Peptide-encapsulated ferritin

Abstract

The present invention provides a peptide delivery means capable of avoiding disruption of a cell membrane, immunogenicity, and toxicity. More specifically, the present invention provides the following (1) to (3). (1) A ferritin enclosing a peptide that comprises 3 to 19 amino acid residues and satisfies the following conditions: a) -10.2 ≤ X ≤ 5.9 and 445 ≤ Y ≤ 2524 (where X represents the charge of the peptide at pH 9 and Y represents the chemical formula weight of the peptide). (2) A peptide intracellular delivery agent containing the ferritin enclosing the peptide. (3) A method for producing the ferritin enclosing the peptide.

Description

[Technical field]

[0001] The present invention relates to peptide-encapsulated ferritin and the like. [Background technology]

[0002] Peptides that target intracellular proteins and nucleic acids and have physiological activity are expected to be used as pharmaceuticals (Non-Patent Document 1). However, many of these peptides have issues with cell membrane permeability, and various intracellular delivery technologies are being investigated.

[0003] An approach has been reported in which a target peptide is encapsulated in nanoparticles or microparticles, such as liposomes, and the liposomes are fused with a cell membrane to deliver the target peptide into cells (Patent Document 1).Another approach has been reported in which a target peptide is fused with a molecule or peptide that has cell membrane permeability, and then permeates the cell membrane or is taken up into the cell via an endosome to deliver the target peptide into cells (Non-Patent Document 2).

[0004] Ferritin is a globular protein with a cavity composed of multiple monomers, which is universally present in animals, plants, and microorganisms. In animals such as humans, it is known that there are two types of monomers, H chain and L chain, as monomers that compose ferritin, and that ferritin is a multimer (often a mixture of H chain and L chain) composed of 24 monomers, has a cage-like shape with an outer diameter of 12 nm, and has a cavity with an inner diameter of 7 nm. Ferritin is deeply involved in the homeostasis of iron elements in living organisms or cells, and is known to play a role in physiological functions such as transport and storage of iron because it can retain iron in its cavity. In addition, ferritin is known to be taken up by transferrin receptor-presenting cells (Non-Patent Document 3).

[0005] Ferritin is also being considered for use as a DDS carrier that encapsulates low-molecular-weight organic compounds in its lumen (Patent Document 2), and is also used in the production of electronic devices. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] U.S. Patent No. 4,515,736 [Patent Document 2] China Patent Application Publication No. 106110333 [Non-patent literature]

[0007] [Non-Patent Document 1] Y. Hayashi et al. ACS Chem. Biol. 2012;7(3):607-613 [Non-Patent Document 2] Z. Guo et al. Biomed Rep. 2016; 4(5): 528-534 [Non-Patent Document 3] L. Li et al. Proc Natl Acad Sci USA. 2010;107(8):3505-10 Summary of the Invention [Problem to be solved by the invention]

[0008] As mentioned above, the use of liposomes or cell-penetrating peptides has been reported as an approach to deliver target peptides into cells. However, liposomes and cell-penetrating peptides are usually positively charged in the neutral pH region, and therefore have the problem of disrupting cell membranes through interaction with the cell membrane. In addition, liposomes have the problem that liposomes may exhibit immunogenicity and that metabolites of liposomes may exhibit toxicity.

[0009] Therefore, an object of the present invention is to provide a means for delivering peptides that can avoid the above-mentioned cell membrane destruction, immunogenicity and toxicity. [Means for solving the problem]

[0010] As a result of intensive research, the inventors have found that a specific peptide can be encapsulated in ferritin, that such a specific peptide can be used to produce peptide-encapsulated ferritin, and that such a peptide-encapsulated ferritin can be used to deliver the specific peptide into a specific cell.

[0011] Ferritin is negatively charged in the neutral pH range, and is taken up into specific cells via the transferrin receptor. Therefore, the above problem can be solved by using ferritin encapsulating a specific peptide to deliver the specific peptide into cells without destroying the cell membrane. In addition, since ferritin is a natural protein that naturally exists in mammals such as humans, the problem of immunogenicity can be solved by matching the type of ferritin (the mammalian species from which ferritin is derived) with the mammalian species to which peptide-encapsulated ferritin is administered. Furthermore, ferritin is composed of natural amino acids, and in light of the fact that metabolites of natural amino acids are also natural substances present in living organisms, there is no concern about cytotoxicity of metabolites of natural amino acids, so the problem of cytotoxicity caused by metabolites can also be solved.

[0012] As described above, the present inventors have succeeded in solving the above problems and have completed the present invention. [1] The peptide is composed of 3 to 19 amino acid residues, and The following conditions: a) -10.2≦X≦5.9 and 445≦Y≦2524; (where X represents the charge of the peptide at pH 9 and Y represents the formula weight of the peptide) Peptide-encapsulated ferritin that meets the above requirements. [2] A peptide-encapsulated ferritin as described in [1], in which the peptide is composed of 4 to 16 amino acid residues. [3] The peptide satisfies the following conditions: b) -10.2≦X≦0.0 and 445≦Y≦2524; or c) 3.7≦X≦5.9 and 445≦Y≦2524 (where X and Y are the same as in [1]) A peptide-encapsulated ferritin of (1) or (2) that satisfies the above requirements. [4] An intracellular delivery agent for a peptide, comprising: Contains peptide-encapsulated ferritin, The peptide is composed of 3 to 19 amino acid residues, and The following conditions: a) -10.2≦X≦5.9 and 445≦Y≦2524; (where X represents the charge of the peptide at pH 9 and Y represents the formula weight of the peptide) An intracellular peptide delivery agent that satisfies the above requirements. [5] The agent according to [4], wherein the peptide is delivered intracellularly to a human cell. [6] The agent according to [4] or [5], wherein the peptide is delivered intracellularly to a cancer cell. [7] A method for producing peptide-encapsulated ferritin, comprising the steps of: 1) dissociating ferritin in a buffer solution of pH 3.0 or less in the presence or absence of a peptide; and 2) Coexisting the dissociated ferritin and the peptide in a buffer solution having a pH of 5.0 or more and 10.0 or less to produce peptide-encapsulated ferritin; Including, The peptide is composed of 3 to 19 amino acid residues, and The following conditions: a) -10.2≦X≦5.9 and 445≦Y≦2524; (where X represents the charge of the peptide at pH 9 and Y represents the formula weight of the peptide) A manufacturing method that satisfies the above requirements. Effect of the Invention

[0013] The peptide-encapsulated ferritin of the present invention can deliver a specific peptide into cells without destroying cell membranes. The peptide-encapsulated ferritin of the present invention can also avoid both immunogenicity and cytotoxicity caused by metabolites. The peptide-encapsulated ferritin of the present invention can also specifically and reproducibly deliver a specific peptide into transferrin receptor-presenting cells (particularly cells with high expression of transferrin receptor). [Brief description of the drawings]

[0014] [Figure 1] FIG. 1 shows confirmation of the formation of a complex between ferritin (FTH) and a peptide (PKC-F) by column chromatography. [Diagram 2] FIG. 2 shows the results of LC-MS analysis of a peptide (PKC-F) encapsulated in ferritin (FTH). [Diagram 3] FIG. 3 shows the results of LC-MS analysis of a peptide (PKC-F). [Figure 4] FIG. 4 shows a transmission electron microscope (TEM) image of peptide (PKC-F)-encapsulating ferritin (FTH). [Diagram 5] FIG. 5 shows a comparison of the surface charges of ferritin (FTH) without peptide (PKC-F) encapsulated therein and ferritin (FTH) encapsulated with peptide (PKC-F). [Figure 6] Figure 6 shows the results of measuring the uptake of peptide (PKC-F) into transferrin receptor (TfR)-presenting cells (SKBR-3 cells) by fluorescence-activated cell sorting (FACS). Peptide (PKC-F) was used in a state where it was encapsulated in ferritin (FTH) (test control) and in a state where only peptide (PKC-F) was present (negative control). [Figure 7]Figure 7 shows the results of measuring the uptake of peptide (PKC-F) into transferrin receptor TfR-presenting cells (SKBR-3 cells) using a two-photon excitation fluorescence microscope. Peptide (PKC-F) was used in a state where it was encapsulated in ferritin (FTH) (test control) and in a state where only peptide (PKC-F) was present (negative control). [Figure 8] FIG. 8 shows confirmation of the formation of a complex between ferritin (FTH) and a peptide (FAM-SV40) by column chromatography. [Figure 9] 9 shows the results of measuring the uptake of peptide (FAM-SV40) into transferrin receptor TfR-presenting cells (SKBR-3 cells) by fluorescence-activated cell sorting (FACS). The peptide (FAM-SV40) was used in a state where it was encapsulated in ferritin (FTH) (test control) and in a state where only the peptide (FAM-SV40) was present (negative control). [Figure 10] FIG. 10 shows a comparison of peptide (FAM-SV40) uptake between transferrin receptor TfR-presenting cells (SKBR-3 cells with high TfR expression and HEK293E cells with low TfR expression) by fluorescence-activated cell sorting (FACS). [Figure 11] Figure 11 shows a comparison of peptide (FAM-SV40) uptake between transferrin receptor TfR-presenting cells (SKBR-3 cells with high TfR expression and HEK293E cells with low TfR expression) by fluorescence activated cell sorting (FACS). The results of Figure 10 are plotted in Figure 11. [Figure 12] FIG. 12 shows (A) the presence of an MS peak of a peptide (ClAc-FHC) derived from ferritin (FTH) containing the peptide (ClAc-FHC) when the disassociation / reassociation process was performed, and (B) the absence of the same MS peak when the disassociation / reassociation process was not performed. [Figure 13]FIG. 13 shows the presence of MS peaks of peptides (EGFR, cyloRGDfV, or FGF3-FP16) derived from ferritin (FTH) containing peptides (EGFR, cyloRGDfV, or FGF3-FP16) when the disassociation and reassociation processes were performed. [Figure 14] FIG. 14 shows the presence of MS peaks of peptides (Hymenistatin I, Ex10, or ανβ6) derived from ferritin (FTH) containing peptides (Hymenistatin I, Ex10, or ανβ6) when the disassociation and reassociation process was performed. [Figure 15] FIG. 15 shows the presence of MS peaks of peptides (NRP-1-2, Murepavadin, or Pakti-L1) derived from ferritin (FTH) containing peptides (NRP-1-2, Murepavadin, or Pakti-L1) when the disassociation and reassociation process was performed. [Figure 16] FIG. 16 shows the presence of MS peaks of peptides (NS, GRP78-3, or FBP0032) derived from ferritin (FTH) containing peptides (NS, GRP78-3, or FBP0032) when the disassociation and reassociation process was performed. [Figure 17] FIG. 17 shows the presence of an MS peak of a peptide (FBP0033) derived from ferritin (FTH) containing the peptide (FBP0033) when the disassociation and reassociation process was carried out. [Figure 18]Figure 18 shows the correlation between the charge of peptides at pH 9 and the chemical formula weight of peptides for the inclusion of various peptides in ferritin (FTH) (three trials). ●: Peptides confirmed to be included with good reproducibility in three trials; △: Peptides confirmed to be included in two or fewer trials; ×: Peptides not confirmed to be included even once. That is, peptides that satisfied the conditions a) -10.2≦peptide charge (X) at pH 9≦5.9 and 445≦peptide formula weight (Y)≦2524 were able to be included in ferritin. Furthermore, among the peptides that satisfied the above conditions, peptides that satisfied the conditions b) -10.2≦X≦0.0 and 445≦Y≦2524, or c) 3.7≦X≦5.9 and 445≦Y≦2524 were able to be included in ferritin with good reproducibility. [Figure 19] FIG. 19 shows confirmation of the formation of a complex between ferritin (FTL) and a peptide (PKC-F) by column chromatography. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0015] The present invention relates to a peptide comprising 3 to 19 amino acid residues, The following conditions: a) -10.2≦X≦5.9 and 445≦Y≦2524; (where X represents the charge of the peptide at pH 9 and Y represents the formula weight of the peptide) To provide a peptide-encapsulated ferritin that satisfies the above requirements.

[0016] The amino acids constituting the peptide are not particularly limited as long as they are compounds having both an amino group and a carboxy group. For example, the amino acids constituting the peptide may be natural amino acids (20 types of L-α-amino acids) constituting proteins, or non-natural amino acids that do not constitute proteins. Examples of natural amino acids include L-alanine (A), L-asparagine (N), L-cysteine ​​(C), L-glutamine (Q), L-isoleucine (I), L-leucine (L), L-methionine (M), L-phenylalanine (F), L-proline (P), L-serine (S), L-threonine (T), L-tryptophan (W), L-tyrosine (Y), L-valine (V), L-aspartic acid (D), L-glutamic acid (E), L-arginine (R), L-histidine (H), L-lysine (K), and glycine (G). As the unnatural amino acid, for example, any unnatural amino acid in the L- or D-form (eg, α-amino acids, β-amino acids, and γ-amino acids) can be used. More specifically, examples of unnatural amino acids include 2,4-diaminobutanoic acid (Dab), 2,3-diaminopropionic acid (Dap), ornithine, homohistidine, homophenylalanine, cycloleucine, 1-aminocyclohexanecarboxylic acid, carboxycyclopropylamine, 2-aminocyclohexanecarboxylic acid, 1-aminocyclobutanecarboxylic acid, tert-leucine, norvaline, norleucine, pyroglutamine, penicillamine, homoamino acids, 4-aminobutyric acid, 6-aminohexanoic acid, 7-aminoheptanoic acid, 4-amino-3-hydroxybutyric acid, 5-aminolevulinic acid, D-2-aminoadipic acid, and modified compounds of the above natural amino acids and unnatural amino acids (e.g., N-alkylated compounds such as N-methylated compounds, carbobenzoxyaminated compounds, tert-butoxycarbonylated compounds, 9-fluorenylmethyloxycarbonylated compounds, and azido compounds).

[0017] A peptide may be composed of only natural amino acids, only non-natural amino acids, or a mixture of natural and non-natural amino acids. A peptide may also be one in which the N-terminal amino group and the C-terminal carboxy group are protected or not protected. Examples of the protecting group for the N-terminal amino group include an alkylcarbonyl group (acyl group) (e.g., an acetyl group, a propoxy group, a butoxycarbonyl group such as a tert-butoxycarbonyl group), an alkyloxycarbonyl group (e.g., a fluorenylmethoxycarbonyl group), an aryloxycarbonyl group, and an arylalkyl(aralkyl)oxycarbonyl group (e.g., a benzyloxycarbonyl group). Examples of the protecting group for the C-terminal carboxy group include a group capable of forming an ester or an amide. Examples of groups capable of forming an ester or amide include alkyloxy groups (e.g., methyloxy, ethyloxy, propyloxy, butyloxy, pentyloxy, hexyloxy), aryloxy groups (e.g., phenyloxy, naphthyloxy), aralkyloxy groups (e.g., benzyloxy), and amino groups.

[0018] The peptide may have a main chain composed of an amide bond and a carbon chain. Examples of the carbon chain include alkylene (e.g., C1-C6 alkylene such as methylene, ethylene, propylene, butylene, pentylene, and hexylene), cycloalkylene (e.g., C3-C8 cycloalkylene such as cyclopropylene, cyclobutylene, cyclopentylene, cyclohexylene, cycloheptylene, and cyclooctylene), and arylene (e.g., C6-C12 arylene such as phenylene and naphthylene). Alternatively, the peptide may have a main chain composed of a bond structure other than an amide bond and / or a chain structure other than a carbon chain. Examples of the bond structure other than an amide bond include an N-alkylamide bond (e.g., an amide bond having a C1-C6 alkyl on the nitrogen atom, such as an N-methylamide bond or an N-ethylamide bond), an ester bond, an ether bond, a disulfide bond, a thioether bond, and a thioester bond. Examples of chain structures other than carbon chains include structures containing heterocycles (eg, oxazole, methyloxazole, thiazole, triazole).

[0019] The peptide may also have a linear or branched, or cyclic structure. For example, a peptide having a cyclic structure may be one in which the N-terminal amino acid residue and the C-terminal amino acid residue are cyclized via an amide bond. A peptide containing multiple (e.g., two) cysteine ​​residues can form a cyclic structure by forming a disulfide bond via a thiol group in the side chain of the cysteine ​​residue. Furthermore, even a peptide containing one cysteine ​​residue can form a cyclic structure by binding to either the N-terminal amino acid residue or the C-terminal amino acid residue.

[0020] The number of amino acid residues constituting the peptide is 3 to 19. The number of amino acid residues constituting the peptide may be preferably 4 or more. The number of amino acid residues constituting the peptide may also be 18 or less, preferably 17 or less, more preferably 16 or less. More specifically, the number of amino acid residues constituting the peptide may be 3 to 18, 3 to 17, 3 to 16, 4 to 18, 4 to 17, or 4 to 16.

[0021] In the present invention, the peptide encapsulated in ferritin satisfies the following conditions, as shown in FIG. a) -10.2≦X≦5.9 and 445≦Y≦2524; (where X represents the charge of the peptide at pH 9 and Y represents the formula weight of the peptide)

[0022] The value of the chemical formula weight of a peptide can be calculated as the sum of the products of the atomic weights and the numbers of atoms based on the composition formula of the peptide.

[0023] The charge of a peptide at pH 9 can be evaluated using ChemAxon (O.Toure et. al., Oil Gas Sci. Technol. 2013, 68, 281-297.) (see Examples), but when evaluation with ChemAxon is not desired (e.g. when very specific peptides are used that are difficult or imprecise to evaluate with ChemAxon), it may be evaluated by the experimental method described in L.Settimo et. al., Pharm. Res. 2014, 31, 1082-1095.

[0024] Although it is not desired that the present invention be restricted by theory, the following is thought to be the reason why peptides satisfying the above conditions are encapsulated in ferritin.

[0025] (1) Why the condition -10.2≦X is desirable In an aqueous solution with a pH higher than pH 5, ferritin is strongly negatively charged. Therefore, at the pH of the solution used for encapsulation of ferritin (e.g., pH 9), it is considered that molecules that are neutrally to positively charged are more likely to be encapsulated in ferritin, while strongly negatively charged molecules are less likely to be encapsulated in ferritin. Therefore, strongly negatively charged peptides with X > -10.2 are considered to be less likely to be encapsulated in ferritin due to electrostatic repulsion with ferritin. On the other hand, for peptides with -10.2 ≤ X, since the force for ferritin to form a cage-like supramolecular structure is stronger than the repulsion of negative charges between the peptide and ferritin, there is a possibility of being encapsulated in ferritin.

[0026] (2) Reasons why the condition of X ≤ 5.9 is desirable Peptides that are too strongly positively charged may adsorb peptides inside and outside ferritin due to electrostatic interaction, preventing the formation of the cage-like structure of ferritin and may not be encapsulated. Also, strongly positively charged peptides tend to aggregate and form particles of a size that cannot be encapsulated in ferritin, and there is also a possibility of not being encapsulated.

[0027] (3) Reasons why the condition of 445 ≤ Y is desirable Peptides with too small a chemical formula weight may flow out by diffusion from inside ferritin during the formation of the cage-like structure of ferritin, and there is a possibility of being difficult to encapsulate.

[0028] (4) Reasons why the condition of Y ≤ 2524 is desirable The diameter of the ferritin lumen is 7 nm, and due to the large chemical formula weight, it is considered that bulky molecules are difficult to be encapsulated in ferritin.

[0029] Preferably, from the viewpoint of improving the reproducibility of peptide encapsulation by ferritin, etc., the peptide satisfies the following conditions: b) -10.2 ≤ X ≤ 0.0, and 445 ≤ Y ≤ 2524, or c) 3.7 ≤ X ≤ 5.9, and 445 ≤ Y ≤ 2524

[0030] (5) Reasons for excluding 0.0 < X < 3.7 Peptides that have a relatively large formula weight and are not very charged are thought to be difficult to be encapsulated in ferritin because the peptide molecules themselves aggregate and form particles of a size that cannot be encapsulated in ferritin.

[0031] In the present invention, ferritin can be used from various animals.The animals from which ferritin is derived include, for example, mammals or birds (e.g., chickens), and preferably mammals.The mammals include, for example, primates (e.g., humans, monkeys, chimpanzees), rodents (e.g., mice, rats, hamsters, guinea pigs, rabbits), livestock and working mammals (e.g., cows, pigs, sheep, goats, horses).

[0032] It is known that in animals such as humans, there are two types of monomers, ferritin H chain and L chain, as the ferritin monomers that constitute ferritin, and ferritin is a multimer (often a mixture of H chain and L chain) that is composed of 24 monomers.Therefore, in the present invention, ferritin that is composed only of ferritin H chain, ferritin that is composed only of ferritin L chain, and ferritin that is composed of a mixture of ferritin H chain and L chain can be used.

[0033] As the ferritin monomer, either a natural ferritin monomer or a recombinant ferritin monomer capable of forming a 24-mer can be used. For example, the recombinant ferritin monomer may be modified in the flexible linker region between the six α-helices that constitute the ferritin monomer. Examples of such recombinant ferritin monomers include ferritin monomers in which a functional peptide has been inserted into a flexible linker region between the first and second, the second and third, the third and fourth, the fourth and fifth, or the fifth and sixth of the six α-helices constituting the ferritin monomer, counting from the N-terminus (see, for example, U.S. Patent Application Publication No. 2016 / 0060307; Jae Og Jeon et al., ACS Nano (2013), 7 (9), 7462-7471; Sooji Kim et al., Biomacromolecules (2016), 17 (3), 1150-1159; Young Ji Kang et al., Biomacromolecules (2012), 13 (12), 4057-4064). For example, in the human ferritin H chain (SEQ ID NO: 1) and the human ferritin L chain (SEQ ID NO: 2), the 1st to 6th α-helices counting from the N-terminus of the six α-helices are as shown in Table 1. Thus, the flexible linker region of the human ferritin H chain (SEQ ID NO: 1) is the flexible linker region between the 1st and 2nd (region consisting of amino acid residues at positions 43 to 49), the flexible linker region between the 2nd and 3rd (region consisting of amino acid residues at positions 78 to 96), the flexible linker region between the 3rd and 4th (region consisting of amino acid residues at positions 125 to 127), the flexible linker region between the 4th and 5th (position of amino acid residue at position 138), or the flexible linker region between the 5th and 6th (region of amino acid residues at positions 160 to 164).In addition, the flexible linker region of the human ferritin L chain (sequence number 2) is the flexible linker region between the first and second residues (region consisting of amino acid residues at positions 38 to 45), the flexible linker region between the second and third residues (region consisting of amino acid residues at positions 74 to 92), the flexible linker region between the third and fourth residues (region consisting of amino acid residues at positions 121 to 123), the flexible linker region between the fourth and fifth residues (position 134 of the amino acid residue), or the flexible linker region between the fifth and sixth residues (region consisting of amino acid residues at positions 155 to 159).

[0034] [Table A]

[0035] The recombinant feritin monomer may also be modified in its N-terminal region and / or C-terminal region. The N-terminus of the ferritin monomer is exposed on the surface of the multimer, and its C-terminus cannot be exposed on the surface. Therefore, the peptide portion added to the N-terminus of the ferritin monomer is exposed on the surface of the multimer and can interact with target materials present outside the multimer (e.g., International Publication No. 2006 / 126595). On the other hand, the C-terminus of the ferritin monomer can interact with organic compounds contained in the ferritin lumen by modifying its amino acid residues (e.g., YJ Kang, Biomacromolecules. 2012, vol. 13 (12), 4057). Such recombinant feritin monomers include, for example, ferritin monomers with functional peptides added to the N-terminus or C-terminus.

[0036] From the viewpoint of clinical application, the ferritin is preferably human ferritin. As the human ferritin, human ferritin composed only of human ferritin H chain, human ferritin composed only of human ferritin L chain, and human ferritin composed of a mixture of human ferritin H chain and L chain can be used.

[0037] Preferably, the human ferritin H chain may be: (A1) a protein comprising the amino acid sequence of SEQ ID NO:1; (B1) a protein having an amino acid sequence containing one or several modifications of amino acid residues selected from the group consisting of substitution, deletion, insertion, and addition of amino acid residues in the amino acid sequence of SEQ ID NO: 1, and having the ability to form a 24-mer; or (C1) A protein comprising an amino acid sequence having 90% or more identity to the amino acid sequence of SEQ ID NO:1 and capable of forming a 24-mer.

[0038] Preferably, the human ferritin light chain may be: (A2) a protein comprising the amino acid sequence of SEQ ID NO: 2; (B2) a protein having an amino acid sequence of SEQ ID NO: 2, which contains a modification of one or several amino acid residues selected from the group consisting of substitution, deletion, insertion, and addition of amino acid residues, and which has the ability to form a 24-mer; or (C2) A protein comprising an amino acid sequence having 90% or more identity to the amino acid sequence of SEQ ID NO:2 and having the ability to form a 24-mer.

[0039] In the above (B1) and (B2), one or several amino acid residues can be modified by one, two, three or four types of modification selected from the group consisting of deletion, substitution, addition and insertion of amino acid residues. The modification of the amino acid residue may be introduced into one region in the amino acid sequence, or into several different regions. The term "one or several" indicates a number that does not significantly impair the activity of the protein. The number indicated by the term "one or several" is, for example, 1 to 50, preferably 1 to 40, more preferably 1 to 30, even more preferably 1 to 20, and particularly preferably 1 to 10 or 1 to 5 (e.g., 1, 2, 3, 4 or 5).

[0040] In the above (C1) and (C2), the protein identity percentage can be calculated using the algorithm blastp. More specifically, the polypeptide identity percentage can be calculated using the algorithm blastp provided by the National Center for Biotechnology Information (NCBI) with default Scoring Parameters (Matrix: BLOSUM62; Gap Costs: Existence=11 Extension=1; Compositional Adjustments: Conditional compositional score matrix adjustment).

[0041] The position of the amino acid residue to be mutated in the amino acid sequence is clear to a person skilled in the art, but may be specified by further referring to sequence alignment. Specifically, a person skilled in the art 1) compares a plurality of amino acid sequences, 2) clarifies relatively conserved regions and relatively non-conserved regions, and then 3) predicts regions that may play an important role in function and regions that may not play an important role in function from the relatively conserved regions and relatively non-conserved regions, respectively, and can recognize the correlation between structure and function. Therefore, a person skilled in the art can specify the position to be mutated in the amino acid sequence by using sequence alignment, and can also specify the position of the amino acid residue to be mutated in the amino acid sequence by using known secondary and tertiary structure information in combination. Preferably, the flexible linker region, as well as the N-terminal and C-terminal regions, can be used as the mutation introduction site.

[0042] When an amino acid residue is mutated by substitution, the substitution of the amino acid residue may be a conservative substitution. As used herein, the term "conservative substitution" refers to replacing a given amino acid residue with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains are well known in the art. For example, such families include amino acids with basic side chains (e.g., lysine, arginine, histidine), amino acids with acidic side chains (e.g., aspartic acid, glutamic acid), amino acids with uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids with nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), amino acids with beta-branched side chains (e.g., threonine, valine, isoleucine), amino acids with aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine), amino acids with hydroxyl (e.g., alcoholic, phenolic)-containing side chains (e.g., serine, threonine, tyrosine), and amino acids with sulfur-containing side chains (e.g., cysteine, methionine). Preferably, conservative amino acid substitutions may be between aspartic acid and glutamic acid, between arginine, lysine and histidine, between tryptophan and phenylalanine, between phenylalanine and valine, between leucine, isoleucine and alanine, and between glycine and alanine.

[0043] The recombinant fetilin monomer may also be a recombinant fetilin monomer containing a functional peptide. The functional peptide may be a peptide that can add any function to a target protein when fused with the target protein. Such functional peptides include peptides that have the ability to bind to bioorganic molecules, protease-degradable peptides, stabilizing peptides, and cell-penetrating peptides.

[0044] Bio-organic molecules include, for example, proteins (e.g., oligopeptides or polypeptides), nucleic acids (e.g., DNA or RNA, or nucleosides, nucleotides, oligonucleotides or polynucleotides), carbohydrates (e.g., monosaccharides, oligosaccharides or polysaccharides), and lipids. Bio-organic molecules can also be cell surface antigens (e.g., cancer antigens, heart disease markers, diabetes markers, neurological disease markers, immune disease markers, inflammatory markers, hormones, infectious disease markers). Bio-organic molecules can also be disease antigens (e.g., cancer antigens, heart disease markers, diabetes markers, neurological disease markers, immune disease markers, inflammatory markers, hormones, infectious disease markers).Examples of peptides capable of binding to such bioorganic molecules include peptides capable of binding to proteins (e.g., see F. Danhier et al., Mol. Pharmaceutics, 2012, vol. 9, No. 11, p. 2961; CH. Wu et al., Sci. Transl. Med., 2015, vol. 7, No. 290, 290-91; L. Vannucci et al. Int. J. Nanomedicine. 2012, vol. 7, p. 1489; J. Cutrera et al., Mol. Ther. 2011, vol. 19(8), p. 1468; R. Liu et al., Adv. Drug Deliv. Rev. 2017, vol. 110-111, p. 13), peptides capable of binding to nucleic acids (e.g., see R. Tan et.al. Proc. Natl. Acad. Sci. USA, 1995, vol. 92, p. 5282; R. Tan et.al. Cell, 1993, vol. 73, p. 1031; R. Talanian et.al. Biochemistry. 1992, vol. 31, p. 6871), peptides capable of binding to carbohydrates (e.g., see K. Oldenburg et.al., Proc. Natl. Acad. Sci. USA, 1992, vol. 89, No. 12, p. 5393-5397; K. Yamamoto et.al., J. Biochem., 1992, vol. 111, p. 436; A. Baimiev Various peptides have been reported, including peptides with lipid-binding ability (see, e.g., O.Kruse et al., B Z. Naturforsch., 1995, vol.50c, p.380; O.Silva et al., Sci.Rep., 2016, vol.6, 27128; A.Filoteo et al., J.Biol.Chem., 1992, vol.267, No.17, p.11800).

[0045] When a protease-degradable peptide is used as the functional peptide, examples of the protease include cysteine ​​proteases such as caspases and cathepsins (D. McIlwain1 et al., Cold Spring Harb Perspect Biol., 2013, vol. 5, a008656; V. Stoka et al., IUBMB Life. 2005, vol. 57, No. 4-5, p. 347), collagenase (G. Lee et al., Eur J Pharm Biopharm., 2007, vol. 67, No. 3, p. 646), thrombin and Xa factor (R. Jenny et al., Protein Expr. Purif., 2003, vol. 31, p. 1; H. Xu et al., J. Virol., 2010, vol. 84, No. 2, p. 1076) and viral proteases (C. Byrd et al., Drug Dev. Res., 2006, vol. 67, p. 501).

[0046] Various peptides have been reported as protease-degradable peptides (see, for example, E. Lee et al., Adv. Funct. Mater., 2015, vol. 25, p. 1279; G. Lee et al., Eur J Pharm Biopharm., 2007, vol. 67, No. 3, p. 646; Y. Kang et al., Biomacromolecules, 2012, vol. 13, No. 12, p. 4057; R. Talanian et al., J. Biol. Chem., 1997, vol. 272, p. 9677; Jenny et al., Protein Expr. Purif., 2003, vol. 31, p. 1; H. Xu et al., J. Virol., 2010, vol. 84, No. 2, p. 1076). Therefore, in the present invention, such peptides or their mutant peptides (e.g., mutations such as conservative substitutions of 1, 2, 3, 4 or 5 amino acid residues), or peptides having one or more amino acid sequences of such peptides or their mutant peptides, can be used as protease-degradable peptides.

[0047] Various peptides have been reported as stabilizing peptides (see, for example, X. Meng et al., Nanoscale, 2011, vol. 3, No. 3, p. 977; E. Falvo et al., Biomacromolecules, 2016, vol. 17, No. 2, p. 514). Thus, in the present invention, such peptides or mutant peptides thereof (e.g., mutations such as conservative substitutions of 1, 2, 3, 4, or 5 amino acid residues), or peptides having one or more amino acid sequences of such peptides or mutant peptides thereof can be used as stabilizing peptides.

[0048] Various peptides have been reported as cell-penetrating peptides (see, for example, Z. Guo et al. Biomed. Rep., 2016, vol. 4, No. 5, p. 528). Therefore, in the present invention, such peptides or mutant peptides thereof (e.g., mutations such as conservative substitutions of 1, 2, 3, 4, or 5 amino acid residues), or peptides having one or more amino acid sequences of such peptides or mutant peptides thereof can be used as cell-penetrating peptides.

[0049] The functional peptide is preferably a peptide capable of binding to a bioorganic molecule, and more preferably a peptide capable of binding to a protein.

[0050] The present invention also provides a peptide delivery agent comprising the above-mentioned peptide-encapsulated ferritin.

[0051] The peptide delivery agent of the present invention can deliver the peptide in the peptide-encapsulated ferritin to the inside of the transferrin receptor-presenting cell through the interaction between ferritin and the transferrin receptor-presenting cell. Examples of the transferrin receptor-presenting cell include cells present in tissues and sites such as the basal layer of the epidermis, pancreatic endocrine tissue, pituitary gland, placenta, brain cortex, striatum, renal proximal tubule, esophagus, cervix, gastric mucosal epithelium, and breast epithelium, as well as cells such as erythrocytes, hemoblasts, brain capillary endothelial cells, hepatocytes, Kupffer cells, and hippocampal neurons. The transferrin receptor-presenting cell can be a cell derived from any mammal. Examples of such a mammal include primates (e.g., humans, monkeys, and chimpanzees), rodents (e.g., mice, rats, hamsters, guinea pigs, and rabbits), and livestock and working mammals (e.g., cows, pigs, sheep, goats, and horses). From the viewpoint of clinical application, the mammal is preferably a human.

[0052] The peptide delivery agent of the present invention can also deliver peptide to the inside of transferrin receptor-presenting cells in general, but can deliver peptide to the inside of cells with high transferrin receptor expression more specifically and reproducibly.Therefore, the transferrin receptor-presenting cells are preferably cells with high transferrin receptor expression.The cells with high transferrin receptor expression include, for example, the above-mentioned transferrin receptor-presenting cells, cells present in tissues and sites such as epidermal basal layer, pancreatic endocrine tissue, pituitary gland, placenta, and cells such as erythrocytes, hemoblasts, brain capillary endothelial cells, hepatocytes, and Kupffer cells.

[0053] In certain embodiments, the transferrin receptor-presenting cell may be a cell that can cause a certain disease. Such specific diseases include, for example, cancer, leukemia, and malignant lymphoma, with cancer being preferred. Examples of cancer include, for example, breast cancer, pancreatic cancer, ovarian cancer, uterine cancer, lung cancer (e.g., non-small cell cancer such as squamous cell carcinoma, adenocarcinoma, and large cell carcinoma, and small cell carcinoma), digestive system cancer (e.g., gastric cancer, small intestine cancer, colon cancer, and rectal cancer), pancreatic cancer, kidney cancer, thymus cancer, spleen cancer, thyroid cancer, adrenal cancer, prostate cancer, bladder cancer, bone cancer, skin cancer, brain tumor, and melanoma, with breast cancer being preferred. Therefore, the peptide delivery agent of the present invention is useful for the prevention or treatment of such specific diseases.

[0054] The present invention also provides a method for producing the above-mentioned peptide-encapsulated ferritin, which comprises the following 1) and 2): 1) Dissociating ferritin by placing it in a buffer solution of pH 3.0 or less (disassociation process); and 2) The dissociated ferritin and peptide are allowed to coexist in a buffer solution with a pH of 5.0 to 10.0 to produce peptide-encapsulated ferritin (reassociation process).

[0055] In the above 1), ferritin (24-mer) can be dissociated into ferritin monomers by leaving ferritin in a buffer solution of pH 3.0 or less. The leaving of ferritin in the buffer solution can be carried out in the presence or absence of a peptide. When leaving ferritin in the buffer solution in the absence of a peptide, a peptide is added to the buffer solution before the above 2).

[0056] As the buffer solution, any buffer solution that can withstand acidic conditions of pH 3.0 or less can be used. Examples of such buffer solutions include glycine buffer solution, citrate buffer solution, acetate buffer solution, phosphate buffer solution, carbonate buffer solution, borate buffer solution, tartrate buffer solution, and MES (2-morpholinoethanesulfonic acid) buffer solution.

[0057] The pH of the buffer solution used in 1) is preferably 2.8 or less, more preferably 2.6 or less, and even more preferably 2.5 or less. The pH can be measured at 25° C. using a pH analyzer (LAQUA, F-72, Horiba) and a pH electrode (9680S-10D).

[0058] The time for leaving ferritin in a buffer solution of pH 3.0 or less is not particularly limited as long as it is the time required for dissociation of ferritin. More specifically, such a time varies depending on conditions such as pH, but from the viewpoint of the production efficiency of peptide-encapsulated ferritin and the shortening of the production time of peptide-encapsulated ferritin, it is, for example, 1 minute to 10 hours, preferably 2 minutes to 5 hours, more preferably 3 minutes to 2 hours, even more preferably 4 minutes to 1 hour, and particularly preferably 5 to 30 minutes.

[0059] After completion of 1), the operation 2) can be carried out by exchanging the buffer or adding a buffer or base. For example, the buffer can be exchanged by neutralizing and leaving the buffer after the operation 1), and then recovering the supernatant containing dissociated ferritin and peptides, and then mixing it with a buffer having a pH of 5.0 to 10.0. Examples of the buffer having a pH of 5.0 to 10.0 include Tris buffer, HEPES buffer, phosphate buffer, borate buffer, citrate buffer, carbonate buffer, and glycine buffer.

[0060] The pH of the buffer used in 2) is preferably from 5.0 to 9.5, more preferably from 5.0 to 9.2, and even more preferably from 5.0 to 9.0.

[0061] The time that dissociated ferritin and peptide are left in the buffer solution is not particularly limited, as long as it is the time required for reassociation of ferritin. More specifically, this time varies depending on conditions such as pH, but from the viewpoint of the efficiency of producing peptide-encapsulated ferritin and the shortening of the time required for producing peptide-encapsulated ferritin, it is, for example, 10 minutes to 72 hours, preferably 20 minutes to 48 hours, more preferably 30 minutes to 24 hours. EXAMPLES

[0062] The present invention will now be described in more detail with reference to examples, but the present invention is not limited to the following examples.

[0063] <Example 1: Preparation of ferritin> DNA encoding human ferritin H chain (FTH (SEQ ID NO: 1)) was totally synthesized. PCR was performed using the totally synthesized DNA as a template and 5'-GAAGGAGATATACATATGACGACCGCGTCCACCTCG-3' (SEQ ID NO: 3) and 5'-CTCGAATTCGGATCCTTAGCTTTCATTATCACTGTC-3' (SEQ ID NO: 4) as primers. PCR was also performed using pET20 (Merck) as a template and 5'-TTTCATATGTATATCTCCTTCTTAAAGTTAAAC-3' (SEQ ID NO: 5) and 5'-TTTGGATCCGAATTCGAGCTCCGTCG-3' (SEQ ID NO: 6) as primers. Each PCR product was purified with Wizard DNA Clean-Up System (Promega), and then treated with In-Fusion enzyme at 50°C for 15 minutes with In-Fusion HD Cloning Kit (Takara Bio) to construct an expression plasmid (pET20-FTH) carrying a gene encoding FTH.

[0064] Next, Escherichia coli BL21(DE3) with the constructed pET20-FTH introduced was cultured in a flask in 100 ml of LB medium (containing 10 g / l Bacto-typtone, 5 g / l Bacto-yeast extract, 5 g / l NaCl, and 100 mg / l ampicillin) at 37°C for 24 hours. The resulting cells were ultrasonically disrupted, and the supernatant was heated at 60°C for 20 minutes. The supernatant obtained after heating was injected into a HiPerp Q HP column (GE Healthcare) equilibrated with 50 mM TrisHCl buffer (pH 8.0), and the target protein was separated and purified by applying a salt concentration gradient with 50 mM TrisHCl buffer (pH 8.0) containing 0 mM to 500 mM NaCl. The solvent of the solution containing the protein was replaced with 10 mM TrisHCl buffer (pH 8.0) by centrifugal ultrafiltration using Vivaspin 20-100K (GE Healthcare). The solution was injected into a HiPrep 26 / 60 Sephacryl S-300 HR column (GE Healthcare) equilibrated with 10 mM TrisHCl buffer (pH 8.0), and FTH was separated and purified according to size. The solution containing FTH was concentrated by centrifugal ultrafiltration using Vivaspin 20-100K (GE Healthcare), and the protein concentration was determined using Protein Assay CBB solution (Nacalai Tesque) with bovine albumin as the standard. As a result, 1 ml of solution containing 5 mg / ml FTH was obtained per 100 ml of culture medium. The pH was measured at 25°C using a pH analyzer (LAQUA, F-72, Horiba) and a pH electrode (9680S-10D).

[0065] <Example 2: Examination of inclusion of fluorescently modified peptide (1)> To achieve peptide delivery using ferritin, we attempted to construct an FTH encapsulating a peptide modified with the fluorescent dye fluorescein (FAM) (5(6)-FAM-RFARKGALRQKNVHEVKN (sequence number 9), PKC-F, chemical formula 2524, Table 3).

[0066] 0.5 ml of 50 mM glycine hydrochloride buffer (pH 2.3) containing FTH (formula 509421) at a final concentration of 5 mg / ml and peptide at a final concentration of 0.5 mM was left at room temperature for 15 minutes. Then, 50 μl of 1 M Tris hydrochloride buffer (pH 9.0) was added to neutralize and left at room temperature for 3 hours. After leaving, the mixture was centrifuged (15,000 rpm, 1 minute), and the supernatant was collected and the volume was increased to 3 ml with 10 mM Tris hydrochloride buffer (pH 8). The solution was injected into a HiPrep 26 / 60 Sephacryl S-300 HR column (GE Healthcare) equilibrated with 10 mM TrisHCl buffer (pH 8.0), and 24-mer FTH was separated and purified according to size at a flow rate of 1.3 ml / min. When the purified ferritin was analyzed at a flow rate of 0.5 ml / min using a HiPrep 16 / 60 Sephacryl S-300 HR column (GE Healthcare) equilibrated with 10 mM TrisHCl buffer (pH 8.0), absorbance at 480 nm, which was not observed with FTH alone, was observed at the same position as the FTH peak, indicating that FTH and the peptide had formed a complex (Figure 1).

[0067] The solution containing FTH was concentrated to 0.25 ml by centrifugal ultrafiltration using Vivaspin 20-100K (GE Healthcare). The presence of peptides in the solution was confirmed by LC-MS analysis. For LC-MS analysis, 50 μl of 1 M glycine hydrochloride buffer (pH 2.3) was added to 50 μl of the sample solution and left at room temperature for 15 minutes. 900 μl of ethanol was added to the solution, and after vigorously stirring, the supernatant was collected by centrifugation (15000 rpm, 5 minutes). The supernatant was analyzed. In this experiment, an LCMS-2020 (Shimadzu Corporation) was used as the LC-MS, and an Inertsil (registered trademark) ODS-3 column with a particle size of 2 μm and a size of 2.1 mm x 50 mm (GL science) was used. Then, 10 μl of the sample applied to the column was eluted at a flow rate of 0.2 ml / min for 10 minutes so that the mixing ratio of solution A (0.1% formic acid / 99.9% acetonitrile) and solution B (50% water / 50% acetonitrile) changed from 95:5 to 95:5. The protein concentration was determined using Protein Assay CBB solution (Nacalai Tesque) with bovine albumin as the standard. The concentration of the peptide contained was determined from the absorbance at 480 nm of the fluorescent dye FAM modified to PKC-F.

[0068] As a result, LC-MS analysis showed that the retention time of the peptide encapsulated in ferritin (Figure 2) and the standard peptide (Figure 3) were both 3.9 minutes, and the MS spectra were also comparable, confirming that PKC-F was encapsulated without being decomposed by the ferritin encapsulation procedure. 0.25 ml of solution containing 4.3 mg / ml (8.5 μM) FTH and 0.18 mg / ml (72 μM) peptide was obtained. Based on the molar ratio at this time, an average of 8.5 PKC-F molecules were encapsulated per ferritin molecule.

[0069] <Example 3: Shape of ferritin encapsulating fluorescently modified peptide> The fact that the purified PKC-F-encapsulated FTH exhibited a cage-like shape was confirmed by a transmission electron microscope (TEM) image stained with 3% phosphotungstic acid, as shown in Figure 4. The diameter of the peptide-encapsulated FTH was 12 nm, the same size as that of natural human ferritin, indicating that the higher-order structure of ferritin was not significantly affected by the inclusion of the peptide.

[0070] Next, the PKC-F-encapsulated FTH complex was suspended in 50 mM phosphate buffer (pH 6 or 7), acetate buffer (pH 4 or 5), or Tris-HCl buffer (pH 8) to a final concentration of 0.1 g / l in terms of FTH, and the surface charge in the buffer was measured at 25°C using a Zetasizer Nano ZS (Malvern Instruments). 750 μl of the sample was placed in a DTS1070 cell, and the measurements were performed under Material settings (RI: 1.450, Absorption: 0.001), Dispersant settings (Temperature: 25°C, Viscosity: 0.8872 cP, RI: 1.330, Dielectric constant: 78.5), and Smoluchowski model (Fκa value: 1.50). As a result, the surface charges of FTH without peptide encapsulation and the PKC-F-encapsulated FTH complex were equivalent, indicating that the complex was not formed by adsorption of the peptide to the FTH surface (Figure 5).

[0071] <Example 4: Cellular uptake test using fluorescently modified peptide-encapsulated ferritin (1)> Using the obtained PKC-F-encapsulating FTH, the transport of PKC-F into cells by ferritin was evaluated.

[0072] Evaluation medium (Opti-MEM TMPKC-F-encapsulated FTH was added to a final concentration of 100 nM (PKC-F concentration 0.86 μM), 200 nM (PKC-F concentration 1.72 μM), or 400 nM (PKC-F concentration 3.44 μM) in 100 μl of medium, and then added to SKBR-3 cells (20,000 cells / well, 96-well plate) derived from human breast cancer and cultured at 37°C. The SKBR-3 cells express the transferrin receptor TfR. As a negative control, SKBR-3 cells were similarly cultured in medium containing peptides not encapsulated in FTH at final concentrations of 0.86 μM, 1.72 μM, or 3.44 μM. After culturing for 24 hours, each was washed twice with 100 μl of phosphate-buffered saline and left in 50 μl of Trypsin-EDTA (Sigma-Aldrich) at 37° C. for 10 minutes. TM 100 μl of medium was added, and the cells were transferred to a plate for fluorescence-activated cell sorting (FACS) and centrifuged at 400×g for 5 minutes. Each cell was then soaked in FACS buffer (Attune TM The cells were suspended in Focusing Fluid (Thermo Fisher Scientific) and analyzed by FACS (Attune NxT, Thermo Fisher Scientific).

[0073] As a result, a concentration-dependent change in fluorescence intensity was confirmed in PKC-F-encapsulated FTH (FIG. 6), suggesting that the amount of uptake into cells increased in a concentration-dependent manner.

[0074] When cells prepared under the same conditions were observed with a two-photon excitation fluorescence microscope (CQ-1, Yokogawa Electric Corporation), intracellular fluorescence was observed only in PKC-F-encapsulated FTH, and concentration-dependent uptake of PKC-F-encapsulated FTH into cells was confirmed (Figure 7). On the other hand, transport into cells was not confirmed for PKC-F not encapsulated in ferritin.

[0075] From the above, it was found that peptides can be delivered into TfR-presenting cells by encapsulating them in FTH.

[0076] <Example 5: Examination of inclusion of fluorescently modified peptide (2)> To investigate the versatility of peptide delivery using ferritin, we attempted to encapsulate peptides other than PKC-F into ferritin and transport them into cells.

[0077] First, we attempted to construct FTH encapsulating two types of fluorescently modified peptides [(5(6)-FAM-CGGPKKKRKVG (SEQ ID NO: 10), FAM-SV40, formula weight 1516, and 5(6)-FAM-CGGKRPAAIK KAGQAKKKKG (SEQ ID NO: 11), FAM-Np, formula weight 384)]. 0.5 ml of 50 mM glycine hydrochloride buffer (pH 2.3) containing FTH (formula weight 509421) at a final concentration of 5 mg / ml and peptide at a final concentration of 0.5 mM was left at room temperature for 15 minutes. Then, 50 μl of 1 M Tris hydrochloride buffer (pH 9.0) was added to neutralize, and the mixture was left at room temperature for 3 hours. After leaving the mixture, it was centrifuged (15,000 rpm, 1 minute), and the supernatant was collected and the volume was increased to 3 ml with 10 mM Tris hydrochloride buffer (pH 8). The solution was used to separate and purify the 24-mer FTH by size at a flow rate of 0.5 ml / min using a HiPrep 16 / 60 Sephacryl S-300 HR column (GE Healthcare) equilibrated with D-PBS(-) (Fujifilm Wako Pure Chemical Industries, Ltd.). In this case, the absorbance at 430 nm was confirmed at the same elution position as the ferritin 24-mer in the ferritin that had been encapsulated with FAM-SV40, suggesting that FAM-SV40 was encapsulated in the ferritin (Figure 8). However, the absorbance at 480 nm was not confirmed in the ferritin that had been encapsulated with FAM-Np, indicating that FAM-Np was not encapsulated. This suggests that there are peptides that are difficult to encapsulate in ferritin due to differences in physical properties, etc.

[0078] Next, the amount of FAM-SV40 peptide encapsulated in the purified ferritin was quantified by absorbance at 480 nm and by CBB staining using albumin as a standard.

[0079] As a result, 0.3 ml of solution containing 6.3 mg / ml (12 μM) FTH and 0.09 mg / ml (30 μM) FAM-SV40 peptide was obtained. Based on the molar ratio at this time, an average of 2.5 FAM-SV40 molecules were encapsulated per ferritin molecule.

[0080] <Example 6: Cellular uptake test using fluorescently modified peptide-encapsulated ferritin (2)> The uptake of the obtained FAM-SV40-encapsulated FTH into cells was evaluated. TM The medium was supplemented with 100 μl of FAM-SV40-encapsulated FTH at a final concentration of 100 nM (FAM-SV40 concentration 250 nM), 200 nM (FAM-SV40 concentration 500 nM), or 400 nM (FAM-SV40 concentration 1000 nM) in a total of 1% non-essential amino acid solution (Thermo Fisher Scientific) + 1% penicillin-streptomycin (Nacalai Tesque), and the cells were incubated at 37° C. in 100 μl of medium. In addition, SKBR-3 cells were incubated in a medium supplemented with peptides not encapsulated in FTH at a final concentration of 250 nM, 500 nM, or 1000 nM as negative controls. After culturing for 24 hours, each was washed twice with 100 μl of phosphate-buffered saline and allowed to stand in 50 μl of Trypsin-EDTA (Sigma-Aldrich) at 37° C. for 10 minutes.

[0081] Then, Opti-MEM TM 100 μl of medium was added, and the cells were transferred to a plate for fluorescence-activated cell sorting (FACS) and centrifuged at 400×g for 5 minutes. Each cell was then soaked in FACS buffer (Attune TMThe cells were suspended in Focusing Fluid (Thermo Fisher Scientific) and analyzed by FACS (Attune NxT, Thermo Fisher Scientific). As a result, a concentration-dependent increase in fluorescence intensity was observed only in the case of FTH encapsulated in FAM-SV40, whereas no fluorescence was observed in the case of FAM-SV40 alone (Figure 9).

[0082] From the above, it was found that peptides that were previously unable to permeate membranes can be delivered into cells by being encapsulated in FTH.

[0083] <Example 7: Confirmation of the dependency of peptide delivery amount on TfR expression level> To confirm that the peptide of interest can be delivered specifically to transferrin receptor (TfR)-presenting cells by encapsulating it in ferritin, we evaluated the TfR dependency of the uptake efficiency of FTH using cell lines with different levels of TfR expression.

[0084] In this evaluation, we used SKBR3 cells with high TfR expression (expression intensity 449.7 TPM, see the database "The Human Protein Atlas (https: / / www.proteinatlas.org / )") and HEK293E cells, a subline of HEK293 cells with low TfR expression (expression intensity 74.5 TPM, see the database "The Human Protein Atlas")

[0085] First, total RNA was extracted from SKBR3 cells and HEK293E cells using the PureLink® RNA Mini Kit (Thermo Fisher Scientific). 50 ng of total RNA from each cell and 2 μL of SuperScript TM VILO TMMaster Mix (Thermo Fisher Scientific) was mixed, and water was added to make the total volume 10 μL. After incubation at 25 ° C for 10 minutes, 42 ° C for 60 minutes, and 85 ° C for 5 minutes, 115 μL of water was added to dilute and obtain a cDNA solution of 0.4 ng / μL. TaqMan (registered trademark) Fast Advanced Master Mix (Applied Biosystems), 4.8 μL of water, and 25 μM primer mix were added to 5 μL of each cDNA solution to prepare a quantitative PCR solution. The primer mix for the TfR gene was mixed and used (Forward: TGGCAGTTCAGAATGATGGA (SEQ ID NO: 26), Reverse: AGGCTGAACCGGGTATATGA (SEQ ID NO: 27)). 18S rRNA was quantified as an internal standard. The primer mix for the 18S rRNA gene was mixed with (Forward: TGAGAAACGGCTACCACATC (SEQ ID NO: 28), Reverse: TTACAGGGCCTCGAAAGAGT (SEQ ID NO: 29)). TM When the expression level of TfR mRNA was confirmed using a ELISA system (Applied Biosystems), the expression level of TfR in SKBR3 cells was 3.2-fold higher than that in HEK293E cells.

[0086] Evaluation medium (Opti-MEM TM The cells were added to each cell (20,000 cells / well, 96-well plate) in 100 μl of medium containing FAM-SV40-encapsulated FTH at a final concentration of 0 to 800 nM (FAM-SV40 concentration 2 μM) in a total of 1% non-essential amino acid solution (Thermo Fisher Scientific) + 1% penicillin-streptomycin (Nacalai Tesque) and cultured at 37°C. After 24 hours of culture, each cell was washed twice with 100 μl of phosphate-buffered saline and left in 50 μl of Trypsin-EDTA (Sigma-Aldrich) at 37°C for 10 minutes.

[0087] Then, Opti-MEM TM100 μl of medium was added, and the cells were transferred to a plate for fluorescence-activated cell sorting (FACS) and centrifuged at 400×g for 5 minutes. Each cell was then soaked in FACS buffer (Attune TM The cells were suspended in Focusing Fluid (Thermo Fisher Scientific) and analyzed by FACS (Attune NxT, Thermo Fisher Scientific).

[0088] As a result, more than 90% of SKBR3 cells cultured in a medium containing 100 nM of FAM-SV40-encapsulated FTH emitted fluorescence, suggesting that most of the cells had taken up FAM-SV40-encapsulated FTH. This percentage was 60 times higher than that of HEK293E cells obtained under the same conditions (Figure 10). In the case of HEK293E cells, it was necessary to culture them in a medium containing a high concentration of FAM-SV40-encapsulated FTH of 800 nM or more in order for more than 90% of the cells to emit fluorescence (Figure 11). These results suggest that SKBR3 cells, which have a high TfR expression level, took up ferritin more efficiently into the cells.

[0089] In other words, it was found that by encapsulating the peptide in ferritin, it is possible to control the amount of the peptide delivered into the cell depending on the TfR expression level of the target cell.

[0090] <Example 8: Search for peptides that can be encapsulated in ferritin (1)> We searched for peptides that can be encapsulated in ferritin by the disassociation / reassociation process. In the disassociation / reassociation process, 1 ml of 50 mM glycine hydrochloride buffer (pH 2.3) containing 5 mg / ml FTH and 0.5 mM peptide was left at room temperature for 15 minutes. Then, 310 μl of 1 M Tris hydrochloride buffer (pH 9.0) was added to neutralize the mixture, and the mixture was left at room temperature for 3 hours. After leaving the mixture, 1.2 ml of 50 mM Tris hydrochloride buffer (pH 8.0) was added, and the mixture was centrifuged (15,000 rpm, 1 minute). 2.5 ml of the supernatant was applied to a desalting column PD-10 (Sephadex G-25 packed, GE Healthcare) equilibrated with 50 mM Tris hydrochloride buffer (pH 8), and eluted with 3.0 ml of 50 mM Tris hydrochloride buffer (pH 8.0) to separate the unencapsulated peptides and ferritin. The total amount of the solution (3.0 ml) was concentrated to 0.1 ml by centrifugal ultrafiltration using Vivaspin 20-100K (GE Healthcare). The concentrated solution was added with 10 ml of 50 mM Tris hydrochloride buffer and the operation of concentration was repeated twice to remove peptides that could not be removed by PD-10, and 0.1 ml of sample solution was obtained. For LC-MS analysis, 50 μl of 1 M glycine hydrochloride buffer (pH 2.3) was added to 50 μl of the sample solution and left at room temperature for 15 minutes. 900 μl of ethanol was added to the solution, and after vigorously stirring, the supernatant was collected by centrifugation (15000 rpm, 5 minutes). The supernatant was analyzed. In this experiment, LCMS-2020 (Shimadzu Corporation) was used as the LC-MS, and the column was Inertsil (registered trademark) ODS-3, particle size 2 μm, 2.1 mm x 50 mm (GL science). Then, 10 μl of the sample applied to the column was eluted at a flow rate of 0.2 ml / min over 10 minutes so that the mixing ratio of solution A (0.1% formic acid / 99.9% acetonitrile) and solution B (50% water / 50% acetonitrile) changed from 95:5 to 95:5.

[0091] Table 1 shows a list of peptides used in the inclusion study. For the inclusion of peptides into ferritin, samples were prepared in which peptides were encapsulated in ferritin by the disassociation / reassociation process, and samples in which ferritin and peptides were simply mixed, and the amounts of peptides detected by LC-MS were compared. For example, ClAc-FHC elutes at a retention time of 0.8 minutes, and a peak derived from ClAc-FHC (chemical formula weight 445) was confirmed at m / z = 445 in the disassociation / reassociation process (Figure 12A). However, this peak was not observed in the simple mixture of peptide and ferritin without the disassociation / reassociation process (Figure 12B). The results of LC-MS of FTH in which peptides were encapsulated by the disassociation / reassociation process are shown in Figures 13 to 17.

[0092] [Table 1]

[0093] The peptides evaluated this time can be incorporated into ferritin as shown in the following table. 5 As shown in.

[0094] <Example 9: Examination of properties that can be encapsulated in ferritin> In this study, the correlation between the physical properties listed below and whether or not a peptide could be encapsulated in ferritin was examined for peptides that were encapsulated in ferritin and peptides that could not be encapsulated in ferritin. (1) Peptide length (chain length) (2) Chemical formula weight of peptide (3) Hydrophobicity (4) GRAVY (5)Average of hydrophilicity (6) Ratio of hydrophilic amino acids in peptide (Ratio of hydrophilic residues / total number of residues) (7) Peptide charge at pH 9

[0095] The above physical property values ​​(1) to (7) were determined according to the following methods.

[0096] (1) Peptide length (chain length) The length of the peptide was determined based on the total number of amino acid residues constituting the peptide.

[0097] (2) Chemical formula weight of peptide It was determined as the sum of the products of the atomic weights and the numbers of atoms based on the peptide formula.

[0098] (3) Hydrophobicity The hydrophobicity of peptides was calculated based on SSRCalc Hydrophobicity (OV Krokhin Anal. Chem. (2006), 78 (22) 7785-7795). In this study, the hydrophobicity was calculated using Prot pi (https: / / www.protpi.ch / Calculator / PeptideTool) with a database of 300 angstrom C18 column and 0.1% TFA elution conditions.

[0099] (4) GRAVY GRAVY (grand average of hydropathy) was calculated by adding the hydropathy scores of each amino acid residue and dividing by the length of the sequence (J. Kyte and RF Doolittle, J. Mol. Biol. 1982 157(1) 105-32.).

[0100] [Table 2]

[0101] (5) Average hydrophilicity Average hydrophilicity was calculated by adding the hydrophilicity scores of each amino acid residue and dividing by the length of the sequence (Hopp and Woods Proc Natl Acad Sci USA. 1981 78(6) 3824-8.).

[0102] [Table 3]

[0103] (6) Proportion of hydrophilic amino acids in peptides The ratio of hydrophilic amino acids in a peptide (ratio of hydrophilic residues / total number of residues) was determined by evaluating the proportion of hydrophilic amino acids (H, C, T, S, K, Q, E, D, N, and R) among all amino acids constituting the peptide.

[0104] (7) Peptide charge at pH 9 The charge of a peptide at pH 9 was calculated using the dissociation constant (pKa) and positive / negative charge of all functional groups, including the side chains of each amino acid residue constituting the peptide, modification groups, the N-terminal amino group or its protecting group, and the C-terminal carboxyl group or its protecting group, at pH 9 using the following formula.

[0105]

number

[0106] The pKa of each amino acid was evaluated using ChemAxon (https: / / chemaxon.com / ) (O.Toure et. al., Oil Gas Sci. Technol. 2013, 68, 281-297.).

[0107] [Table 4]

[0108] The relationship between the above-mentioned physical property values ​​of the peptides used in the study of inclusion in ferritin and whether the peptides can be included in ferritin is as follows.

[0109] [Table 5]

[0110] As a result, a correlation was found between the relationship between charge and formula weight at pH 9.0 and the ease of peptide inclusion (FIG. 18).

[0111] That is, a) peptides that satisfy the conditions of -10.2≦pH 9, charge of peptide (X)≦5.9 and chemical formula weight of peptide (Y) ≦445≦2524 could be encapsulated in ferritin (FIG. 18).

[0112] Furthermore, among the peptides that satisfied the above conditions, peptides that satisfied the conditions b) -10.2≦X≦0.0 and 445≦Y≦2524, or c) 3.7≦X≦5.9 and 445≦Y≦2524, were reproducibly encapsulated in ferritin (FIG. 18).

[0113] <Example 10: Preparation of ferritin (2)> DNA encoding human ferritin L chain (FTL (SEQ ID NO: 2)) was totally synthesized. PCR was performed using the totally synthesized DNA as a template and 5'-GAAGGAGATATACATATGAGCTCCCAGATTCGTCAG-3' (SEQ ID NO: 7) and 5'-CTCGAATTCGGATCCTTAGTCGTGCTTGAGAGTGAG-3' (SEQ ID NO: 8) as primers. PCR was also performed using pET20 (Merck) as a template and 5'-TTTCATATGTATATCTCCTTCTTAAAGTTAAAC-3' (SEQ ID NO: 5) and 5'-TTTGGATCCGAATTCGAGCTCCGTCG-3' (SEQ ID NO: 6) as primers. Each PCR product was purified with Wizard DNA Clean-Up System (Promega), and then treated with In-Fusion enzyme at 50°C for 15 minutes with In-Fusion HD Cloning Kit (Takara Bio) to construct an expression plasmid (pET20-FTL) carrying a gene encoding FTL.

[0114] Next, Escherichia coli BL21(DE3) with the constructed pET20-FTL introduced was cultured in a flask in 100 ml of LB medium (containing 10 g / l Bacto-typtone, 5 g / l Bacto-yeast extract, 5 g / l NaCl, and 100 mg / l ampicillin) at 37°C for 24 hours. The resulting cells were ultrasonically disrupted, and the supernatant was heated at 60°C for 20 minutes. The supernatant obtained after heating was injected into a HiPerp Q HP column (GE Healthcare) equilibrated with 50 mM TrisHCl buffer (pH 8.0), and the target protein was separated and purified by applying a salt concentration gradient with 50 mM TrisHCl buffer (pH 8.0) containing 0 mM to 500 mM NaCl. The solvent of the solution containing the protein was replaced with 10 mM TrisHCl buffer (pH 8.0) by centrifugal ultrafiltration using Vivaspin 20-100K (GE Healthcare). The solution was injected into a HiPrep 26 / 60 Sephacryl S-300 HR column (GE Healthcare) equilibrated with 10 mM TrisHCl buffer (pH 8.0), and FTL was separated and purified according to size. The solution containing FTH was concentrated by centrifugal ultrafiltration using Vivaspin 20-100K (GE Healthcare), and the protein concentration was determined using Protein Assay CBB solution (Nacalai Tesque) with bovine albumin as the standard. As a result, 1 ml of solution containing 3 mg / ml FTL was obtained per 100 ml of culture medium.

[0115] <Example 11: Examination of inclusion of fluorescently modified peptide> An FTL was constructed that encapsulated a peptide (5(6)-FAM-RFARKGALRQKNVHEVKN (sequence number 9), PKC-F, chemical formula 2524) modified with the fluorescent dye fluorescein (FAM).

[0116] 0.5 ml of 50 mM glycine hydrochloride buffer (pH 2.3) containing FTL (formula 480466) at a final concentration of 5 mg / ml and peptide at a final concentration of 0.5 mM was left at room temperature for 15 minutes. Then, 50 μl of 1 M Tris hydrochloride buffer (pH 9.0) was added to neutralize and left at room temperature for 3 hours. After leaving it, it was centrifuged (15,000 rpm, 1 minute), and the supernatant was collected and the volume was increased to 3 ml with 10 mM Tris hydrochloride buffer (pH 8). The solution was injected into a HiPrep 26 / 60 Sephacryl S-300 HR column (GE Healthcare) equilibrated with D-PBS (-) (Fujifilm Wako Pure Chemical Co., Ltd.), and 24-mer FTL was separated and purified by size at a flow rate of 1.3 ml / min. When the purified ferritin was analyzed at a flow rate of 0.5 ml / min using a HiPrep 16 / 60 Sephacryl S-300 HR column (GE Healthcare) equilibrated with PBS, the absorbance at 480 nm, which was not observed in FTL alone, was observed at the same position as the FTL peak, indicating that the peptide was encapsulated in FTL (Figure 19). From the above, it was found that peptides can be encapsulated in FTL as well.

Claims

1. The peptide is composed of 3 to 19 amino acid residues, and The following conditions: 3.7≦X≦5.9 and 445≦Y≦2524; (where X represents the charge of the peptide at pH 9 and Y represents the formula weight of the peptide) Fulfilling The peptide is a peptide that is not fused to the C-terminus of the ferritin monomer that constitutes ferritin. Peptide-encapsulated ferritin.

2. The peptide-encapsulated ferritin according to claim 1, wherein the peptide is composed of 4 to 16 amino acid residues.

3. An intracellular delivery agent for a peptide, comprising: Contains peptide-encapsulated ferritin, The peptide is composed of 3 to 19 amino acid residues, and The following conditions: 3.7≦X≦5.9 and 445≦Y≦2524; (where X represents the charge of the peptide at pH 9 and Y represents the formula weight of the peptide) Fulfilling The peptide is a peptide that is not fused to the C-terminus of the ferritin monomer that constitutes ferritin. Intracellular delivery agents for peptides.

4. The agent according to claim 3, wherein the peptide is delivered intracellularly to a human cell.

5. The agent according to claim 3 or 4, wherein the peptide is delivered intracellularly to cancer cells.

6. A method for producing peptide-encapsulated ferritin, comprising: 1) Dissociating ferritin by placing ferritin in a buffer solution of pH 3.0 or less in the presence or absence of a peptide; and 2) Coexisting the dissociated ferritin and the peptide in a buffer solution with a pH of 5.0 to 10.0 to produce peptide-encapsulated ferritin; Including, The peptide is composed of 3 to 19 amino acid residues, and The following conditions: 3.7≦X≦5.9 and 445≦Y≦2524; (where X represents the charge of the peptide at pH 9 and Y represents the formula weight of the peptide) Fulfilling The peptide is a peptide that is not fused to the C-terminus of the ferritin monomer that constitutes ferritin. Manufacturing method.

Images