUCAUCACUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'AGUGAUGAGAUCUCUUUCCA3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5'UCAGUGGAAAGAGAUCUCAUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5'AUGAGAUCUCUUUCCACUGA3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5'UGUGUAACCGUCAUAGCAGUG G3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 389 (5'ACUGCUAUGACGGUUACACA3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5'UAAUUAAGUUGACUAGACACUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5'GUGUCUAGUCAACUUAAUUA3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5'UUAGACAUCCAGAUAAUCCUCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5'AGGAUUAUCUGGAUGUCUAA3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5'UAAGCAUUGAUGUUCACUUGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5'CAAGUGAACAUCAAUGCUUA3');viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5'UAAAGCAUUGAUGUUCACUUGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5'AAGUGAACAUCAAUGCUUUA3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5'UUAAAAUUCAGGAAUUCCUGCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5'CAGGAAUUCCUGAAUUUUAA3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5'UAUAAAAUUCAGGA AUUCCUGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5'AGGAAUUCCUGAAUUUUAUA3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5'UGUCAUAAAAUUCAGGAAUUCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAUUCCUGAAUUUUAUGACA3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UAAACGACUUCUCUUGUGAACU3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5'UUCACAAGAGAAGUCGUUUA3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5'UAAACCCAAAUCCUCAUCUUGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5'AAGAUGAGGAUUUGGGUUUA3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAGCUGUUUUAAUUCAAUCCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5'GAUUGAAUUAAAA xv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5'UAUAGCAGUGGAAAGAGAUCUC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5'GAUCUCUUUCCACUGCUAUA3'); or xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5'UAAGUAUUGGGGUCAGCAUAGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5'UAUGCUGACCCCAAUACUUA3');

[0154] 20-50% knockdown of CFB at 0.02nM

[0155] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence substantially identical to a region comprising 19 to 25 nucleotides from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, or 45% to 50%) at a dose of 0.02 nM.

[0156] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence that is substantially identical to a region comprising 19 to 25 nucleotides between any one of nucleotide positions selected from a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468 from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region. The mRNA expression was attenuated by 20% to 50% at a dose of 0.02 nM, and the double-stranded region consisted of: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5'UUAAGUUGACUAGACACUUUUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5'AAAGUGUCUAGUCAACUUAA3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5'UCAAUUAAGUUGACUAGACACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5'UGUCUAGUCAACUUAAUUGA3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5'UGAGAUCUUGGCCUGCCAUGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5'CAUGGCAGGCCAAGAUC iv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5'UUAUUCUUGAGCUUGAUCAGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5'CUGAUCAAGCUCAAGAAUAA3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5'UCAUCUUGGAGUUUCUCCUUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 66 (5'AAGGAGAAACUCCAAGAUGA3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5'UUUUUUGCAGACAUCCACUACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5'UAGUGGAUGUCUGCAAAAAA3');vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5'UAACCCAAAUCCUCAUCUUGGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5'CAAGAUGAGGAUUUGGGUUA3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5'UUUAUUCUUGAGCUUGAUCAGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5'UGAUCAAGCUCAAGAAUAAA3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5'UUUGACUUUGU CAUAGCCUGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5'CAGGCUAUGACAAAGUCAAA3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5'UUUCUCUUGUGAACUAUCAAGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 63 (5'UUGAUAGUUCACAAGAGAAA3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5'UAACACAUGUUGCUCAUUGUCU3'). strand and the sense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5'ACAAUGAGCAACAUGUGUUA3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UUUGACUUUGAACACAUGUUGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5'AACAUGUGUUCAAAGUCAAA3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5'UAUAUCCUUGACUUUGAACACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5'UGUUCAAAGU xiv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5'UAAGUACUCAGACACCACAGCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5'CUGUGGUGUCUGAGUACUUA3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5'UAUUCAGGAAUUCCUGCUUCUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5'GAAGCAGGAAUUCCUGAAUA3');xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5'UAAUUCAGGAAUUCCUGCUUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'AAGCAGGAAUUCCUGAAUUA3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5'UUUGACUAGACACUUUUUGGCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5'CCAAAAAGUGUCUAGUCAAA3'); or xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5'UAUAUCUUGGCUUCACACCAUA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5'UGGUGUGAAGCCAAGAUAUA3');

[0157] The present disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence substantially identical to a region comprising 19 to 25 nucleotides from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1 and between any one of nucleotide positions selected from a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1815 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand, such that the sense strand and the antisense strand together form a double-stranded region.

[0158] 20-50% knockdown of CFB at 0.1 nM

[0159] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region comprising 19 to 25 nucleotides from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1815 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by 20% to 50% at a dose of 0.1 nM.

[0160] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence that is substantially identical to a region comprising 19 to 25 nucleotides from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1 and between any one of nucleotide positions selected from a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1815 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide comprises a CFB mRNA sequence according to SEQ ID NO: 1. The mRNA expression was attenuated by 20% to 50% at a dose of 0.1 nM, and the double-stranded region consisted of: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 94 (5'UGACACUUUUUGGCUCCUGUGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 204 (5'ACAGGAGCCAAAAAGUGUCA3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 124 (5'UAUGUUGCUCAUUGUCUUUCUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 234 (5'GAAAGACAAUGAGCAACAUA3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 169 (5'UCUCUUGUGAACUAUCAAGGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 279 (5'CCUUGAUAGUUCACAAG AGA3'); iv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 87 (5'UGUACAUGAAGGAGUCUUGGCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 197 (5'CCAAGACUCCUUCAUGUACA3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 163 (5'UGUCAGCAUAGGGACUCACUCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 273 (5'AGUGAGUCCCUAUGCUGACA3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 104 (5'UCUUCAACUUGUGGUCUUCAUA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 214 (5'UGAAGACCACAAGUUGAAGA3');vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 121 (5'UCUCAUUGUCUUUCUUGGAAGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 231 (5'UUCCAAGAAAGACAAUGAGA3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 99 (5'UUUCUCAAUUAAGUUGACUAGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 209 (5'UAGUCAACUUAAUUGAGAAA3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 155 (5'UCUCUCUCACA x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 144 (5'UCUUAUUCUUGAGCUUGAUCAG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 254 (5'GAUCAAGCUCAAGAAUAAGA3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 136 (5'UCUGACCUUGAUUGAGUGUUCC3'). strand and the sense strand of the nucleic acid sequence according to SEQ ID NO: 246 (5'AACACUCAAUCAAGGUCAGA3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 76 (5'UGGAUUGCUCUGCACUCUGCCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 186 (5'GCAGAGUGCAGAGCAAUCCA3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 134 (5'UAACAAUGUGCUGCUGUCAGCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 244 (5'CUGACAGCAG xiv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 158 (5'UAUUGAGCAUCUCUCUCACAGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 268 (5'UGUGAGAGAGAUGCUCAAUA3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 153 (5'UCAUUCUUGAUGUAGACCUCCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 263 (5'GAGGUCUACAUCAAGAAUGA3');xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 73 (5'UGAAACUCCAGACCUAGACCUG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 183 (5'GGUCUAGGUCUGGAGUUUCA3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 152 (5'UCUUGAUGUAGACCUCCUUCCG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 262 (5'GAAGGAGGUCUACAUCAAGA3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 147 (5'UCAGAGCUUU xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 101 (5'UCAUAACUUGCCACCUUCUCAA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 211 (5'GAGAAGGUGGCAAGUUAUGA3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 174 (5'UUUCUGGUUUUUGCAGACAUCC3'). xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 118 (5'UUUUCUUGGAAGCCAAAGCAUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 228 (5'UGCUUUGGCUUCCAAGAAAA3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 149 (5'UAAACAGAGCUUUGAUAUCCUG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 259 (5'GGAUAUCAAAG xxiii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 95 (5'UGACUAGACACUUUUUGGCUCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 205 (5'AGCCAAAAAGUGUCUAGUCA3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 142 (5'UUUCUUGAGCUUGAUCAGGGCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 252 (5'CCCUGAUCAAGCUCAAGAAA3');xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 160 (5'UCAUAUUGAGCAUCUCUCUCAC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 270 (5'GAGAGAGAUGCUCAAUAUGA3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 164 (5'UGUAUUGGGGUCAGCAUAGGGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 274 (5'CCUAUGCUGACCCCAAUACA3'); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 74 (5'UUGAAACUCCAGACCUAGACCU3'); and the sense strand of the nucleic acid sequence according to SEQ ID NO: 184 (5'GUCUAGGUCUGGAGUUUCAA3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 91 (5'UAUCCAUCUAGCACCAGGUAGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 201 (5'UACCUGGUGCUAGAUGGAUA3'); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 167 (5'UGUGAACUAUCAAGGGGCCGCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 277 (5'CGGCCCCUUGAUAGUUCACA3'). xxx) the sense strand of the nucleic acid sequence according to SEQ ID NO: 175 (5'UUUGGAGUUUCUCCUUCAGCCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 285 (5'GCUGAAGGAGAAACUCCAAA3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 72 (5'UAAACUCCAGACCUAGACCUGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 182 (5'AGGUCUAGGUCUGGAGUUUA3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 119 (5'UCUUUCUUGGAAGC xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 154 (5'UCUUUCUUAUCCCCAUUCUUGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 264 (5'AAGAAUGGGGAUAAGAAAGA3'); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 70 (5'UCUAGACCUGGUCACAUUCCCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 180 (5'GGAAUGUGACCAGGUCUAGA3'); xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 92 (5'UCUGUCUGAUCCAUCUAGCACC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 202 (5'UGCUAGAUGGAUCAGACAGA3'); xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 116 (5'UCAAAGCAUUGAUGUUCACUUG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 226 (5'AGUGAACAUCAAUGCUUUGA3');xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 84 (5'UGAGAGUGUAACCGUCAUAGCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 194 (5'CUAUGACGGUUACACUCUCA3'); xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 89 (5'UGUCGUACAUGAAGGAGUCUUG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 199 (5'AGACUCCUUCAUGUACGACA3'); xxxix) SEQ ID NO: 83 (5'UGAGUGU xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 107 (5'UUAAUUGGGUCCCCGCCCAUGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 217 (5'AUGGGCGGGGACCCAAUUAA3'); xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 100 (5'UAUAACUUGCCACCUUCUCAAU3'). xLii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 157 (5'UUUGAGCAUCUCUCUCACAGCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 267 (5'CUGUGAGAGAGAUGCUCAAA3'); xLiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 77 (5'UCUCACAUUGUAGUAGGGAGAC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 187 (5'CUCCCUACU xLiv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 105 (5'UGACUUCAACUUGUGGUCUUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 215 (5'AAGACCACAAGUUGAAGUCA3'); xLv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 130 (5'UCAGGUUUUCCAUAUCCUUGAC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 240 (5'CAAGGAUAUGGAAAACCUGA3');xLvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 166 (5'UAACUAUCAAGGGGCCGCCAGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 276 (5'UGGCGGCCCCUUGAUAGUUA3'); xLvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 131 (5'UCACAGAGACUCAGAGACUGGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 241 (5'CAGUCUCUGAGUCUCUGUGA3'); xLviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 127 (5'UCUUUGAACACAUGUUGCUCAU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 237 (5'GAGCAACAUGUGUUCAAAGA3'). xLix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 111 (5'UAUCAAUGACAGUAAUUGGGUC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 221 (5'CCCAAUUACUGUCAUUGAUA3'); l) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 93 (5'UCUUUUUGGCUCCUGUGAAGUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 203 (5'CUUCACAGGAGCCAAAAAGA3'); or Li) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 71 (5'UAACUCCAGACCUAGACCUGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 181 (5'CAGGUCUAGGUCUGGAGUUA3');

[0161] At least 50% knockdown of CFB at 0.1 nM

[0162] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region comprising 19 to 25 nucleotides from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1 and between any one of nucleotide positions selected from a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1815 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by at least 50% at a dose of 0.1 nM.

[0163] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence that is substantially identical to a region comprising 19 to 25 nucleotides from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1 and between any one of nucleotide positions selected from a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1815 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide comprises a CFB mRNA sequence according to SEQ ID NO: 1. The double-stranded region is selected from the group consisting of: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 171 (5'UAUGAAACGACUUCUCUUGUGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 281 (5'ACAAGAGAAGUCGUUUCAUA3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 165 (5'UAUCACCUCUGCAAGUAUUGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 275 (5'CAAUACUUGCAGAGGUGAUA3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 129 (5'UUUUCCAUAUCCUUGACUUUGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 239 (5'AAAGUCAAGGAUAUGGA AAA3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 176 (5'UAUCUUGGAGUUUCUCCUUCAG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 286 (5'GAAGGAGAAACUCCAAGAUA3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 177 (5'UCUCAUCUUGGAGUUUCUCCUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 287 (5'GGAGAAACUCCAAGAUGAGA3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 138 (5'UCAUAAAAUUCAGGAAUUCCUG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 248 (5'GGAAUUCCUGAAUUUUAUGA3');vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 140 (5'UGUCAUAGUCAUAAAAUUCAGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 250 (5'UGAAUUUUAUGACUAUGACA3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 148 (5'UAACAGAGCUUUGAUAUCCUGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 258 (5'AGGAUAUCAAAGCUCUGUUA3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 150 (5'UCAAACAGAG CUUUGAUAUCCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 260 (5'GAUAUCAAAGCUCUGUUUGA3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 179 (5'UGAAAACCCAAAUCCUCAUCUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 289 (5'GAUGAGGAUUUGGGUUUUCA3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5'UAAAGCUUCGGCCACCUCUUGA3'). xii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 172 (5'UUUUUGCAGACAUCCACUACUC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 282 (5'GUAGUGGAUGUCUGCAAAAA3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 88 (5'UCGUACAUGAAGGAGUCUUGGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 198 (5'CAAGACUCC xiv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 168 (5'UUUGUGAACUAUCAAGGGGCCG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 278 (5'GCCCCUUGAUAGUUCACAAA3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 81 (5'UGUGGAAAGAGAUCUCAUCACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 191 (5'UGAUGAGAUCUCUUUCCACA3');xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 159 (5'UAUAUUGAGCAUCUCUCUCACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 269 (5'UGAGAGAGAUGCUCAAUAUA3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 82 (5'UCAUAGCAGUGGAAAGAGAUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 192 (5'AUCUCUUUCCACUGCUAUGA3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 97 (5 207 (5'AAGUGUCUAGUCAACUUAAA3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 132 (5'UUUGCUUGUGGUAAUCGGUACC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 242 (5'UACCGAUUACCACAAGCAAA3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 123 (5'UGUUGCUCAUUGUCU xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 126 (5'UUUUGAACACAUGUUGCUCAUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 236 (5'UGAGCAACAUGUGUUCAAAA3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 162 (5'UGAGAUGUCCUUGACUUUGUCA3'). xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 79 (5'UCAUCACUCACAUUGUAGUAGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 189 (5'UACUACAAUGUGAGUGAUGA3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 151 (5'UCAGACACAAACAGAGCUUUGA3'); and the sense strand of the nucleic acid sequence according to SEQ ID NO: 261 (5'AAAGCUCUGUUUGUGUCUGA3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 143 (5'UAUUCUUGAGCUUGAUCAGGGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 253 (5'CCUGAUCAAGCUCAAGAAUA3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 117 (5'UAAGCCAAAGCAUUGAUGUUCA3') and the nucleic acid sequence according to SEQ ID NO: 227 (5'AACAUCAAUGCUUUGGCUUA3'). xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 133 (5'UAAAGUACUCAGACACCACAGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 243 (5'UGUGGUGUCUGAGUACUUUA3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 122 (5'UUUGCUCAUUGUCUUUCUUGGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 232 (5'CAAGAAAGACAAUGAGCAAA3'); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5'UCAAUGACAGUAA xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 173 (5'UGUUUUUGCAGACAUCCACUAC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 283 (5'AGUGGAUGUCUGCAAAAACA3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 156 (5'UGAGCAUCUCUCACAGCUGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 266 (5' XXXII) the sense strand of the nucleic acid sequence according to SEQ ID NO: 141 (5'UCUUGAUCAGGGCAACGUCAUA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 251 (5'UGACGUUGCCCUGAUCAAGA3'); XXXIII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 135 (5'UCUUGAUUGAGUGUUCCUUGUC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 245 (5'CAAGGAACACUCAAUCAAGA3');xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 170 (5'UGACUUCUCUUGUGAACUAUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 280 (5'AUAGUUCACAAGAGAAGUCA3'); xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 178 (5'UAAUCCUCAUCUUGGAGUUUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 288 (5'AAACUCCAAGAUGAGGAUUA3'); xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 114 (5'UAUAGACAUC xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 139 (5'UCAUAGUCAUAAAAUUCAGGAA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 249 (5'CCUGAAUUUUAUGACUAUGA3'); xxxviii) the nucleic acid sequence according to SEQ ID NO: 125 (5'UCAUGUUGCUCAUUGUCUUUCU3'). and the sense strand of the nucleic acid sequence according to SEQ ID NO: 235 (5'AAAGACAAUGAGCAACAUGA3'); xxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 145 (5'UGAGACAAAUGGGCCUGAUAGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 255 (5'UAUCAGGCCCAUUUGUCUCA3'); xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 113 (5'UCUCAUCAAUGACAGUAAUUGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 223 (5'AAUUACU xLi) the sense strand of the nucleic acid sequence according to SEQ ID NO: 120 (5'UGUCUUUCUUGGAAGCCAAAGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 230 (5'UUUGGCUUCCAAGAAAGACA3'); xLii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 75 (5'UGAUCUGCAGGUACGUGUCUGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 185 (5'AGACACGUACCUGCAGAUCA3');xLiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 112 (5'UCAUCAAUGACAGUAAUUGGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 222 (5'CCAAUUACUGUCAUUGAUGA3'); xLiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 108 (5'UAUGACAGUAAUUGGGUCCCCG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 218 (5'GGGACCCAAUUACUGUCAUA3'); xLv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 128 (5'UGACUU xLvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 161 (5'UCUUGACUUUGUCAUAGCCUGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 271 (5'AGGCUAUGACAAAGUCAAGA3'); xLvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 85 (5'UUUGUCACAGAUCGCUGUCUGC3'). the antisense strand of the nucleic acid sequence according to SEQ ID NO: 195 (5'AGACAGCGAUCUGUGACAAA3'); xLviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 137 (5'UGAAUUCCUGCUUCUUUUUCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 247 (5'AAAAAAGAAGCAGGAAUUCA3'); xLix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 80 (5'UGAAAGAGAUCUCAUCACUCAC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 19 0 (5'GAGUGAUGAGAUCUCUUUCA3'); l) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 115 (5'UCAUAGACAUCCAGAUAAUCCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 225 (5'GAUUAUCUGGAUGUCUAUGA3'); Li) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 96 (5'UGUUGACUAGACACUUUUUGGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 206 (5'CAAAAAGUGUCUAGUCAACA3');Lii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 146 (5'UAAGUGGUAGUUGGAGGAAGCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 256 (5'CUUCCUCCAACUACCACUUA3'); Liiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 78 (5'UAUCACUCACAUUGUAGUAGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 188 (5'CUACUACAAUGUGAGUGAUA3'); Liiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 103 (5'UUUCACACCAUAACUUGCCACC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 213 (5'UGGCAAGUUAU Lv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 102 (5'UCACCAUAACUUGCCACCUUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 212 (5'AAGGUGGCAAGUUAUGGUGA3'); Lvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 109 (5'UAAUGACAGUAAUUGGGUCCCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 219 (5'GGACCCAAUUACUGUCAUUA3'); Lvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 86 (5'UCAUGAAGGAGUCUUGGCAGGA3'); and the sense strand of the nucleic acid sequence according to SEQ ID NO: 196 (5'CUGCCAAGACUCCUUCAUGA3'); Lviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 106 (5'UCUCAUCAUGCUGUACACUGCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 216 (5'CAGUGUACAGCAUGAUGAGA3'); or Lix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 98 (5'UCUCAAUUAAGUUGACUAGACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 208 (5'UCUAGUCAACUUAAUUGAGA3').

[0164] 20-50% knockdown of CFB at 0.02nM

[0165] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region comprising 19 to 25 nucleotides from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1815 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by 20% to 50% at a dose of 0.02 nM.

[0166] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence that is substantially identical to a region comprising 19 to 25 nucleotides from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1 and between any one of nucleotide positions selected from a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1815 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide comprises a CFB mRNA sequence according to SEQ ID NO: 1. The mRNA expression was attenuated by 20% to 50% at a dose of 0.02 nM, and the double-stranded region consisted of: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 165 (5'UAUCACCUCUGCAAGUAUUGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 275 (5'CAAUACUUGCAGAGGUGAUA3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 129 (5'UUUUCCAUAUCCUUGACUUUGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 239 (5'AAAGUCAAGGAUAUGGAAAA3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 176 (5'UAUCUUGGAGUUUCUCCUUCAG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 286 (5'GAAGGAGAAACUCCAAG AUA3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 177 (5'UCUCAUCUUGGAGUUUCUCCUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 287 (5'GGAGAAACUCCAAGAUGAGA3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 138 (5'UCAUAAAAUUCAGGAAUUCCUG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 248 (5'GGAAUUCCUGAAUUUUAUGA3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 140 (5'UGUCAUAGUCAUAAAAUUCAGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 250 (5'UGAAUUUUAUGACUAUGACA3');vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 148 (5'UAACAGAGCUUUGAUAUCCUGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 258 (5'AGGAUAUCAAAGCUCUGUUA3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 150 (5'UCAAACAGAGCUUUGAUAUCCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 260 (5'GAUAUCAAAGCUCUGUUUGA3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 179 (5'UGAAAACCCA AAUCCUCAUCUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 289 (5'GAUGAGGAUUUGGGUUUUCA3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5'UAAAGCUUCGGCCACCUCUUGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 200 (5'AAGAGGUGGCCGAAGCUUUA3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 172 (5'UUUUUGCAGACAUCCACUACUC3'). xii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 88 (5'UCGUACAUGAAGGAGUCUUGGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 198 (5'CAAGACUCCUUCAUGUACGA3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 168 (5'UUUGUGAACUAUCAAGGGGCCG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 278 (5'GCCCCUUGA xiv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 81 (5'UGUGGAAAGAGAUCUCAUCACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 191 (5'UGAUGAGAUCUCUUUCCACA3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 159 (5'UAUAUUGAGCAUCUCUCUCACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 269 (5'UGAGAGAGAUGCUCAAUAUA3');xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 82 (5'UCAUAGCAGUGGAAAGAGAUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 192 (5'AUCUCUUUCCACUGCUAUGA3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 97 (5'UUUAAGUUGACUAGACACUUUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 207 (5'AAGUGUCUAGUCAACUUAAA3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 132 (5'UUUGCUUGUGGUAAUCGGUACC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 242 (5'UACCGAUUACCACAAGCAAA3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 123 (5'UGUUGCUCAUUGUCUUUCUUGG3'); and the sense strand of the nucleic acid sequence according to SEQ ID NO: 233 (5'AAGAAAGACAAUGAGCAACA3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 79 (5'UCAUCACUCACAUUGUAGUAGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 189 (5'UACUACAAUGUGAGUGAUGA3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 117 (5'UAAGCCAAAGCAUUGAUGUUCA3') and the nucleic acid sequence according to SEQ ID NO: 227 (5'AACAUCAAUGCUUUGGCUUA3'). xxii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 122 (5'UUUGCUCAUUGUCUUUCUUGGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 232 (5'CAAGAAAGACAAUGAGCAAA3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5'UCAAUGACAGUAAUUGGGUCCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 220 (5'GACCCAAUUACUGUCAUUGA3'); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 135 (5'UCUUGAUUGAGUGUU xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 178 (5'UAAUCCUCAUCUUGGAGUUUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 288 (5'AAACUCCAAGAUGAGGAUUA3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 114 (5'UAUAGACAUCCAGAUAAUCCUC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 224 (5'G xxvii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 125 (5'UCAUGUUGCUCAUUGUCUUUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 235 (5'AAAGACAAUGAGCAACAUGA3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 113 (5'UCUCAUCAAUGACAGUAAUUGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 223 (5'AAUUACUGUCAUUGAUGAGA3');xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 120 (5'UGUCUUUCUUGGAAGCCAAAGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 230 (5'UUUGGCUUCCAAGAAAGACA3'); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 75 (5'UGAUCUGCAGGUACGUGUCUGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 185 (5'AGACACGUACCUGCAGAUCA3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 112 (5'UCAUCAAUGACAGU xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 108 (5'UAUGACAGUAAUUGGGUCCCCG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 218 (5'GGGACCCAAUUACUGUCAUA3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 115 (5'UCAUAGACAUCCAGAUAAUCCU3'). xxxiv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 102 (5'UCACCAUAACUUGCCACCUUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 212 (5'AAGGUGGCAAGUUAUGGUGA3'); xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 109 (5'UAAUGACAGUAAUUGGGUCCCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 219 (5'GGACCCAAUUA xxxvi) the sense strand of the nucleic acid sequence according to SEQ ID NO: 106 (5'UCUCAUCAUGCUGUACACUGCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 216 (5'CAGUGUACAGCAUGAUGAGA3'); xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 98 (5'UCUCAAUUAAGUUGACUAGACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 208 (5'UCUAGUCAACUUAAUUGAGA3');xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 124 (5'UAUGUUGCUCAUUGUCUUUCUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 234 (5'GAAAGACAAUGAGCAACAUA3'); xxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 121 (5'UCUCAUUGUCUUUCUUGGAAGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 231 (5'UUCCAAGAAAGACAAUGAGA3'); or xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 107 (5'UUAAUUGGGUCCCCGCCCAUGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 217 (5'AUGGGCGGGGACCCAAUUAA3');

[0167] At least 50% knockdown of CFB at 0.02nM

[0168] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region comprising 19 to 25 nucleotides from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1 and between any one of nucleotide positions selected from a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1815 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by at least 50% at a dose of 0.02 nM.

[0169] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence that is substantially identical to a region comprising 19 to 25 nucleotides from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1 and between any one of nucleotide positions selected from a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1815 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide comprises a CFB mRNA sequence. The mRNA expression is attenuated by at least 50% at a dose of 0.02 nM, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 171 (5'UAUGAAACGACUUCUCUUGUGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 281 (5'ACAAGAGAAGUCGUUUCAUA3').

[0170] In vivo reduction of CFB expression

[0171] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a CFB according to SEQ ID NO: 1. and n) 2448-2468, from the 5' end of the mRNA sequence, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region. mRNA expression is attenuated by at least 25% at a dose of 1 mg / kg.

[0172] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a CFB according to SEQ ID NO: 1. and n) 2448-2468, from the 5' end of the mRNA sequence, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region. The mRNA expression was attenuated by at least 25% at a dose of 1 mg / kg, and the double-stranded region consisted of: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5'UAAAGAGAUCUCAUCACUCACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5'UGAGUGAUGAGAUCUCUUUA3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UGGAAAGAGAUCUCAUCACUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'AGUGAUGAGAUCUCUUUCCA3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5'UCAGUGGAAAGAGAUCUCA iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5'UAUAGCAGUGGAAAGAGAUCUC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5'GAUCUCUUUCCACUGCUAUA3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5'UGUGUAACCGUCAUAGCAGUGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 391 (5'ACUGCUAUGACGGUUACACA3');vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5'UUAAGUUGACUAGACACUUUUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5'AAAGUGUCUAGUCAACUUAA3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5'UAAUUAAGUUGACUAGACACUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5'GUGUCUAGUCAACUUAAUUA3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5'UAUAUCUUGGCUU CACACCAUA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5'UGGUGUGAAGCCAAGAUAUA3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5'UUAGACAUCCAGAUAAUCCUCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5'AGGAUUAUCUGGAUGUCUAA3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5'UAAGCAUUGAUGUUCACUUGGU3'). , and the sense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5'CAAGUGAACAUCAAUGCUUA3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5'UAAAGCAUUGAUGUUCACUUGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5'AAGUGAACAUCAAUGCUUUA3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5'UAACACAUGUUGCUCAUUGUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5'ACAAUGAGCAACA xiii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UUUGACUUUGAACACAUGUUGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5'AACAUGUGUUCAAAGUCAAA3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5'UAUAUCCUUGACUUUGAACACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5'UGUUCAAAGUCAAGGAUAUA3');xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5'UGAGAUCUUGGCCUGCCAUGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5'CAUGGCAGGCCAAGAUCUCA3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5'UAAGUACUCAGACACCACAGCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5'CUGUGGUGUCUGAGUACUUA3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5'UAAUUCAGGAAUU xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5'UUAAAAUUCAGGAAUUCCUGCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5'CAGGAAUUCCUGAAUUUUAA3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5'UAUAAAAUUCAGGAAUUCCUGC3'). xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5'UGUCAUAAAAUUCAGGAAUUCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAUUCCUGAAUUUUAUGACA3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5'UUAUUCUUGAGCUUGAUCAGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5'CUGAUCAAGCUC xxii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5'UUUAUUCUUGAGCUUGAUCAGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5'UGAUCAAGCUCAAGAAUAAA3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5'UAAGUAUUGGGGUCAGCAUAGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5'UAUGCUGACCCCAAUACUUA3');xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UAAACGACUUCUCUUGUGAACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5'UUCACAAGAGAAGUCGUUUA3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 171 (5'UAUGAAACGACUUCUCUUGUGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 281 (5'ACAAGAGAAGUCGUUUCAUA3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5'UUUUUUGCAGACAUCCACUACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5'UAGUGGAUGUCUGCAAAAAA3'); xxv ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5'UCAUCUUGGAGUUUCUCCUUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 66 (5'AAGGAGAAACUCCAAGAUGA3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5'UAAACCCAAAUCCUCAUCUUGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5'AAGAUGAGGAUUUGGGUUUA3'); or xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAGCUGUUUUAAUUCAAUCCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5'GAUUGAAUUAAAACAGCUGA3');

[0173] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a CFB according to SEQ ID NO: 1. and n) 2448-2468, from the 5' end of the mRNA sequence, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region. The mRNA expression was attenuated by at least 25% at a dose of 1 mg / kg, and the double-stranded region consisted of: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5'UAAAGAGAUCUCAUCACUCACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5'UGAGUGAUGAGAUCUCUUUA3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UGGAAAGAGAUCUCAUCACUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'AGUGAUGAGAUCUCUUUCCA3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5'UCAGUGGAAAGAGAUCUCA iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5'UAUAGCAGUGGAAAGAGAUCUC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5'GAUCUCUUUCCACUGCUAUA3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5'UGUGUAACCGUCAUAGCAGUGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 391 (5'ACUGCUAUGACGGUUACACA3');vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5'UAAUUAAGUUGACUAGACACUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5'GUGUCUAGUCAACUUAAUUA3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5'UAUAUCUUGGCUUCACACCAUA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5'UGGUGUGAAGCCAAGAUAUA3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5'UUAGACAUCCAG AUAAUCCUCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5'AGGAUUAUCUGGAUGUCUAA3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5'UAAGCAUUGAUGUUCACUUGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5'CAAGUGAACAUCAAUGCUUA3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5'UAAAGCAUUGAUGUUCACUUGG3'). xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5'UAACACAUGUUGCUCAUUGUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5'ACAAUGAGCAACAUGUGUUA3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UUUGACUUUGAACACAUGUUGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5'AACAUGUGUUCA AAGUCAAA3'); xiii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5'UAUAUCCUUGACUUUGAACACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5'UGUUCAAAGUCAAGGAUAUA3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5'UAAGUACUCAGACACCACAGCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5'CUGUGGUGUCUGAGUACUUA3');xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5'UAAUUCAGGAAUUCCUGCUUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'AAGCAGGAAUUCCUGAAUUA3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5'UUAAAAUUCAGGAAUUCCUGCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5'CAGGAAUUCCUGAAUUUUAA3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5'UAUAAAAUUCAGG xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5'UGUCAUAAAAUUCAGGAAUUCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAUUCCUGAAUUUUAUGACA3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5'UUUAUUCUUGAGCUUGAUCAGG3'). xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5'UAAGUAUUGGGGUCAGCAUAGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5'UAUGCUGACCCCAAUACUUA3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UAAACGACUUCUCUUGUGAACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5'UUCACAAGAGAAGU xxii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 171 (5'UAUGAAACGACUUCUCUUGUGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 281 (5'ACAAGAGAAGUCGUUUCAUA3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5'UUUUUUGCAGACAUCCACUACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5'UAGUGGAUGUCUGCAAAAAA3');xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5'UAAACCCAAAUCCUCAUCUUGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5'AAGAUGAGGAUUUGGGUUUA3'); or xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAGCUGUUUUAAUUCAAUCCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5'GAUUGAAUUAAAACAGCUGA3');

[0174] In some embodiments, the isolated oligonucleotides of the present disclosure can include a linker, sometimes referred to as a loop. siRNAs containing a linker or loop are sometimes referred to as short hairpin RNAs (shRNAs). In some embodiments, both the sense and antisense regions of an siRNA are encoded by single-stranded RNA. In these embodiments, the antisense and sense regions hybridize to form a duplex region. The sense and antisense regions are connected by a linker sequence to form a "hairpin" or "stem-loop" structure. An siRNA can have complementary sense and antisense regions at opposite ends of a single-stranded molecule, such that the molecule can form a duplex region with the complementary sequence portion, and the strands are connected at one end of the duplex region by a linker. The linker can be a nucleotide linker, a non-nucleotide linker, or a combination thereof. The linker can interact with the first strand and, optionally, the second strand through covalent or non-covalent interactions.

[0175] Any suitable nucleotide linker sequence is considered to be within the scope of the present disclosure.The siRNA of the present disclosure can comprise the nucleotide linker, non-nucleotide linker, or mixed nucleotide / non-nucleotide linker that connects the sense region of nucleic acid to the antisense region of nucleic acid.Nucleotide linker can be 2 nucleotides or more in length, for example, about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 nucleotides in length.

[0176] Examples of non-nucleotide linkers include abasic nucleotides, polyethers, polyamines, polyamides, peptides, carbohydrates, lipids, polyhydrocarbons, or other polymeric agents, such as polyethylene glycols, such as those having 2 to 100 ethylene glycol units. Some examples are described in Seela et al., Nucleic Acids Research, 1987, Vol. 15, pp. 3113-3129; Cload et al., J. Am. Chem. Soc., 1991, Vol. 113, pp. 6324-6326; Jaeschke et al., Tetrahedron Lett., 1993, Vol. 34, pp. 301; Arnold et al., WO 1989 / 002439; Usman et al., WO 1995 / 006731; Dudycz et al., WO 1995 / 011910; and Ferentz et al., J. Am. Chem. Soc., 1991, Vol. 113, pp. 4000-4002.

[0177] Examples of nucleotide linker sequences include, but are not limited to, AUG, CCC, UUCG, CCACC, AAGCAA, CCACACC, and UUCAAGAGA.

[0178] In some embodiments, the isolated oligonucleotide of the present disclosure is siRNA, and can be processed to produce RISC active siRNA molecule, and can be the dsRNA of suitable length as Dicer substrate.See, for example, Rossi et al. US Patent Application Publication No. 2005 / 0244858.

[0179] The Dicer substrate double-stranded RNA (dsRNA) can be of sufficient length that it can be processed by Dicer to generate active siRNA, and can further comprise one or more of the following properties: (i) the Dicer substrate dsRNA can be asymmetric, e.g., have a 3' overhang on the antisense strand; (ii) the Dicer substrate dsRNA can have a modified 3' end, e.g., incorporation of one or more DNA nucleotides, on the sense strand to direct the orientation of Dicer binding and processing of the dsRNA into active siRNA; and (iii) the first and second strands of the Dicer substrate dsRNA can be 19-30 bp in length.

[0180] In some embodiments, the isolated oligonucleotide of the present disclosure comprises at least one modified nucleotide. In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand, the antisense strand, or both comprise one or more modified nucleotides. In some embodiments, only the sense strand comprises one or more modified nucleotides. In some embodiments, only the antisense strand comprises one or more modified nucleotides. In some embodiments, both the sense strand and the antisense strand comprise one or more modified nucleotides. In some embodiments, the isolated oligonucleotide is partially chemically modified. In some embodiments, the isolated oligonucleotide is fully chemically modified.

[0181] In some embodiments, the isolated oligonucleotide comprises at least two modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least three modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least four modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least five modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least six modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least seven modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least eight modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least nine modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least ten modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least eleven modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least twelve modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least thirteen modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least fourteen modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least fifteen modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least sixteen modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least seventeen modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least 18 modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least 19 modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least 20 modified nucleotides. In some embodiments, the isolated oligonucleotide comprises more than 20 modified nucleotides. In some embodiments, the isolated oligonucleotide comprises between 20 and 30 modified nucleotides. In some embodiments, the isolated oligonucleotide comprises between 30 and 40 modified nucleotides.In some embodiments, the isolated oligonucleotide comprises between 40 and 50 modified nucleotides.

[0182] In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least one modified nucleotide. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least two modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least three modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least four modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least five modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least six modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least seven modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least eight modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least nine modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least ten modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 11 modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 12 modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 13 modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 14 modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 15 modified nucleotides.In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 16 modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 17 modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 18 modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 19 modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 20 modified nucleotides.

[0183] In some embodiments, the isolated oligonucleotide comprises two or more modified nucleotides, wherein at least a first nucleotide comprises a first modification and at least a second nucleotide comprises a second modification. In some embodiments, the first modification and the second modification are different. In some embodiments, the at least first nucleotide and the at least second nucleotide are located on different strands of the isolated oligonucleotide. In some embodiments, the at least first nucleotide and the at least second nucleotide are located on the same strand of the isolated oligonucleotide.

[0184] In some embodiments of the isolated oligonucleotide, the isolated oligonucleotide comprises two or more modified nucleotides, wherein at least a first modified nucleotide comprises a first modification, and at least a second modified nucleotide comprises a second modification, and at least a third nucleotide comprises a third modification. In some embodiments, the isolated oligonucleotide comprises a first, a second, a third, and a fourth modification. In some embodiments, the isolated oligonucleotide comprises more than four modifications. In some embodiments, all modifications are on the sense strand. In some embodiments, all modifications are on the antisense strand. Any combination of modification positions between the sense strand and the antisense strand is contemplated within the isolated oligonucleotide of the present disclosure.

[0185] In some embodiments, the modified nucleotides are contiguous in the sense strand, the antisense strand, or both. In some embodiments, some, but not all, of the modified nucleotides are contiguous in the sense strand, the antisense strand, or both. In some embodiments, the modified nucleotides in the sense strand, the antisense strand, or both are not contiguous.

[0186] The present disclosure encompasses isolated oligonucleotides in which any nucleotide on the sense strand or antisense strand can be modified. In some embodiments, any nucleotide on the antisense strand can be modified. In some embodiments, any nucleotide on the antisense strand can be modified.

[0187] In some embodiments, the isolated oligonucleotide of the present disclosure comprises at least one modified nucleotide. In some embodiments, the one or more modified nucleotides increase the stability or efficacy, or both, of the isolated oligonucleotide. In some embodiments, the one or more modified nucleotides increase the stability of the RNA duplex and the siRNA.

[0188] Modifications that increase RNA stability include, but are not limited to, locked nucleic acids. As used herein, the term "locked nucleic acid" or "LNA" includes, but is not limited to, modified RNA nucleotides containing a methylene bridge connecting the 2' oxygen and 4' carbon of the ribose moiety. This methylene bridge locks the ribose in the 3' end confirmation, also known as the north confirmation, found in A-form RNA duplexes. The term "inaccessible RNA" can be used interchangeably with LNA. LNA has a 2'-4' cyclic linkage, as described in International Patent Applications WO 99 / 14226, WO 00 / 56746, WO 00 / 56748, and WO 00 / 66604, the contents of which are incorporated herein by reference.

[0189] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand, the antisense strand, or both contain at least one nucleotide with a modified phosphate backbone. In some embodiments, the sense strand of the isolated oligonucleotide contains at least one nucleotide with a modified phosphate backbone. In some embodiments, the antisense strand of the isolated oligonucleotide contains at least one nucleotide with a modified phosphate backbone. In some embodiments, the isolated oligonucleotide of the present disclosure contains a modified phosphate backbone, the modified phosphate backbone contains a modified phosphodiester linkage. In some embodiments, the modified phosphodiester linkage is modified by replacing one or more oxygen atoms with a moiety, where the moiety is attached to the phosphorus atom in the phosphodiester linkage through a carbon, nitrogen, or sulfur atom in the moiety, or by forming a 2'-5' linkage. In some embodiments, the modified phosphodiester linkage contains phosphorothioate, phosphorodithioate, methylphosphonate, phosphoramidate diester, mesyl phosphoramidate, or phosphonoacetate.

[0190] In some embodiments, the isolated oligonucleotides of the present disclosure comprise one or more unnatural base-containing nucleotides, locked nucleotides, or abasic nucleotides. In some embodiments, the one or more modified nucleotides comprise phosphorothioate derivatives or acridinine-substituted nucleotides. In some embodiments, the isolated oligonucleotides of the present disclosure comprise a phosphate mimic at the 5'-end of the antisense strand, including, but not limited to, vinyl phosphonate or other phosphate analogs. In some embodiments, the 5'-phosphate mimic is ethyl phosphonate, vinyl phosphonate, or an analog thereof.

[0191] In some embodiments, the modified nucleotides are 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyuracil, dihydrouracil, β-D-galactosylketone, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methyl -aminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D-mannosylqueosin, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N-isopentenyladenine, uracil-5-oxyacetic acid(v), wibutoxysin, pseudouracil, queosin, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid(v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, or 2,6-diaminopurine.

[0192] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand, the antisense strand, or both comprise terminal or internal nucleotides linked to one or more targeting ligands. In some embodiments, the terminal or internal nucleotides are directly linked to one or more targeting ligands. In some embodiments, the terminal or internal nucleotides are indirectly linked to one or more targeting ligands via a linker. In some embodiments, the one or more targeting ligands directly or indirectly linked to the terminal or internal nucleotides can further comprise a PK modulator. In some embodiments, the PK modulator is a competitive modulator, a positive allosteric modulator, a negative allosteric modulator, or a neutral allosteric modulator. In some embodiments, the targeting ligand is selected from one or more of a carbohydrate, a peptide, a lipid, an antibody or fragment thereof, an aptamer, albumin, fibrinogen, and folate.

[0193] Nucleotide Modifications

[0194] Provided herein are isolated oligonucleotides, the sense strand comprising: (a) an X1 nucleotide, wherein at least one nucleotide is modified with a first modification and each of the remaining nucleotides is independently modified with a second modification, and X1 is an integer selected from 13 to 36, and the first modification and the second modification are different; and (b) an X2 nucleotide, wherein at least one nucleotide is modified with a third modification and each of the remaining nucleotides is independently modified with a fourth modification, and X2 is an integer selected from 18 to 31, and the third modification and the fourth modification are different.

[0195] In some embodiments, the X1 nucleotide in the sense strand of the isolated oligonucleotide of this disclosure is 18-21, and the X2 nucleotide in the antisense strand of the isolated oligonucleotide of this disclosure is 20-23. In some embodiments, the X1 nucleotide in the sense strand of the isolated oligonucleotide of this disclosure is 20 or 21, and the X2 nucleotide in the antisense strand of the isolated oligonucleotide of this disclosure is 22 or 23. In some embodiments, the X2 nucleotide in the antisense strand of the isolated oligonucleotide of this disclosure is equal to the X1 nucleotide in the sense strand of the isolated oligonucleotide of this disclosure + 2. In some embodiments, the X1 nucleotide in the sense strand of the isolated oligonucleotide of this disclosure is 21, and the X2 nucleotide in the antisense strand of the isolated oligonucleotide of this disclosure is 23. In some embodiments, the X1 nucleotide in the sense strand of the isolated oligonucleotide of this disclosure is 20, and the X2 nucleotide in the antisense strand of the isolated oligonucleotide of this disclosure is 22.

[0196] In some embodiments of the isolated oligonucleotides of the present disclosure, the isolated oligonucleotides comprise: (a) a sense strand comprising 20 nucleotides, wherein at least one nucleotide is modified with a first modification and each of the remaining nucleotides is independently modified with a second modification, wherein the first and second modifications are the same or different; and (b) an antisense strand comprising 22 nucleotides, wherein at least one nucleotide is modified with a third modification and each of the remaining nucleotides is independently modified with a fourth modification, wherein the third and fourth modifications are the same or different.

[0197] In some embodiments, the first modification is a modification of the sugar moiety of at least one nucleotide at the 2' position selected from a 2'-F modification, a 2'-CN modification, a 2'-N3 modification, a 2'-deoxy modification, and equivalents thereof, and combinations thereof. In some embodiments, the first modification is a 2'-F modification, a 2'-CN modification, a 2'-N3 modification, or a 2'-deoxy modification, or a stereoisomer thereof. In some embodiments, the first modification is a 2'-F modification, a 2'-CN modification, or a 2'-N3 modification, or a stereoisomer thereof. In some embodiments, the first modification is a 2'-F modification or a stereoisomer thereof.

[0198] In some embodiments, the second modification is a modification of the sugar moiety of one or more of the remaining nucleotides at the 2' position selected from a 2'-C1-C6 alkyl, a 2'-OR modification (where R is a C1-C6 alkyl optionally substituted with a C1-C6 alkoxy, acetamido, phenyl, or heteroaryl comprising a 5- or 6-membered ring and one or two heteroatoms selected from N, O, and S), a 2'-amino, and a morpholino substitution, and equivalents thereof, and combinations thereof. In some embodiments, the second modification is a 2'-OR modification, or a morpholino substitution, or a combination thereof. In some embodiments, the second modification is a 2'-OR modification. In some embodiments, the second modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification. In some embodiments, the second modification is a 2'-O-methyl modification. In some embodiments, the second modification is a morpholino substitution.

[0199] In some embodiments, the first modification is a 2'-F modification or a stereoisomer thereof, and the second modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification. In some embodiments, the first modification is a 2'-F modification or a stereoisomer thereof, and the second modification is a 2'-O-methyl modification.

[0200] In some embodiments, the third modification is a modification of the sugar moiety of at least one nucleotide at the 2' position selected from a 2'-F modification, a 2'-CN modification, a 2'-N3 modification, a 2'-deoxy modification, and equivalents thereof, and combinations thereof. In some embodiments, the third modification is a 2'-F modification, a 2'-CN modification, a 2'-N3 modification, or a 2'-deoxy modification, or a stereoisomer thereof. In some embodiments, the third modification is a 2'-F modification, a 2'-CN modification, or a 2'-N3 modification, or a stereoisomer thereof. In some embodiments, the third modification is a 2'-F modification or a stereoisomer thereof.

[0201] In some embodiments, the fourth modification is a modification of the sugar moiety of one or more of the remaining nucleotides at the 2' position selected from a 2'-C1-C6 alkyl, a 2'-OR modification (where R is a C1-C6 alkyl optionally substituted with a C1-C6 alkoxy, acetamido, phenyl, or heteroaryl comprising a 5- or 6-membered ring and one or two heteroatoms selected from N, O, and S), a 2'-amino, and a morpholino substitution, and equivalents thereof, and combinations thereof. In some embodiments, the fourth modification is a 2'-OR modification, or a morpholino substitution, or a combination thereof. In some embodiments, the fourth modification is a 2'-OR modification. In some embodiments, the fourth modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification. In some embodiments, the fourth modification is a 2'-O-methyl modification. In some embodiments, the fourth modification is a morpholino substitution.

[0202] In some embodiments, the third modification is a 2'-F modification or a stereoisomer thereof, and the fourth modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification. In some embodiments, the third modification is a 2'-F modification or a stereoisomer thereof, and the fourth modification is a 2'-O-methyl modification.

[0203] Sense strand

[0204] In some embodiments of the isolated oligonucleotide of the present disclosure, including a sense strand and an antisense strand, at least three nucleotides in the sense strand of the isolated oligonucleotide of the present disclosure are modified with a first modification.In some embodiments, at least two of the at least three nucleotides modified with a first modification are consecutively located in the sense strand of the isolated oligonucleotide of the present disclosure.In some embodiments, at least three of the at least three nucleotides modified with a first modification are consecutively located in the sense strand of the isolated oligonucleotide of the present disclosure.

[0205] In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least four nucleotides are modified with first modification in the sense strand.In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least three of the at least four nucleotides that are modified with first modification are located consecutively.In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least four of the at least four nucleotides that are modified with first modification are located consecutively.

[0206] In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least 5 nucleotides in the sense strand are modified with first modification.In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least 3 of the at least 5 nucleotides that are modified with first modification are located consecutively.In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least 4 of the at least 5 nucleotides that are modified with first modification are located consecutively.

[0207] In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, at least three nucleotides, at least four nucleotides, or at least five nucleotides modified with a first modification are located between positions 10 and 15 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand.

[0208] In some embodiments, in the sense strand of the isolated oligonucleotide of the disclosure, two of the at least three nucleotides modified with the first modification are located at positions selected from positions 10, 11, 12, and 13 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the disclosure, three of the at least three nucleotides modified with the first modification are located at positions selected from positions 10, 11, 12, and 13 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the disclosure, one of the at least three nucleotides modified with the first modification is located at position 11 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand.

[0209] In some embodiments, in the sense strand of the isolated oligonucleotide of the disclosure, three of the at least three nucleotides modified with the first modification are located at positions 11, 12, and 13 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the disclosure, three of the at least three nucleotides modified with the first modification are located at positions 12, 13, and 14 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the disclosure, three of the at least three nucleotides modified with the first modification are located at positions 10, 11, and 12 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand.

[0210] In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 10 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 11 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 12 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 13 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 14 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 15 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand.

[0211] In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, the at least four nucleotides modified with the first modification are located at positions 10, 11, 12, and 13 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand.

[0212] In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, the at least five nucleotides modified with the first modification are located at positions 10, 11, 12, 13, and 15 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand.

[0213] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises five nucleotides modified with a first modification, and the five nucleotides modified with the first modification are located at positions 10, 11, 12, 13, and 15 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand.

[0214] In some embodiments, not all of the at least three, at least four, or at least five nucleotides modified with the first modification are located consecutively in the sense strand of the isolated oligonucleotide of the present disclosure, hi some embodiments, at least three, at least four, or at least five nucleotides in the sense strand of the isolated oligonucleotide of the present disclosure are modified with a 2'-F modification.

[0215] In some embodiments, the sense strand of the isolated oligonucleotide of the present disclosure has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93'.

[0216] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93'.

[0217] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', wherein the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 37, 39, 49, 55, 56, 58, or 389.

[0218] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a3' comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', wherein the sense strand comprises a nucleotide sequence according to SEQ ID NO: 58.

[0219] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 58 and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 24.

[0220] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a3' comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', wherein the sense strand comprises a nucleotide sequence according to SEQ ID NO: 56.

[0221] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 56 and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 22.

[0222] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a3', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', wherein the sense strand comprises a nucleotide sequence according to SEQ ID NO: 37.

[0223] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 37 and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 3.

[0224] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a3' comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', wherein the sense strand comprises a nucleotide sequence according to SEQ ID NO: 55.

[0225] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 55 and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 21.

[0226] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a3' comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', wherein the sense strand comprises a nucleotide sequence according to SEQ ID NO:49.

[0227] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises a nucleotide sequence according to SEQ ID NO:49 and the antisense strand comprises a nucleotide sequence according to SEQ ID NO:15.

[0228] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a3' comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', wherein the sense strand comprises a nucleotide sequence according to SEQ ID NO: 389.

[0229] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 389 and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 6.

[0230] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a3', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', wherein the sense strand comprises a nucleotide sequence according to SEQ ID NO: 39.

[0231] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises a nucleotide sequence according to SEQ ID NO:49 and the antisense strand comprises a nucleotide sequence according to SEQ ID NO:5.

[0232] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1829 and 1849 from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5'UGUCAUAAAAUUCAGGAAUUCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAUUCCUGAAUUUUAUGACA3').

[0233] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1825 and 1845 from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5'UUAAAAUUCAGGAAUUCCUGCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5'CAGGAAUUCCUGAAUUUUAA3').

[0234] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 495 and 515 from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UGGAAAGAGAUCUCAUCACUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'AGUGAUGAGAUCUCUUUCCA3').

[0235] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1822 and 1842 from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5'UAAUUCAGGAAUUCCUGCUUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'AAGCAGGAAUUCCUGAAUUA3').

[0236] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1465 and 1485 from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5'UAACACAUGUUGCUCAUUGUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5'ACAAUGAGCAACAUGUGUUA3').

[0237] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 514 and 534 from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5'UGUGUAACCGUCAUAGCAGUGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 389 (5'ACUGCUAUGACGGUUACACA3').

[0238] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 503 and 523 from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5'UAUAGCAGUGGAAAGAGAUCUC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5'GAUCUCUUUCCACUGCUAUA3').

[0239] antisense strand

[0240] In some embodiments, up to seven nucleotides in the antisense strand of the isolated oligonucleotide of the disclosure are modified with a third modification.

[0241] In some embodiments, in the antisense strand of an isolated oligonucleotide of the disclosure, up to four of the up to seven nucleotides modified with a tertiary modification are located at positions 2-8 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the disclosure, at least one of the up to seven nucleotides modified with a tertiary modification is located at position 2 from the first nucleotide at the 5' end of the antisense strand.

[0242] In some embodiments, in the antisense strand of the isolated oligonucleotide of the present disclosure, up to two of the up to seven nucleotides modified with a tertiary modification are located consecutively. In some embodiments, in the antisense strand of the isolated oligonucleotide of the present disclosure, up to two of the up to seven nucleotides modified with a tertiary modification that are located consecutively are located at positions 2 and 3 from the first nucleotide at the 5' end of the antisense strand.

[0243] In some embodiments, in the antisense strand of the isolated oligonucleotide of this disclosure, at least one of the up to seven nucleotides modified with a tertiary modification is located at position 14 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotide of this disclosure, two or three of the up to seven nucleotides modified with a tertiary modification are located at a position selected from positions 2, 3, 5, and 6 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotide of this disclosure, three of the up to seven nucleotides modified with a tertiary modification are located at a position selected from positions 2, 3, 5, and 6 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotide of this disclosure, two of the up to seven nucleotides modified with a tertiary modification are located at positions 2 and 5 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, two of the up to seven nucleotides modified with a third modification are located at positions 2 and 3 from the first nucleotide at the 5' end of the antisense strand.

[0244] In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, three of the up to seven nucleotides modified with a third modification are located at positions 2, 3, and 5 from the first nucleotide at the 5' end of the antisense strand.

[0245] In some embodiments, in the antisense strand of an isolated oligonucleotide of this disclosure, one or two of the up to seven nucleotides modified with a tertiary modification are located at positions selected from positions 14 and 16 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of this disclosure, two of the up to seven nucleotides modified with a tertiary modification are located at positions 14 and 16 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of this disclosure, up to seven nucleotides are modified with a 2'-F modification. In some embodiments, in the antisense strand of an isolated oligonucleotide of this disclosure, one of the up to seven nucleotides modified with a tertiary modification is located at position 14 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of this disclosure, two of the up to seven nucleotides modified with a tertiary modification are located at positions 14 and 16 from the first nucleotide at the 5' end of the antisense strand.

[0246] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand comprises up to seven nucleotides modified with a third modification, wherein up to seven nucleotides are modified with a 2'-F modification. In some embodiments, in the antisense strand of the isolated oligonucleotide of the present disclosure, one of the up to seven nucleotides modified with a third modification is located at position 2 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotide of the present disclosure, one of the up to seven nucleotides modified with a third modification is located at position 3 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotide of the present disclosure, one of the up to seven nucleotides modified with a third modification is located at position 5 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotide of the present disclosure, one of the up to seven nucleotides modified with a third modification is located at position 7 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of this disclosure, one of the up to seven nucleotides modified with a tertiary modification is located at position 10 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of this disclosure, one of the up to seven nucleotides modified with a tertiary modification is located at position 14 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of this disclosure, one of the up to seven nucleotides modified with a tertiary modification is located at position 16 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of this disclosure, the up to seven nucleotides modified with a tertiary modification are located at positions 2, 3, 5, 7, 10, 14, and 16 from the first nucleotide at the 5' end of the antisense strand.

[0247] In some embodiments, in the antisense strand of the isolated oligonucleotide of the present disclosure, the antisense strand has the formula: 3'(M)a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o The antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15'.

[0248] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) oand a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 to 16, and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 3, 5, 6, 15, 21, 22, or 24.

[0249] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 24.

[0250] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a(F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o and wherein the antisense strand is one of: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 24, and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 58.

[0251] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) oand the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 22.

[0252] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o and wherein the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 22, and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 56.

[0253] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M)a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 3.

[0254] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) oand wherein the antisense strand is one of: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 3, and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 37.

[0255] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 21.

[0256] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M)a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o and wherein the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 21, and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 55.

[0257] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) oand the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 15.

[0258] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o and wherein the antisense strand is one of: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 15, and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 49.

[0259] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M)a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 6.

[0260] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) oand a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 to 16, and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 6, and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 389.

[0261] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 5.

[0262] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M)a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 to 16, and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 5, and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 39.

[0263] Targeting Ligands

[0264] In some embodiments, the sense strand or antisense strand, or both, of the isolated oligonucleotide of the present disclosure are linked to a targeting ligand at a terminal or internal nucleotide. In some embodiments, the targeting ligand is linked to one or more nucleotides at the 5' end of the sense strand of the isolated oligonucleotide of the present disclosure. In some embodiments, the targeting ligand is linked to one or more nucleotides at the 3' end of the sense strand of the isolated oligonucleotide of the present disclosure. In some embodiments, the targeting ligand is linked to one or more nucleotides at the 5' end of the antisense strand of the isolated oligonucleotide of the present disclosure. In some embodiments, the targeting ligand is linked to one or more nucleotides at the 3' end of the antisense strand of the isolated oligonucleotide of the present disclosure. In some embodiments, the targeting ligand is linked to one or more nucleotides of the at least two single-stranded nucleotides at the 3' end of the antisense strand of the isolated oligonucleotide of the present disclosure.

[0265] In some embodiments, the targeting ligand is selected from one or more of a carbohydrate, a peptide, a lipid, an antibody or fragment thereof, an aptamer, albumin, fibrinogen, and folate. In some embodiments, the targeting ligand binds to a surface protein on a cell expressing the target mRNA of the isolated oligonucleotide of the present disclosure. In some embodiments, the targeting ligand mediates the entry of the isolated oligonucleotide of the present disclosure into a cell expressing the target mRNA of the isolated oligonucleotide of the present disclosure.

[0266] In some embodiments, the targeting ligand is a therapeutic ligand. In some embodiments, the targeting ligand is a therapeutic antibody.

[0267] In some embodiments, the targeting ligand is linked to the isolated oligonucleotide of the present disclosure by a linker. In some embodiments, the linker is any one of a protein, DNA, RNA, or chemical compound. In some embodiments, the isolated oligonucleotide of the present disclosure, the linker, and the targeting ligand form a scaffold. As used herein, the term "scaffold" refers to a compound or complex comprising a linker of the present disclosure, wherein the linker is covalently bound to the ligand or the isolated oligonucleotide, or both.

[0268] In some embodiments, the isolated oligonucleotide of the present disclosure, the linker, and the targeting ligand form a conjugate. As used herein, the term "conjugate" refers to a compound or complex comprising an isolated oligonucleotide covalently attached to a ligand via a linker of the present disclosure.

[0269] As used herein, the term "targeting ligand" or "ligand" refers to a moiety that, when covalently attached to an oligonucleotide, GalNAc, can mediate its entry into, or facilitate or enable its delivery to, a target site (e.g., a target cell or tissue). In some embodiments, the targeting ligand comprises a sugar ligand moiety (e.g., N-acetylgalactosamine (GalNAc)) that can direct uptake of the oligonucleotide to the liver.

[0270] In some embodiments, the targeting ligand binds to the asialoglycoprotein receptor (ASGPR). In some embodiments, the targeting ligand binds to the liver, e.g., to liver parenchymal cells (e.g., via ASGPR).

[0271] Suitable targeting ligands include, but are not limited to, those described in Winkler (Ther. Deliv., 2013, 4(7):791-809), PCT Patent Application Publication Nos. WO 2016 / 100401, WO 2012 / 089352, and WO 2009 / 082607, and U.S. Patent Application Publication Nos. 2009 / 0239814, 2012 / 0136042, 2013 / 0158824, and 2009 / 0247608, each of which is incorporated by reference.

[0272] In some embodiments, the targeting ligand comprises a carbohydrate moiety.

[0273] As used herein, a "carbohydrate moiety" refers to a moiety comprising one or more monosaccharide units, each having at least six carbon atoms (which may be linear, branched, or cyclic), with an oxygen, nitrogen, or sulfur atom attached to each carbon atom. In some embodiments, the carbohydrate moiety comprises a monosaccharide, disaccharide, trisaccharide, or tetrasaccharide. In some embodiments, the carbohydrate moiety comprises an oligosaccharide containing about 4-9 monosaccharide units. In some embodiments, the carbohydrate moiety comprises a polysaccharide (e.g., starch, glycogen, cellulose, or a polysaccharide gum).

[0274] In some embodiments, the carbohydrate moiety comprises a monosaccharide, disaccharide, trisaccharide, or tetrasaccharide. In some embodiments, the carbohydrate moiety comprises an oligosaccharide (e.g., containing about 4 to about 9 monosaccharide units). In some embodiments, the carbohydrate moiety comprises a polysaccharide (e.g., starch, glycogen, cellulose, or a polysaccharide gum).

[0275] In some embodiments, the ligand is capable of binding to a human asialoglycoprotein receptor (ASGPR), such as human asialoglycoprotein receptor 2 (ASGPR2).

[0276] In some embodiments, the carbohydrate moiety comprises a sugar (e.g., 1, 2, or 3 sugars). In some embodiments, the carbohydrate moiety comprises galactose or a derivative thereof (e.g., 1, 2, or 3 galactose or a derivative thereof). In some embodiments, the carbohydrate moiety comprises N-acetylgalactosamine or a derivative thereof (e.g., 1, 2, or 3 N-acetylgalactosamine or a derivative thereof). In some embodiments, the carbohydrate moiety comprises N-acetyl-D-galactosylamine or a derivative thereof (e.g., 1, 2, or 3 N-acetyl-D-galactosylamine or a derivative thereof).

[0277] In some embodiments, the carbohydrate moiety comprises an N-acetylgalactosamine (e.g., one, two, or three N-acetylgalactosamines). In some embodiments, the carbohydrate moiety comprises an N-acetyl-D-galactosylamine (e.g., one, two, or three N-acetyl-D-galactosylamines).

[0278] In some embodiments, the carbohydrate moiety comprises mannose or a derivative thereof (e.g., mannose-6-phosphate). In some embodiments, the carbohydrate moiety further comprises a linking moiety that connects one or more sugars (e.g., N-acetyl-D-galactosylamine) to a linker.

[0279] In some embodiments, the linker comprises a thioether (e.g., thiosuccinimide, or its hydrolyzed analog), a disulfide, a triazole, a phosphorothioate, a phosphodiester, an ester, an amide, or any combination thereof. In some embodiments, the linker is a three-branched linking moiety. Suitable targeting ligands include, but are not limited to, those described in PCT Publication Nos. WO 2015 / 006740, WO 2016 / 100401, WO 2017 / 214112, WO 2018 / 039364, and WO 2018 / 045317 (each of which is incorporated herein by reference).

[0280] In some embodiments, the targeting ligand comprises a lipid or lipid moiety (e.g., one, two, or three lipid moieties). In some embodiments, the lipid moiety comprises a C8-C24 fatty acid, cholesterol, a vitamin, a sterol, a phospholipid, or any combination thereof (e.g., one, two, or three of these).

[0281] In some embodiments, the targeting ligand comprises a peptide or peptide moiety (e.g., one, two, or three peptide moieties). In some embodiments, the peptide moiety comprises an integrin, insulin, glucagon-like peptide, or any combination thereof (e.g., one, two, or three of these). In some embodiments, the targeting ligand comprises an antibody or antibody moiety (e.g., transferrin). In some embodiments, the targeting ligand comprises one, two, or three antibody moieties (e.g., transferrin).

[0282] In some embodiments, the targeting ligand comprises an oligonucleotide (e.g., an aptamer or CpG). In some embodiments, the targeting ligand comprises one, two, or three oligonucleotides (e.g., an aptamer or CpG).

[0283] In some embodiments, the ligand comprises one, two, or three sugars (e.g., N-acetyl-D-galactosylamine); one, two, or three lipid moieties; one, two, or three peptide moieties; one, two, or three antibody moieties; one, two, or three oligonucleotides; or any combination thereof.

[0284] In some embodiments, the linker is attached to the isolated oligonucleotide of the present disclosure via a phosphate group or an analog of a phosphate group in the isolated oligonucleotide.

[0285] In some embodiments, the ligand comprises a sugar ligand moiety (eg, N-acetylgalactosamine (GalNAc)) that can direct uptake of the oligonucleotide into the liver.

[0286] In some embodiments, the ligand comprises GalNAc or a derivative thereof, hi some embodiments, the ligand comprises the GalNAc G1b structure shown below: [ka]

[0287] In some embodiments, the ligand comprises three GalNAc moieties or three derivatives thereof. In some embodiments, the ligand comprises three GalNAc G1b moieties. In some embodiments, the ligand comprises three GalNAc G1b moieties, the GalNAc G1b moieties are positioned consecutively. In some embodiments, the consecutively positioned GalNAc G1b moieties are positioned at the 3'-end of the sense strand. In some embodiments, the ligand comprises three consecutively positioned GalNAc G1b ("G1b") moieties, the first G1b moiety is linked to the second G1b moiety, and the second G1b moiety is linked to the third G1b moiety. In some embodiments, the first GalNAc G1b moiety is linked to the sense strand of an isolated oligonucleotide of the present disclosure.

[0288] In some embodiments of the isolated oligonucleotide of the present disclosure, the ligand comprises three GalNAc Glb ("Glb") moieties, wherein a first GalNAc Glb moiety is linked to the sense strand of the isolated oligonucleotide, the first GalNAc Glb moiety is also linked to a second GalNAc Glb moiety, and the second Glb moiety is linked to a third Glb moiety. In some embodiments where the ligand comprises three GalNAc Glb moieties, the three GalNAc Glb moieties are located consecutively at the 3'-end of the sense strand.

[0289] In some embodiments of the isolated oligonucleotide of the present disclosure, the isolated oligonucleotide is linked to a ligand (e.g., GalNAc G1b or three GalNAc G1b moieties). In some embodiments, the isolated oligonucleotide is linked to the ligand via an internal or terminal nucleotide of the isolated oligonucleotide. In some embodiments, the isolated oligonucleotide is linked to the ligand via a ligand linker. In some embodiments,

[0290] In some embodiments of the isolated oligonucleotide of the present disclosure, the isolated oligonucleotide comprises a sense strand and an antisense strand, and the ligand comprises three GalNAc G1b moieties, and the three GalNAc G1b moieties are located consecutively at the 3'-end of the sense strand, and the ligand is linked to the terminal nucleotide on the sense strand of the isolated oligonucleotide. In some embodiments, the ligand is linked to the terminal nucleotide on the sense strand via a ligand linker. In some embodiments, the ligand linker is a monovalent linker. In some embodiments, the ligand linker is a bivalent linker. In some embodiments, the ligand linker is a trivalent linker.

[0291] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 495-534; b) 1465-1485; and c) 1822-1849 from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, and a targeting ligand is attached to the 3' end of the sense strand. In some embodiments, the targeting ligand comprises three GalNAc G1b moieties.

[0292] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 495-534; b) 1465-1485; and c) 1822-1849 from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the targeting ligand comprises three GalNAc nucleotides attached to the 3' end of the sense strand. The G1b portion is included, and the sense strand comprises a nucleic acid sequence according to SEQ ID NO: 37 (5'AGUGAUGAGAUCUCUUUCCA3'); SEQ ID NO: 39 (5'GAUCUCUUUCCACUGCUAUA3'); SEQ ID NO: 49 (5'ACAAUGAGCAACAUGUGUUA3'); SEQ ID NO: 55 (5'AAGCAGGAAUUCCUGAAUUA3'); SEQ ID NO: 56 (5'CAGGAAUUCCUGAAUUUUAA3'); SEQ ID NO: 58 (5'AAUUCCUGAAUUUUAUGACA3'); or SEQ ID NO: 389 (5'ACUGCUAUGACGGUUACACA3').

[0293] Linkage at the 3' end of the isolated oligonucleotides of the present disclosure may utilize either the 2' or 3' hydroxyl position of the nucleoside, either directly via the 5', 3', or 2' hydroxyl group, or indirectly via a non-nucleotidic linker or nucleoside. Linkage may also utilize a functionalized sugar or nucleobase of the 3'-terminal nucleotide. In some embodiments, the ligands described herein may be attached to the isolated oligonucleotides of the present disclosure using a variety of ligand linkers, which may be cleavable or non-cleavable.

[0294] Modification of phosphate groups

[0295] Modified terminal phosphate groups

[0296] The present disclosure further provides oligonucleotides and conjugates containing modified phosphate groups (also called phosphate mimetics or phosphate derivatives) for nucleic acid delivery. The present disclosure also relates to the use of oligonucleotides and conjugates containing modified phosphate groups, for example, in the delivery of nucleic acids and / or the treatment or prevention of disease.

[0297] In some embodiments, the present disclosure provides phosphate mimetics of the 5'-terminal nucleotide. Without wishing to be bound by theory, it is understood that when incorporated into an oligonucleotide (e.g., at the 5'-end of the antisense strand), the phosphate mimetics can improve Ago2 binding / loading and enhance the metabolic stability of the oligonucleotide, thus enhancing the potency and duration of the isolated oligonucleotide (e.g., dsRNA or siRNA).

[0298] In some embodiments of the isolated oligonucleotides of the present disclosure, the oligonucleotides comprise 5'-terminal nucleotide modifications. In some embodiments, the 5'-terminal modifications provide the functional effects of a phosphate group, but are more stable in the environmental conditions to which the oligonucleotides are exposed when administered to a subject. In some embodiments, the isolated oligonucleotides comprise phosphate mimics that are more resistant to phosphatases and other enzymes, while minimizing adverse effects on the function of the oligonucleotides (e.g., minimizing reduction in gene target knockdown when used as RNAi inhibitor molecules).

[0299] In some embodiments, the 5'-end modification is a chemical modification, hi some embodiments, the chemical modification enhances stability against nucleases or other enzymes that degrade or interfere with the structure or activity of the isolated oligonucleotide.

[0300] In some embodiments, the sense strand or antisense strand of an isolated oligonucleotide of the present disclosure comprises a 5'-terminal phosphate group. In some embodiments, the 5'-terminal phosphate group comprises an unmodified phosphate having the formula: -OP(=O)(OH)OH. In some embodiments, the 5'-terminal phosphate group comprises a modified phosphate. In some embodiments, the 5'-terminal phosphate group comprises a modified phosphate having the formula: -CH2-P(=X)(OR 1 ) OR 2 (wherein X is O or S, and R 1 is H or C1-C6 alkyl, and R 2 is H or C1-C6 alkyl). In some embodiments, the modified phosphates are referred to as "phosphate mimetics."

[0301] The term "halo" or "halogen" as used herein refers to fluoro, chloro, bromo, and iodo.

[0302] As used herein, the term "aryl" includes groups with aromatic character, including "conjugated" or polycyclic systems having one or more aromatic rings, and does not include heteroatoms in the ring structure. The term aryl includes both monovalent and divalent species. Examples of aryl groups include, but are not limited to, phenyl, biphenyl, naphthyl, and the like. Conveniently, the aryl is phenyl.

[0303] As used herein, the term "alkyl" or "C1-C6 alkyl" is intended to include C1, C2, C3, C4, C5, or C6 straight-chain (linear) saturated aliphatic hydrocarbon groups and C3, C4, C5, or C6 branched saturated aliphatic hydrocarbon groups. For example, C1-C6 alkyl is intended to include C1, C2, C3, C4, C5, and C6 alkyl groups. Examples of alkyl include, but are not limited to, moieties having 1 to 6 carbon atoms, such as methyl, ethyl, n-propyl, i-propyl, n-butyl, s-butyl, t-butyl, n-pentyl, i-pentyl, or n-hexyl. In some embodiments, a straight-chain or branched alkyl has 6 or fewer carbon atoms (e.g., C1-C6 for straight chain, C3-C6 for branched chain), and in other embodiments, a straight-chain or branched alkyl has 4 or fewer carbon atoms. In some embodiments, a straight-chain alkyl has 1 carbon atom. In some embodiments, a straight-chain alkyl has 2 carbon atoms.

[0304] In some embodiments, the phosphate mimetic is linked to the 5' end of an isolated oligonucleotide (e.g., siRNA) as shown in the following formula: [ka] During the ceremony, B is H or a nucleobase moiety; X is O or S; R 1 is H or C1-C6 alkyl, R 2 is H or C1-C6 alkyl, Y 1 is O or S, Y 2 is O or S, Z is H, halogen or -OR Z and R Z is H, C1-C6 alkyl, or -(C1-C6 alkyl)-(C6-C 10 aryl), where C1-C6 alkyl or -(C1-C6 alkyl)-(C6-C 10aryl) can be one or more R Za and optionally substituted with Each R Za are independently halogen, C1-C6 alkyl, or —O—(C1-C6 alkyl), where C1-C6 alkyl or —O—(C1-C6 alkyl) is optionally substituted with one or more halogens; and [ka] indicates the attachment of an isolated oligonucleotide (eg, siRNA) to a nucleotide.

[0305] In some embodiments, the phosphate mimetic is linked to the 5' end of an isolated oligonucleotide (e.g., siRNA) as shown in the following formula: [ka] During the ceremony, B is H or a nucleobase moiety; X is O or S; R 1 is H or C1-C6 alkyl, R 2 is H or C1-C6 alkyl, Y 1 is O or S, Y 2 is O or S, and [ka] indicates the attachment of an isolated oligonucleotide (eg, siRNA) to a nucleotide.

[0306] In some embodiments, the phosphate mimetic is linked to the 5' end of an isolated oligonucleotide (e.g., siRNA) as shown in the following formula: [ka] During the ceremony, B is H or a nucleobase moiety; X is O or S; R 1 is H or C1-C6 alkyl, R 2 is H or C1-C6 alkyl, and [ka] indicates the attachment of an isolated oligonucleotide (eg, siRNA) to a nucleotide.

[0307] In some embodiments, X is O.

[0308] In some embodiments, X is S.

[0309] In some embodiments, R 1 is H.

[0310] In some embodiments, R 1 is C1-C6 alkyl (for example, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl or hexyl).

[0311] In some embodiments, R 1 is methyl.

[0312] In some embodiments, R 2 is H.

[0313] In some embodiments, R 2 is C1-C6 alkyl (for example, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl or hexyl).

[0314] In some embodiments, R 2 is methyl.

[0315] In some embodiments, Y 1 is O.

[0316] In some embodiments, Y 1 is S.

[0317] In some embodiments, Y 2 is O.

[0318] In some embodiments, Y 2 is S.

[0319] In some embodiments, Z is H.

[0320] In some embodiments, Z is not H.

[0321] In some embodiments, Z is halogen (eg, F, Cl, Br, or I).

[0322] In some embodiments, Z is F or Cl.

[0323] In some embodiments, Z is F.

[0324] In some embodiments, Z is -OR Z is.

[0325] In some embodiments, Z is —OH.

[0326] In some embodiments, Z is not —OH.

[0327] In some embodiments, Z is -O-(C1-C6 alkyl) (e.g., C1-C6 alkyl is methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl).

[0328] In some embodiments, Z is —OCH 3 .

[0329] In some embodiments, Z is -O-(C1-C6 alkyl)-O-(C1-C6 alkyl) (e.g., C1-C6 alkyl is methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl).

[0330] In some embodiments, Z is —OCH 2 CH 2 OCH 3 .

[0331] In some embodiments, Z is one or more R Za optionally substituted with -O-(C1-C6 alkyl)-(C6-C 10 aryl).

[0332] In some embodiments, Z is —O—(C1-C6 alkyl)-(C6-C 10 aryl).

[0333] In some embodiments, Z is [ka] is.

[0334] In some embodiments, Z is one or more R Za optionally replaced with [ka] is.

[0335] In some embodiments, Z is optionally substituted with one or more halogens. [ka] is.

[0336] In some embodiments, Z is optionally substituted with one or more C1-C6 alkyl or -O-(C1-C6 alkyl). [ka] wherein the C1-C6 alkyl or -O-(C1-C6 alkyl) is optionally substituted with one or more halogens.

[0337] In some embodiments, R Z is H.

[0338] In some embodiments, R Z is not H.

[0339] In some embodiments, R Z is one or more R Za and C1-C6 alkyl (for example, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl or hexyl) optionally substituted with.

[0340] In some embodiments, R Z is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl or hexyl) optionally substituted with one or more halogens (e.g., F, Cl, Br or I) or —O—(C1-C6 alkyl) optionally substituted with one or more halogens (e.g., C1-C6 alkyl is methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl or hexyl).

[0341] In some embodiments, R Z is C1-C6 alkyl (for example, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl or hexyl).

[0342] In some embodiments, R Z is methyl, ethyl or propyl.

[0343] In some embodiments, R Z is methyl.

[0344] In some embodiments, R Z is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl) substituted with one or more halogens (e.g., F, Cl, Br, or I).

[0345] In some embodiments, R Z is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl or hexyl) substituted with one or more —O—(C1-C6 alkyl) (e.g., C1-C6 alkyl is methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl or hexyl), where —O—(C1-C6 alkyl) is optionally substituted with one or more halogens.

[0346] In some embodiments, R Z is one or more R Za optionally substituted with -(C1-C6 alkyl)-(C6-C 10 aryl).

[0347] In some embodiments, R Z is -(C1-C6 alkyl)-(C6-C6 alkyl) optionally substituted with one or more halogens (e.g., F, Cl, Br, or I); 10 aryl), C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl), or —O—(C1-C6 alkyl) (e.g., C1-C6 alkyl is methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl), where C1-C6 alkyl or —O—(C1-C6 alkyl) is optionally substituted with one or more halogens.

[0348] In some embodiments, R Zis -(C1-C6 alkyl)-(C6-C 10 aryl).

[0349] In some embodiments, at least one R Za is a halogen (e.g., F, Cl, Br, or I).

[0350] In some embodiments, at least one R Za is F or Cl.

[0351] In some embodiments, at least one R Za is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl or hexyl) optionally substituted with one or more halogens (e.g., F, Cl, Br or I).

[0352] In some embodiments, at least one R Za is C1-C6 alkyl (for example, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl or hexyl).

[0353] In some embodiments, at least one R Za is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl) substituted with one or more halogens (e.g., F, Cl, Br, or I).

[0354] In some embodiments, at least one R Za is —O—(C1-C6 alkyl) optionally substituted with one or more halogens (e.g., F, Cl, Br, or I).

[0355] In some embodiments, at least one R Za is —O—(C1-C6 alkyl).

[0356] In some embodiments, at least one R Za is —O—(C1-C6 alkyl) substituted with one or more halogens (e.g., F, Cl, Br, or I).

[0357] In some embodiments, B is H.

[0358] In some embodiments, B is a nucleobase moiety.

[0359] As used herein, the term "nucleobase moiety" refers to a nucleobase that is attached to the remainder of an isolated oligonucleotide (e.g., a dsRNA or siRNA) of the disclosure, e.g., via an atom of the nucleobase or a functional group thereof.

[0360] In some embodiments, the nucleobase moiety is adenine (A), cytosine (C), guanine (G), thymine (T), or uracil (U).

[0361] In some embodiments, the nucleobase moiety is uracil (U).

[0362] In some embodiments, the phosphate mimetic is linked to the 5' end of the isolated oligonucleotide, as shown in the following formula: [ka] During the ceremony, B is a nucleobase moiety, the nucleobase moiety is uracil (U), the uracil is at position 1 from the 5' end of the sense strand or position 1 from the 5' end of the antisense strand; X is O, R 1 is a C1 alkyl, R 2 is H, and [ka] indicates the attachment of an isolated oligonucleotide (eg, siRNA) to a nucleotide.

[0363] In some embodiments of the isolated oligonucleotide of the present disclosure, a phosphate mimetic is attached to the 5' end of the antisense strand of the isolated oligonucleotide.

[0364] In some embodiments, the phosphate mimetic is attached to the 5'-terminal uridine of the antisense strand of an isolated oligonucleotide having the following structure: 5'-MeEPmU. [ka] where "mU" is a 2'-O-methyl modified uridine nucleotide and "MeEP" is a monomethyl protected phosphate mimic.

[0365] In some embodiments, the phosphate mimetic is attached to the 5'-terminal uridine of the antisense strand of an isolated oligonucleotide having the following structure: (5'-MeEPmUs). [ka] where "mU" is a 2'-O-methyl modified uridine nucleotide, "MeEP" is a monomethyl protected phosphate mimic, and "s" is a phosphorothioate internucleotide linkage.

[0366] In some embodiments, the phosphate mimetic is attached to the 5'-terminal uridine of the antisense strand of an isolated oligonucleotide having the following structure: (5'-EPmUs): [ka] where "mU" is a 2'-O-methyl modified uridine nucleotide, "EP" is a phosphate mimetic, and "s" is a phosphorothioate internucleotide linkage.

[0367] The terms "5'-MeEP", "5'-MeEP", and "5'MeEP" are used interchangeably herein.

[0368] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 495-534; b) 1465-1485; and c) 1822-1849 from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, and the antisense strand comprises a monomethyl-protected phosphate mimic (MeEP). In some embodiments, MeEP is linked to the 5' end of the antisense strand (5'-MeEP).

[0369] In some embodiments in which MeEP is linked to the 5' end of the antisense strand, the phosphate mimetic is attached to the 5' terminal uridine of the antisense strand.

[0370] In some embodiments, the 5'-terminal uridine is a 2'-O-methyl modified nucleotide.

[0371] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 495-534; b) 1465-1485; and c) 1822-1849 from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, the antisense strand comprises 5'-MeEP linked to the 5' end of the antisense strand, and the antisense strand comprises a nucleotide sequence identical to a region of SEQ ID NO: 3 (5'UGGAAAGAGAUCUCAUCAC SEQ ID NO: 5 (5'UAUAGCAGUGGAAAGAGAUCUC3'); SEQ ID NO: 6 (5'UGUGUAACCGUCAUAGCAGUGG3'); SEQ ID NO: 15 (5'UAACACAUGUUGCUCAUUGUCU3'); SEQ ID NO: 21 (5'UAAUUCAGGAAUUCCUGCUUCU3'); SEQ ID NO: 22 (5'UUAAAAUUCAGGAAUUCCUGCU3'); or SEQ ID NO: 24 (5'UGUCAUAAAAUUCAGGAAUUCC3').

[0372] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 495-534; b) 1465-1485; and c) 1822-1849 from the 5' end of the CFB mRNA sequence according to SEQ ID NO:1, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, wherein the antisense strand comprises 5'-MeEP linked to the 5' end of the antisense strand, and the sense strand comprises a targeting ligand comprising three GalNAc G1b moieties attached to the 3' end of the sense strand.

[0373] Modified backbone phosphate / phosphodiester linkages

[0374] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand, the antisense strand, or both, comprise at least one nucleotide with a modified phosphate backbone. In some embodiments, the sense strand of the isolated oligonucleotide comprises at least one nucleotide with a modified phosphate backbone. In some embodiments, the antisense strand of the isolated oligonucleotide comprises at least one nucleotide with a modified phosphate backbone. In some embodiments, the isolated oligonucleotide of the present disclosure comprises a modified phosphate backbone, the modified phosphate backbone comprises a modified phosphodiester bond. The phosphodiester bond is represented by the formula: [ka] (In the formula, [ka] indicates the linkage to the 3' carbon of the first nucleotide in the isolated oligonucleotide of the disclosure, and [ka] In some embodiments, the phosphodiester bond is unmodified and Z 1 is O and Z 2 is OH or O - In some embodiments, the phosphodiester bond is modified and Z 1 is O, S, NH, or N(C1-C6 alkyl), and Z 2 OH, SH, NH2, NH(C1-C6 alkyl), O - , S - , H.N. - , or (C1-C6 alkyl)N - and Z 1 If is O, then Z 2 is OH or O - isn't it.

[0375] In some embodiments, Z 1 is O.

[0376] In some embodiments, Z 1 is S.

[0377] In some embodiments, Z1 is NH.

[0378] In some embodiments, Z1 is N(C1-C6 alkyl).

[0379] In some embodiments, Z2 is OH.

[0380] In some embodiments, Z2 is SH.

[0381] In some embodiments, Z2 is NH2.

[0382] In some embodiments, Z2 is NH(C1-C6 alkyl).

[0383] In some embodiments, Z2 is SH, NH2, or NH(C1-C6 alkyl).

[0384] In some embodiments, Z2 is O - is.

[0385] In some embodiments, Z2 is S - is.

[0386] In some embodiments, Z2 is HN - is.

[0387] In some embodiments, Z2 is (C1-C6 alkyl)N - is.

[0388] In some embodiments, Z2 is S - , H.N. - or (C1-C6 alkyl)N - is.

[0389] In some embodiments, Z 1 is O and Z 2 is SH.

[0390] In some embodiments, Z1 is O and Z2 is NH2.

[0391] In some embodiments, Z1 is O and Z2 is NH(C1-C6 alkyl).

[0392] In some embodiments, Z1 is S and Z2 is OH.

[0393] In some embodiments, Z1 is S and Z2 is SH.

[0394] In some embodiments, Z1 is S and Z2 is NH2.

[0395] In some embodiments, Z1 is S and Z2 is NH(C1-C6 alkyl).

[0396] In some embodiments, Z1 is NH and Z2 is OH.

[0397] In some embodiments, Z1 is NH and Z2 is SH.

[0398] In some embodiments, Z1 is NH and Z2 is NH2.

[0399] In some embodiments, Z1 is NH and Z2 is NH(C1-C6 alkyl).

[0400] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is OH.

[0401] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is SH.

[0402] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is NH2.

[0403] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is NH(C1-C6 alkyl).

[0404] In some embodiments, Z1 is O and Z2 is S - is.

[0405] In some embodiments, Z1 is O and Z2 is HN - is.

[0406] In some embodiments, Z1 is O and Z2 is (C1-C6 alkyl)N - is.

[0407] In some embodiments, Z1 is S and Z2 is O - is.

[0408] In some embodiments, Z1 is S and Z2 is S - is.

[0409] In some embodiments, Z1 is S and Z2 is HN - is.

[0410] In some embodiments, Z1 is S and Z2 is (C1-C6 alkyl)N - is.

[0411] In some embodiments, Z1 is NH and Z2 is O - is.

[0412] In some embodiments, Z1 is NH and Z2 is S - is.

[0413] In some embodiments, Z1 is NH and Z2 is HN - is.

[0414] In some embodiments, Z1 is NH and Z2 is (C1-C6 alkyl)N - is.

[0415] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is O - is.

[0416] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is S - is.

[0417] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is HN - is.

[0418] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is (C1-C6 alkyl)N - is.

[0419] In some embodiments, the modified phosphodiester linkage comprises a phosphorothioate internucleotide linkage.

[0420] In some embodiments, the modified phosphodiester bond is [ka] (In the formula, [ka] indicates the linkage to the 3' carbon of the first nucleotide in the isolated oligonucleotide of the disclosure, and [ka] indicates the linkage to the 5' carbon of the second nucleotide in the isolated oligonucleotide of the disclosure).

[0421] In some embodiments, the modified phosphodiester bond is [ka] (In the formula, [ka] indicates the linkage to the 3' carbon of the first nucleotide in the isolated oligonucleotide of the disclosure, and [ka] indicates the linkage to the 5' carbon of the second nucleotide in the isolated oligonucleotide of the disclosure).

[0422] In some embodiments, the modified phosphodiester bond is [ka] (In the formula, [ka] indicates the linkage to the 3' carbon of the first nucleotide in the isolated oligonucleotide of the disclosure, and [ka] indicates the linkage to the 5' carbon of the second nucleotide in the isolated oligonucleotide of the disclosure).

[0423] In some embodiments, the isolated oligonucleotide of the present disclosure comprises at least one modified phosphodiester bond. In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand, the antisense strand, or both comprise one or more modified phosphodiester bonds. In some embodiments, only the sense strand comprises one or more modified phosphodiester bonds. In some embodiments, only the antisense strand comprises one or more modified phosphodiester bonds. In some embodiments, both the sense strand and the antisense strand comprise one or more modified phosphodiester bonds.

[0424] In some embodiments, the isolated oligonucleotide comprises at least two modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least three modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least four modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least five modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least six modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least seven modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least eight modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least nine modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least ten modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least eleven modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least twelve modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least thirteen modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least four modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least fifteen modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least 16 modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least 17 modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least 18 modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least 19 modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least 20 modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises more than 20 modified phosphodiester linkages.In some embodiments, the isolated oligonucleotide comprises 20 to 30 modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises 30 to 40 modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises 40 to 50 modified phosphodiester linkages.

[0425] In some embodiments, the isolated oligonucleotide comprises at least two phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least three phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least four phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least five phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least six phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least seven phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least eight phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least nine phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least ten phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least eleven phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least twelve phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least thirteen phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least 14 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least 15 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least 16 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least 17 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least 18 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least 19 phosphorothioate internucleotide linkages.In some embodiments, the isolated oligonucleotide comprises at least 20 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises more than 20 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises 20-30 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises 30-40 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises 40-50 phosphorothioate internucleotide linkages.

[0426] In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least one modified phosphodiester bond. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least two modified phosphodiester bond(s). In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least three modified phosphodiester bond(s). In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least four modified phosphodiester bond(s). In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least five modified phosphodiester bond(s). In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least six modified phosphodiester bond(s). In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least seven modified phosphodiester bond(s). In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least eight modified phosphodiester bond(s). In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least nine modified phosphodiester bond(s). In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 10 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 11 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 12 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 13 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 14 modified phosphodiester linkages.In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 15 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 16 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 17 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 18 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 19 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 20 modified phosphodiester linkages.

[0427] In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least one phosphorothioate internucleotide linkage. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least two phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least three phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least four phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least five phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least six phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least seven phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least eight phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 9 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 10 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 11 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 12 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 13 phosphorothioate internucleotide linkages.In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 14 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 15 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 16 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 17 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 18 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 19 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 20 phosphorothioate internucleotide linkages.

[0428] In some embodiments, the modified phosphodiester linkages are contiguous in the sense strand, the antisense strand, or both. In some embodiments, some, but not all, of the modified phosphodiester linkages are contiguous in the sense strand, the antisense strand, or both. In some embodiments, the modified phosphodiester linkages in the sense strand, the antisense strand, or both are not contiguous.

[0429] The present disclosure provides isolated oligonucleotides in which any phosphodiester bond on the sense strand or antisense strand can be modified. In some embodiments, any phosphodiester bond on the antisense strand can be modified. In some embodiments, any phosphodiester bond on the antisense strand can be modified.

[0430] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand comprises 1 to 20, 1 to 15, 1 to 10, 1 to 5, or fewer than 5 modified phosphodiester linkages. In some embodiments, the 1 to 20, 1 to 15, 1 to 10, 1 to 5, or fewer than 5 modified phosphodiester linkages comprise phosphorothioate internucleotide linkages. In some embodiments, the antisense strand comprises fewer than 5 modified phosphodiester linkages. In some embodiments, the antisense strand comprises 1, 2, 3, or 4 modified phosphodiester linkages. In some embodiments, the antisense strand comprises 1, 2, 3, or 4 modified phosphodiester linkages, and the 1, 2, 3, or 4 modified phosphodiester linkages comprise phosphorothioate internucleotide linkages. In some embodiments, the antisense strand comprises 4 modified phosphodiester linkages. In some embodiments, the antisense strand comprises 4 modified phosphodiester linkages. The modified phosphodiester linkages comprise phosphorothioate.

[0431] In some embodiments, the antisense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, where the phosphorothioate internucleotide linkages link nucleotides at positions 1 and 2 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, the antisense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, where the phosphorothioate internucleotide linkages link nucleotides at positions 2 and 3 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, the antisense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, where the phosphorothioate internucleotide linkages link nucleotides at positions 20 and 21 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, the antisense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, which link nucleotides at positions 21 and 22 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, the antisense strand comprises at least one, at least two, at least three, or at least four modified phosphodiester linkages, which include phosphorothioate internucleotide linkages, and which are located between nucleotides 1 and 2, 2 and 3, 20 and 21, and 21 and 22 from the first nucleotide at the 5' end of the antisense strand.

[0432] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages being located between nucleotides 1-3 and 20-22 from the first nucleotide at the 5' end of the antisense strand.

[0433] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand comprises at least four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages are located between nucleotides 1-3 and 20-22 from the first nucleotide at the 5' end of the antisense strand.

[0434] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand comprises four phosphorothioate internucleotide linkages. In some embodiments, the antisense strand comprises four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages are located between nucleotides 1-3 and 20-22 from the first nucleotide at the 5' end of the antisense strand.

[0435] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises 1 to 20, 1 to 15, 1 to 10, 1 to 5, or fewer than 5 modified phosphodiester linkages. In some embodiments, the 1 to 20, 1 to 15, 1 to 10, 1 to 5, or fewer than 5 modified phosphodiester linkages comprise phosphorothioate internucleotide linkages. In some embodiments, the sense strand comprises fewer than 5 modified phosphodiester linkages. In some embodiments, the sense strand comprises 1, 2, 3, or 4 modified phosphodiester linkages. In some embodiments, the sense strand comprises 1, 2, 3, or 4 modified phosphodiester linkages. In some embodiments, the sense strand comprises 1, 2, 3, or 4 modified phosphodiester linkages, the 1, 2, 3, or 4 modified phosphodiester linkages comprise phosphorothioate internucleotide linkages. In some embodiments, the sense strand comprises 4 modified phosphodiester linkages. In some embodiments, the sense strand comprises 4 modified phosphodiester linkages. In some embodiments, the sense strand comprises 4 modified phosphodiester linkages, the modified phosphodiester linkages comprise phosphorothioate internucleotide linkages.

[0436] In some embodiments where the sense strand comprises at least one, at least two, at least three, or at least four modified phosphodiester linkages, the phosphodiester linkages comprise phosphorothioate internucleotide linkages. In some embodiments where the sense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages link nucleotides at positions 1 and 2 from the first nucleotide at the 5'-end of the sense strand. In some embodiments where the sense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages link nucleotides at positions 2 and 3 from the first nucleotide at the 5'-end of the sense strand. In some embodiments where the sense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages link nucleotides at positions 18 and 19 from the first nucleotide at the 5'-end of the sense strand. In some embodiments where the sense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages link nucleotides at positions 19 and 20 from the first nucleotide at the 5' end of the sense strand. In some embodiments where the sense strand comprises at least one, at least two, at least three, or at least four modified phosphodiester linkages, where the modified phosphodiester linkages comprise phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages are located between nucleotides 1 and 2, 2 and 3, 18 and 19, and 19 and 20 from the first nucleotide at the 5' end of the sense strand.

[0437] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages are located between nucleotides 1-3 and 18-20 from the first nucleotide at the 5' end of the sense strand.

[0438] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises at least four phosphorothioate internucleotide linkages, the at least four phosphorothioate internucleotide linkages are located between nucleotides 1-3 and 18-20 from the first nucleotide at the 5' end of the sense strand.

[0439] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises four phosphorothioate internucleotide linkages. In some embodiments, the sense strand comprises four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages are located between nucleotides 1-3 and 18-20 from the first nucleotide at the 5' end of the sense strand.

[0440] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand and the sense strand comprise four phosphorothioate internucleotide linkages, the antisense strand comprises phosphorothioate internucleotide linkages located between nucleotides 1-3 and 20-22 from the first nucleotide at the 5' end of the antisense strand, and the sense strand comprises phosphorothioate internucleotide linkages located between nucleotides 1-3 and 18-20 from the first nucleotide at the 5' end of the sense strand.

[0441] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand is i) the antisense strand of a nucleic acid sequence according to SEQ ID NO: 370 (5'[MeEPmUs][fGs][fU][mC][fA][mU][fA][mA][mA][fA][mU][mU][mC][fA][mG][fG][mA][mA][mU][mUs][mCs][mC]3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 371 (5'[MeEPmUs][fUs][fA][mA][fA][mA][fU][mU][mC][fA][mG][mG][mA][fA][mU][fU][mC][mC][mU][mGs][mCs][mU]3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 372 (5'[MeEPmUs][fGs][fG][mA][fA][mA][fG][mA][mG][fA][mU][mC][mU][fC][mA][fU][mC][mA][mC][mUs][mCs][mA]3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 373 (5'[MeEPmUs][fAs][fA][mU][fU][mC][fA][mG][mG][fA][mA][mU][mU][fC][mC][fU][mG][mC][mU][mUs][mCs][mU]3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 374 (5'[MeEPmUs][fAs][fA][mC][fA][mC][fA][mU][mG][fU][mU][mG][mC][fU][mC][fA][mU][mU][mU][mG][mU][mCs][mU]3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 375 (5'[MeEPmUs][fGs][fU][mG][fU][mA][fA][mC][mC][fG][mU][mC][mA][fU][mA][fG][mC][mA][mG][mU][mGs][mG]3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 376 (5'[MeEPmUs][fAs][fU][mA][fG][mC][fA][mG][mU][fG][mG][mA][mA][fA][mG][fA][mG][mA][mU][mCs][mU][mC]3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 377 (5'[mUs][fGs][fU][mC][fA][mU][fA][mA][mA][fA][mU][mU][mC][fA][mG][fG][mA][mA][mU][mU][mCs][mC]3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 378 (5'[mUs][fUs][fA][mA][fA][mA][fU][mU][mC][fA][mG][mG][mA][fA][mU][fU][mC][mC][mU][mGs][mCs][mU]3'); or x) comprising any one of the antisense strands of a nucleic acid sequence according to SEQ ID NO: 379 (5'[mUs][fGs][fG][mA][fA][mA][fG][mA][mG][fA][mU][mC][mU][fC][mA][fU][mC][mA][mC][mUs][mCs][mA]3'), wherein "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate internucleotide linkage, and "MeEP" is a monomethyl protected phosphate mimic.

[0442] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand is i) the sense strand of the nucleic acid sequence according to SEQ ID NO: 381 (5'[mAs][mAs][mU][mU][mC][fC][mU][fG][fA][fA][fU][mU][mU][mU][mA][mU][mG][mAs][mCs][mA][G1b][G1b][G1b]3'); ii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 382 (5'[mCs][mAs][mG][mG][mA][fA][mU][fU][fC][fC][fU][mG][mA][mA][mU][mU][mU][mUs][mAs][mA][Glb][Glb][Glb]3'); iii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 383 (5'[mAs][mGs][mU][mG][mA][fU][mG][fA][fG][fA][fU][mC][mU][mC][mU][mU][mU][mCs][mCs][mA][G1b][G1b][G1b]3'); iv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 384 (5'[mAs][mAs][mG][mC][mA][fG][mG][fA][fA][fU][fU][mC][mC][mU][mG][mA][mA][mUs][mUs][mA][Glb][Glb][Glb]3'); v) the sense strand of the nucleic acid sequence according to SEQ ID NO: 385 (5'[mAs][mCs][mA][mA][mU][fG][mA][fG][fC][fA][fA][mC][mA][mU][mG][mU][mG][mUs][mUs][mA][G1b][G1b][G1b]3'); vi) the sense strand of the nucleic acid sequence according to SEQ ID NO: 386 (5'[mAs][mCs][mU][mG][mC][fU][mA][fU][fG][fA][fC][mG][mG][mU][mU][mA][mC][mAs][mCs][mA][Glb][Glb][Glb]3'); or vii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 387 (5'[mGs][mAs][mU][mC][mU][fC][mU][fU][fC][fC][mA][mC][mU][mG][mC][mU][mAs][mU][mA][Glb][Glb][Glb]3') wherein "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate internucleotide linkage, and "Glb" is a GalNac Glb moiety.

[0443] In some embodiments of the isolated oligonucleotides of the present disclosure, i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 370 (5'[MeEPmUs][fGs][fU][mC][fA][mU][fA][mA][mA][fA][mU][mU][mC][fA][mG][fG][mA][mA][mU][mUs][mCs][mC]3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 381 (5'[mAs][mAs][mU][mU][mC][fC][mU][fG][fA][fA][fU][mU][mU][mU][mA][mU][mG][mAs][mCs][mA][G1b][G1b]3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 371 (5'[MeEPmUs][fUs][fA][mA][fA][mA][fU][mU][mC][fA][mG][mG][mA][fA][mU][fU][mC][mC][mU][mGs][mCs][mU]3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 382 (5'[mCs][mAs][mG][mG][mA][fA][mU][fU][fC][fC][fU][mG][mA][mA][mU][mU][mU][mU][mAs][mA][G1b][G1b][G1b]3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 372 (5'[MeEPmUs][fGs][fG][mA][fA][mA][fG][mA][mG][fA][mU][mC][mU][fC][mA][fU][mC][mA][mC][mUs][mCs][mA]3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 383 (5'[mAs][mGs][mU][mG][mA][fU][mG][fA][fG][fA][fU][mC][mU][mC][mU][mU][mCs][mCs][mA][G1b][G1b]3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 373 (5'[MeEPmUs][fAs][fA][mU][fU][mC][fA][mG][mG][fA][mA][mU][mU][fC][mC][fU][mG][mC][mU][mUs][mCs][mU]3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 384 (5'[mAs][mAs][mG][mC][mA][fG][mG][fA][fA][fU][fU][mC][mC][mU][mG][mA][mA][mUs][mUs][mA][G1b][G1b][G1b]3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 374 (5'[MeEPmUs][fAs][fA][mC][fA][mC][fA][mU][mG][fU][mU][mG][mC][fU][mC][fA][mU][mU][mG][mUs][mCs][mU]3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 385 (5'[mAs][mCs][mA][mA][mU][fG][mA][fG][fC][fA][fA][mC][mA][mU][mG][mU][mG][mU][mUs][mA][G1b][G1b][G1b]3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 375 (5'[MeEPmUs][fGs][fU][mG][fU][mA][fA][mC][mC][fG][mU][mC][mA][fU][mA][fG][mC][mA][mG][mUs][mGs][mG]3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 386 (5'[mAs][mCs][mU][mG][mC][fU][mA][fU][fG][fA][fC][mG][mG][mU][mU][mA][mC][mAs][mCs][mA][G1b][G1b][G1b]3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 376 (5'[MeEPmUs][fAs][fU][mA][fG][mC][fA][mG][mU][fG][mG][mA][mA][fA][mG][fA][mG][mA][mU][mCs][mUs][mC]3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 387 (5'[mGs][mAs][mU][mC][mU][fC][mU][fC][mU][fU][fC][fC][mA][mC][mU][mG][mC][mU][mAs][mUs][mA][G1b][G1b][G1b]3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 377 (5'[mUs][fGs][fU][mC][fA][mU][fA][mA][mA][fA][mU][mU][mC][fA][mG][fG][mA][mA][mU][mU][mUs][mCs][mC]3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 381 (5'[mAs][mAs][mU][mU][mC][fC][mU][fG][fA][fA][fU][mU][mU][mU][mA][mU][mG][mAs][mCs][mA][G1b][G1b][G1b]3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 378 (5'[mUs][fUs][fA][mA][fA][mA][fU][mU][mC][fA][mG][mG][mA][fA][mU][fU][mC][mC][mU][mGs][mCs][mU]3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 382 (5'[mCs][mAs][mG][mG][mA][fA][mU][fU][fC][fC][fU][mG][mA][mA][mU][mU][mU][mU][mAs][mA][Glb][Glb][Glb]3'); or x) an antisense strand of a nucleic acid sequence according to SEQ ID NO: 379 (5'[mUs][fGs][fG][mA][fA][mA][fG][mA][mG][fA][mU][mC][mU][fC][mA][fU][mC][mA][mC][mU][mCs][mA]3'), and a sense strand of a nucleic acid sequence according to SEQ ID NO: 383 (5'[mAs][mGs][mU][mG][mA][fU][mG][fA][fG][fA][fU][mC][mU][mC][mU][mU][mCs][mCs][mA][Glb][Glb][Glb]3'), wherein "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate internucleotide linkage, "MeEP" is a monomethyl protected phosphate mimic, and "Glb" is a GalNAc This is the G1b part.

[0444] Nucleic acids and vectors

[0445] The present disclosure also provides vectors encoding at least one isolated oligonucleotide disclosed herein. In some embodiments, the vector is any one of a plasmid, a cosmid, or a viral vector. In some embodiments, the vector is an adenoviral vector. In some embodiments, the vector is a lentiviral vector. In some embodiments, the plasmid is an expression plasmid. In some embodiments, the vector encodes one isolated oligonucleotide disclosed herein. In some embodiments, the vector encodes two or more isolated oligonucleotides disclosed herein. In some embodiments, the vector encodes two, three, four, or five isolated oligonucleotides disclosed herein. In some embodiments, the vector encodes more than five isolated oligonucleotides disclosed herein.

[0446] The present disclosure provides nucleic acids comprising sequences encoding isolated oligonucleotides (eg, dsRNA or siRNA) that target CFB as described herein.

[0447] In some embodiments, the nucleic acid is ribonucleic acid (RNA). In some embodiments, the nucleic acid is deoxyribonucleic acid (DNA). The DNA can be a vector or a plasmid, for example, an expression vector.

[0448] A "vector" is any nucleic acid molecule for cloning a nucleic acid and / or transferring it into a cell. A vector may be a replicon to which another nucleotide sequence may be attached to enable replication of the attached nucleotide sequence. A "replicon" may be any genetic element (e.g., plasmid, phage, cosmid, chromosome, viral genome) that functions as an autonomous unit of nucleic acid replication in vivo, i.e., capable of replication under its own control. The term "vector" includes both viral and non-viral (e.g., plasmid) nucleic acid molecules for introducing nucleic acids into cells in vitro, ex vivo, and / or in vivo. Numerous vectors known in the art can be used to manipulate nucleic acids, incorporate response elements and promoters into genes, etc. For example, insertion of nucleic acid fragments corresponding to response elements and promoters into an appropriate vector can be accomplished by ligating the appropriate nucleic acid fragments into a selected vector having complementary cohesive termini. Alternatively, the ends of the nucleic acid molecule may be enzymatically modified, or any site may be created by ligating nucleotide sequences (linkers) to the nucleic acid termini. Such vectors may be engineered to contain a sequence encoding a selectable marker that provides for selection of cells that contain the vector and / or have integrated the vector's nucleic acid into their genome. Such markers allow for the identification and / or selection of host cells that have incorporated and express the protein encoded by the marker. A "recombinant" vector refers to a viral or non-viral vector that contains one or more heterologous nucleotide sequences (i.e., transgenes), for example, two, three, four, five, or more heterologous nucleotide sequences.

[0449] The term "express" or "expression" of a polynucleotide coding sequence means that the sequence is transcribed and optionally translated. Typically, according to the present disclosure, expression of a coding sequence of the present disclosure results in the production of a polypeptide of the present disclosure. The whole expressed polypeptide or fragment may also function in the intact cell without purification.

[0450] In some embodiments, the vector is an expression vector for producing the siRNA of the present disclosure.Exemplary expression vectors can include sequences encoding the sense strand and / or antisense strand of the isolated oligonucleotide of the present disclosure under the control of a promoter suitable for transcription.Interfering RNA can be expressed from various eukaryotic promoters known to those skilled in the art, including pol III promoters such as U6 or H1 promoters, or pol II promoters such as cytomegalovirus promoters.Those skilled in the art will recognize that these promoters can also be adapted to allow inducible expression of interfering RNA.

[0451] The isolated oligonucleotides (e.g., dsRNA and siRNA) of the present disclosure can be expressed endogenously from a plasmid or viral expression vector, or from a minimal expression cassette, such as a PCR-generated fragment containing one or more promoters and an appropriate template(s) for transcribing the siRNA. Examples of commercially available plasmid-based expression vectors for shRNA include members of the pSilencer series (Ambion) and pCpG-siRNA (InvivoGen). Examples of kits for preparing PCR-generated shRNA expression cassettes include Silencer Express (Ambion) and siXpress (Mirus).

[0452] Viral vectors for in vivo expression of isolated oligonucleotides (e.g., siRNA and dsRNA) in eukaryotic cells are also considered within the scope of the present disclosure. Viral vectors can be derived from various viruses, including adenoviruses, adeno-associated viruses, lentiviruses (e.g., HIV, FIV, and EIAV), and herpes viruses. Examples of commercially available viral vectors for shRNA expression include pSilencer adeno (Ambion) and pLenti6 / BLOCK-iT™-DEST (Invitrogen). The selection of viral vectors, methods for expressing siRNA from the vectors, and methods for delivering viral vectors, for example, incorporated into nanoparticles, are within the ordinary skill of those skilled in the art.

[0453] It will be apparent to those skilled in the art that any suitable vector, optionally incorporated into a nanoparticle, can be used to deliver the isolated oligonucleotides (e.g., dsRNA or siRNA) of the present disclosure described herein to a cell or a subject. The vector can be delivered to a cell in vivo. In other embodiments, the vector can be delivered to a cell ex vivo, and the cells containing the vector are then delivered to a subject. The selection of a delivery vector can be based on many factors known in the art, including the age and species of the target host, in vitro delivery versus in vivo delivery, the desired level and persistence of expression, the intended purpose (e.g., for therapy or screening), the target cell or organ, the delivery route, the size of the isolated polynucleotide, safety concerns, etc.

[0454] Delivery System

[0455] The present disclosure also provides a delivery system comprising at least an isolated oligonucleotide disclosed herein or a vector of the present disclosure encoding at least an isolated oligonucleotide disclosed herein. In some embodiments, the delivery system is any one of a liposome, a nanoparticle, a polymer-based delivery system, or a ligand-conjugate delivery system. In some embodiments, the ligand-conjugate delivery system comprises one or more of an antibody, a peptide, a sugar moiety, or a combination thereof.

[0456] In some embodiments, the delivery system of the present disclosure comprises nanoparticles comprising an isolated oligonucleotide (e.g., siRNA or dsRNA) of the present disclosure that targets CFB mRNA for degradation. In some embodiments, the nanoparticles comprise polymer-based nanoparticles, lipid-polymer-based nanoparticles, metal-based nanoparticles, carbon nanotube-based nanoparticles, nanocrystals, or polymeric micelles. In some embodiments, the polymer-based nanoparticles comprise multiblock copolymers, diblock copolymers, polymeric micelles, or hyperbranched macromolecules. In some embodiments, the polymer-based nanoparticles comprise multiblock copolymers, diblock copolymers. In some embodiments, the polymer-based nanoparticles are pH-responsive. In some embodiments, the polymer-based nanoparticles further comprise a buffering component.

[0457] In some embodiments, the delivery system comprises a liposome. Liposomes are spherical vesicles having at least one lipid bilayer and, in some embodiments, an aqueous core. In some embodiments, the lipid bilayer of the liposome can comprise a phospholipid. An illustrative, but non-limiting, example of a phospholipid is phosphatidylcholine, although the lipid bilayer can comprise additional lipids, such as phosphatidylethanolamine. Liposomes can be multilamellar, i.e., composed of several lamellar lipid bilayers, or unilamellar, having a single lipid bilayer. Liposomes can be fabricated in specific size ranges that make them viable targets for phagocytosis. Liposomes can range in size from 20 nm to 100 nm, 100 nm to 400 nm, 1 μM or greater, or 200 nm to 3 μM. Examples of lipidoid and lipid-based formulations are provided in U.S. Patent Application Publication No. 20090023673. In other embodiments, the one or more lipids are one or more cationic lipids. Those skilled in the art will recognize which liposomes are suitable for encapsulating siRNA.

[0458] In some embodiments, the liposomes or nanoparticles of the present disclosure comprise micelles. Micelles are aggregates of surfactant molecules. Exemplary micelles comprise aggregates of amphiphilic macromolecules, polymers, or copolymers in aqueous solution, with the hydrophilic head regions in contact with the surrounding solvent and the hydrophobic tail regions sequestered in the center of the micelle.

[0459] In some embodiments, the nanoparticles comprise nanocrystals. Exemplary nanocrystals are crystalline particles having at least one dimension less than 1000 nanometers, preferably less than 100 nanometers.

[0460] In some embodiments, the nanoparticles comprise polymer-based nanoparticles. In some embodiments, the polymer comprises a multiblock copolymer, a diblock copolymer, a polymeric micelle, or a hyperbranched macromolecule. In some embodiments, the particles comprise one or more cationic polymers. In some embodiments, the cationic polymer is chitosan, protamine, polylysine, polyhistidine, polyarginine, or poly(ethylene)imine. In other embodiments, the one or more polymers comprise a buffering component, a degradable component, a hydrophilic component, a cleavable linker component, or some combination thereof.

[0461] In some embodiments, the nanoparticles or portions thereof are degradable. In other embodiments, the lipids and / or polymers of the nanoparticles are degradable.

[0462] In some embodiments, any of these delivery systems of the present disclosure can include a buffering component. In other embodiments, any of the present disclosures can include a buffering component and a degradable component. In yet other embodiments, any of the present disclosures can include a buffering component and a hydrophilic component. In still other embodiments, any of the present disclosures can include a buffering component and a cleavable linkage component. In still other embodiments, any of the present disclosures can include a buffering component, a degradable component, and a hydrophilic component. In still other embodiments, any of the present disclosures can include a buffering component, a degradable component, and a cleavable linkage component. In further embodiments, any of the present disclosures can include a buffering component, a hydrophilic component, and a cleavable linkage component. In yet other embodiments, any of the present disclosures can include a buffering component, a degradable ... some embodiments, the particles are composed of one or more polymers containing any of the aforementioned combinations of components.

[0463] In some embodiments of the isolated oligonucleotides of the present disclosure, the delivery system comprises a ligand-conjugate delivery system, hi some embodiments, the ligand-conjugate delivery system comprises one or more of an antibody, a peptide, a sugar moiety, a lipid, or a combination thereof.

[0464] In further embodiments, the isolated oligonucleotide (e.g., siRNA or dsRNA) of the present disclosure targeting CFB mRNA is conjugated, complexed, or encapsulated to one or more lipids or polymers of the delivery system. In further embodiments, the isolated oligonucleotide (e.g., siRNA or dsRNA) of the present disclosure targeting CFB mRNA can be encapsulated in the hollow core of a nanoparticle. Alternatively, or in addition, the isolated oligonucleotide (e.g., siRNA or dsRNA) of the present disclosure targeting CFB mRNA can be incorporated into the lipid- or polymer-based shell of the delivery system, e.g., by intercalation. Alternatively, or in addition, the isolated oligonucleotide (e.g., siRNA or dsRNA) of the present disclosure targeting CFB mRNA can be attached to the surface of the delivery system. In some embodiments, the isolated oligonucleotide (e.g., siRNA or dsRNA) of the present disclosure targeting CFB mRNA is conjugated to one or more lipids or polymers of the delivery system, e.g., via a covalent bond.

[0465] In some embodiments, the ligand conjugate delivery system further comprises a targeting agent, hi some embodiments, the targeting agent comprises a peptide ligand, a nucleotide ligand, a polysaccharide ligand, a fatty acid ligand, a lipid ligand, a small molecule ligand, an antibody, an antibody fragment, an antibody mimetic, or an antibody mimetic fragment.

[0466] In some embodiments, the isolated oligonucleotides disclosed herein may further comprise a ligand that facilitates delivery or uptake of the isolated oligonucleotide to specific tissues or cells, such as liver cells. In certain embodiments, the ligand targets delivery of the RNAi construct to liver cells. In these and other embodiments, the ligand may comprise galactose, galactosamine, or N-acetyl-galactosamine (GalNAc). In certain embodiments, the ligand comprises a multivalent galactose or multivalent GalNAc moiety, such as a trivalent or tetravalent galactose or GalNAc moiety. The ligand may be covalently attached to the 5' or 3' end of the sense strand of the RNAi construct, optionally via a linker.

[0467] In some embodiments, the targeting agent comprises a binding partner for a cell surface protein that is upregulated, overexpressed, or normally expressed in target cells that encode CFB mRNA and express CFB protein. In some embodiments, the binding partner may be a transmembrane peptidoglycan expressed on the surface of many types of such cells. Thus, targeting cell surface proteins with the delivery system of the present disclosure provides superior delivery and specificity of the compositions of the present disclosure to the target cells. In some embodiments, the target cells may be any one of intestinal cells, arterial cells, cells of the cardiovascular system, liver cells, pancreatic cells, or a combination thereof.

[0468] In some embodiments, the delivery system of the present disclosure comprises a polymer-based delivery system. In some embodiments, the polymer-based delivery system comprises a blend polymer. In some embodiments, the blend polymer is a copolymer comprising a degradable component and a hydrophilic component. In some embodiments, the degradable component of the blend polymer is a polyester, poly(orthoester), poly(ethyleneimine), poly(caprolactone), polyanhydride, poly(acrylic acid), polyglycolide, or poly(urethane). In some embodiments, the degradable component of the blend polymer is poly(lactic acid) (PLA) or poly(lactic-co-glycolic acid) (PLGA). In some embodiments, the hydrophilic component of the blend polymer is a polyalkylene glycol or a polyalkylene oxide. In some embodiments, the polyalkylene glycol is polyethylene glycol (PEG). In other embodiments, the polyalkylene oxide is polyethylene oxide (PEO).

[0469] In some embodiments, the delivery system of the present disclosure is a polymer-based nanoparticle. The polymer-based nanoparticle comprises one or more polymers. In some embodiments, the one or more polymers comprise a polyester, a poly(orthoester), a poly(ethyleneimine), a poly(caprolactone), a polyanhydride, a poly(acrylic acid), a polyglycolide, or a poly(urethane). In still other embodiments, the one or more polymers comprise poly(lactic acid) (PLA) or poly(lactic-co-glycolic acid) (PLGA). In some embodiments, the one or more polymers comprise poly(lactic-co-glycolic acid) (PLGA). In some embodiments, the one or more polymers comprise poly(lactic acid) (PLA). In some embodiments, the one or more polymers comprise a polyalkylene glycol or a polyalkylene oxide. In some embodiments, the polyalkylene glycol is polyethylene glycol (PEG) or the polyalkylene oxide is polyethylene oxide (PEO).

[0470] In some embodiments, the polymer-based nanoparticles comprise poly(lactic-co-glycolic acid) PLGA polymer. In some embodiments, the PLGA nanoparticles further comprise a targeting agent described herein.

[0471] In some embodiments, the delivery systems of the present disclosure are nanoparticles with an average characteristic dimension of less than about 500 nm, 400 nm, 300 nm, 250 nm, 200 nm, 180 nm, 150 nm, 120 nm, 100 nm, 90 nm, 80 nm, 70 nm, 60 nm, 50 nm, 40 nm, 30 nm, or 20 nm. In other embodiments, the nanoparticles have an average characteristic dimension of 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 120 nm, 150 nm, 180 nm, 200 nm, 250 nm, or 300 nm. In further embodiments, the nanoparticles are 10 to 500 nm, 10 to 400 nm, 10 to 300 nm, 10 to 250 nm, 10 to 200 nm, 10 to 150 nm, 10 to 100 nm, 10 to 75 nm, 10 to 50 nm, 50 to 500 nm, 50 to 400 nm, 50 to 300 nm, 50 to 200 nm, 50 to 150 nm, 50 to 100 nm, 50 to 75 nm, 100 to 500 nm, 100 to 400 nm, 100-300 nm, 100-250 nm, 100-200 nm, 100-150 nm, 150-500 nm, 150-400 nm, 150-300 nm, 150-250 nm, 150-200 nm, 200-500 nm, 200-400 nm, 200-300 nm, 200-250 nm, 200-500 nm, 200-400 nm or 200-300 nm.

[0472] therapeutic agent

[0473] In some embodiments, the delivery system of the present disclosure is administered with one or more additional therapeutic agents. In some embodiments, the additional therapeutic agent may be a steroid, an anti-inflammatory drug, an antibody, a fusion protein, a small molecule, or a combination thereof. In some embodiments, the additional therapeutic agent is incorporated into a delivery system of the present disclosure comprising at least one isolated oligonucleotide targeting a CFB as disclosed herein. In some embodiments, the additional therapeutic agent is conjugated, complexed, or encapsulated with one or more lipids or polymers of the delivery system. The additional therapeutic agent may be encapsulated in the hollow core of the delivery system. Alternatively, the additional therapeutic agent may be incorporated into the lipid- or polymer-based shell of the delivery system, for example, by intercalation. Alternatively, the additional therapeutic agent may be attached to the surface of the delivery system. In some embodiments, the additional therapeutic agent is conjugated to one or more lipids or polymers of the delivery system, for example, via a covalent bond.

[0474] In some embodiments, the additional therapeutic agent and the delivery system comprising at least one isolated oligonucleotide targeting CFB disclosed herein are formulated in the same composition. For example, the delivery system comprising at least one isolated oligonucleotide targeting CFB disclosed herein and the additional therapeutic agent can be formulated in the same pharmaceutical composition.

[0475] In some embodiments, the delivery systems comprising the additional therapeutic agent and at least one isolated oligonucleotide targeting CFB disclosed herein are formulated as separate compositions, e.g., for separate administration to a subject.

[0476] Pharmaceutical Composition

[0477] The present disclosure also provides a pharmaceutical composition comprising at least one oligonucleotide disclosed herein, a vector of the present disclosure encoding at least one isolated oligonucleotide disclosed herein, or a delivery system of the present disclosure, and a pharmaceutically acceptable carrier, diluent, or excipient.

[0478] Pharmaceutical compositions of the present disclosure can optionally include a therapeutic agent, a pharmaceutical agent, a carrier, an adjuvant, a dispersing agent, a diluent, etc. In some embodiments, the pharmaceutical composition includes a therapeutic agent, such as a chemotherapeutic agent. In some embodiments, the therapeutic agent is formulated in a delivery system that includes one or more isolated oligonucleotides (e.g., dsRNA or siRNA) targeting a CFB of the present disclosure.

[0479] In some embodiments, the additional therapeutic agent is not formulated in a delivery system comprising one or more isolated oligonucleotides (e.g., dsRNA or siRNA) targeting a CFB of the present disclosure, but both the delivery system and the therapeutic agent are formulated in the same pharmaceutical composition. In some embodiments, the additional therapeutic agent is not formulated in a delivery system comprising one or more isolated oligonucleotides (e.g., dsRNA or siRNA) targeting a CFB of the present disclosure, and the delivery system and the therapeutic agent are formulated in separate pharmaceutical compositions.

[0480] Pharmaceutical compositions of the present disclosure can con...

Claims

1. 1. An isolated oligonucleotide comprising a sense strand and an antisense strand, The sense strand is from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1 to a) 493-534; b) 991-1054; c) 1384-1500; d) 1606-1686; e) 1821-1881; f) 2116-2307; and g) 2382-2468 a nucleotide sequence substantially identical to a region comprising 19 to 25 nucleotides between any one nucleotide position selected from and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region. Isolated oligonucleotides.

2. The sense strand is from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1 a) 493-534; b) 991-1054; c) 1384-1500; d) 1606-1686; e) 1821-1881; f) 2116-2307; and g) 2382-2468 2. The isolated oligonucleotide of claim 1, comprising a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising 19 to 25 nucleotides between any one nucleotide position selected from:

3. the sense strand is from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1 to a) 493-534; b) 991-1054; c) 1384-1500; d) 1606-1686; e) 1821-1881; f) 2116-2307; and g) 2382-2468 2. The isolated oligonucleotide of claim 1, comprising a nucleotide sequence identical to a region comprising 19 to 25 nucleotides between any one nucleotide position selected from:

4. the sense strand is from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1 to a) 503 to 523; and b) 2190-2210 4. The isolated oligonucleotide of claim 1, comprising a nucleotide sequence substantially identical to a region between any one nucleotide position selected from:

5. the sense strand is from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1 to a) 503 to 523; and b) 2190-2210 5. The isolated oligonucleotide of claim 4, comprising a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region between any one nucleotide position selected from:

6. the sense strand is from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1 to a) 503 to 523; and b) 2190-2210 5. The isolated oligonucleotide of claim 4, comprising a nucleotide sequence identical to a region between any one nucleotide position selected from:

7. the sense strand is from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1 to a) 493-534; b) 991-1054; c) 1384-1500; d) 1666-1686; e) 1821-1881; f) 2116-2136; g) 2232-2307; and h) 2394-2468 4. The isolated oligonucleotide of claim 1, comprising a nucleotide sequence substantially identical to a region between any one nucleotide position selected from:

8. the sense strand is from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1 to a) 493-534; b) 991-1054; c) 1384-1500; d) 1666-1686; e) 1821-1881; f) 2116-2136; g) 2232-2307; and h) 2394-2468 8. The isolated oligonucleotide of claim 7, comprising a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region between any one nucleotide position selected from:

9. the sense strand is from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1 to a) 493-534; b) 991-1054; c) 1384-1500; d) 1666-1686; e) 1821-1881; f) 2116-2136; g) 2232-2307; and h) 2394-2468 8. The isolated oligonucleotide of claim 7, comprising a nucleotide sequence identical to a region between any one nucleotide position selected from:

10. the sense strand is from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1 to a) 995-1019; b) 1606-1626; c) 1860-1880; and d) 2382-2402 4. The isolated oligonucleotide of claim 1, comprising a nucleotide sequence substantially identical to a region between any one nucleotide position selected from:

11. the sense strand is from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1 to a) 995-1019; b) 1606-1626; c) 1860-1880; and d) 2382-2402 11. The isolated oligonucleotide of claim 10, comprising a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region between any one nucleotide position selected from:

12. the sense strand is from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1 to a) 995-1019; b) 1606-1626; c) 1860-1880; and d) 2382-2402 11. The isolated oligonucleotide of claim 10, comprising a nucleotide sequence identical to a region between any one nucleotide position selected from:

13. 13. The isolated oligonucleotide of any one of claims 1 to 12, wherein the isolated oligonucleotide is capable of inducing degradation of CFB mRNA.

14. The isolated oligonucleotide of any one of claims 1 to 13, wherein either the sense strand or the antisense strand is a single-stranded RNA molecule.

15. The isolated oligonucleotide of any one of claims 1 to 13, wherein both the sense strand and the antisense strand are single-stranded RNA molecules.

16. 16. The isolated oligonucleotide of any one of claims 1 to 15, wherein the antisense strand comprises a 3' overhang.

17. 17. The isolated oligonucleotide of claim 16, wherein the 3' overhang comprises at least one nucleotide.

18. 18. The isolated oligonucleotide of any one of claims 1 to 17, wherein the sense strand comprises an RNA sequence of at least 20 nucleotides in length.

19. 19. The isolated oligonucleotide of any one of claims 1 to 18, wherein the antisense strand comprises an RNA sequence at least 22 nucleotides in length.

20. 20. The isolated oligonucleotide of any one of claims 1 to 19, wherein the double-stranded region is 19 to 21 nucleotides in length.

21. 21. The isolated oligonucleotide of any one of claims 1 to 20, wherein the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2 to 35.

22. 22. The isolated oligonucleotide of any one of claims 1 to 21, wherein the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 36 to 69.

23. the double-stranded region i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5'UAUAGCAGUGGAAAGAGAUCUC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5'GAUCUCUUUCCACUGCUAUA3'); or ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5'UAAGUAUUGGGGUCAGCAUAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5'UAUGCUGACCCCAAUACUUA 3') 7. The isolated oligonucleotide of claim 6, comprising:

24. the double-stranded region i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5'UAAAGAGAUCUCAUCACUCACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5'UGAGUGAUGAGAUCUCUUUA3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UGGAAAGAGAUCUCAUCACUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'AGUGAUGAGAUCUCUUUCCA3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5'UCAGUGGAAAGAGAUCUCAUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5'AUGAGAUCUCUUUCCACUGA3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5'UGUGUAACCGUCAUAGCAGUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 389 (5'ACUGCUAUGACGGUUACACA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5'UUUGACUAGACACUUUUUGGCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5'CCAAAAGUGUCUAGUCAAA3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5'UAAUUAAGUUGACUAGACACUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5'GUGUCUAGUCAACUUAAUUA3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5'UAUAUCUUGGCUUCACACCAUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5'UGGUGUGAAGCCAAGAUAUA 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5'UUAGACAUCCAGAUAAUCCUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5'AGGAUUAUCUGGAUGUCUAA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5'UAAGCAUUGAUGUUCACUUGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5'CAAGUGAACAUCAAUGCUUA3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5'UAAAGCAUUGAUGUUCACUUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5'AAGUGAACAUCAAUGCUUUA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5'UAACACAUGUUGCUCAUUGUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5'ACAAUGAGCAACAUGUGUUA3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UUUGACUUUGAACACAUGUUGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5'AACAUGUGUUCAAAGUCAAA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5'UAUAUCCUUGACUUUGAACACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5'UGUUCAAAGUCAAGGAUAUA3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5'UAAGUACUCAGACACCACAGCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5'CUGUGGGUGUCUGAGUACUUA3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5'UAUUCAGGAAUUCCUGCUUCUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5'GAAGCAGGAAUUCCUGAAUA3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5'UAAUUCAGGAAUUCCUGCUUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'AAGCAGGAAUUCCUGAAUUA3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5'UUAAAAUUCAGGAAUUCCUGCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5'CAGGAAUUCCUGAAUUUUAA3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5'UAUAAAAUUCAGGAAUUCCUGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5'AGGAAUUCCUGAAUUUUAUA3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5'UGUCAUAAAAUUCAGGAAUUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAUUCCUGAAUUUUAUGACA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5'UUUAUUCUUGAGCUUGAUCAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5'UGAUCAAGCUCAAGAAUAAA 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5'UUUGACUUUGUCAUAGCCUGGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5'CAGGCUAUGACAAAGUCAAA 3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5'UUUCUCUUGUGAACUAUCAAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 63 (5'UUGAUAGUUCACAAGAGAAA 3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UAAACGACUUCUCUUGUGAACU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5'UUCACAAGAGAAGUCGUUUA 3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5'UUUUUUGCAGACAUCCACUACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5'UAGUGGAUGUCUGCAAAAAA3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5'UAACCCAAAUCCUCAUCUUGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5'CAAGAUGAGGAUUUGGGUUA 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5'UAAAACCCAAAUCCUCAUCUUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5'AAGAUGAGGAUUUGGGUUUA 3'); or xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAGCUGUUUUAAUUCAAUCCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5'GAUUGAAUUAAAACAGCUGA3') 10. The isolated oligonucleotide of claim 9, comprising:

25. the double-stranded region i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5'UUAAGUUGACUAGACACUUUUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5'AAAGUGUCUAGUCAACUUAA3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5'UCAAUUAAGUUGACUAGACACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5'UGUCUAGUCAACUUAAUUGA3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5'UGAGAUCUUGGCCUGCCAUGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5'CAUGGCAGGCCAAGAUCUCA3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5'UUAUUCUUGAGCUUGAUCAGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5'CUGAUCAAGCUCAAGAAUAA3'); or v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5'UCAUCUUGGAGUUUCUCCUUCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 66 (5'AAGGAGAAACUCCAAGAUGA 3') 13. The isolated oligonucleotide of claim 12, comprising:

26. 26. The isolated oligonucleotide of any one of claims 1 to 25, wherein the isolated oligonucleotide attenuates expression of the CFB mRNA by at least 50% at a dose of 0.1 nM.

27. the double-stranded region i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5'UAAAGAGAUCUCAUCACUCACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5'UGAGUGAUGAGAUCUCUUUA3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UGGAAAGAGAUCUCAUCACUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'AGUGAUGAGAUCUCUUUCCA3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5'UCAGUGGAAAGAGAUCUCAUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5'AUGAGAUCUCUUUCCACUGA3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5'UGUGUAACCGUCAUAGCAGUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 389 (5'ACUGCUAUGACGGUUACACA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5'UUUGACUAGACACUUUUUGGCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5'CCAAAAGUGUCUAGUCAAA3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5'UAAUUAAGUUGACUAGACACUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5'GUGUCUAGUCAACUUAAUUA3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5'UAUAUCUUGGCUUCACACCAUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5'UGGUGUGAAGCCAAGAUAUA 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5'UUAGACAUCCAGAUAAUCCUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5'AGGAUUAUCUGGAUGUCUAA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5'UAAGCAUUGAUGUUCACUUGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5'CAAGUGAACAUCAAUGCUUA3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5'UAAAGCAUUGAUGUUCACUUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5'AAGUGAACAUCAAUGCUUUA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5'UAACACAUGUUGCUCAUUGUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5'ACAAUGAGCAACAUGUGUUA3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UUUGACUUUGAACACAUGUUGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5'AACAUGUGUUCAAAGUCAAA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5'UAUAUCCUUGACUUUGAACACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5'UGUUCAAAGUCAAGGAUAUA3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5'UAAGUACUCAGACACCACAGCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5'CUGUGGGUGUCUGAGUACUUA3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5'UAUUCAGGAAUUCCUGCUUCUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5'GAAGCAGGAAUUCCUGAAUA3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5'UAAUUCAGGAAUUCCUGCUUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'AAGCAGGAAUUCCUGAAUUA3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5'UUAAAAUUCAGGAAUUCCUGCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5'CAGGAAUUCCUGAAUUUUAA3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5'UAUAAAAUUCAGGAAUUCCUGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5'AGGAAUUCCUGAAUUUUAUA3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5'UGUCAUAAAAUUCAGGAAUUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAUUCCUGAAUUUUAUGACA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5'UUUAUUCUUGAGCUUGAUCAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5'UGAUCAAGCUCAAGAAUAAA 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5'UUUGACUUUGUCAUAGCCUGGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5'CAGGCUAUGACAAAGUCAAA 3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5'UUUCUCUUGUGAACUAUCAAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 63 (5'UUGAUAGUUCACAAGAGAAA 3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UAAACGACUUCUCUUGUGAACU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5'UUCACAAGAGAAGUCGUUUA 3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5'UUUUUUGCAGACAUCCACUACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5'UAGUGGAUGUCUGCAAAAAA3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5'UAACCCAAAUCCUCAUCUUGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5'CAAGAUGAGGAUUUGGGUUA 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5'UAAAACCCAAAUCCUCAUCUUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5'AAGAUGAGGAUUUGGGUUUA 3'); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAGCUGUUUUAAUUCAAUCCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5'GAUUGAAUUAAAACAGCUGA3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5'UUAAGUUGACUAGACACUUUUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5'AAAGUGUCUAGUCAACUUAA3'); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5'UCAAUUAAGUUGACUAGACACU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5'UGUCUAGUCAACUUAAUUGA 3'); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5'UGAGAUCUUGGCCUGCCAUGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5'CAUGGCAGGCCAAGAUCUCA3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5'UUAUUCUUGAGCUUGAUCAGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5'CUGAUCAAGCUCAAGAAUAA3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5'UCAUCUUGGAGUUUCUCCUCCUUCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 66 (5'AAGGAGAAACUCCAAGAUGA 3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5'UAUAGCAGUGGAAAGAGAUCUC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5'GAUCUCUUUCCACUGCUAUA3'); or xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5'UAAGUAUUGGGGUCAGCAUAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5'UAUGCUGACCCCAAUACUUA 3') 27. The isolated oligonucleotide of claim 26, comprising:

28. 26. The isolated oligonucleotide of any one of claims 1 to 25, wherein the isolated oligonucleotide attenuates expression of the CFB mRNA by at least 50% at a dose of 0.02 nM.

29. the double-stranded region i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5'UAAAGAGAUCUCAUCACUCACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5'UGAGUGAUGAGAUCUCUUUA3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UGGAAAGAGAUCUCAUCACUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'AGUGAUGAGAUCUCUUUCCA3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5'UCAGUGGAAAGAGAUCUCAUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5'AUGAGAUCUCUUUCCACUGA3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5'UGUGUAACCGUCAUAGCAGUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 389 (5'ACUGCUAUGACGGUUACACA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5'UAAUUAAGUUGACUAGACACUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5'GUGUCUAGUCAACUUAAUUA3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5'UUAGACAUCCAGAUAAUCCUCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5'AGGAUUAUCUGGAUGUCUAA3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5'UAAGCAUUGAUGUUCACUUGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5'CAAGUGAACAUCAAUGCUUA3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5'UAAAGCAUUGAUGUUCACUUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5'AAGUGAACAUCAAUGCUUUA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5'UUAAAAUUCAGGAAUUCCUGCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5'CAGGAAUUCCUGAAUUUUAA3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5'UAUAAAAUUCAGGAAUUCCUGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5'AGGAAUUCCUGAAUUUUAUA3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5'UGUCAUAAAAUUCAGGAAUUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAUUCCUGAAUUUUAUGACA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UAAACGACUUCUCUUGUGAACU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5'UUCACAAGAGAAGUCGUUUA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5'UAAAACCCAAAUCCUCAUCUUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5'AAGAUGAGGAUUUGGGUUUA 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAGCUGUUUUAAUUCAAUCCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5'GAUUGAAUUAAAACAGCUGA3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5'UAUAGCAGUGGAAAGAGAUCUC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5'GAUCUCUUUCCACUGCUAUA3'); or xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5'UAAGUAUUGGGGUCAGCAUAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5'UAUGCUGACCCCAAUACUUA 3') 29. The isolated oligonucleotide of claim 28, comprising:

30. 26. The isolated oligonucleotide of claim 25, wherein the isolated oligonucleotide attenuates expression of the CFB mRNA by 20% to 50% at a dose of 0.02 nM.

31. the double-stranded region i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5'UUAAGUUGACUAGACACUUUUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5'AAAGUGUCUAGUCAACUUAA3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5'UCAAUUAAGUUGACUAGACACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5'UGUCUAGUCAACUUAAUUGA3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5'UGAGAUCUUGGCCUGCCAUGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5'CAUGGCAGGCCAAGAUCUCA3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5'UUAUUCUUGAGCUUGAUCAGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5'CUGAUCAAGCUCAAGAAUAA3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5'UCAUCUUGGAGUUUCUCCUCCUUCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 66 (5'AAGGAGAAACUCCAAGAUGA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5'UUUUUUGCAGACAUCCACUACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5'UAGUGGAUGUCUGCAAAAAA3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5'UAACCCAAAUCCUCAUCUUGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5'CAAGAUGAGGAUUUGGGUUA 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5'UUUAUUCUUGAGCUUGAUCAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5'UGAUCAAGCUCAAGAAUAAA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5'UUUGACUUUGUCAUAGCCUGGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5'CAGGCUAUGACAAAGUCAAA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5'UUUCUCUUGUGAACUAUCAAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 63 (5'UUGAUAGUUCACAAGAGAAA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5'UAACACAUGUUGCUCAUUGUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5'ACAAUGAGCAACAUGUGUUA3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UUUGACUUUGAACACAUGUUGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5'AACAUGUGUUCAAAGUCAAA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5'UAUAUCCUUGACUUUGAACACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5'UGUUCAAAGUCAAGGAUAUA3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5'UAAGUACUCAGACACCACAGCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5'CUGUGGGUGUCUGAGUACUUA3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5'UAUUCAGGAAUUCCUGCUUCUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5'GAAGCAGGAAUUCCUGAAUA3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5'UAAUUCAGGAAUUCCUGCUUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'AAGCAGGAAUUCCUGAAUUA3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5'UUUGACUAGACACUUUUUGGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5'CCAAAAGUGUCUAGUCAAA 3'); or xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5'UAUAUCUUGGCUUCACACCAUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5'UGGUGUGAAGCCAAGAUAUA 3') 31. The isolated oligonucleotide of claim 30, comprising:

32. 1. An isolated oligonucleotide comprising a sense strand and an antisense strand, The sense strand is from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1 a) 5-38; b) 340-606; c) 776-828; d) 939-1227; e) 1305-1606; f) 1667-1746; g) 1815-2313; and h) 2378-2417 a nucleotide sequence substantially identical to a region comprising 19 to 25 nucleotides between any one nucleotide position selected from and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region. Isolated oligonucleotides.

33. 33. The isolated oligonucleotide of claim 32, wherein the isolated oligonucleotide attenuates expression of the CFB mRNA by 20% to 50% at a dose of 0.1 nM.

34. the double-stranded region i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 94 (5'UGACACUUUUUGGCUCCUGUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 204 (5'ACAGGAGCCAAAAGUGUCA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 124 (5'UAUGUUGCUCAUUGUCUUUCUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 234 (5'GAAAGACAAUGAGCAACAUA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 169 (5'UCUCUUGUGAACUAUCAAGGGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 279 (5'CCUUGAUAGUUCACAAGAGA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 87 (5'UGUACAUGAAGGAGUCUUGGCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 197 (5'CCAAGACUCCUUCAUGUACA3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 163 (5'UGUCAGCAUAGGGACUCACUCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 273 (5'AGUGAGUCCCUAUGCUGACA3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 104 (5'UCUUCAACUUGUGGUCUUCAUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 214 (5'UGAAGACCACAAGUUGAAGA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 121 (5'UCUCAUUGUCUUUCUUGGAAGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 231 (5'UUCCAAGAAAGACAAUGAGA 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 99 (5'UUUCUCAAUUAAGUUGACCUAGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 209 (5'UAGUCAACUUAAUUGAGAAA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 155 (5'UCUCUCUCUCACAGCUGCCUUUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 265 (5'AAAGGCAGCUGUGAGAGAGA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 144 (5'UCUUAUUCUUGAGCUUGAUCAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 254 (5'GAUCAAGCUCAAGAAUAAGA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 136 (5'UCUGACCUUGAUUGAGUGUUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 246 (5'AACACUCAAUCAAGGUCAGA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 76 (5'UGGAUUGCUCUGCACUCUGCCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 186 (5'GCAGAGUGCAGAGCAAUCCA3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 134 (5'UAACAAUGUGCUGCUGUCAGCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 244 (5'CUGACAGCAGCACAUUGUUA3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 158 (5'UAUUGAGCAUCUCUCUCUCACAGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 268 (5'UGUGAGAGAGAGAUGCUCAAUA 3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 153 (5'UCAUUCUUGAUGUAGACCUCCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 263 (5'GAGGUCUACAUCAAGAAUGA3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 73 (5'UGAAACUCCAGACCUAGACCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 183 (5'GGUCUAGGUCUGGAGUUUCA 3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 152 (5'UCUUGAUGUAGACCUCCUUCCG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 262 (5'GAAGGAGGUCUACAUCAAGA3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 147 (5'UCAGAGCUUUGAUAUCCUGUGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 257 (5'ACAGGAUAUCAAAGCUCUGA3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 101 (5'UCAUAACUUGCCACCUUCUCAA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 211 (5'GAGAAGGUGGGCAAGUUAUGA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 174 (5'UUUCUGGUUUUUGCAGACAUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 284 (5'AUGUCUGCAAAACCAGAAA 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 118 (5'UUUUCUUGGAAGCCAAAGCAUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 228 (5'UGCUUUGGCUUCCAAGAAAA 3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 149 (5'UAAACAGAGCUUUGAUAUCCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 259 (5'GGAUAUCAAAGCUCUGUUUA 3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 95 (5'UGACUAGACACUUUUUGGCUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 205 (5'AGCCAAAAGUGUCUAGUCA 3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 142 (5'UUUCUUGAGCUUGAUCAGGGCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 252 (5'CCCUGAUCAAGCUCAAGAAA3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 160 (5'UCAUAUUGAGCAUCUCUCUUCACAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 270 (5'GAGAGAGAUGCUCAAUAUGA 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 164 (5'UGUAUUGGGGUCAGCAUAGGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 274 (5'CCUAUGCUGACCCCAAUACA 3'); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 74 (5'UUGAAACUCCAGACCUAGACCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 184 (5'GUCUAGGUCUGGAGUUUCAA3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 91 (5'UAUCCAUCUAGCACCAGGUAGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 201 (5'UACCUGGUGCUAGAUGGAUA 3'); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 167 (5'UGUGAACUAUCAAGGGGCCGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 277 (5'CGGCCCCUUGAUAGUUCACA 3'); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 175 (5'UUUGGAGUUUCUCCUCCUUCAGCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 285 (5'GCUGAAGGAGAAACUCCAAA 3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 72 (5'UAAACUCCAGACCUAGACCUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 182 (5'AGGUCUAGGUCUGGAGUUUA 3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 119 (5'UCUUUCUUGGAAGCCAAAGCAU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 229 (5'GCUUUGGCUUCCAAGAAAGA3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 154 (5'UCUUUCUUAUCCCCAUUCUUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 264 (5'AAGAAUGGGGAUAAGAAAGA 3'); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 70 (5'UCUAGACCUGGUCACAUUCCCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 180 (5'GGAAUGUGACCAGGUCUAGA3'); xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 92 (5'UCUGUCUGAUCCAUCUAGCACC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 202 (5'UGCUAGAUGGAUCAGACAGA 3'); xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 116 (5'UCAAAGCAUUGAUGUUCACUUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 226 (5'AGUGAACAUCAAUGCUUUGA 3'); xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 84 (5'UGAGAGUGUAACCGUCAUAGCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 194 (5'CUAUGACGGUUACACUCUCA 3'); xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 89 (5'UGUCGUACAUGAAGGAGUCUUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 199 (5'AGACUCCUUCAUGUACGACA 3'); xxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 83 (5'UGAGUGUAACCGUCAUAGCAGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 193 (5'UGCUAUGACGGUUACACUCA 3'); xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 107 (5'UUAAUUGGGUCCCCCGCCCAUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 217 (5'AUGGGCGGGGACCCAAUUAA 3'); xLi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 100 (5'UAUAACUUGCCACCUUCUCAAU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 210 (5'UGAGAAGGUGGCAAGUUAUA3'); xLii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 157 (5'UUUGAGCAUCUCUCUCUCACAGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 267 (5'CUGUGAGAGAGAUGCUCAAA 3'); xLiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 77 (5'UCUCACAUUGUAGUAGGGAGAC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 187 (5'CUCCCUACUACAAUGUGAGA3'); xLiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 105 (5'UGACUUCAACUUGUGGUCUUCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 215 (5'AAGACCACAAGUUGAAGUCA 3'); xLv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 130 (5'UCAGGUUUUCCAUAUCCUUGAC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 240 (5'CAAGGAUAUGGAAAACCUGA3'); xLvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 166 (5'UAACUAUCAAGGGGGCCGCCAGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 276 (5'UGGCGGCCCCCUUGAUAGUUA 3'); xLvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 131 (5'UCACAGAGACUCAGAGACUGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 241 (5'CAGUCUCUGAGUCUCUGUGA 3'); xLviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 127 (5'UCUUUGAACACAUGUUGCUCAU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 237 (5'GAGCAACAUGUGUUCAAAGA 3'); xLix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 111 (5'UAUCAAUGACAGUAAUUGGGUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 221 (5'CCCAAUUACUGUCAUUGAUA 3'); L) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 93 (5'UCUUUUUGGCUCCUGUGAAGUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 203 (5'CUUCACAGGAGCCAAAAGA 3'); or Li) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 71 (5'UAACUCCAGACCUAGACCUGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 181 (5'CAGGUCUAGGUCUGGAGUUA3') 34. The isolated oligonucleotide of claim 33, comprising:

35. 33. The isolated oligonucleotide of claim 32, wherein the isolated oligonucleotide attenuates expression of the CFB mRNA by at least 50% at a dose of 0.1 nM.

36. the double-stranded region i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 171 (5'UAUGAAACGACUUCUCUUGUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 281 (5'ACAAGAGAAGUCGUUUCAUA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 165 (5'UAUCACCUCUGCAAGUAUUGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 275 (5'CAAUACUUGCAGAGGUGAUA3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 129 (5'UUUUCCAUAUCCUUGACUUUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 239 (5'AAAGUCAAGGAUAUGGAAA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 176 (5'UAUCUUGGAGUUUCUCCUUCAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 286 (5'GAAGGAGAAACUCCAAGAUA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 177 (5'UCUCAUCUUGGAGUUUCUCCUCCUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 287 (5'GGAGAAACUCCAAGAUGAGA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 138 (5'UCAUAAAAUUCAGGAAUUCCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 248 (5'GGAAUUCCUGAAUUUUAUGA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 140 (5'UGUCAUAGUCAUAAAAUUCAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 250 (5'UGAAUUUUAUGACUAUGACA 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 148 (5'UAACAGAGCUUUGAUAUCCUGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 258 (5'AGGAUAUCAAAGCUCUGUUA3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 150 (5'UCAAACAGAGCUUUGAUAUCCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 260 (5'GAUAUCAAAGCUCUGUUUGA3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 179 (5'UGAAAACCCAAAUCCUCAUCUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 289 (5'GAUGAGGAUUUGGGUUUUCA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5'UAAAGCUUCGGCCACCUCUUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 200 (5'AAGAGGUGGCCGAAGCUUUA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 172 (5'UUUUUGCAGACAUCCACUACUC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 282 (5'GUAGUGGAUGUCUGCAAAA3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 88 (5'UCGUACAUGAAGGAGUCUUGGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 198 (5'CAAGACUCCUUCAUGUACGA3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 168 (5'UUUGUGAACUAUCAAGGGGCCG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 278 (5'GCCCCUUGAUAGUUCACAAA3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 81 (5'UGUGGAAAGAGAUCUCAUCACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 191 (5'UGAUGAGAUCUCUUUCCACA3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 159 (5'UAUAUUGAGCAUCUCUCUCUCACA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 269 (5'UGAGAGAGAUGCUCAAUAUA 3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 82 (5'UCAUAGCAGUGGAAAGAGAUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 192 (5'AUCUCUUUCCACUGCUAUGA 3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 97 (5'UUUAAGUUGACUAGACACUUUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 207 (5'AAGUGUCUAGUCAACUUAAA 3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 132 (5'UUUGCUUGUGGUAAUCGGUACC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 242 (5'UACCGAUUACCACAAGCAAA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 123 (5'UGUUGCUCAUUGUCUUUCUUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 233 (5'AAGAAAGACAAUGAGCAACA 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 126 (5'UUUUGAACACAUGUUGCUCAUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 236 (5'UGAGCAACAUGUGUUCAAAA 3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 162 (5'UGAGAUGUCCUUGACUUUGUCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 272 (5'ACAAAGUCAAGGACAUCUCA 3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 79 (5'UCAUCACUCACAUUGUAGUAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 189 (5'UACUACAAUGUGAGUGAUGA 3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 151 (5'UCAGACACAAACAGAGCUUUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 261 (5'AAAGCUCUGUUUGUGUCUGA 3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 143 (5'UAUUCUUGAGCUUGAUCAGGGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 253 (5'CCUGAUCAAGCUCAAGAAUA3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 117 (5'UAAGCCAAAGCAUUGAUGUUCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 227 (5'AACAUCAAUGCUUUGGCUUA 3'); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 133 (5'UAAAGUACUCAGACACCACAGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 243 (5'UGUGGUGUCUGAGUACUUUA 3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 122 (5'UUUGCUCAUUGUCUUUCUUGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 232 (5'CAAGAAAGACAAUGAGCAAA 3'); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5'UCAAUGACAGUAAUUGGGUCCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 220 (5'GACCCAAUUACUGUCAUUGA3'); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 173 (5'UGUUUUUGCAGACAUCCACUAC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 283 (5'AGUGGAUGUCUGCAAAAAACA3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 156 (5'UGAGCAUCUCUCUCUCACAGCUGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 266 (5'AGCUGUGAGAGAGAUGCUCA 3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 141 (5'UCUUGAUCAGGGCAACGUCAUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 251 (5'UGACGUUGCCCUGAUCAAGA 3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 135 (5'UCUUGAUUGAGUGUUCCUUGUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 245 (5'CAAGGAACACUCAAUCAAGA 3'); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 170 (5'UGACUUCUCUUGUGAACUAUCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 280 (5'AUAGUUCACAAGAGAAGUCA 3'); xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 178 (5'UAAUCCUCAUCUUGGAGUUUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 288 (5'AAACUCCAAGAUGAGGAUUA 3'); xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 114 (5'UAUAGACAUCCAGAUAAUCCUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 224 (5'GGAUUAUCUGGAUGUCUAUA 3'); xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 139 (5'UCAUAGUCAUAAAAUUCAGGAA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 249 (5'CCUGAAUUUUAUGACUAUGA 3'); xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 125 (5'UCAUGUUGCUCAUUGUCUUUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 235 (5'AAAGACAAUGAGCAACAUGA 3'); xxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 145 (5'UGAGACAAAUGGGCCUGAUAGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 255 (5'UAUCAGGCCCAUUUGUCUCA 3'); xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 113 (5'UCUCAUCAAUGACAGUAAUUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 223 (5'AAUUACUGUCAUUGAUGAGA 3'); xLi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 120 (5'UGUCUUUCUUGGAAGCCAAAGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 230 (5'UUUGGCUUCCAAGAAAGACA3'); xLii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 75 (5'UGAUCUGCAGGUACGUGUCUGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 185 (5'AGACACGUACCUGCAGAUCA 3'); xLiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 112 (5'UCAUCAAUGACAGUAAUUGGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 222 (5'CCAAUUACUGUCAUUGAUGA 3'); xLiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 108 (5'UAUGACAGUAAUUGGGUCCCCG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 218 (5'GGGACCCAAUUACUGUCAUA3'); xLv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 128 (5'UGACUUUGAACACAUGUUGCUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 238 (5'GCAACAUGUGUUCAAAGUCA 3'); xLvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 161 (5'UCUUGACUUUGUCAUAGCCUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 271 (5'AGGCUAUGACAAAGUCAAGA 3'); xLvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 85 (5'UUUGUCACAGAUCGCUGUCUGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 195 (5'AGACAGCGAUCUGUGACAAA 3'); xLviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 137 (5'UGAAUUCCUGCUUCUUUUUUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 247 (5'AAAAAAGAAGCAGGAAUUCA 3'); xLix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 80 (5'UGAAAGAGAUCUCAUCACUCACAC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 190 (5'GAGUGAUGAGAUCUCUUUCA3'); L) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 115 (5'UCAUAGACAUCCAGAUAAUCCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 225 (5'GAUUAUCUGGAUGUCUAUGA3'); Li) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 96 (5'UGUUGACUAGACACUUUUUGGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 206 (5'CAAAAGUGUCUAGUCAACA3'); Lii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 146 (5'UAAGUGGUAGUUGGAGGAAGCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 256 (5'CUUCCUCCAACUACCACUUA3'); Liii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 78 (5'UAUCACUCACAUUGUAGUAGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 188 (5'CUACUACAAUGUGAGUGAUA3'); Liv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 103 (5'UUUCACACCAUAACUUGCCACC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 213 (5'UGGCAAGUUAUGGUGUGAAA3'); Lv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 102 (5'UCACCAUAACUUGCCACCUUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 212 (5'AAGGUGGCAAGUUAUGGUGA3'); Lvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 109 (5'UAAUGACAGUAAUUGGGUCCCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 219 (5'GGACCCAAUUACUGUCAUUA3'); Lvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 86 (5'UCAUGAAGGAGUCUUGGCAGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 196 (5'CUGCCAAGACUCCUUCAUGA 3'); Lviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 106 (5'UCUCAUCAUGCUGUACACUGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 216 (5'CAGUGUACAGCAUGAUGAGA 3'); or Lix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 98 (5'UCUCAAUUAAGUUGACUAGACA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 208 (5'UCUAGUCAACUUAAUUGAGA 3') 36. The isolated oligonucleotide of claim 35, comprising:

37. 33. The isolated oligonucleotide of claim 32, wherein the isolated oligonucleotide attenuates expression of the CFB mRNA by 20% to 50% at a dose of 0.02 nM.

38. the double-stranded region i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 165 (5'UAUCACCUCUGCAAGUAUUGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 275 (5'CAAUACUUGCAGAGGUGAUA3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 129 (5'UUUUCCAUAUCCUUGACUUUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 239 (5'AAAGUCAAGGAUAUGGAAA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 176 (5'UAUCUUGGAGUUUCUCCUUCAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 286 (5'GAAGGAGAAACUCCAAGAUA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 177 (5'UCUCAUCUUGGAGUUUCUCCUCCUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 287 (5'GGAGAAACUCCAAGAUGAGA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 138 (5'UCAUAAAAUUCAGGAAUUCCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 248 (5'GGAAUUCCUGAAUUUUAUGA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 140 (5'UGUCAUAGUCAUAAAAUUCAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 250 (5'UGAAUUUUAUGACUAUGACA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 148 (5'UAACAGAGCUUUGAUAUCCUGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 258 (5'AGGAUAUCAAAGCUCUGUUA3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 150 (5'UCAAACAGAGCUUUGAUAUCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 260 (5'GAUAUCAAAGCUCUGUUUGA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 179 (5'UGAAAACCCAAAUCCUCAUCUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 289 (5'GAUGAGGAUUUGGGUUUUCA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5'UAAAGCUUCGGCCACCUCUUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 200 (5'AAGAGGUGGCCGAAGCUUUA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 172 (5'UUUUUGCAGACAUCCACUACUC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 282 (5'GUAGUGGAUGUCUGCAAAA3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 88 (5'UCGUACAUGAAGGAGUCUUGGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 198 (5'CAAGACUCCUUCAUGUACGA3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 168 (5'UUUGUGAACUAUCAAGGGGCCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 278 (5'GCCCCUUGAUAGUUCACAAA 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 81 (5'UGUGGAAAGAGAUCUCAUCACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 191 (5'UGAUGAGAUCUCUUUCCACA3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 159 (5'UAUAUUGAGCAUCUCUCUCUCACA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 269 (5'UGAGAGAGAUGCUCAAUAUA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 82 (5'UCAUAGCAGUGGAAAGAGAUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 192 (5'AUCUCUUUCCACUGCUAUGA 3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 97 (5'UUUAAGUUGACUAGACACUUUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 207 (5'AAGUGUCUAGUCAACUUAAA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 132 (5'UUUGCUUGUGGUAAUCGGUACC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 242 (5'UACCGAUUACCACAAGCAAA 3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 123 (5'UGUUGCUCAUUGUCUUUCUUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 233 (5'AAGAAAGACAAUGAGCAACA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 79 (5'UCAUCACUCACAUUGUAGUAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 189 (5'UACUACAAUGUGAGUGAUGA 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 117 (5'UAAGCCAAAGCAUUGAUGUUCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 227 (5'AACAUCAAUGCUUUGGCUUA 3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 122 (5'UUUGCUCAUUGUCUUUCUUGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 232 (5'CAAGAAAGACAAUGAGCAAA 3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5'UCAAUGACAGUAAUUGGGUCCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 220 (5'GACCCAAUUACUGUCAUUGA3'); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 135 (5'UCUUGAUUGAGUGUUCCUUGUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 245 (5'CAAGGAACACUCAAUCAAGA 3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 178 (5'UAAUCCUCAUCUUGGAGUUUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 288 (5'AAACUCCAAGAUGAGGAUUA 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 114 (5'UAUAGACAUCCAGAUAAUCCUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 224 (5'GGAUUAUCUGGAUGUCUAUA 3'); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 125 (5'UCAUGUUGCUCAUUGUCUUUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 235 (5'AAAGACAAUGAGCAACAUGA 3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 113 (5'UCUCAUCAAUGACAGUAAUUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 223 (5'AAUUACUGUCAUUGAUGAGA 3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 120 (5'UGUCUUUCUUGGAAGCCAAAGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 230 (5'UUUGGCUUCCAAGAAAGACA3'); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 75 (5'UGAUCUGCAGGUACGUGUCUGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 185 (5'AGACACGUACCUGCAGAUCA 3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 112 (5'UCAUCAAUGACAGUAAUUGGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 222 (5'CCAAUUACUGUCAUUGAUGA 3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 108 (5'UAUGACAGUAAUUGGGUCCCCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 218 (5'GGGACCCAAUUACUGUCAUA 3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 115 (5'UCAUAGACAUCCAGAUAAUCCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 225 (5'GAUUAUCUGGAUGUCUAUGA3'); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 102 (5'UCACCAUAACUUGCCACCUUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 212 (5'AAGGUGGCAAGUUAUGGUGA 3'); xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 109 (5'UAAUGACAGUAAUUGGGUCCCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 219 (5'GGACCCAAUUACUGUCAUUA3'); xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 106 (5'UCUCAUCAUGCUGUACACUGCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 216 (5'CAGUGUACAGCAUGAUGAGA3'); xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 98 (5'UCUCAAUUAAGUUGACUAGACA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 208 (5'UCUAGUCAACUUAAUUGAGA 3'); xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 124 (5'UAUGUUGCUCAUUGUCUUUCUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 234 (5'GAAAGACAAUGAGCAACAUA 3'); xxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 121 (5'UCUCAUUGUCUUUCUUGGAAGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 231 (5'UUCCAAGAAAGACAAUGAGA 3'); or xL) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 107 (5'UUAAUUGGGUCCCCCGCCCAUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 217 (5'AUGGGCGGGGACCCAAUUAA 3') 38. The isolated oligonucleotide of claim 37, comprising:

39. 33. The isolated oligonucleotide of claim 32, wherein said isolated oligonucleotide attenuates expression of said CFB mRNA by at least 50% at a dose of 0.02 nM.

40. 40. The isolated oligonucleotide of claim 39, wherein the double-stranded region comprises the antisense strand of a nucleic acid sequence according to SEQ ID NO: 171 (5'UAUGAAACGACUUCUCUUGUGA 3') and the sense strand of a nucleic acid sequence according to SEQ ID NO: 281 (5'ACAAGAGAAGUCGUUUCAUA 3').

41. 41. The isolated oligonucleotide of any one of claims 1 to 40, wherein the sense strand or the antisense strand or both comprise one or more modified nucleotides.

42. 42. The isolated oligonucleotide of claim 41, wherein the antisense strand comprises a monomethyl-protected phosphate mimic (5'-MeEP).

43. 43. The isolated oligonucleotide of any one of claims 1 to 42, wherein a terminal or internal nucleotide in the sense strand or the antisense strand or both is linked to a targeting ligand.

44. 44. The isolated oligonucleotide of claim 43, wherein the targeting ligand comprises at least one GalNAc Glb moiety.

45. The antisense strand has the formula: 3’(M) 0 (F) 0 (M) 6 (F) 1 (M) 1 (F) 1 (M) 3 (F) 1 (M) 2 (F) 1 (M) 1 (F) 1 (M) 1 (F) 2 (M) 1 5’ 45. The isolated oligonucleotide of any one of claims 1 to 44, comprising nucleotides modified with 2'-F modifications and nucleotides modified with 2'-O-methyl modifications according to

46. The sense strand has the formula: 5’(M) 0 (F) 0 (M) 5 (F) 1 (M) 1 (F) 4 (M) 9 3’ 46. ​​The isolated oligonucleotide of any one of claims 1 to 45, comprising nucleotides modified with 2'-F modifications and nucleotides modified with 2'-O-methyl modifications according to

47. The antisense strand is i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 370 (5'[MeEPmUs][fGs][fU][mC][fA][mU][fA][mA][mA][fA][mU][mU][mC][fA][mG][fG][mA][mA][mU][mUs][mCs][mC]3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 371 (5' [MeEPmUs] [fUs] [fA] [mA] [fA] [mA] [fU] [mU] [mC] [fA] [mG] [mG] [mA] [fA] [mU] [fU] [mC] [mC] [mU] [mGs] [mCs] [mU] 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 372 (5' [MeEPmUs] [fGs] [fG] [mA] [fA] [mA] [fG] [mA] [mG] [fA] [mU] [mC] [mU] [fC] [mA] [fU] [mC] [mA] [mC] [mUs] [mCs] [mA] 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 373 (5'[MeEPmUs][fAs][fA][mU][fU][mC][fA][mG][mG][fA][mA][mU][mU][fC][mC][fU][mG][mC][mU][mUs][mCs][mU]3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 374 (5' [MeEPmUs] [fAs] [fA] [mC] [fA] [mC] [fA] [mU] [mG] [fU] [mU] [mG] [mC] [fU] [mC] [fA] [mU] [mU] [mG] [mUs] [mCs] [mU] 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 375 (5'[MeEPmUs][fGs][fU][mG][fU][mA][fA][mC][mC][fG][mU][mC][mA][fU][mA][fG][mC][mA][mG][mUs][mGs][mG]3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 376 (5' [MeEPmUs] [fAs] [fU] [mA] [fG] [mC] [fA] [mG] [mU] [fG] [mG] [mA] [mA] [fA] [mG] [fA] [mG] [mA] [mU] [mCs] [mUs] [mC] 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 377 (5' [mUs] [fGs] [fU] [mC] [fA] [mU] [fA] [mA] [mA] [fA] [mU] [mU] [mC] [fA] [mG] [fG] [mA] [mA] [mU] [mUs] [mCs] [mC] 3'); ix) the antisense strand of a nucleic acid sequence according to SEQ ID NO: 378 (5' [mUs] [fUs] [fA] [mA] [fA] [mA] [fU] [mU] [mC] [fA] [mG] [mG] [mA] [fA] [mU] [fU] [mC] [mC] [mU] [mGs] [mCs] [mU] 3'); or x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 379 (5' [mUs] [fGs] [fG] [mA] [fA] [mA] [fG] [mA] [mG] [fA] [mU] [mC] [mU] [fC] [mA] [fU] [mC] [mA] [mC] [mUs] [mCs] [mA] 3') and where "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate internucleotide linkage, and "MeEP" is a monomethyl protected phosphate mimic.

47. An isolated oligonucleotide according to any one of claims 1 to 46.

48. the sense strand is i) the sense strand of the nucleic acid sequence according to SEQ ID NO: 381 (5' [mAs] [mAs] [mU] [mU] [mC] [fC] [mU] [fG] [fA] [fA] [fU] [mU] [mU] [mU] [mA] [mU] [mG] [mAs] [mCs] [mA] [G1b] [G1b] [G1b] 3'); ii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 382 (5' [mCs] [mAs] [mG] [mG] [mA] [fA] [mU] [fU] [fC] [fC] [fU] [mG] [mA] [mA] [mU] [mU] [mUs] [mAs] [mA] [Glb] [Glb] [Glb] 3'); iii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 383 (5' [mAs] [mGs] [mU] [mG] [mA] [fU] [mG] [fA] [fG] [fA] [fU] [mC] [mU] [mC] [mU] [mU] [mCs] [mCs] [mA] [Glb] [Glb] [Glb] 3'); iv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 384 (5' [mAs] [mAs] [mG] [mC] [mA] [fG] [mG] [fA] [fA] [fU] [fU] [mC] [mC] [mU] [mG] [mA] [mA] [mUs] [mUs] [mA] [Glb] [Glb] [Glb] 3'); v) the sense strand of the nucleic acid sequence according to SEQ ID NO: 385 (5' [mAs] [mCs] [mA] [mA] [mU] [fG] [mA] [fG] [fC] [fA] [fA] [mC] [mA] [mU] [mG] [mU] [mG] [mUs] [mUs] [mA] [Glb] [Glb] [Glb] 3'); vi) the sense strand of the nucleic acid sequence according to SEQ ID NO: 386 (5' [mAs] [mCs] [mU] [mG] [mC] [fU] [mA] [fU] [fG] [fA] [fC] [mG] [mG] [mU] [mU] [mA] [mC] [mAs] [mCs] [mA] [Glb] [Glb] [Glb] 3'); or vii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 387 (5' [mGs] [mAs] [mU] [mC] [mU] [fC] [mU] [fU] [fU] [fC] [fC] [mA] [mC] [mU] [mG] [mC] [mU] [mAs] [mUs] [mA] [Glb] [Glb] [Glb] 3') and wherein "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate internucleotide linkage, and "Glb" is a GalNac Glb moiety; 48. An isolated oligonucleotide according to any one of claims 1 to 47.

49. the double-stranded region i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 370 (5' [MeEPmUs] [fGs] [fU] [mC] [fA] [mU] [fA] [mA] [mA] [fA] [mU] [mU] [mC] [fA] [mG] [fG] [mA] [mA] [mU] [mUs] [mCs] [mC] 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 381 (5' [mAs] [mAs] [mU] [mU] [mC] [fC] [mU] [fG] [fA] [fA] [mU] [mU] [mU] [mU] [mA] [mU] [mG] [mAs] [mCs] [mA] [Glb] [Glb] [Glb] 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 371 (5' [MeEPmUs] [fUs] [fA] [mA] [fA] [mA] [fU] [mU] [mC] [fA] [mG] [mG] [mA] [fA] [mU] [fU] [mC] [mC] [mU] [mGs] [mCs] [mU] 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 382 (5' [mCs] [mAs] [mG] [mG] [mA] [fA] [mU] [fU] [fC] [fC] [fU] [mG] [mA] [mU] [mU] [mU] [mUs] [mAs] [mA] [Glb] [Glb] [Glb] 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 372 (5' [MeEPmUs] [fGs] [fG] [mA] [fA] [mA] [fG] [mA] [mG] [fA] [mU] [mC] [mU] [fC] [mA] [fU] [mC] [mA] [mC] [mUs] [mCs] [mA] 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 383 (5' [mAs] [mGs] [mU] [mG] [mA] [fU] [mG] [fA] [fG] [fA] [fU] [mC] [mU] [mC] [mU] [mU] [mCs] [mCs] [mA] [Glb] [Glb] [Glb] 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 373 (5' [MeEPmUs] [fAs] [fA] [mU] [fU] [mC] [fA] [mG] [mG] [fA] [mA] [mU] [mU] [fC] [mC] [fU] [mG] [mC] [mU] [mUs] [mCs] [mU] 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 384 (5' [mAs] [mAs] [mG] [mC] [mA] [fG] [mG] [fA] [fA] [fU] [fU] [mC] [mC] [mU] [mG] [mA] [mUs] [mUs] [mA] [Glb] [Glb] [Glb] 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 374 (5' [MeEPmUs] [fAs] [fA] [mC] [fA] [mC] [fA] [mU] [mG] [fU] [mU] [mG] [mC] [fU] [mC] [fA] [mU] [mU] [mG] [mUs] [mCs] [mU] 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 385 (5' [mAs] [mCs] [mA] [mA] [mU] [fG] [mA] [fG] [fC] [fA] [fA] [mC] [mA] [mU] [mG] [mU] [mG] [mUs] [mUs] [mA] [Glb] [Glb] [Glb] 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 375 (5' [MeEPmUs] [fGs] [fU] [mG] [fU] [mA] [fA] [mC] [mC] [fG] [mU] [mC] [mA] [fU] [mA] [fG] [mC] [mA] [mG] [mUs] [mGs] [mG] 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 386 (5' [mAs] [mCs] [mU] [mG] [mC] [fU] [mA] [fU] [fG] [fA] [fC] [mG] [mG] [mU] [mU] [mA] [mC] [mA] [Glb] [Glb] [Glb] 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 376 (5' [MeEPmUs] [fAs] [fU] [mA] [fG] [mC] [fA] [mG] [mU] [fG] [mG] [mA] [mA] [fA] [mG] [fA] [mG] [mA] [mU] [mCs] [mUs] [mC] 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 387 (5' [mGs] [mAs] [mU] [mC] [mU] [fC] [mU] [fU] [fC] [fC] [mA] [mC] [mU] [mG] [mC] [mU] [mAs] [mUs] [mA] [Glb] [Glb] [Glb] 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 377 (5' [mUs] [fGs] [fU] [mC] [fA] [mU] [fA] [mA] [mA] [fA] [mU] [mU] [mC] [fA] [mG] [fG] [mA] [mA] [mU] [mUs] [mCs] [mC] 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 381 (5' [mAs] [mAs] [mU] [mU] [mC] [fC] [mU] [fG] [fA] [fA] [fU] [mU] [mU] [mU] [mA] [mU] [mG] [mAs] [mCs] [mA] [Glb] [Glb] [Glb] 3'); ix) the antisense strand of a nucleic acid sequence according to SEQ ID NO: 378 (5' [mUs] [fUs] [fA] [mA] [fA] [mA] [fU] [mU] [mC] [fA] [mG] [mG] [mA] [fA] [mU] [fU] [mC] [mC] [mU] [mGs] [mCs] [mU] 3') and the sense strand of a nucleic acid sequence according to SEQ ID NO: 382 (5' [mCs] [mAs] [mG] [mG] [mA] [fA] [mU] [fU] [fC] [fC] [fU] [mG] [mA] [mA] [mU] [mU] [mU] [mU] [mA] [Glb] [Glb] [Glb] 3'); or x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 379 (5' [mUs] [fGs] [fG] [mA] [fA] [mA] [fG] [mA] [mG] [fA] [mU] [mC] [mU] [fC] [mA] [fU] [mC] [mA] [mC] [mU] [mCs] [mA] 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 383 (5' [mAs] [mGs] [mU] [mG] [mA] [fU] [mG] [fA] [fG] [fA] [fU] [mC] [mU] [mC] [mU] [mU] [mCs] [mCs] [mA] [Glb] [Glb] [Glb] 3').

48. The isolated oligonucleotide of claim 47, comprising:

50. A vector encoding the isolated oligonucleotide of any one of claims 1 to 49.

51. A delivery system comprising the isolated oligonucleotide of any one of claims 1 to 49 or the vector of claim 50.

52. 52. A pharmaceutical composition comprising at least one isolated oligonucleotide according to any one of claims 1 to 49, a vector according to claim 50, or a delivery system according to claim 51, and a pharmaceutically acceptable carrier, diluent or excipient.

53. A kit comprising at least one isolated oligonucleotide according to any one of claims 1 to 49, a vector according to claim 50, a delivery system according to claim 51 or a pharmaceutical composition according to claim 52.

54. 52. A method of inhibiting or downregulating the expression or level of CFB in a subject in need thereof, comprising administering to the subject an effective amount of at least one isolated oligonucleotide according to any one of claims 1 to 49, a vector according to claim 50, a delivery system according to claim 51 or a pharmaceutical composition according to claim 52.

55. 52. A method of treating or preventing a disease or disorder associated with aberrant or increased expression or activity of CFB, or a disease or disorder in which CFB plays a role in a subject in need thereof, comprising administering to the subject an effective amount of at least one isolated oligonucleotide of any one of claims 1 to 49, a vector of claim 50, a delivery system of claim 51, or a pharmaceutical composition of claim 52.