Methods for producing Bola-type sophorosides and alkyl sophorosides

Abstract

The present invention provides yeast mutant strains that improve the productivity of Bola-type sophorosides and alkyl sophorosides, and a method for producing at least one product selected from the group consisting of Bola-type sophorosides and alkyl sophorosides using the same. [Solution] A yeast mutant strain in which a polypeptide consisting of an amino acid sequence represented by a specific sequence or an amino acid sequence having at least 90% identity with the amino acid sequence represented by the specific sequence, and FAO1 or a polypeptide equivalent thereof are functionally inhibited, expression suppressed, or inactivated, respectively.

Description

Technical Field

[0001] The present invention relates to a yeast mutant strain with improved productivity of bola - type sophorolipid and alkyl sophorolipid, and a method for producing at least one selected from the group consisting of bola - type sophorolipid and alkyl sophorolipid using the mutant strain.

Background Art

[0002] Sophorolipid is a glycolipid in which a long - chain hydroxy fatty acid and sophorose are bound, and is produced mainly by microorganisms, particularly yeasts. Sophorolipid is an amphiphilic lipid having strong surface activity and excellent biodegradability, and is used as a biosurfactant having both environmental compatibility and functionality. With the recent expansion of the market scale of biosurfactants, attention has also been increasing on novel biosurfactants other than sophorolipids such as bola - type sophorolipids and alkyl sophorolipids.

[0003] To improve the productivity of glycolipids produced by microorganisms, it is necessary to enhance the activity of the microorganisms. Genetic engineering is one of the main methods for such activity enhancement. Patent document 1 reports that a mutant strain of Starmerella bombicola (formerly known as Candida bombicola), a non-pathogenic basidiomycete yeast in which a specific putative transcription factor polypeptide is suppressed or inactivated, has improved sophorolipid productivity compared to the parent strain before the mutation. Non-patent document 1 also reports that a mutant strain of Starmerella bombicola in which the aliphatic alcohol oxidase FAO1 (fatty alcohol oxidase 1) is suppressed or inactivated can produce Bola-type sophoroside, alkyl sophoroside, alkyl glucoside, and Bola-type glucoside. It is known that sophorolipids are produced as a byproduct during the production of Bola-type sophorosides and alkyl sophorosides by yeast. Therefore, there is a need for methods that can efficiently produce Bola-type sophorosides and alkyl sophorosides while suppressing the byproduct formation of sophorolipids. [Prior art documents] [Patent Documents]

[0004] [Patent Document 1] Patent No. 6725506 [Non-patent literature]

[0005] [Non-Patent Document 1] Takahashi F., Igarashi K and Hagihara H., Appl Microbiol Biotechnol. 2016 Nov;100(22):9519-9528 [Overview of the project] [Problems that the invention aims to solve]

[0006] The present invention relates to a yeast mutant strain that enhances the productivity of Bola-type sophorosides and alkyl sophorosides, and a method for producing at least one product selected from the group consisting of Bola-type sophorosides and alkyl sophorosides using the same. [Means for solving the problem]

[0007] The inventors have found that in yeast mutant strains that have acquired the ability to produce Bola-type sophorosides and alkyl sophorosides by inhibiting, suppressing, or inactivating the function, expression, or development of FAO1, further inhibiting, suppressing, or inactivating the function, expression, or development of a putative transcription factor polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 increases the production of Bola-type sophorosides and alkyl sophorosides, while surprisingly suppressing the production ratio of the by-product sophorolipid, thus enabling the efficient production of Bola-type sophorosides and alkyl sophorosides.

[0008] The present invention relates to the following 1) to 5). 1) A yeast mutant strain in which a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5, and FAO1 or a corresponding polypeptide are functionally inhibited, expression suppressed, or inactivated, respectively. 2) A method for producing a yeast mutant strain, comprising inhibiting the function, suppressing the expression, or inactivating a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5, and FAO1 or a polypeptide equivalent thereto, in yeast. 3) A method for improving the productivity of yeast, comprising inhibiting the function, suppressing the expression, or inactivating a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5, and FAO1 or a polypeptide equivalent thereto, respectively, by selecting at least one of the group consisting of Bola-type sophorosides and alkyl sophorosides. 4) A method for suppressing the production ratio of sophorolipids during the production of at least one type of sophoroside selected from the group consisting of Bola-type sophorosides and alkyl sophorosides by yeast, comprising functional inhibition, expression suppression, or inactivation of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5, and FAO1 or a polypeptide equivalent thereto. 5) A method for producing at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides, comprising culturing the mutant strain described in 1). [Effects of the Invention]

[0009] The present invention provides a yeast mutant strain with improved productivity of Bola-type sophorosides and alkyl sophorosides. According to the yeast mutant strain of the present invention, at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides can be efficiently produced. [Modes for carrying out the invention]

[0010] (1.Definition) In this specification, the identity of amino acid sequences or nucleotide sequences is calculated using the Lipman-Pearson method (Science, 1985, 227:1435-1441). Specifically, it is calculated by performing the homology analysis (Search homology) using the genetic information processing software GENETYX Ver.12 with a Unit size to compare (ktup) of 2.

[0011] In this specification, "at least 90% identity" with respect to an amino acid sequence or nucleotide sequence means identity of 90% or more, preferably 95% or more, more preferably 97% or more, even more preferably 98% or more, and even more preferably 99% or more.

[0012] In this specification, "amino acid sequence in which one or more amino acids are deleted, substituted, added, or inserted" means an amino acid sequence in which one to 20, preferably one to 10, more preferably one to 8, even more preferably one to 5, and even more preferably one to 3 amino acids are deleted, substituted, added, or inserted. Also, "nucleotide sequence in which one or more nucleotides are deleted, substituted, added, or inserted" means a nucleotide sequence in which one to 60, preferably one to 30, more preferably one to 24, even more preferably one to 15, and even more preferably one to 9 nucleotides are deleted, substituted, added, or inserted. In this specification, "addition" of an amino acid or nucleotide includes the addition of an amino acid or nucleotide to one end and both ends of a sequence.

[0013] In this specification, "upstream" and "downstream" with respect to a gene refer to the upstream and downstream regions in the transcription direction of the gene. For example, "a gene located downstream of a promoter" means that the gene is located on the 3' side of the promoter in the DNA sense strand, and "upstream of a gene" means the 5' region of the gene in the DNA sense strand.

[0014] Examples of "yeast" as used herein include ascomycetes such as Starmerella, Candida, and Wickerhamiella, and preferably Starmerella bombicola, Candida bogoriensis, Candida batistae, Candida apicola, and Wickerhamiella domericqiae. Of these, Starmerella microorganisms are preferred from the viewpoint of Bola-type sophoroside and alkyl sophoroside productivity, and Starmerella bombicola is more preferred.

[0015] In the yeast mutant strain of the present invention, the polypeptides whose function is inhibited, whose expression is suppressed, or which are inactivated are polypeptides consisting of the amino acid sequence shown in SEQ ID NO: 5 or equivalent polypeptides, and FAO1 (fatty alcohol oxidase 1) or equivalent polypeptides.

[0016] In this specification, the "polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5" is a putative transcription factor polypeptide having a Zinc Finger C2H2 type DNA-binding domain at amino acid residues 101 to 123 and 129 to 152, respectively. The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 improves sophorolipid productivity in yeast when inhibited, repressed, or inactivated by its own action.

[0017] In this specification, "polypeptide corresponding to the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5" refers to a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5. Examples of amino acid sequences having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5 include amino acid sequences in which one or more amino acids are deleted, substituted, added, or inserted from the amino acid sequence shown in SEQ ID NO: 5. Preferably, the "polypeptide corresponding to the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5" is a putative transcription factor polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5, and more preferably, it is a putative transcription factor polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5 and having two Zinc Finger C2H2 type DNA-binding domains. The polypeptide corresponding to the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 improves sophorolipid productivity in yeast by being inhibited, repressed, or inactivated by function alone. The presence or absence of a Zinc Finger C2H2 type DNA-binding domain in a polypeptide can be confirmed, for example, by analyzing the amino acid sequence using NCBI's CD search, but the method of analyzing the presence or absence of such a domain is not limited to this.

[0018] In this specification, "a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5" is preferably a gene consisting of the nucleotide sequence shown in SEQ ID NO: 4.

[0019] As used herein, the "gene encoding a polypeptide corresponding to the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5" consists of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 4, and encodes a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 or a polypeptide corresponding thereto. Examples of nucleotide sequences having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 4 include nucleotide sequences in which one or several nucleotides have been deleted, substituted, added, or inserted with respect to the nucleotide sequence shown in SEQ ID NO: 4.

[0020] As used herein, "FAO1" is a polypeptide having aliphatic alcohol oxidase activity. FAO1 is preferably FAO1 of Starmerella bombicola, and more preferably a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 15.

[0021] As used herein, the "polypeptide corresponding to FAO1" refers to a polypeptide having the same function as FAO1, and includes homologs, orthologs of FAO1 or variants thereof. The polypeptide corresponding to FAO1 is preferably a polypeptide comprising an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 15. Examples of amino acid sequences having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 15 include amino acid sequences in which one or several amino acids are deleted, substituted, added, or inserted with respect to the amino acid sequence shown in SEQ ID NO: 15. More preferably, the "polypeptide corresponding to the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 15" comprises an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 15, and has aliphatic alcohol oxidase activity. The aliphatic alcohol oxidase activity can be measured, for example, by preparing a reaction solution containing the polypeptide to be measured, an aliphatic alcohol substrate, ABTS (2,2'-azino-di-(3-ethylbenzothiazoline)-6-sulfonic acid), and peroxidase, and using the amount of oxidized ABTS finally obtained by the enzyme reaction as an index (for example, the non-patent document 1).

[0022] As used herein, the "gene encoding FAO1" preferably refers to the gene encoding FAO1 of Starmerella bombicola, and more preferably refers to the gene consisting of the nucleotide sequence shown in SEQ ID NO: 14.

[0023] In this specification, "gene encoding a polypeptide equivalent to FAO1" means a gene encoding a polypeptide having the same function as FAO1, and includes genes encoding homologs, orthologs, or variants thereof of FAO1. Preferably, a gene encoding a polypeptide or equivalent polypeptide consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 14 and the amino acid sequence shown in SEQ ID NO: 15. An example of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 14 is a nucleotide sequence in which one or more nucleotides are deleted, substituted, added, or inserted from the nucleotide sequence shown in SEQ ID NO: 14.

[0024] In this specification, "sophoroside" refers to a glycolipid in which an alcohol is bonded to sophorose or an acetylated derivative thereof; "Bola-type sophoroside" refers to a glycolipid among sophorosides in which sophorose or an acetylated derivative thereof is bonded to both ends of the alcohol; "alkyl sophoroside" refers to a glycolipid among sophorosides in which sophorose or an acetylated derivative thereof is bonded to the hydroxy terminus of the alcohol; and "sophorolipid" refers to a glycolipid in which a long-chain hydroxy fatty acid is bonded to sophorose or an acetylated derivative thereof.

[0025] (2. Yeast mutant strains) The present invention provides a yeast mutant strain (hereinafter referred to as the mutant strain of the present invention). In the mutant strain of the present invention, the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 or an equivalent polypeptide and FAO1 or an equivalent polypeptide are functionally inhibited, expression suppressed, or inactivated, respectively. Preferably, the mutant strain of the present invention is a mutant strain produced in yeast by artificial modification, more preferably by genetic modification, to functionally inhibit, expression suppressed, or inactivate the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 or an equivalent polypeptide and FAO1 or an equivalent polypeptide, respectively.

[0026] Preferably, the mutant strain of the present invention is a mutant strain in which the expression of the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 or an equivalent polypeptide and FAO1 or an equivalent polypeptide is suppressed compared to the pre-mutation strain (parent strain). In one embodiment, the mutant strain of the present invention may be a mutant strain in which the expression levels of the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 or an equivalent polypeptide and FAO1 or an equivalent polypeptide are reduced by 50% or less, preferably 40% or less, more preferably 30% or less, even more preferably 20% or less, even more preferably 10% or less, and still preferably 5% or less, compared to the parent strain. Even more preferably, the mutant strain of the present invention may be a mutant strain in which the expression levels of the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 or an equivalent polypeptide and FAO1 or an equivalent polypeptide are lost to an undetectable level (below the expression level of a negative control or background). The expression level of polypeptides can be measured by commonly used protein expression quantification methods, such as, but not limited to, colorimetric quantification, fluorescence quantification, Western blotting, ELISA, radioimmunoassay, etc.

[0027] Means for inhibiting, suppressing the expression of, or inactivating the function of a polypeptide consisting of the amino acid sequence shown in Sequence ID No. 5 or a similar polypeptide and FAO1 or a similar polypeptide include methods of suppressing, deleting, or inactivating the expression of the encoding gene; methods of inactivating mRNA transcribed from the encoding gene; methods of suppressing the translation of mRNA of the encoding gene by RNA interference using siRNA; methods of introducing a polynucleotide encoding siRNA and suppressing mRNA translation of the encoding gene by RNA interference using the produced siRNA; methods of mutating the encoding gene to reduce or eliminate the activity of the polypeptide; methods of inhibiting or inactivating the function of the polypeptide by inhibitors such as aptamers or antibodies; and methods of introducing a polynucleotide encoding an aptamer or a gene encoding an antibody and inhibiting or inactivating the function of the polypeptide by inhibitors such as the produced aptamer or antibody. The polypeptide consisting of the amino acid sequence shown in Sequence ID No. 5 or a similar polypeptide and FAO1 or a similar polypeptide may be inhibited, suppressed, or inactivated by the same means, or by different means, and the order of functional inhibition, suppression, or inactivation of both is not particularly limited. In one preferred embodiment, the mutant strain of the present invention is a mutant strain in which the gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5, or an equivalent gene, and the gene encoding FAO1, or an equivalent gene, are repressed, deleted, or inactivated, respectively.

[0028] Means for suppressing, deleting, or inactivating genes in yeast cells include introducing mutations (deletion, insertion, substitution, or addition) to one or more nucleotides in the nucleotide sequence of the target gene, substituting or inserting another nucleotide sequence into the said nucleotide sequence, or deleting part or all of the said nucleotide sequence. Alternatively, similar mutations, substitutions, insertions, or deletions of nucleotide sequences may be performed on regulatory regions such as the promoter region of the target gene. For example, by introducing mutations to the promoter that controls the expression of the target gene, or by replacing it with a lower-expression promoter, promoter activity can be reduced or eliminated, thereby reducing or eliminating the transcription of mRNA from the target gene, and thus suppressing or inactivating the expression of the target gene. The gene encoding a polypeptide consisting of the amino acid sequence shown in Sequence ID No. 5, or a gene equivalent thereto, and the gene encoding FAO1, or a gene equivalent thereto, may be suppressed, deleted, or inactivated by the same means, or by different means, and the order of suppression, deletion, or inactivation of their expression is not particularly limited.

[0029] Specific methods for introducing the above-mentioned mutations, or for substituting, inserting, or deleting nucleotide sequences, can be those known in the field for genetic modification of microorganisms. Examples of such methods include, but are not limited to, ultraviolet irradiation, site-directed mutagenesis, homologous recombination using SOE-PCR (splicing by overlap extension PCR: Gene, 1989, 77:61-68), and genome editing using artificial DNA nucleases (or programmable nucleases).

[0030] After introducing the above-mentioned mutations or substituting, inserting, or deleting nucleotide sequences, the mutant strain of the present invention can be obtained by selecting cells with the desired mutations through gene analysis or evaluation of the expression level of mRNA or polypeptides encoded by the target gene.

[0031] Alternatively, if the means for repressing, deleting, or inactivating the gene is homologous recombination using SOE-PCR, a drug resistance marker gene can be incorporated into a gene deletion DNA fragment to replace the target gene DNA. Cells into which the deletion DNA fragment has been introduced can be cultured on a medium containing the drug, and the growing colonies can be isolated to obtain a mutant strain in which the target gene is deleted. Furthermore, the mutation can be confirmed by performing the gene analysis or evaluation of polypeptide expression levels described above. By following the above procedure, a yeast mutant strain of the present invention can be obtained in which the gene encoding the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 or an equivalent gene and the gene encoding FAO1 or an equivalent gene are repressed, deleted, or inactivated, respectively.

[0032] Alternatively, by confirming the improved productivity of at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides in the mutant strain prepared by the above procedure, a mutant strain of the present invention can be obtained in which the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 or an equivalent polypeptide and FAO1 or an equivalent polypeptide are functionally inhibited, expression suppressed, or inactivated, respectively.

[0033] In mutant strains of the present invention, in which a polypeptide consisting of the amino acid sequence shown in Sequence ID No. 5 described above, or a polypeptide equivalent thereto, and FAO1 or a polypeptide equivalent thereto are functionally inhibited, their expression suppressed, or inactivated, the productivity of Bola-type sophorosides and alkyl sophorosides is improved compared to mutant strains (parent strains) in which only FAO1 or a polypeptide equivalent thereto is functionally inhibited, their expression suppressed, or inactivated. Specifically, in mutant strains of the present invention, the production of at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides, preferably Bola-type sophorosides and alkyl sophorosides, is improved compared to the parent strain. The production of at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides by mutant strains of the present invention is preferably 140% or more, more preferably 160% or more, and even more preferably 180% or more compared to the production of at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides by the parent strain.

[0034] Furthermore, compared to the parent strain, the mutant strain of the present invention exhibits an increased ratio (production ratio) of the production of at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides, preferably Bola-type sophorosides and alkyl sophorosides, and the production of at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides, preferably Bola-type sophorosides and alkyl sophorosides, to the production of the by-product sophorolipid. In other words, compared to the parent strain, the mutant strain of the present invention exhibits a suppressed ratio (production ratio) of the production of the by-product sophorolipid. It is known that yeast sophorolipid productivity can be improved by suppressing or inactivating the expression of a polypeptide consisting of the amino acid sequence shown in Sequence ID No. 5 or a comparable polypeptide (see Patent Document 1). However, it is quite surprising that in a yeast mutant strain that has acquired the ability to produce Bola-type sophorosides and alkyl sophorosides by inhibiting, suppressing, or inactivating the function, expression, or expression of the polypeptide consisting of the amino acid sequence shown in Sequence ID No. 5 or a comparable polypeptide, the production ratio of the by-product sophorolipid can be suppressed by further inhibiting, suppressing, or inactivating its function. The ratio of the production of at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides to the production of sophorolipids by the mutant strain of the present invention is preferably 110% or more, more preferably 130% or more, even more preferably 150% or more, and even more preferably 170% or more compared to the ratio of the production of at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides to the production of sophorolipids in the parent strain. Furthermore, the ratio of the production of sophorolipid to the production of at least one selected from the group consisting of Bola-type sophoroside and alkyl sophoroside, and sophorolipid, in the mutant strain of the present invention is preferably 75% or less, more preferably 65% ​​or less, even more preferably 55% or less, and even more preferably 45% or less, compared to the ratio of the production of sophorolipid to the production of at least one selected from the group consisting of Bola-type sophoroside and alkyl sophoroside, and sophorolipid, in the parent strain. Preferably, the productivity of at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides as used herein is based on the productivity of at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides after 20 to 200 hours of culture, more preferably after 50 to 200 hours.

[0035] (3. Methods for improving the productivity of Bola-type sophorosides and alkyl sophorosides in mutant strains) The present invention also provides a method for improving the productivity of at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides in yeast, comprising functional inhibition, expression suppression, or inactivation of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 or a corresponding polypeptide and FAO1 or a corresponding polypeptide, respectively. This method can be rephrased as a method for suppressing the production ratio of sophorolipids during the production of at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides by yeast, or a method for improving the purity of at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides during the production of at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides by yeast.

[0036] In yeast, inhibiting the function, suppressing the expression, or inactivating a polypeptide consisting of the amino acid sequence shown in Sequence ID No. 5 or a polypeptide equivalent thereto and FAO1 or a polypeptide equivalent thereto, respectively, improves the productivity of at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides, suppresses the production ratio of sophorolipids during the production of at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides by yeast, or improves the purity of at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides during the production of at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides by yeast. Preferably, these improvements in productivity, suppression of production ratio, or improvement in purity are compared to the case where only FAO1 or a polypeptide equivalent thereto is functionally inhibited, suppressed, or inactivated in yeast.

[0037] (4. Methods for producing Bola-type sophorosides and alkyl sophorosides) The mutant strain of the present invention exhibits improved productivity of Bola-type sophorosides and alkyl sophorosides. Furthermore, the mutant strain of the present invention can produce Bola-type sophorosides and alkyl sophorosides using alcohols of various chain lengths as substrates. Therefore, by culturing the mutant strain of the present invention with an alcohol of an appropriate chain length, at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides containing hydrocarbon chains of a desired chain length can be efficiently produced. Accordingly, the present invention also provides a method for producing at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides (hereinafter collectively referred to as Bola-type sophoroside, etc.), which includes culturing the mutant strain of the present invention described above.

[0038] The mutant strain of the present invention used in the production method of the present invention is a yeast mutant strain in which the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5, and FAO1 or a corresponding polypeptide are functionally inhibited, expression suppressed, or inactivated, respectively. However, it may be further modified to improve glycolipid production capacity. Further modifications include functional inhibition, expression suppression, or inactivation of polypeptides involved in suppressing the production capacity of the target glycolipid, enhancement of the expression of polypeptides involved in improving the production capacity of the target glycolipid, and enhancement of the expression of various enzymes for producing the target glycolipid.

[0039] A preferred example of further modification is the inhibition, suppression, or inactivation of the function, expression, or protein of CYP52M1 (CYP52M1 cytochrome P450 monooxygenase) or a protein equivalent thereto. Here, "CYP52M1" is a polypeptide having hydroxylation activity at the ω or ω-1 position of a fatty acid or aliphatic alcohol, preferably CYP52M1 from Star Merella Bombicola, and more preferably a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 25. Also, "protein equivalent to CYP52M1" is a protein having the same function as CYP52M1, and includes homologs, orthologs, or variants thereof of CYP52M1. The protein equivalent to CYP52M1 is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 25. An example of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 25 is an amino acid sequence in which one or more amino acids are deleted, substituted, added, or inserted from the amino acid sequence shown in SEQ ID NO: 25. The modification preferably involves suppressing, deleting, or inactivating the expression of a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 25 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 25; more preferably, suppressing, deleting, or inactivating the expression of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 24 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 24; and even more preferably, suppressing, deleting, or inactivating the expression of a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 24 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 24, and an amino acid sequence showing at least 90% identity with the amino acid sequence shown in SEQ ID NO: 25. Note that the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 25 is encoded in the nucleotide sequence shown in SEQ ID NO: 24 in Star Merella Bombicola.In Star Merella bombicola mutants in which the cyp52M1 and fao1 genes are disrupted, the productivity of Bola-type sophorosides is improved and the byproduct formation of sophorolipids is suppressed (International Publication No. 2020 / 104582).

[0040] Another preferred example of further modification is the inhibition, suppression, or inactivation of the function, expression, or protein of CYP52N1 (CYP52N1 cytochrome P450 monooxygenase) or a protein equivalent thereto. Here, "CYP52N1" is a polypeptide having hydroxylation activity at the ω or ω-1 position of a fatty acid or aliphatic alcohol, similar to CYP52M1 described above (Inge NA Van Bogaert et al., FEMS Yeast Res., 2009, 9(1): 87-94), preferably CYP52N1 from Star Merella bombicola, and more preferably a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 27. Furthermore, "protein equivalent to CYP52N1" is a protein having the same function as CYP52N1, and includes homologs, orthologs, or variants thereof of CYP52N1. The protein equivalent to CYP52N1 is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 27. An example of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 27 is an amino acid sequence in which one or more amino acids are deleted, substituted, added, or inserted from the amino acid sequence shown in SEQ ID NO: 27. The modification preferably involves suppression, deletion, or inactivation of the expression of a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 27 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 27; more preferably involves suppression, deletion, or inactivation of the expression of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 26 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 26; and even more preferably involves suppression, deletion, or inactivation of the expression of a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 26 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 26, and an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 27 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 27.Furthermore, the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 27 is encoded in the nucleotide sequence shown in SEQ ID NO: 26 in Star Merella Bombicola.

[0041] Another preferred example of further modification is the inhibition, suppression, or inactivation of the function, expression, or equivalent of CYP52E3 (CYP52E3 cytochrome P450 monooxygenase) or a protein equivalent thereto. Here, "CYP52E3" is a polypeptide having hydroxylation activity at the ω or ω-1 position of a fatty acid or aliphatic alcohol, similar to CYP52M1 described above (Inge NA Van Bogaert et al., FEMS Yeast Res., 2009, 9(1): 87-94), preferably CYP52E3 from Star Merella Bombicola, and more preferably a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 29. Furthermore, "protein equivalent to CYP52E3" is a protein having the same function as CYP52E3 from Star Merella Bombicola, and includes homologs, orthologs, or variants thereof of CYP52E3 from Star Merella Bombicola. The protein corresponding to CYP52E3 is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 29. An example of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 29 is an amino acid sequence in which one or more amino acids are deleted, substituted, added, or inserted from the amino acid sequence shown in SEQ ID NO: 29.The modification preferably involves suppressing, deleting, or inactivating the expression of a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 29 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 29; more preferably, suppressing, deleting, or inactivating the expression of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 28 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 28; and even more preferably, suppressing, deleting, or inactivating the expression of a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 28 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 28, and the amino acid sequence shown in SEQ ID NO: 29 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 29. Note that the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 29 is encoded in the nucleotide sequence shown in SEQ ID NO: 28 in Star Merella Bombicola.

[0042] Another preferred example of further modification is the inhibition, suppression, or inactivation of the function, expression, or function of UGTB1 (UDP-glucosyltransferase B1) or a corresponding protein. Here, "UGTB1" is a polypeptide having glycosyltransferase activity to hydroxylated fatty acids using UDP-glucose as a donor, preferably UGTB1 from Star Merella bombicola, and more preferably a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 31. "Protein corresponding to UGTB1" is a protein having the same function as UGTB1, and includes homologs, orthologues, or variants thereof of UGTB1. The protein corresponding to UGTB1 is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 31. An example of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 31 is an amino acid sequence in which one or more amino acids are deleted, substituted, added, or inserted from the amino acid sequence shown in SEQ ID NO: 31. The modification preferably involves suppression, deletion, or inactivation of the expression of a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 31 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 31; more preferably, suppression, deletion, or inactivation of the expression of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 30 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 30; and even more preferably, suppression, deletion, or inactivation of the expression of a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 30 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 30, and the amino acid sequence shown in SEQ ID NO: 31 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 31. Note that the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 31 is encoded in the nucleotide sequence shown in SEQ ID NO: 30 in Star Merella Bombicola.It has been reported that Star Merella bombicola mutants with disrupted ugtB1 gene can produce glucolipids (Sofie Lodens et al., Biotechnol Bioeng., 2020, 117(2): 453-465). Furthermore, it has been reported that Star Merella bombicola mutants with disrupted ugtB1, fao1, and cyp52M1 genes can produce alkylglucosides and alkylsophorosides (International Publication No. 2021 / 229017).

[0043] Another preferred example of further modification is the inhibition, suppression, or inactivation of the function, expression, or activation of UGTA1 (UDP-glucosyltransferase A1) or a corresponding protein. Here, "UGTA1" is a polypeptide having glycosyltransferase activity to hydroxylated fatty acids using UDP-glucose as a donor, similar to UGTB1 above (Karen MJ Saerens et al., FEMS Yeast Res., 2015, 15(7): fov075), preferably UGTA1 from Star Merella bombicola, and more preferably a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 33. Furthermore, "protein corresponding to UGTA1" is a protein having the same function as UGTA1, and includes homologs, orthologs, or variants thereof of UGTA1. The protein corresponding to UGTA1 is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 33. An example of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 33 is an amino acid sequence in which one or more amino acids are deleted, substituted, added, or inserted from the amino acid sequence shown in SEQ ID NO: 33. The modification preferably involves suppression, deletion, or inactivation of the expression of a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 33 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 33; more preferably involves suppression, deletion, or inactivation of the expression of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 32 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 32; and even more preferably involves suppression, deletion, or inactivation of the expression of a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 32 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 32, and an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 33 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 33.Furthermore, the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 33 is encoded in the nucleotide sequence shown in SEQ ID NO: 32 in Star Merella bombicola.

[0044] Another preferred example of further modification is the inhibition, suppression, or inactivation of the function, expression, or action of AT (acetyl transferase) or an equivalent protein. Here, "AT" is a polypeptide having acetylation activity of the OH moiety of a sugar, preferably the AT of Star Merella bombicola, and more preferably a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 35. "Protein equivalent to AT" is a protein having the same function as AT, and includes homologs, orthologues, or variants thereof of AT. The protein equivalent to AT is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 35. An example of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 35 is an amino acid sequence in which one or more amino acids are deleted, substituted, added, or inserted from the amino acid sequence shown in SEQ ID NO: 35. The modification preferably involves suppression, deletion, or inactivation of the expression of a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 35 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 35; more preferably, suppression, deletion, or inactivation of the expression of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 34 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 34; and even more preferably, suppression, deletion, or inactivation of the expression of a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 34 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 34, and an amino acid sequence showing at least 90% identity with the amino acid sequence shown in SEQ ID NO: 35. Note that the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 35 is encoded in the nucleotide sequence shown in SEQ ID NO: 34 in Star Merella Bombicola.It has been reported that non-acetylated sophorolipids are produced in Star Merella bombicola mutants in which the at gene is disrupted (Karen MJ Saerens et al., Biotechnol Bioeng., 2011, 108(12): 2923-2931).

[0045] Another preferred example of further modification is the inhibition, suppression, or inactivation of the function, expression, or protein of SBLE (Starmerella Bombicola Lactone Esterase) or an equivalent protein. Here, "SBLE" is a polypeptide having sophorolipid lactonization activity, preferably Starmerella Bombicola SBLE, and more preferably a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 37. "Protein equivalent to SBLE" is a protein having the same function as SBLE, and includes homologs, orthologs, or variants thereof of SBLE. The protein equivalent to SBLE is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 37. An example of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 37 is an amino acid sequence in which one or more amino acids are deleted, substituted, added, or inserted from the amino acid sequence shown in SEQ ID NO: 37. The modification preferably involves suppression, deletion, or inactivation of the expression of a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 37 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 37; more preferably, suppression, deletion, or inactivation of the expression of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 36 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 36; and even more preferably, suppression, deletion, or inactivation of the expression of a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 36 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 36, and the amino acid sequence shown in SEQ ID NO: 37 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 37. Note that the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 37 is encoded in the nucleotide sequence shown in SEQ ID NO: 36 in Star Merella Bombicola.It has been reported that the proportion of acidic sophorolipids is increased in Star Merella bombicola mutants in which the sble gene is disrupted (Katarzyna Ciesielska et al., Appl Microbiol Biotechnol., 2016, 100(22): 9529-9541). Furthermore, it has been reported that Star Merella bombicola mutants in which both the sble and at genes are disrupted can produce non-acetylated Bola-type sophorolipids (International Publication No. 2015 / 028278).

[0046] A preferred example of further modification is the enhancement of the expression of MDR1 (multidrug resistance protein 1) or an equivalent protein. Here, "MDR1" is a transporter polypeptide responsible for the intracellular and extracellular transport of sophorolipids, preferably MDR1 from Star Merella bombicola, and more preferably a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 39. "Protein equivalent to MDR1" is a protein having the same function as MDR1, and includes homologs, orthologs, or variants thereof of MDR1. The protein equivalent to MDR1 is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 39. An example of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 39 is an amino acid sequence in which one or more amino acids are deleted, substituted, added, or inserted from the amino acid sequence shown in SEQ ID NO: 39. The modification preferably involves enhancing the expression of a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 39 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 39; more preferably, enhancing the expression of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 38 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 38; and even more preferably, enhancing the expression of a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 38 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 38, and the amino acid sequence shown in SEQ ID NO: 39 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 39. Note that the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 39 is encoded in the nucleotide sequence shown in SEQ ID NO: 38 in Star Merella Bombicola.It has been reported that in Star Merella bombicola mutants with disrupted mdr1 gene, the productivity of sophorolipids and Bola-type sophorolipids is significantly reduced (Silke Claus et al., BMC Genomics, 2022, 23(1): 22).

[0047] Another preferred example of further modification is the inhibition, suppression, or inactivation of the function, expression, or protein of MFE-2 (multifunctional enzyme type 2) or an equivalent protein. Here, "MFE-2" is a polypeptide involved in the β-oxidative degradation of fatty acids, preferably MFE-2 from Star Merella bombicola. "Protein equivalent to MFE-2" is a protein having the same function as MFE2, and includes homologs, orthologs, or variants thereof of MFE2. It has been reported that Star Merella bombicola mutants in which the mfe-2 gene is disrupted produce sophorolipids with a medium-chain fatty acid backbone (Inge NA Van Bogaert et al., FEMS Yeast Res., 2009, 9(4): 610-617).

[0048] In the production method of the present invention, the mutant strain of the present invention is cultured in a medium containing alcohol as a substrate. Bola-type sophorosides, etc., are recovered from the culture medium after cultivation and purified as appropriate if necessary to produce the desired Bola-type sophorosides, etc.

[0049] As the culture medium used for the above cultivation, a conventional medium containing a carbon source, a nitrogen source, inorganic salts, and, if necessary, organic micronutrients such as amino acids and vitamins can be used. Furthermore, the medium may be either a synthetic medium or a natural medium.

[0050] The carbon and nitrogen sources included in the culture medium may be of any type available to the mutant strain being cultured. Examples of carbon sources include sugars such as glucose, glycerol, fructose, sucrose, maltose, mannose, galactose, starch hydrolysates, and molasses; organic acids such as acetic acid and citric acid; and alcohols such as ethanol. These carbon sources can be used individually or in combination of two or more. Examples of nitrogen sources include ammonia; ammonium salts such as ammonium sulfate, ammonium carbonate, ammonium chloride, ammonium phosphate, and ammonium acetate; nitrates; and urea.

[0051] Examples of the inorganic salts mentioned above include phosphates, magnesium salts, calcium salts, iron salts, and manganese salts. Examples of the organic micronutrients mentioned above include amino acids, vitamins, fatty acids, nucleic acids, and peptones, casamino acids, yeast extracts, and hydrolyzed soy protein containing these. When using a nutrient-requiring mutant strain that requires amino acids or other nutrients for growth, the required nutrients may be supplemented.

[0052] The alcohols that serve as substrates in the culture medium are preferably aliphatic alcohols, more preferably C12-22 aliphatic alcohols, and even more preferably C12-18 aliphatic alcohols.

[0053] More detailed examples of the above substrates include, but are not limited to, C12-22 aliphatic alcohols, which may be saturated or unsaturated alcohols, and may be straight-chain or branched-chain alcohols, such as lauryl alcohol, tridecyl alcohol, myristyl alcohol, pentadecyl alcohol, cetyl alcohol, heptadecyl alcohol, stearyl alcohol, isostearyl alcohol, nonadecyl alcohol, arachidyl alcohol, behenyl alcohol, palmitrail alcohol, oleyl alcohol, linoleyl alcohol, and linolenyl alcohol. The substrates listed above can be used individually or in combination of two or more.

[0054] The content of the above-mentioned substrate that may be contained in the culture medium (when the substrate is added) is preferably 1% by mass / volume or more, more preferably 1.5% by mass / volume or more, even more preferably 2% by mass / volume or more, and preferably 30% by mass / volume or less, more preferably 20% by mass / volume or less, and even more preferably 15% by mass / volume or less. Alternatively, it is preferably 1 to 30% by mass / volume, 1 to 20% by mass / volume, 1 to 15% by mass / volume, 1.5 to 30% by mass / volume, 1.5 to 20% by mass / volume, 1.5 to 15% by mass / volume, 2 to 30% by mass / volume, 2 to 20% by mass / volume, or 2 to 15% by mass / volume. In this specification, volume means volume at 25°C and 1 atmosphere.

[0055] The culture conditions should be such that Bola-type sophoroside and the like are fermented and produced by the mutant strain of the present invention. Culture is preferably carried out under aerobic conditions, and general methods such as aerated stirring culture and shaking culture can be applied. The culture temperature is preferably 20 to 33°C, more preferably 25 to 30°C, and even more preferably 28 to 30°C. The initial pH of the culture medium (at 30°C) is preferably 2 to 7, more preferably 3 to 6. The culture time is preferably about 24 to 200 hours, and more preferably 50 to 200 hours.

[0056] In the above culture, the mutant strain of the present invention may be cultured under conditions that allow cells to proliferate to produce Bola-type sophoroside and the like through fermentation, or the mutant strain of the present invention may be cultured in a dormant state, i.e., in a state where growth and proliferation have stopped, to produce Bola-type sophoroside and the like through fermentation.

[0057] The method for recovering Bola-type sophorosides and the like from the culture medium after incubation is not particularly limited and can be carried out according to known recovery methods. For example, Bola-type sophorosides and the like from the culture medium can be recovered or purified by solvent extraction using ethyl acetate, butanol, etc., fractional precipitation, liquid-liquid partitioning, column chromatography, high-performance liquid chromatography, etc., either alone or in appropriate combination.

[0058] As exemplary embodiments of the present invention, the following compositions, manufacturing methods, uses, or methods are further disclosed herein. However, the present invention is not limited to these embodiments.

[0059] [1] A yeast mutant strain in which a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5, and FAO1 or a corresponding polypeptide are functionally inhibited, expression suppressed, or inactivated, respectively. [2] The mutant strain according to [1], wherein FAO1 is a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 15, and the polypeptide corresponding to FAO1 is a polypeptide comprising an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 15. [3] The mutant strain according to [1], wherein the gene encoding a polypeptide consisting of the amino acid sequence shown in Sequence ID No. 5 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in Sequence ID No. 5, and the gene encoding FAO1 or a corresponding polypeptide are repressed, deleted, or inactivated, respectively. [4] The mutant strain according to [3], wherein FAO1 is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 15, and the polypeptide corresponding to FAO1 is a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 15. [5] The mutant strain according to [4], wherein the gene comprising the nucleotide sequence shown in SEQ ID NO: 4 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 4, and encoding a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 5 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5, and the gene comprising the nucleotide sequence shown in SEQ ID NO: 14 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 14, and encoding a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 15 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 15, is suppressed, deleted, or inactivated. [6] A mutant strain according to any one of [1] to [5], wherein the polypeptide comprising an amino acid sequence having at least 90% identity with the amino acid sequence shown in Sequence ID No. 5 is a putative transcription factor polypeptide comprising an amino acid sequence having at least 90% identity with the amino acid sequence shown in Sequence ID No. 5, preferably comprising an amino acid sequence having at least 90% identity with the amino acid sequence shown in Sequence ID No. 5 and having two Zinc Finger C2H2 type DNA binding domains, and the polypeptide corresponding to FAO1 or the polypeptide comprising an amino acid sequence having at least 90% identity with the amino acid sequence shown in Sequence ID No. 15 is a polypeptide comprising an amino acid sequence having at least 90% identity with the amino acid sequence shown in Sequence ID No. 15 and having aliphatic alcohol oxidase activity. [7] A mutant strain according to any one of [1] to [6], wherein the yeast is a microorganism of the genus Star Merella, preferably Star Merella bombicola. [8] A mutant strain according to any one of [1] to [7], wherein the productivity of Bola-type sophorosides and alkyl sophorosides is improved compared to a parent strain in which only FAO1 or a polypeptide equivalent thereto is functionally inhibited, expression suppressed, or inactivated.

[0060] [9] A method for producing a yeast mutant strain, comprising inhibiting the function, suppressing the expression, or inactivating a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5, and FAO1 or a polypeptide equivalent thereto, respectively.

[10] A method for improving the productivity of yeast, comprising inhibiting the function, suppressing the expression, or inactivating a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5, and FAO1 or a polypeptide equivalent thereto, by selecting at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides.

[11] The method according to

[10] , wherein the improvement in productivity of at least one selected from the group consisting of Bola-type sophoroside and alkyl sophoroside is an increase in the ratio of the production amount of at least one selected from the group consisting of Bola-type sophoroside and alkyl sophoroside and sophorolipid to the production amount of at least one selected from the group consisting of Bola-type sophoroside and alkyl sophoroside and sophorolipid.

[12] A method for suppressing the production ratio of sophorolipids during the production of at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides by yeast, comprising functional inhibition, expression suppression, or inactivation of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5 and FAO1 or a polypeptide equivalent thereof.

[13] The method according to

[12] , wherein the suppression of the production ratio of sophorolipid during the production of at least one selected from the group consisting of Bola-type sophoroside and alkyl sophoroside is the suppression of the ratio of the production amount of sophorolipid to the production amount of at least one selected from the group consisting of Bola-type sophoroside and alkyl sophoroside and sophorolipid during the production of at least one selected from the group consisting of Bola-type sophoroside and alkyl sophoroside.

[14] A method for improving the purity of at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides during the production of at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides by yeast, comprising inhibiting the function, suppressing expression, or inactivating a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5 and FAO1 or a polypeptide equivalent thereto.

[15] The method according to any one of [9] to

[14] , wherein FAO1 is a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 15, and the polypeptide corresponding to FAO1 is a polypeptide comprising an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 15.

[16] The method according to any one of the claims [9] to

[14] , comprising suppressing, deleting, or inactivating the expression of a gene encoding a polypeptide consisting of the amino acid sequence shown in Sequence ID No. 5 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in Sequence ID No. 5, and a gene encoding FAO1 or a polypeptide equivalent thereto.

[17] The method according to

[16] , wherein FAO1 is a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 15, and the polypeptide corresponding to FAO1 is a polypeptide comprising an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 15.

[18] The method according to

[17] , comprising suppressing, deleting, or inactivating the expression of a gene comprising the nucleotide sequence shown in SEQ ID NO: 4 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 4, and encoding a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 5 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5, and a gene comprising the nucleotide sequence shown in SEQ ID NO: 14 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 14, and encoding a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 15 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 15.

[19] The method according to any one of [9] to

[18] , wherein the polypeptide comprising an amino acid sequence having at least 90% identity with the amino acid sequence shown in Sequence ID No. 5 is a putative transcription factor polypeptide comprising an amino acid sequence having at least 90% identity with the amino acid sequence shown in Sequence ID No. 5, preferably comprising an amino acid sequence having at least 90% identity with the amino acid sequence shown in Sequence ID No. 5 and having two Zinc Finger C2H2 type DNA binding domains, and the polypeptide corresponding to FAO1 or the polypeptide comprising an amino acid sequence having at least 90% identity with the amino acid sequence shown in Sequence ID No. 15 is a polypeptide comprising an amino acid sequence having at least 90% identity with the amino acid sequence shown in Sequence ID No. 15 and having aliphatic alcohol oxidase activity.

[20] The method according to any one of [9] to

[19] , wherein the yeast is a microorganism of the genus Star Merella, preferably Star Merella bombicola.

[0061] A method for producing at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides, comprising culturing a yeast mutant strain described in any one of items

[21] , [1], to [8].

[22] The method according to

[21] , wherein the culture medium for cultivation contains alcohol as a substrate.

[23] The method according to

[22] , wherein the alcohol is an aliphatic alcohol, preferably at least one selected from the group consisting of C12-C22 aliphatic alcohols, and more preferably at least one selected from the group consisting of C12-C18 aliphatic alcohols.

[24] The method according to

[22] or

[23] , wherein the alcohol content in the culture medium is preferably 1% by mass / vol. or more, more preferably 1.5% by mass / vol. or more, even more preferably 2% by mass / vol. or more, and preferably 30% by mass / vol. or less, more preferably 20% by mass / vol. or less, even more preferably 15% by mass / vol. or less, or preferably 1 to 30% by mass / vol., 1 to 20% by mass / vol., 1 to 15% by mass / vol., 1.5 to 30% by mass / vol., 1.5 to 20% by mass / vol., 1.5 to 15% by mass / vol., 2 to 30% by mass / vol., 2 to 20% by mass / vol., or 2 to 15% by mass / vol.

[25] The method according to any one of

[21] to

[24] , wherein the culture medium for the culture contains glucose as a carbon source.

[26] The method according to any one of

[21] to

[25] , further comprising recovering at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides from the culture medium after incubation.

[27] The method according to any one of

[10] to

[26] , wherein at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides is a Bola-type sophoroside and an alkyl sophoroside. [Examples]

[0062] The present invention will be described in more detail below using examples, but the technical scope of the present invention is not limited to the following examples.

[0063] Example 1 (1) Extraction of genomic DNA from NBRC10243 strain Using Gentoru-kun (for yeast) High Recovery (Takara Bio Inc.), genomic DNA extraction and purification were performed from Starmerella bombicola strain NBRC10243 (ATCC22214) according to the attached protocol.

[0064] (2) Amplification of DNA fragments containing the hygromycin resistance gene Unless otherwise specified, all PCR enzymes used from this point forward were PrimeSTAR Max DNA Polymerase (Takara Bio). The self-excisable hygromycin resistance gene expression cassette six-PgalK-βrec-Ttkt-Pgpd-HygR-Ttkt-six (SEQ ID NO: 1), which has been confirmed to work with Star Merella Bombicola, was used as a template, and the hygromycin resistance gene expression cassette was amplified using primer 1 (SEQ ID NO: 2: TCGGAATTGACACATATAGGTCAATAGAGTATACTTATTTG) and primer 2 (SEQ ID NO: 3: TAAATCTAGATGATATATTATGCTCAACTTAAATGACCTACT).

[0065] (3) Amplification of 1 kbp upstream and 1 kbp downstream genomic DNA fragments of the seq1 gene (SEQ ID NO: 4) Using the genomic DNA of the NBRC10243 strain obtained in (1) as a template, a 1 kbp DNA fragment upstream of the seq1 gene was amplified using primer 3 (SEQ ID NO: TATCATCTAGATTTATCAATTGGTAAGAGGGAACGCGTAGCG) and primer 4 (SEQ ID NO: AGAGTCGACCTGCAGTCCAATTTCTAAGGCGCAAGCGACGCT), and a 1 kbp DNA fragment downstream of the seq1 gene was amplified using primer 5 (SEQ ID NO: GCCAAGCTTGCATGCCAACCCAACGCCTTGACAAGCTTTCCA) and primer 6 (SEQ ID NO: TGTGTCAATTCCGGAATTGTTGTCCGAATGCTCTGCGACGGC).

[0066] (4) Amplification of vector fragments Using pHSG298 (Takara Bio Inc.) as a template, the vector DNA fragment was amplified using primer 7 (SEQ ID NO: 10: GCATGCAAGCTTGGCACTGGCCGTCG) and primer 8 (SEQ ID NO: 11: CTGCAGGTCGACTCTAGAGGATCCCC).

[0067] (5) Preparation of the template plasmid pbJK47 for the introduced DNA fragment For the four PCR products described in (2), (3), and (4), each DNA fragment was purified using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.) and then ligated using the In-Fusion HD cloning kit (Clontech Inc.). The resulting plasmid solution was used to transform ECOS Competent E. coli DH5α strain (Nippon Gene Inc.), and the cell suspension was spread onto LB agar medium containing kanamycin and left to stand overnight at 37°C. Colony PCR was performed using the resulting colonies as templates and Sapphire Amp (Takara Bio Inc.) as the enzyme. The introduction of the target DNA fragment was confirmed using primer 9 (SEQ ID NO: 12: CTCTTCGCTATTACGCCAGC) and primer 10 (SEQ ID NO: 13: CACTTTATGCTTCCGGCTCG). Transformants containing plasmids in which gene introduction was confirmed were inoculated into 2 mL of LB liquid medium containing kanamycin and cultured overnight at 37°C. Plasmid purification was performed from this culture medium using NucleoSpin Plasmid EasyPure (Takara Bio Inc.), yielding plasmid pbJK47, which contained a DNA fragment ligated with 1 kbp downstream of the seq1 gene, the expression cassette six-PgalK-βrec-Ttkt-Pgpd-HygR-Ttkt-six (an autoexcisable hygromycin resistance gene), and 1 kbp upstream of the seq1 gene.

[0068] (6) Amplification of 1 kbp upstream and 1 kbp downstream genomic DNA fragments of the fao1 gene (SEQ ID NO: 14) Using the genomic DNA of the NBRC10243 strain obtained in (1) as a template, a 1 kbp DNA fragment upstream of the fao1 gene was amplified using primer 11 (SEQ ID NO: 16: GCCAAGCTTGCATGCGAAGGGGCTCTCCGAAGTACATCACTG) and primer 12 (SEQ ID NO: 17: TGTGTCAATTCCGGAAAAACGACAGAAAAGTGCTGAGGCCGC), and a 1 kbp DNA fragment downstream of the fao1 gene was amplified using primer 13 (SEQ ID NO: 18: TATCATCTAGATTTATATCACAAGTCACTATTTACTTGTTTA) and primer 14 (SEQ ID NO: 19: AGAGTCGACCTGCAGCTCAATGAACTGAGACAGCAGCTTGTC).

[0069] (7) Preparation of the template plasmid pbJK27 for the introduced DNA fragment For the four PCR products described in (2), (4), and (6), each DNA fragment was purified using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.) and then ligated using the In-Fusion HD cloning kit (Clontech Inc.). The resulting plasmid solution was used to transform ECOS Competent E. coli DH5α strain (Nippon Gene Inc.), and the cell suspension was spread onto LB agar medium containing kanamycin and left to stand overnight at 37°C. Colony PCR was performed using the resulting colonies as templates and Sapphire Amp (Takara Bio Inc.) as the enzyme. The introduction of the target DNA fragment was confirmed using primer 9 (SEQ ID NO: 12) and primer 10 (SEQ ID NO: 13). Transformants containing plasmids in which gene introduction was confirmed were inoculated into 2 mL of LB liquid medium containing kanamycin and cultured overnight at 37°C. Plasmid purification was performed from this culture medium using NucleoSpin Plasmid EasyPure (Takara Bio Inc.), yielding plasmid pbJK27, which contained a DNA fragment ligated with the upstream 1 kbp of the fao1 gene, the self-excisable hygromycin resistance gene expression cassette six-PgalK-βrec-Ttkt-Pgpd-HygR-Ttkt-six, and the downstream 1 kbp of the fao1 gene.

[0070] (8) Preparation of introduced DNA fragments Using plasmid pbJK47 as a template, a DNA fragment for seq1 gene disruption was amplified using primer 15 (SEQ ID NO: 20: CAACCCAACGCCTTGACAAGC) and primer 16 (SEQ ID NO: 21: TCCAATTTCTAAGGCGCAAGC). Similarly, using plasmid pbJK27 as a template, a DNA fragment for fao1 gene disruption was amplified using primer 17 (SEQ ID NO: 22: GAAGGGGCTCTCCGAAGTACA) and primer 18 (SEQ ID NO: 23: CTCAATGAACTGAGACAGCAG). Each obtained PCR product was treated with DpnI (Takara Bio Inc.), and the DNA fragments were further purified using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.).

[0071] (9) Insertion of DNA fragments into NBRC10243 strain and creation of Δseq1 strain Using the DNA fragment for seq1 gene disruption obtained in (8), the NBRC10243 strain was transformed by electroporation (neppazine). The transformed cell saturation was spread onto YPD+hyg agar medium (1 mass / vol.% yeast extract, 2 mass / vol.% tryptone, 2 mass / vol.% glucose, 1.5 mass / vol.% agar, 0.05 mass / vol.% hygromycin) and left to stand at 30°C for 2 days. The resulting colonies were inoculated into 5 mL of YNB+GAL liquid medium (0.67 mass / vol.% Yeast Nitrogen Base w / o Amino Acids, 2 mass / vol.% galactose) and cultured with shaking at 30°C for 2 days. The culture medium was spread onto YPD agar medium (1 mass / vol.% yeast extract, 2 mass / vol.% tryptone, 2 mass / vol.% glucose, 1.5 mass / vol.% agar) and left to stand at 30°C for 2 days. The obtained colonies were inoculated onto YPD agar and YPD+hyg agar, respectively. PCR was performed using colonies that grew only on YPD agar as templates, and sequencing analysis of the amplified fragments was conducted. It was confirmed that the seq1 gene was disrupted, and this strain was designated as the Δseq1 strain.

[0072] (10) Insertion of DNA fragments into strain NBRC10243 and creation of strain Δfao1 The NBRC10243 strain was transformed using the DNA fragment for disrupting the fao1 gene obtained in (8) by electroporation (neppageen). Subsequently, a Δfao1 strain in which the fao1 gene was disrupted was created using the method described in (9).

[0073] (11) Preparation of the Δfao1Δseq1 strain The DNA fragment for disrupting the seq1 gene obtained in (8) was used to transform the Δfao1 strain obtained in (10) by electroporation (neppagene). Subsequently, the Δfao1Δseq1 strain, in which both the fao1 gene and the seq1 gene were disrupted, was created using the method described in (9).

[0074] (12) Glycolipid production culture Four strains, NBRC10243 and Δseq1, Δfao1, and Δfao1Δseq1 obtained in (9), (10), and (11), were inoculated into YPD liquid medium (1% by mass / volume yeast extract, 2% by mass / volume tryptone, 2% by mass / volume glucose) and cultured with shaking at 30°C for 1 day. The obtained preculture solution was inoculated (1 vol%) into glycolipid production medium 3 (0.5 mass / vol% trisodium citrate dihydrate, 0.4 mass / vol% yeast extract, 0.15 mass / vol% ammonium chloride, 0.07 mass / vol% magnesium sulfate heptahydrate, 0.05 mass / vol% sodium chloride, 0.027 mass / vol% calcium chloride dihydrate, 0.1 mass / vol% potassium dihydrogen phosphate, 0.016 mass / vol% dipotassium hydrogen phosphate, 15 mass / vol% glucose, 2.6 mass / vol% oleyl alcohol) and cultured with shaking at 30°C.

[0075] (13) Confirmation of glucose-lipid productivity After 4 days of glycolipid production culture, 3 mL of the culture medium was collected, and 3 mL of hexane was added and mixed for 5 seconds. After centrifugation at 3000 rpm and 25°C for 5 minutes, the hexane fraction of the supernatant was removed. Next, 3 mL of butanol was added to the remaining solution and mixed for 5 seconds. After centrifugation at 3000 rpm and 25°C for 5 minutes, the entire butanol fraction was collected. Another 3 mL of butanol was added to the remaining solution, and the same procedure was repeated to collect the entire butanol fraction. The collected butanol fraction was volatilized by blowing nitrogen gas, and the weight of the dissolved precipitate was measured to calculate the glycolipid concentration in the culture medium. Glycolipid production was confirmed at 51.6 g / L for strain NBRC10243, 56.1 g / L for strain Δseq1, 30.8 g / L for strain Δfao1, and 46.0 g / L for strain Δfao1Δseq1.

[0076] (14) Composition analysis of produced glycolipids The glycolipid precipitates obtained in (13) were dissolved in 50% by volume ethanol to a concentration of 10 g / L each to prepare samples for glycolipid composition analysis. Subsequently, the samples were filtered using an Acroprep Advance wwPTFE 96-well filter plate (Pall Corporation), and their composition was analyzed by HPLC-CAD. An LC-2050C (Shimadzu Corporation) and a Corona CAD charged particle detector (Thermo Fisher Scientific) were used as the HPLC-CAD system, and an L-column 4.6 × 150 mm, 5 μm was used as the column. Two types of eluents were used: Eluent A, prepared with MilliQ water containing 5 mM acetic acid and 10 mM ammonium acetate, and Eluent B, prepared with a solvent of acetonitrile and MilliQ mixed in a 95:5 volume ratio containing 5 mM acetic acid and 10 mM ammonium acetate. Gradient elution was performed by varying the ratio of the two eluents flowing through the flow path. The gradient conditions were as follows: from 0-5 min of analysis, the ratio of eluent A was 60 vol% and eluent B was 40 vol%; from 5-10 min, the ratio of eluent B was linearly increased to 50 vol% each; from 10-30 min, the ratio of eluent A was linearly increased to 40 vol% and eluent B was linearly increased to 60 vol%; from 30-50 min, the ratio of eluent A was linearly increased to 0 vol% and eluent B was linearly increased to 100 vol%; from 50-70 min, the ratio of eluent B was maintained at 100 vol%; and finally, from 70-75 min, the ratio of eluent B was linearly decreased to 70 vol% and eluent B was linearly decreased to 30 vol%. The analysis was performed under the conditions of a column temperature of 40°C and a sample injection volume of 5 μL. The compositional ratios of the three products—Bola sophoroside, alkyl sophoroside, and sophorolipid—were calculated from the peak area values ​​of the obtained chromatograms. Each peak was identified by comparing its retention time with that of peaks identified by HPLC-MS (LCMS-2020, Shimadzu Corporation) using the same column and analytical conditions. The results are shown in Table 1 below.

[0077] [Table 1]

[0078] Compared to the fao1 gene knockout strain alone, the fao1 and seq1 gene knockout strain showed suppressed sophorolipid production ratio and output, while significantly improving the production ratio and output of Bola sophoroside and alkyl sophoroside.

[0079] Example 2 (1) Bacterial strain used Starmerella bombicola T1Δfao1::ade strain (PCT / JP2024 / 037995) and T1Δseq1Δfao1 strain were used. T1Δfao1::ade strain is a strain in which the fao1 gene of the adenine-requiring Starmerella bombicola T1 strain (accession number NITE BP-04096) was disrupted by introducing a gene encoding a phosphoribosylglycinamide formyltransferase-like protein (sequence number 41) that removes adenine requirement (sequence number 40) into the fao1 gene region. T1Δseq1Δfao1 strain was prepared by disrupting the fao1 gene using T1Δseq1::ade strain (PCT / JP2024 / 037995) as a host, according to the method described in Example 1(11). The T1Δseq1::ade strain is a T1 strain in which the seq1 gene region has been disrupted by introducing a gene encoding a phosphoribosylglycinamide formyltransferase-like protein into the seq1 gene region.

[0080] (2) Glycolipid production culture, confirmation of glycolipid productivity, and compositional analysis of produced glycolipids Using two strains, T1Δfao1::ade and T1Δseq1Δfao1, the glycolipid productivity was confirmed using the methods described in Examples 1(12) and (13). Furthermore, the composition of the produced glycolipids was analyzed using the culture supernatant according to the method described in Example 1(14). The results are shown in Table 2 below.

[0081] [Table 2]

[0082] In T1 strains with different hosts, compared to fao1 gene-only knockout strains, the double knockout strains of the fao1 and seq1 genes showed suppression of the sophorolipid production ratio and improvement in the production ratio and volume of Bola sophoroside and alkyl sophoroside.

Claims

1. A yeast mutant strain in which a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5, and FAO1 (fatty alcohol oxide 1) or a corresponding polypeptide are functionally inhibited, expression suppressed, or inactivated, respectively.

2. The mutant strain according to claim 1, wherein FAO1 is a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 15, and the polypeptide corresponding to FAO1 is a polypeptide comprising an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO:

15.

3. The mutant strain according to claim 1, wherein the gene encoding a polypeptide consisting of the amino acid sequence shown in Sequence ID No. 5 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in Sequence ID No. 5, and the gene encoding FAO1 or a polypeptide equivalent thereto are each suppressed, deleted, or inactivated.

4. The mutant strain according to claim 3, wherein FAO1 is a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 15, and the polypeptide corresponding to FAO1 is a polypeptide comprising an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO:

15.

5. The mutant strain according to claim 4, wherein the gene comprising the nucleotide sequence shown in SEQ ID NO: 4 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 4, and encoding a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 5 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5, and the gene comprising the nucleotide sequence shown in SEQ ID NO: 14 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 14, and encoding a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 15 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 15, is each suppressed, deleted, or inactivated.

6. The mutant strain according to claim 1, wherein the yeast is a microorganism of the genus Star Merella.

7. A method for producing a yeast mutant strain, comprising inhibiting the function, suppressing the expression, or inactivating a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5, and FAO1 or a polypeptide equivalent thereto, respectively.

8. A method for improving the productivity of yeast, comprising inhibiting the function, suppressing the expression, or inactivating a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5, and FAO1 or a polypeptide equivalent thereto, by selecting at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides.

9. The method according to claim 8, wherein the improvement in productivity of the at least one selected from the group consisting of Bola-type sophoroside and alkyl sophoroside is an increase in the ratio of the production amount of the at least one selected from the group consisting of Bola-type sophoroside and alkyl sophoroside to the production amount of the at least one selected from the group consisting of Bola-type sophoroside and alkyl sophoroside and sophorolipid.

10. A method for suppressing the production ratio of sophorolipids during the production of at least one type of sophoroside selected from the group consisting of Bola-type sophorosides and alkyl sophorosides by yeast, comprising, in yeast, functional inhibition, expression suppression, or inactivation of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 5, and FAO1 or a polypeptide equivalent thereto.

11. A method for producing at least one selected from the group consisting of Bola-type sophorosides and alkyl sophorosides, comprising culturing a mutant strain according to any one of claims 1 to 6.

12. The method according to claim 11, wherein the culture medium for the culture contains alcohol as a substrate.

Images