Systems, methods, and apparatus for automated, self-contained biological analysis
A self-contained PCR testing system with a disposable test container and portable unit allows for rapid, cost-effective PCR analysis, addressing the limitations of existing systems by enabling community-scale disease detection and surveillance.
Patent Information
- Application Number
- JP2023568447
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2021-05-03
- Filing Date
- 2022-05-03
- Publication Date
- 2026-01-13
- Estimated Expiration
- 2042-05-03
AI Technical Summary
Existing PCR-based testing systems are expensive, complex, and limited to clinical laboratories, with long turnaround times, making them unsuitable for rapid community-scale disease detection and surveillance.
A self-contained, disposable test container assembly with integrated sample preparation and reaction chambers, vacuum-assisted sample processing, and a portable test unit for real-time PCR analysis, utilizing a smartphone for result reporting and data communication.
Enables rapid, cost-effective, and user-friendly PCR testing outside clinical settings, facilitating near-real-time results and community-scale disease detection.
Smart Images

Figure 0007797537000001 
Figure 0007797537000002 
Figure 0007797537000003
Abstract
Description
[Technical Field]
[0001] The present disclosure relates to systems, methods, and devices for performing biological analyses, including PCR tests for detecting organisms. [Background technology]
[0002] Polymerase chain reaction (PCR) has become the preferred method for sensitive and specific detection of pathogens in samples. Detection of pathogen-derived nucleic acids by PCR is now the gold standard for diagnosing many infectious diseases. One challenge that arose during the COVID-19 pandemic was the ability to rapidly perform such assays on a broad community scale and communicate results in near real time so that case detection, contact tracing, and surveillance could be implemented to effectively suppress and control the disease. Many PCR-based testing platforms currently exist, offering closed sample-to-answer designs with turnaround times of 1–2 hours and minimal operator intervention. However, these designs involve complex mechanisms and consumables, making them expensive, and their deployment is primarily limited to clinical laboratories, healthcare providers, government facilities, and other professional organizations. Other PCR systems allow consumers to collect their own samples, but the actual testing and analysis takes place at a centralized lab where the samples are sent, with turnaround times often exceeding 24 hours.
[0003] A system or process for performing biological analyses that is easy to operate would be an improvement in the art. Such a system that requires minimal sample processing for use would be a further improvement in the art. Summary of the Invention [Means for solving the problem]
[0004] The present disclosure is directed to systems, devices, and methods for performing amplification-based analyses, including PCR tests. In one exemplary embodiment of a first aspect of the present disclosure, the system may include a test container assembly and a test unit having a seat for receiving the test container assembly. In some embodiments, the test container assembly may be formed as a single-use, disposable unit.
[0005] The test container assembly can include a sample collection port, a sample preparation chamber, and a reaction chamber. The sample collection port can be formed as a funnel-shaped cup member having a bottom opening sealed by a plug member. The sample preparation chamber can be maintained under vacuum and in fluid connection with the bottom opening. The reaction chamber can also be maintained under vacuum. The sample preparation chamber and the reaction chamber can each contain any necessary reaction components. The test unit can include components that align with the various chambers of the test container assembly and enable analysis to be performed.
[0006] In another aspect of the present disclosure, an exemplary method for analyzing a sample is provided, which may include providing a test container assembly and placing the sample in its collection port, which is then closed with a lid assembly that may include a movable plunger. The test container assembly may be placed in a seat of a test unit. The plunger may disengage a bung member, allowing the sample to be drawn into the sample preparation chamber by vacuum. In some embodiments, this may be achieved by securing the lid assembly to the collection port. In other embodiments, the plunger may be advanced to disengage the bung. A temperature control device in conductive contact with the sample preparation chamber may be activated to perform or terminate a sample preparation reaction. A channel communicating with the reaction chamber may then be opened to allow the prepared sample to flow into the reaction chamber. The reaction chamber may then be sealed, and a reaction, such as PCR, may be performed by activating a temperature control device in conductive contact with the reaction chamber. Detection may occur during and / or after the reaction by detecting fluorescent emission from a fluorescent dye in the reaction chamber that is activated in the presence of a reaction product of interest. A melting curve analysis may optionally be performed during and / or after the reaction to confirm the presence or absence of a particular analyte or a particular variant of the analyte. In some embodiments, the testing unit may include a laser as a light source, and a multi-channel spectrometer may be used for detection.
[0007] In another aspect, the test unit can include a CPU that controls its various components to perform the test procedure and a communication gateway, such as a Bluetooth or other wireless communication component. In some embodiments, the test unit can communicate with a remote system that dictates specific assay requirements and receives and analyzes data collected by the test unit to determine results. In some embodiments, the system can utilize a handheld device, such as a user's smartphone, to route communications and can use an app on the device to report results to the user.
[0008] In another aspect of the present disclosure, exemplary embodiments of the system and container according to the present disclosure can be used in conjunction with a method for detecting nucleic acids in a sample. In such a method, a container or vessel can be provided having multiple fluidly connected chambers, including a sample preparation zone and an amplification zone, with one or more sealable ports fluidly connecting the chambers. It will be understood that the sealable port can provide the only access to the chambers from outside the vessel. A sample can be introduced into a first chamber through a collection port, which has a bottom opening sealed by a plug member. When a lid assembly with a movable plunger assembly is secured to the collection port, the plug member can contact the plunger and disengage, allowing the sample to enter the sample preparation chamber fluidly connected to the bottom opening.
[0009] Optionally, the sample may then be processed in the sample preparation chamber by heating to inactivate enzymes in the sample or by reactants contained within the sample preparation chamber. A seal may be opened to allow the sample to flow from the sample preparation chamber to the reaction chamber. In some embodiments, this may be accomplished by advancing a plunger into the sample preparation chamber to pressurize the sample and fracture the seal. The reaction chamber may then be sealed. Within the reaction chamber, the nucleic acids in the sample may be mixed with PCR components, including primers configured to amplify one or more targets, and the target nucleic acids may be amplified.
[0010] Fluorescence emission signals from fluorescent dyes within the amplification zone can be detected, with the fluorescence excited by a laser diode and the emission detected by a multichannel spectrometer. A multichannel spectrometer capable of processing at least four spectral channels in parallel at wavelengths between approximately 350 nm and 1000 nm can be used. The fluorescence data can be communicated to a cloud or local CPU via a mobile phone or other user-controlled device or operating system. The data can then be analyzed, and the analysis results can be received from the cloud or local CPU by the mobile phone or other user-controlled device or operating system.
[0011] Those skilled in the art will understand that the various drawings are for illustrative purposes only. The nature of the present disclosure, as well as other embodiments in accordance with the present disclosure, may be more clearly understood by reference to the following detailed description, the appended claims, and the several drawings. [Brief explanation of the drawings]
[0012] [Figure 1A] 1 is a perspective view of a first exemplary embodiment of a body for a testing container assembly according to the principles of the present disclosure; [Figure 1B] 1 is a bottom view of a first exemplary embodiment of a body for a test container assembly according to the principles of the present disclosure; [Figure 1C] 1 is a side view of a first exemplary embodiment of a body for a test container assembly according to the principles of the present disclosure; [Figure 1D] 1 is a top view of a first exemplary embodiment of a body for a test container assembly according to the principles of the present disclosure; [Figure 1E] 1 is a cross-sectional view of a first exemplary embodiment of a body for a test container assembly according to the principles of the present disclosure; [Figure 2] 1A-1E are side views of an exemplary plug member for use with the test container assembly of FIGS. 1A-1E. [Figure 3A]FIG. 2 is a bottom perspective view of one exemplary lid member for use with the test container assembly of FIGS. 1A-1E. [Figure 3B] FIG. 2 is a cross-sectional side view of one exemplary lid member for use with the test container assembly of FIGS. 1A-1E. [Figure 4A] FIG. 2 is a perspective view of one exemplary plunger member for use with the test container assembly of FIGS. 1A-1E and the lid member of FIGS. 3A and 3B. [Figure 4B] 1A-1E and the lid member of FIGS. 3A and 3B. FIG. [Figure 5A] FIG. 1B is a perspective view of the test container assembly of FIGS. 1A-1E with the lid member of FIGS. 3A and 3B and the plunger member of FIGS. 4A and 4B in use. [Figure 5B] FIG. 1B is a cross-sectional side view of the test container assembly of FIGS. 1A-1E with the lid member of FIGS. 3A and 3B and the plunger member of FIGS. 4A and 4B in use. [Figure 6A] 1A-1E in place within the seat of one exemplary embodiment of a test unit according to the principles of the present disclosure. FIG. [Figure 6B] FIG. 7 is a cross-sectional view illustrating an exemplary embodiment of a detection assembly similar to that depicted in FIG. 6, using a spherical lens to focus illumination and collection of fluorescent signals. [Figure 6C] 10 is a perspective view of a second exemplary embodiment of a test container according to the principles of the present disclosure in position within a seat of a second exemplary embodiment of a test unit according to the principles of the present disclosure; FIG. [Figure 6D] FIG. 6D is a cross-sectional side view taken along line AA of FIG. 6C. [Figure 7] 1 shows fluorescence at three wavelengths monitored in real time within the test unit during amplification of a human gene target using dried amplification reagents within the test container assembly. [Figure 8A]Amplicon melting was performed in the amplification zone of the test container assembly, and the three-color fluorescence was monitored in real time during melting (Figure 8A). [Figure 8B] From the three-color fluorescence resulting from amplicon melting performed in the amplification zone of the test container assembly and monitored in real time during melting ( FIG. 8A ), a derivative melting curve is calculated and rendered by an external CPU in communication with the test unit according to the principles of the present disclosure ( FIG. 8B ), where F is fluorescence, T is temperature, and dF / dT is the derivative coefficient. [Figure 9] 1 is a differential melting curve calculated from fluorescence monitored at six wavelengths simultaneously during melting in a test unit using two double-stranded DNA fragments in a test container assembly according to the present disclosure. DETAILED DESCRIPTION OF THE INVENTION
[0013] The present disclosure relates to devices, systems, and methods related to the performance of biological analyses, including PCR testing. Those skilled in the art will understand that the embodiments described herein are exemplary and are not intended to limit the scope of the disclosure or the appended claims. Furthermore, those skilled in the art will understand that various combinations or modifications of the embodiments presented herein may be made without departing from the scope of the disclosure. All such alternative embodiments are within the scope of the present disclosure.
[0014] The present disclosure is directed to systems, devices, and methods for performing biological analyses, including PCR testing. While PCR is the amplification method used in the examples herein, it will be appreciated that any amplification method using primers may be suitable, regardless of whether a signal or target is being amplified. Indeed, any proximity-based amplification approach known to those skilled in the art may be used, including assays for signal amplification to detect antigens. Some suitable procedures may include polymerase chain reaction (PCR); strand displacement amplification (SDA); nucleic acid sequence-based amplification (NASBA); cascade rolling circle amplification (CRCA); loop-mediated isothermal amplification of DNA (LAMP); isothermal and chimeric primer-initiated amplification of nucleic acids (ICAN); target-based helicase-dependent amplification (HDA); transcription-mediated amplification (TMA), CRISPR-Cas9-triggered strand displacement amplification, immuno-PCR, and the like. Amplification methods may further include analyses such as melting curve analysis. Therefore, when the term PCR is used, it should be understood to include other alternative amplification methods and analyses of the amplified products. It is understood that protocols will need to be adjusted accordingly.
[0015] For purposes of understanding, the systems and methods herein are discussed in connection with an exemplary PCR-based assay for coronavirus in saliva or nasal swab samples, such as for COVID-19 testing in humans. It will be understood that various assays for a variety of samples and conditions using different reagents and reaction parameters may be used. Environmental and agricultural samples containing potential biological material may also be used. All such variations are within the scope of this disclosure.
[0016] In one exemplary embodiment, a system according to the present invention can include a test container and a test unit having a seat for receiving the test container assembly. In some embodiments, the test container assembly can be formed as a single-use, disposable unit.
[0017] 1A, 1B, 1C, 1D, and 1E, one exemplary test container assembly, generally designated 10, is depicted. It will be understood that the term test container assembly, as used herein, refers to an assembly including one or more vessels or enclosures for containing samples and reactants for processing in accordance with the present disclosure and is used interchangeably with the term container assembly. In the depicted embodiment, the test container assembly 10 may include a body 100 formed of a generally rigid material, which defines a sample collection port 1000, a sample preparation chamber 1100, and a reaction chamber 1200. It will be understood that the body 100 may be constructed of a material compatible with the particular reaction and assay being performed in a particular embodiment. For example, an injection-moldable polymeric material that is non-reactive with PCR reactants and substrates may be used. In the depicted embodiment, a base 1001 may be formed as a generally planar member having an upper surface 1003 and an opposite lower surface 1004.
[0018] The sample preparation chamber 1100 may be disposed within the base 1001 and defined by sidewalls 1101 that rise from the base 1001 and converge towards an upper opening 1103. At the lower end, the sample preparation chamber 1100 may have an open port 1102 that extends through the lower surface 1004.
[0019] A sample collection port 1000 may be located at the top end of the sample preparation chamber 1100. As depicted, the sample collection port 1000 may be formed as a funnel-shaped cup defined by a surrounding sidewall 1011 that tapers to a bottom opening 1013. The sidewall 1011 may include a threaded upper portion 1017 or other structure that allows a lid to be secured thereto.
[0020] As depicted, the bottom opening 1013 and the top opening 1103 may be aligned and define the upper end of a bore 1015 defined by a surrounding sidewall.
[0021] For use, the bore 1015 can accommodate a plug member that seals the bottom of the sample collection port 1000 and the top of the sample preparation chamber 1100. As depicted in FIG. 2 , the plug member may be a ball bearing 200 sized to correspond to the diameter 1016 of the bore 1015. In some embodiments, the ball bearing may have a diameter slightly larger than the diameter of the bore, with the sidewall material compressing the plug member to hold it in place. It will be appreciated that in some other embodiments, the plug member may have a different shape or may be formed as a frangible plug that traverses the bore 1015. In additional embodiments, the frangible seal may be a pierceable plug or seal provided within the bore 1015.
[0022] The reaction chamber 1200 may be formed as a bore through the base 1001 at a location spaced from the sample preparation chamber 1100. The top end of the reaction chamber 1200 may be sealed with a material that is sufficiently transparent to the wavelengths used in detecting the assay being performed to act as a detection window 1203. The detection window 1203 may be formed of a flexible material that allows the window to flex to form a dome shape when the chamber is filled.
[0023] The bottom surface 1004 of the base 1001 can include a series of channels formed in the bottom surface 1004. As depicted, a reaction channel 1302 can lead from the sample preparation chamber 1100 to the reaction chamber 1200. Other channels can lead from the chambers or channels to a vacuum port 1300.
[0024] The bottom surface 1004 may be covered by a bottom sealing sheet 1400 ( FIG. 5B ) of a flexible material. The flexible material may be a flexible plastic film or other flexible material, such as polyester, polyethylene terephthalate (PET), polycarbonate, polypropylene, polymethyl methacrylate, and mixtures thereof, which may be manufactured by any process known in the art, including extrusion, plasma deposition, and lamination. The sheet may be adhered to the edges and / or other portions of the bottom surface by heat treatment or a suitable adhesive, but may remain flexible in the areas covering the sample preparation chamber 1100, reaction chamber 1200, and various channels. It will be understood that in some embodiments, the detection window 1203 and the bottom sheet 1400 may be formed from similar materials. It will be understood that the bottom sealing sheet 1400 may be composed of a material compatible with the particular reactions and assays being performed in a particular embodiment.
[0025] The sample preparation chamber 1100 and the reaction chamber 1200 can be maintained under vacuum. In some embodiments, the vacuum can be applied using a vacuum port 1300. In some embodiments, application of the vacuum can draw the bottom sealing sheet 1400 to the bottom surface 1004, and this contact can form a frangible seal between the bottom sealing sheet 1400 and the bottom surface, sealing the sample preparation chamber 1100 and the reaction chamber 1200 from each other. In other embodiments, the frangible seal between the bottom sealing sheet 1400 and the bottom surface 1004 can be formed by the application of heat. It will be understood that any method of forming a frangible seal between the bottom sealing sheet 1400 and the bottom surface known to those skilled in the art can be used. The vacuum port 1300 can then be sealed or can contain a sealing member that allows for the application of a vacuum. The vacuum port 1300 can be located on an extension protruding from the base 101 or can be placed directly on the base 1001.
[0026] 1B , the sample preparation chamber 1100 can include a stress concentrator feature to facilitate opening of the frangible seal, as discussed elsewhere herein. In the depicted embodiment, the sample preparation chamber 1100 includes an elongated section 1110 divided by a stress concentrator 1112, which appears as part of the bottom surface tapering to a point dividing the elongated section into two "pockets." When the sample preparation chamber 1100 is pressurized, the pockets fill with sample, thereby expanding, and the tapered points serve as initiation points for the bottom sealing sheet 1400 to peel from the bottom surface 1300 when the frangible seal is opened.
[0027] It will be understood that the sample collection port 1000, sample preparation chamber 1100, and reaction chamber 1200 may each contain any necessary reaction components, including reactants in dry form, disposed in and sealed within such chambers. The reaction components in dry form can be lyophilized using various known methods (e.g., Babonneau et al., (2015) Development of a Dry-Reagent-Based qPCR to Facilitate the Diagnosis of Mycobacterium ulcerans Infection in Endemic Countries. PLoS Negl Trop Dis 9(4): e0003606. https: / / doi.org / 10.1371 / journal.pntd.0003606 and Panoka et al., U.S. Patent No. 8,900,525, the contents of each of which are incorporated herein by reference in their entirety) or air-dried using various known methods (e.g., Metzler et al., U.S. Patent No. 8,652,811, and Rombach, et al., (2014) Real-time stability testing of air-dried primers and fluorogenic hydrolysis probes stabilized by trehalose and xanthan, the contents of each of which are incorporated herein by reference in their entirety). BioTechniques 57:151-155. doi 10.2144 / 000114207). For example, the sample collection port 1000 can contain reagents for initiating the sample preparation procedure in the form of pellets or films disposed on the sidewalls at its lower portion. The sample preparation chamber 1100 can similarly contain sample preparation components.
[0028] One potential reagent is a protease, such as proteinase K, which can be used to digest proteins in human samples that may degrade DNA or RNA or otherwise inhibit PCR. Alternatively, or in addition, TCEP (tris(2-carboxyethyl)phosphine) or NAC (N-acetylcysteine) can be used to cleave disulfide bonds present in saliva or nasal enzymes, making them more susceptible to denaturation. It will be understood that the specific components and / or reagents may vary depending on the assay being performed. In some embodiments, mineral oil, paraffin wax, or a combination of mineral oil and paraffin wax may be present in the first chamber. During use, these may float above the aqueous layer during the filling and / or heating steps, thereby reducing bubbles and ensuring the sample is closest to the heater. Paraffin wax can also block the top outlet, acting to seal the sample within the second chamber.
[0029] The reaction chamber 1200 can house assay components and reactants, along with analytical components such as dyes, colorants, etc. In some embodiments, the top film sealing the reaction chamber 1200 can have lyophilized or air-dried enzymes (including polymerases or transcriptases), nucleotides, and / or buffers thereon. The bottom sealing film can have air-dried or lyophilized primers, oligonucleotides, and / or dyes thereon. It will be understood that in some embodiments, drying can be performed on the flexible film itself to deposit materials in the appropriate locations, while in other embodiments, pre-dried materials can be deposited in place.
[0030] 6B and 6C, an outer shroud 605A may be used to reinforce and protect the assembly 10 or 10A. The shroud 605A may include a body formed from a suitable material that may be secured to the base 1001 and surround the sample collection port 1000 body, the sample preparation chamber 1100, and a portion of the top surface of the base 1001 to facilitate handling and provide reinforcement during use. A locking mechanism 603 may be disposed on the shroud 605A at the top surface to secure the lid 300, as discussed further herein.
[0031] Turning to FIGS. 3A and 3B, one exemplary lid member 300 for use with the test container assembly of FIGS. 1A-1E is depicted. In the depicted embodiment, the lid 300 is formed as a cap that uses threads 3006 located inside the sidewall 3004 to attach to the threaded upper portion 1017 of the sample collection port 1000, as depicted in FIGS. 5A and 5B, with the upper portion 3002 of the cap closing the open top of the sample collection port 1000. In some embodiments, one or more locking structures, such as locking tabs 3007, can connect to corresponding locking structures 1007 on the sample collection port 1000 or on the shroud 605A. It will be understood that this particular closure is merely exemplary, and any suitable arrangement known to those skilled in the art may be used.
[0032] A plunger bore 3010 may be disposed within the lid member 300. In the depicted embodiment, the plunger bore 3010 may be formed as an elongated tube 3011 extending from the underside of the upper portion 3002 of the lid downward to a bottom opening 3014. A top opening 3012 in the upper portion 3002 of the lid similarly aligns with the bore 3010. The bore 3010 has a diameter indicated at 3016, which may be generally constant from the upper portion 3002 of the cap downward, with the portion that penetrates the upper portion 3002 of the cap narrowing to provide a stop for the plunger 400.
[0033] The plunger 400 is best depicted in Figures 4A and 4B. As depicted, the plunger 400 may be formed as a shaft member 400 having a generally cylindrical shape with a flat upper end 4002 and a generally flat lower end 4004. The body of the shaft 4000 may include a lower portion having a smaller diameter to form a recess or step 4006. It will be understood that the specific sizes and shapes of the plunger and cap portions may vary in different embodiments to provide the functions discussed further herein.
[0034] 5A and 5B depict the test container assembly of FIGS. 1A-1E with lid member 300 and plunger member 400 (FIG. 5B). As depicted, the larger diameter of plunger body 4000 can accommodate the diameter of bore 1015 such that when lid 300 is secured to sample collection port 1000, its side seals against bore 1015 and its smaller distal end enters reaction chamber 1200. It will be appreciated that plunger 400 can act like a syringe plunger to seal against bore 1015 and provide volume control for sample preparation chamber 1100.
[0035] FIG. 6A depicts a test container assembly 10 in its correct position within a seat 600 in one exemplary embodiment of a test unit 60 according to the principles of the present disclosure. The seat 600 may be formed as a surface for receiving the base 1001 of the container assembly with the test unit 600 components aligned to enable assay performance. The surface 602 may include alignment features, such as tabs or recesses, that allow the base to be properly aligned and maintained in the correct position. The seat 600 may be positioned within the chamber of the unit 60 when components are placed over a portion of the container assembly 10 during use, and such components may be movable as the unit 60 is opened and closed, allowing the user to easily place the container assembly 10 within the seat 600. The seat 600 may receive the base 1001 in a position angled or tilted at least slightly away from horizontal to encourage air bubbles in the solution in the reaction chamber 1200 to move away from the center of the detection window 1203.
[0036] The seat 600 can include a first temperature control element 610 in thermally conductive contact with the sample preparation chamber 1100 for use. In the depicted embodiment, the first temperature control element is a Peltier element with a conductive member 612 disposed in contact therewith such that the conductive member 612 is aligned with the bottom of the sample preparation chamber 1100 when the container assembly 10 is placed within the seat 600. It will be understood that the depicted Peltier element is merely exemplary, and any temperature control assembly known to those skilled in the art can be used, including tubing for circulation of cooled or heated fluids, resistive heating elements, etc.
[0037] Similarly, the seat 600 can include a second temperature control element 614 in thermally conductive contact with the reaction chamber 1200 for use. In the depicted embodiment, the second temperature control element is a Peltier element with a conductive member 616 disposed in contact therewith such that the conductive member 616 is aligned with the bottom of the reaction chamber 1200 when the container assembly 10 is placed within the seat 600. It will be understood that the depicted Peltier element is merely exemplary, and any temperature control assembly known to those skilled in the art can be used, including tubing for circulation of cooled or heated fluids, resistive heating elements, etc.
[0038] A retractable sealing unit, such as a heat sealer 618, can be positioned within the seat 600 so as to reside below the reaction channel 1302 when the container assembly 10 is placed within the seat 600. The retractable sealing unit can be actuated to move upward and, if necessary, heat to melt the sealing sheet 1400 through the channel 1302, thereby sealing and isolating the reaction chamber 1200, as discussed further herein.
[0039] In the depicted embodiment, a detection assembly 620 may be positioned near the seat 600. The detection assembly 620 may include the necessary components to perform detection through the detection window 1203, including an energy source and a sensor. If fluorescence emission detection is used, an energy source for excitation may be present. In the depicted embodiment, this energy source is a laser 630. The use of a laser allows for energy input near a single predefined wavelength, thereby eliminating the need for waveguides and / or filters required in some known detection systems. One suitable laser assembly may be a PL-450B type laser commercially available from OSRAM Opto Semiconductors Inc., which is a blue laser diode in a metal can package that emits light at a wavelength of approximately 450 nm. It will be understood that any suitable laser may be used. Alternatively, an LED may be used as a cost-effective option for the energy source, combined with the use of glass or bandpass / interference filters. The sensor may be an optical detector 640, such as a multichannel spectrometer. One suitable sensor is the AS7341-DLGT, available from AMS, which is an 11-channel spectrometer with a defined spectral response from wavelengths of approximately 350 nm to 1000 nm. It will be appreciated that any suitable sensor may be used. A multi-channel spectrometer may be used to detect emitted fluorescence at multiple wavelengths.
[0040] 6B depicts a cross section of another exemplary embodiment of a detection assembly 620A for an inspection unit according to the present disclosure in relation to a reaction chamber 1200 in the base 1001 of a container assembly positioned within the seat of the inspection unit. Detection assembly 620A is similar to detection assembly 620 and may include the components necessary to perform detection through a detection window 1203, including an energy source such as a laser 630 and an optical detector such as a multichannel spectrometer 640. Additionally, a first spherical lens 650A may be positioned in front of laser 630 and a second spherical lens 650B may be positioned in front of detector 640 to focus the illumination and collection of fluorescent signals (depicted by dotted arrows 652A and 652B) through the detection window 1203 of reaction chamber 1200.
[0041] Spherical lenses 652A and 652B may be ball lenses, which may be formed as transparent spheres. Suitable materials may include silica glass or another highly transparent material with an appropriate refractive index that allows for the use of small diameter spheres capable of focusing laser and fluorescent signals for use in miniaturized or micro-optical applications.
[0042] It will be appreciated that the detection assembly 620 may be movable, allowing the detection assembly 600 to be retracted as the unit 60 is opened and closed, allowing a user to easily place the container assembly 10 in the seat 600 and then position the laser 630 and detector 640 in the correct position to interact with the collection window 1203 of the container assembly 10 when needed for use. It will be appreciated that the placement of the light source and detector is merely exemplary, and any placement that allows for focusing energy for excitation into the reaction chamber and detecting the emitted signal from the reaction chamber may be used. For example, the positions of the light source and detector may be swapped or they may be located elsewhere.
[0043] The test unit 60 may further include a CPU that controls its various components to perform the test procedure, and a communications gateway, such as Bluetooth or other wireless communication components. In some embodiments, the test unit may perform self-diagnostic or calibration protocols, or may communicate with a remote system that dictates specific assay requirements and receives and analyzes data collected by the test unit to determine results. In some embodiments, the system may utilize a handheld device, such as a user's smartphone, to route communications and may use an app on that device to report results to the user.
[0044] 6B and 6C depict a test container assembly 10A including a shroud 605A in position within a seat 600A in another exemplary embodiment of a test unit 60A according to the principles of the present disclosure. The seat 600A may be formed as a surface for receiving the container assembly base 1001 and may include alignment walls 601A to align the components of the test unit 60A so that an assay can be performed. The seat 600A may include various features and components discussed herein in connection with the seat 600 of FIG. 6A. The test unit 60A may also include a system for reducing or relocating gas bubbles within the reaction chamber 1200 to facilitate data collection.
[0045] The foam reduction system 611 may include a rocker arm 6002 extending from a driver assembly to a distal striking end 6003. In the depicted embodiment, the driver assembly includes a vibrator 6004 for actuating the rocker arm 6002 and a return spring 6005. The vibrator 6004 may be actuated by an electric motor (not shown) or as otherwise known in the art. It will be understood that any suitable driver assembly for actuating the rocker arm 6002 may be used.
[0046] The butt end 6003 of the rocker arm 6002 may be positioned to underlie a portion of the base 1001 when the test container assembly is in place within the seat 600. The seat 600A may include a recess through which the rocker arm 6002 extends and / or an opening through which the butt end 6003 can emerge during use. The butt end 6003 may be positioned to underlie a portion of the base 1001 closer to the distal end. The butt end may be positioned so that it does not engage the reaction chamber 1200 during use.
[0047] For use, container assembly 10 or 10A, along with lid assembly 300 housing plunger 400, may be provided to a user as part of a test kit. These components may be provided in a sealed package, such as a vacuum-sealed envelope, that maintains the sterility of the components used. Other materials, such as instructions or sample collection supplies, may also be provided in such a kit. In an exemplary embodiment of a PCR-based test for the presence of coronavirus in human saliva, a sealed container of swishing solution and a set of instructions may be provided.
[0048] The sample can then be collected. In an exemplary embodiment for testing for the presence of coronavirus in human saliva, the user can swish the provided solution around in their mouth and spit into the collection port 1000. Alternatively, the user can collect an anterior nares (nasal) specimen with a collection swab and swirl the swab in solution already dispensed into the collection port 1000 or dispensed in a separate container, which is then used to pour the specimen solution into the collection port 1000. The collection port 1000 can then be closed by the lid assembly 300. Once the lid assembly is secured, the plunger's distal end 4004 can contact and disengage the plug member 200, drawing the sample by vacuum into the sample preparation chamber 1100 around the recess 4006. The test container assembly 10 can be placed into the seat 600 of the test unit 60 before or after the lid is secured. The presence of a longitudinal groove allows for venting of pressure changes as the plug member 200 is disengaged.
[0049] Once placed within seat 60, first temperature control device 610 is in conductive contact with sample preparation chamber 1100 and can be activated to carry out or complete a desired sample preparation reaction. For example, the sample can be heated at a sufficient temperature for a sufficient time to inactivate proteases, nucleases, and other enzymes that may be naturally present in saliva. If necessary pre-processing for a particular assay is desired, reactants can be present in sample preparation chamber 1100 in a dried form to be reconstituted with the sample, and the appropriate conditions can be provided by temperature control device 610. Once pre-processing is complete, the temperature control device 610 can be used to bring the sample to the appropriate temperature for further processing.
[0050] Once pre-treatment is complete, unit 60 can open the frangible seal between flexible sheet 1400 and bottom surface 1004, at least in the area of reaction channel 1302, allowing the pre-treated sample to flow along reaction channel 1302 to reaction chamber 1200. In the depicted embodiment, this can be done by advancing a piston through top opening 3012 of lid 300 and into bore 3010, where the top opening contacts top end 4002 of piston 400, advancing distal end 4004 into sample preparation chamber 1100, sealing bore 1015 and displacing the fluid sample to compress and deflect flexible sheet 1400 and open reaction channel 1302.
[0051] Once a sufficient amount of pre-treated sample reaches the reaction chamber 1200, the retractable sealing unit 618 can be extended to seal the sealing sheet 1400 to the bottom, thereby isolating the reaction chamber 1200. In the depicted embodiment, such sealing can be performed to close the channel in the area generally indicated by 1114 (FIG. 1B). A diagnostic reaction can then be performed. Reactants for a particular reaction can be present in the reaction chamber 1200 in a dried form reconstituted by the sample, and appropriate conditions can be provided by the second temperature control device 614.
[0052] In an exemplary embodiment of a PCR-based test for the presence of coronavirus in human saliva, the necessary reactants may be present. In one embodiment, to reduce the required pretreatment steps, UNG enzyme may be present to reduce cross-contamination and false positives. Appropriate temperature cycling for PCR may be provided to amplify specific regions of the coronavirus genome. In some embodiments, a fluorescent dye linked to an oligonucleotide probe that specifically binds to the amplification product during thermocycling may be used.
[0053] If present, the bubble reduction system can be activated to reduce any air or gas bubbles in the reaction chamber. In the depicted embodiment, when the vibrator 6004 is activated and the arm is constrained by the return spring 6005, the drive can be activated to vibrate the rocker arm 6002. The abutting end 6003 repeatedly contacts the base 1001 a set number of times or for a set period of time, providing energy to pop or displace any air bubbles in the reaction solution. If the base is seated on an inclined surface, any remaining bubbles can migrate toward the side of the chamber and away from the center of the detection window 1203. In an embodiment, if the base 1001 can flex as the rocker arm is activated, the sensor assembly 620 can be positioned away from the container assembly during bubble reduction operation.
[0054] Once the reaction is sufficiently complete, detection can occur; in an exemplary embodiment, a laser 630 is used to provide energy to the reaction chamber at a first wavelength, and a sensor 640 is used to read emissions at different wavelengths on different channels. If appropriate, the sensor assembly 620 can be moved to a position that allows detection to be performed.
[0055] In an exemplary embodiment, a CPU within the test unit 60 may be used to control its various components to perform the test procedure. A communications gateway allows the CPU to communicate with a remote system that dictates specific assay requirements and receives and analyzes data collected by the test unit to determine results. In one exemplary embodiment, the unit 60 may be used in conjunction with a user's handheld mobile device, such as a smartphone, that operates a software application, or app. The user places the unit 60 in communication through such a device. In one example, instructions within the kit may include a scannable code, or a scannable code may be present on the container assembly 10. This code is specific to the particular test and opens a control panel on the mobile device. The remote system provides control instructions to the unit as the procedure is performed, and data collected by the sensor 640 may be transmitted to the remote system. The remote system may then perform data correction and normalization and analyze the data by using multiple channels to determine the presence or absence of the amplified sequence product of interest. The results may then be returned to the user via an app.
[0056] It will be understood that data transmission may be encrypted, anonymized, or otherwise performed in a manner that complies with applicable privacy laws. Additionally, if a positive test result needs to be provided to appropriate authorities, such as a local health department or the CDC, the remote system can do so.
[0057] It will be further understood that the systems, methods, and devices disclosed herein are not limited to a single condition. Reactions used to detect various analytes requiring different primers, enzymes, and / or different reaction conditions may be used. The remote system or test unit itself can vary the specific conditions to perform such tests. By using multiple emission wavelengths detected by the multichannel spectrometer, multiple analytes can also be tested simultaneously in a single reaction chamber. The portability and economy of the multichannel spectrometer sensor and remote data analysis enable the system to process such a variety of tests, and the unit can operate in a home or office environment instead of requiring a medical testing lab with trained personnel. It will be further understood that embodiments in which the container assembly includes multiple reaction chambers and the test unit houses the associated components for those reaction chambers are contemplated to enable the performance of multiplexed tests.
[0058] In another exemplary embodiment, the system and container according to the present disclosure can be used in conjunction with a method for detecting nucleic acids in a sample. In such a method, a container or vessel can be provided having multiple fluidly connected chambers, including a sample preparation zone and an amplification zone, with one or more sealable ports fluidly connecting the chambers. It will be understood that the sealable port can provide the only access to the chambers from outside the vessel. A sample can be introduced into a first chamber through a collection port, which has a bottom opening sealed by a plug member. When a lid assembly is secured to the collection port, the collection port is closed, and the lid assembly includes a movable plunger assembly that can contact the plunger to disengage the plug member and allow the sample to enter the sample preparation chamber fluidly connected to the bottom opening.
[0059] Optionally, the sample may then be treated in the sample preparation chamber by heating to inactivate enzymes in the sample or with reactants contained within the sample preparation chamber. The seal may be opened to allow the sample to flow from the sample preparation chamber to the reaction chamber. In some embodiments, this may be done by advancing a plunger into the sample preparation chamber to pressurize the sample and fracture the seal. The reaction chamber may then be sealed.
[0060] Within the reaction chamber, nucleic acids in the sample can be mixed with PCR components including primers configured to amplify one or more targets, and the target nucleic acids can be amplified.
[0061] Fluorescence emission signals from fluorescent dyes in the amplification zone can be detected. The fluorescence is excited by a laser diode, and the emission is detected by a multichannel spectrometer. A multichannel spectrometer capable of processing at least four spectral channels in parallel at wavelengths between approximately 350 nm and 1000 nm can be used. The fluorescence data can be communicated to a cloud or local CPU via a mobile phone or other user-controlled device or operating system. The data can then be analyzed, and the analysis results can be received from the cloud or local CPU by the mobile phone or other user-controlled device or operating system.
[0062] In such methods, it will be understood that the amplification zone can contain primers configured to amplify one or more nucleic acid targets that may be present in the sample. Such nucleic acid targets may be derived from pathogens such as viruses, bacteria, and fungi. Some exemplary pathogenic viruses may include coronaviruses, adenoviruses, PIV1, PIV2, PIV3, RSV, influenza A, influenza B, rhinovirus, and non-HRV enteroviruses. Some such coronavirus targets may include 229E, NL63, OC43, and HKU1, MERS-CoV, SARS-CoV, and SARS-CoV-2. The method may be optimized to detect multiple SARS-CoV-2 variants. In other embodiments, the nucleic acid target may be a human nucleic acid sequence. In further embodiments, the target may consist of both a pathogen and a human analyte. The amplification zone may comprise dried amplification and detection reagents. In some embodiments, the amplification zone may comprise a means for performing a melting curve analysis.
[0063] A first non-limiting example of detection results from an amplification method according to the present disclosure is shown in Figure 7. A 50-bp fragment of a human polymorphic region (SNP RS1981928, chr2:47445309 + 47445358) was amplified in a test container assembly containing dried, pre-measured PCR reagents. In this example, 5 ng / μL of placenta-derived human DNA (Sigma-Aldrich, St. Louis, MO) dissolved in 2 mL of water was introduced into the sample collection port 1000. When the plunger 400 was engaged, the DNA solution was introduced into the sample preparation chamber 1100 and subsequently into the reaction chamber 1200, which was filled to a volume of 65 μL. Primers 5'CGAGGTAGTGTATTATTAGTGGGAAG SEQ ID NO. 1 and 5'AGGGAGATGATGTAGCACTCA SEQ ID NO. 2 (IDT, Coralville, IA) each at a final concentration of 0.5 μM when dissolved in the DNA solution, and Maverick Blue nucleic acid stain (Idaho Molecular, Inc., Salt Lake City, UT) at a final concentration of 20 μM were attached in dry form to the bottom inner surface of the reaction chamber (bottom sealing sheet 1400). Go-Taq DNA polymerase (0.13 U / μL, Promega, Madison, WI), 0.2 mM dNTPs, 4 mM MgCl2, 50 mM Tris HCl pH 8.5, and 0.12 mg / mL BSA (all final concentrations) were attached in dry form to the upper inner surface of the reaction chamber (detection window 1203). Amplification was performed for 45 cycles at 90°C for 0 seconds and 63°C for 4 seconds and monitored in real time through the detection window 1203 using three wavelength channels (480 nm, 515 nm, and 555 nm). These three wavelength channels covered the range of the fluorescence emission of Maverick Blue, which was used to detect the amplification products. The test unit used a spherical lens in front of a 450 nm laser diode and in front of a multichannel spectrometer.
[0064] After amplification, the sample was heated from 50°C to 90°C at a ramp rate of 0.35°C / s while fluorescence was monitored in real time using three channels (results depicted in Figure 8A). The data were then converted to a negative derivative melting curve shown in Figure 8B. A melting temperature of 77°C confirmed that the correct DNA fragment had been amplified. All data processing was performed by an external CPU communicating with the test unit via Bluetooth.
[0065] Another non-limiting example is shown in Figure 9, which shows a melting curve analysis being performed in a test container assembly using detection at six wavelengths: 480 nm, 515 nm, 555 nm, 590 nm, 630 nm, and 680 nm. The test unit has the same reagents and optical configuration and external CPU as described above for Figures 7, 8A, and 8B. Two synthetic double-stranded DNA fragments mimicking high-melting (75°C) and low-melting (63°C) temperature amplification products are melted in reaction chamber 1200. The high-melting DNA is a double-stranded fragment created by hybridization of an oligonucleotide having the sequence 5'CGGAATCTTGCACGCCCTCGCTCAGGCCTTCGTCACTGGTCCCGCCACC SEQ ID NO. 3 and its reverse complement. The low-melting DNA is a double-stranded fragment created by hybridization of an oligonucleotide having the sequence 5'CGGAATCTTGCACGCCCTCGCTCAGGCCTTCGTCACTGGTCCCGCCACC SEQ ID NO. 3 and its reverse complement. A GTGGAACCTCATCAGGA A SEQ ID NO. 4 and 5' C TCCTGATGAGGTTCCAC CTGGTTTThe double-stranded fragments created by hybridization of SEQ ID NO. 5 (where underlined bases have no complementary bases in the other strand) are stained with the double-stranded DNA binding dye Maverick Blue and detected in the first three color channels (480 nm, 515 nm, 555 nm). The low-melting point DNA fragment is further labeled with carboxyrhodamine (ROX) dye (optionally attached to the 5' end of AGTGGAACCTCATCAGGAA SEQ ID NO. 4) and detected in three additional channels (590 nm, 630 nm, 680 nm) enabled by fluorescence energy transfer from Maverick Blue.
[0066] While the present disclosure has been described with reference to particular embodiments, it can be further modified within its spirit and scope. Accordingly, this application is intended to cover any variations, uses, or adaptations of the present disclosure using its general principles. This application is intended to cover all departures from the present disclosure that come within known or customary practice in the art to which the disclosure pertains and that fall within the limits of the appended claims.
[0067] [Embodiment] (1) A system for conducting a biological assay, comprising: 1. A test container assembly comprising: a sample collection port having a bottom opening sealed by a plug member; a sample preparation chamber in fluid communication with the bottom opening; a reaction chamber; an inspection container assembly including: a lid assembly configured to close the sample collection port, the lid assembly including a movable plunger that contacts the plug member when the lid assembly is secured to the sample collection port; a test unit including a seat for receiving the test container assembly, a first temperature control device in conductive contact with the sample preparation chamber when the test container assembly is positioned within the seat; a second temperature control device in conductive contact with the reaction chamber when the test container assembly is placed in the seat; a detector assembly positioned to monitor conditions within the reaction chamber when the test container assembly is positioned within the seat; an inspection unit including: Including, the system. (2) The system described in embodiment 1, wherein the sample collection port is formed as a cup-shaped member positioned above the sample preparation chamber. (3) The inspection container assembly includes: a base member body having a top surface and an opposite bottom surface; a flexible bottom sealing sheet adhered to a portion of the bottom surface, wherein at least a portion of a lower end of the sample preparation chamber and at least a portion of the reaction chamber are defined by a space between the bottom surface and the bottom sealing sheet; 2. The system of claim 1, further comprising: (4) The system of embodiment 3, wherein the reaction chamber includes a detection window formed on the top surface of the base member body. (5) The system described in embodiment 4, wherein the detection window is formed from a flexible material.
[0068] (6) The system of embodiment 3, wherein the sample preparation chamber is maintained under vacuum until the plug member is pushed from the bottom opening by the movable plunger when the lid assembly is secured. (7) The system of embodiment 3, further comprising a reaction channel extending between the sample preparation chamber and the reaction chamber, the reaction channel being defined by a space between the bottom surface and the bottom sealing sheet. (8) The system of claim 7, wherein a frangible seal between the bottom sheet and the bottom surface of the base member seals the reaction channel until use. (9) The system of claim 8, wherein the bottom surface includes a stress concentration portion that defines a point at which the frangible seal opens during use. (10) The system of embodiment 8, wherein the testing unit further includes a plunger mechanism that contacts and advances the movable plunger to displace fluid within the sample preparation chamber and open the frangible seal.
[0069] (11) The system of embodiment 8, wherein the inspection unit further includes a heat sealer for sealing a portion of the bottom sheet to the bottom surface to close the reaction chamber. (12) The system of embodiment 1, wherein the detector assembly includes a multi-channel spectrometer and a light source selected from the group consisting of a laser diode and a light emitting diode. (13) The system of embodiment 12, wherein the detector assembly further comprises at least a first ball lens positioned to focus illumination of light from the light source onto the reaction chamber. (14) The system of embodiment 13, wherein the detector assembly further comprises a second ball lens positioned to focus emission light from the reaction chamber onto the multichannel spectrometer. (15) A method for analyzing a sample, comprising: depositing a sample into a sample collection port of a container assembly, the sample collection port having a bottom opening sealed by a plug member; securing a lid assembly to the sample collection port to close the sample collection port, the lid assembly including a movable plunger assembly; contacting the plug member with the plunger assembly to remove the plug member and allow the sample to enter a sample preparation chamber in fluid communication with the bottom opening; opening a seal to allow the sample to flow from the sample preparation chamber to a reaction chamber; conducting a reaction to amplify biological markers of interest that may be present in said sample; detecting the presence of the amplified biological marker of interest in said reaction chamber; A method comprising:
[0070] (16) The method of embodiment 15, wherein opening a seal to allow the sample to flow from the sample preparation chamber to the reaction chamber comprises advancing the movable plunger to displace fluid in the sample preparation chamber and open a frangible seal. 17. The method of claim 15, further comprising heating the sample in the sample preparation chamber to inactivate enzymes in the sample. (18) The method of embodiment 17, further comprising sealing the reaction chamber before carrying out the reaction that amplifies a biological marker of interest that may be present in the sample. (19) The method of embodiment 15, wherein the biological marker of interest is at least one nucleic acid target, and the reaction chamber contains primers configured to amplify one or more nucleic acid targets that may be present in the sample. (20) The method of embodiment 15, wherein the reaction chamber contains dried amplification and detection reagents therein.
[0071] 21. The method of claim 20, wherein the dried amplification and detection reagents are prepared by air drying. (22) The method of embodiment 15, wherein detecting the presence of the amplified biological marker of interest in the reaction chamber comprises detecting a fluorescent emission signal from a fluorescent dye. (23) The method of embodiment 15, wherein detecting the presence of the amplified biological marker of interest in the reaction chamber comprises performing a melting curve analysis. (24) A method for detecting a nucleic acid in a sample, comprising: 1. A container having a plurality of fluidly connected chambers, the plurality of fluidly connected chambers comprising: a sample preparation zone; an amplification zone; one or more sealable ports fluidly connecting the chambers, the sealable ports providing the only access to the chambers from outside the container; and introducing the sample into a first chamber through a collection port, the collection port having a bottom opening sealed by a plug member; securing a lid assembly to the collection port to close the collection port, the lid assembly including a movable plunger assembly; contacting the plug member with the plunger to remove the plug member and allow the sample to enter a sample preparation chamber in fluid communication with the bottom opening; opening a seal to allow the sample to flow from the sample preparation chamber to a reaction chamber; sealing the reaction chamber; mixing the nucleic acids in the sample with PCR components including primers configured to amplify one or more targets; amplifying the target nucleic acid; detecting a fluorescent emission signal from a fluorescent dye in the amplification zone; The fluorescence is excited by a laser diode, The emitted light is detected by a multi-channel spectrometer capable of processing at least four spectral channels in parallel at wavelengths between about 350 nm and 1000 nm; communicating the fluorescence data to the cloud or a local CPU via a mobile phone or other user-controlled device or operating system; receiving analytical results from the cloud or local CPU via a mobile phone or other user-controlled device or operating system; A method comprising: (25) The method of embodiment 24, wherein the amplification zone contains primers configured to amplify one or more nucleic acid targets that may be present in the sample.
[0072] (26) The method of embodiment 25, wherein at least one nucleic acid target is derived from a pathogen selected from the group consisting of a virus, a bacterium, and a fungus. (27) The method of embodiment 26, wherein the virus is selected from the group consisting of coronavirus, adenovirus, PIV1, PIV2, PIV3, RSV, influenza A, influenza B, rhinovirus, and non-HRV enterovirus. (28) The method of embodiment 27, wherein the coronavirus is selected from the group consisting of 229E, NL63, OC43, and HKU1, MERS-CoV, SARS-CoV, and SARS-CoV-2. (29) The method of embodiment 28, wherein multiple SARS-CoV-2 variants are detected. (30) The method of embodiment 25, wherein the nucleic acid target is a human nucleic acid sequence.
[0073] (31) The method of embodiment 25, wherein the amplification zone comprises dried amplification and detection reagents therein. 32. The method of claim 31, wherein the dried amplification and detection reagents are prepared by air drying. (33) The method of embodiment 25, wherein the amplification zone further comprises a means for performing a melting curve analysis. (34) The method of claim 25, wherein the laser diode is used in conjunction with a ball lens. (35) The method of embodiment 25, wherein the spectrometer is used in conjunction with a ball lens.
Claims
1. 1. A system for conducting a biological assay, comprising:
1. A test container assembly comprising: a sample collection port having a bottom opening sealed by a plug member; a sample preparation chamber maintained at a vacuum in fluid communication with the bottom opening; a reaction chamber maintained under vacuum, the reaction chamber communicating with the sample preparation chamber via a frangible seal; an inspection container assembly including: a lid assembly configured to close the sample collection port, the lid assembly including a movable plunger that contacts the bung member when the lid assembly is secured to the sample collection port, the movable plunger disengaging the bung member from the bottom opening to allow a sample to be vacuum-drawn into the sample preparation chamber through the bottom opening, the movable plunger further advancing to move the sample within the sample preparation chamber and open the frangible seal to allow the sample to enter the reaction chamber in fluid communication with the sample preparation chamber; a test unit including a seat for receiving the test container assembly, a first temperature control device in conductive contact with the sample preparation chamber when the test container assembly is positioned within the seat; a second temperature control device in conductive contact with the reaction chamber when the test container assembly is placed in the seat; a detector assembly positioned to monitor conditions within the reaction chamber when the test container assembly is positioned within the seat; an inspection unit including: Including, the system.
2. The system of claim 1 , wherein the sample collection port is formed as a cup-shaped member disposed above the sample preparation chamber.
3. The test container assembly includes: a base member body having a top surface and an opposite bottom surface; a flexible bottom sealing sheet adhered to a portion of the bottom surface, wherein at least a portion of a lower end of the sample preparation chamber and at least a portion of the reaction chamber are defined by a space between the bottom surface and the bottom sealing sheet; The system of claim 1 further comprising:
4. The system of claim 3 , wherein the reaction chamber includes a detection window formed in the top surface of the base member body.
5. The system of claim 4 , wherein the detection window is formed from a flexible material.
6. The system described in claim 3, further comprising a channel defined by a space between the bottom surface and the bottom sealing sheet.
7. The system described in claim 6, wherein the frangible sealing portion is between the bottom sealing sheet and the bottom surface of the base member body and seals the channel until it is ready for use.
8. The system of claim 7 , wherein the bottom surface includes a stress concentration that defines a point at which the frangible seal opens during use.
9. 8. The system of claim 7, wherein the test unit further includes a plunger mechanism that contacts and advances the movable plunger to displace fluid within the sample preparation chamber and open the frangible seal.
10. The system of claim 7 , wherein the testing unit further comprises a heat sealer for sealing a portion of the bottom sealing sheet to the bottom surface to close the reaction chamber.
11. The system of claim 1 , wherein the detector assembly includes a multi-channel spectrometer and a light source selected from the group consisting of a laser diode and a light emitting diode.
12. 12. The system of claim 11, wherein the detector assembly further comprises at least a first ball lens positioned to focus illumination of light from the light source onto the reaction chamber.
13. 13. The system of claim 12, wherein the detector assembly further comprises a second ball lens positioned to focus emission light from the reaction chamber onto the multi-channel spectrometer.
14. 10. A method of analyzing a sample using the system of claim 1, comprising: placing the sample in the sample collection port of the test container assembly; securing the lid assembly to the sample collection port to close the sample collection port; a vacuum maintained within the sample preparation chamber prior to removal of the plug member causes the plug member to contact the movable plunger and remove the plug member, allowing the sample to be drawn into the sample preparation chamber in fluid communication with the bottom opening; opening a seal to allow the sample to flow from the sample preparation chamber to the reaction chamber; conducting a reaction to amplify biological markers of interest that may be present in said sample; detecting the presence of the amplified biological marker of interest in the reaction chamber; A method comprising:
15. 15. The method of claim 14, wherein opening a seal to allow the sample to flow from the sample preparation chamber to the reaction chamber comprises advancing the movable plunger to displace fluid in the sample preparation chamber and open a frangible seal.
16. 15. The method of claim 14, further comprising heating the sample in the sample preparation chamber to deactivate enzymes in the sample.
17. 17. The method of claim 16, further comprising sealing the reaction chamber prior to carrying out the reaction that amplifies a biological marker of interest that may be present in the sample.
18. 15. The method of claim 14, wherein the biological marker of interest is at least one nucleic acid target, and the reaction chamber contains primers configured to amplify the one or more nucleic acid targets that may be present in the sample.
19. The method of claim 14 , wherein the reaction chamber contains dried amplification and detection reagents therein.
20. 20. The method of claim 19, wherein the dried amplification and detection reagents are prepared by air drying.
21. 15. The method of claim 14, wherein detecting the presence of the amplified biological marker of interest in the reaction chamber comprises detecting a fluorescent emission signal from a fluorescent dye.
22. 15. The method of claim 14, wherein detecting the presence of the amplified biological marker of interest in the reaction chamber comprises performing a melting curve analysis.
23. 10. A method for detecting nucleic acids in a sample using the system of claim 1, comprising:
1. A container having a plurality of fluidly connected chambers, the plurality of fluidly connected chambers comprising: the sample preparation chamber maintained under vacuum; an amplification zone; one or more sealable ports fluidly connecting the plurality of fluidly connected chambers, the one or more sealable ports providing the only access to the plurality of fluidly connected chambers from outside the container; and introducing the sample into a first chamber through the sample collection port; securing the lid assembly to the sample collection port to close the sample collection port; contacting the plug member with the movable plunger to remove the plug member and allow a vacuum to draw the sample into the sample preparation chamber in fluid communication with the bottom opening; opening a seal to allow the sample to flow from the sample preparation chamber to the reaction chamber; sealing the reaction chamber; mixing the nucleic acids in the sample with PCR components including primers configured to amplify one or more targets; amplifying said target nucleic acid; detecting a fluorescent emission signal from a fluorescent dye in the amplification zone; The fluorescence is excited by a laser diode, The emitted light is detected by a multi-channel spectrometer capable of processing at least four spectral channels in parallel at wavelengths between 350 nm and 1000 nm; communicating the fluorescence data to the cloud or a local CPU via a mobile phone or other user-controlled device or operating system; receiving analysis results from the cloud or local CPU by the mobile phone or other user controlled device or operating system; A method comprising:
24. 24. The method of claim 23, wherein the amplification zone contains primers configured to amplify one or more nucleic acid targets that may be present in the sample.
25. 25. The method of claim 24, wherein the at least one nucleic acid target is from a pathogen selected from the group consisting of a virus, a bacterium, and a fungus.
26. 26. The method of claim 25, wherein the virus is selected from the group consisting of coronavirus, adenovirus, PIV1, PIV2, PIV3, RSV, influenza A, influenza B, rhinovirus, and non-HRV enterovirus.
27. 27. The method of claim 26, wherein the coronavirus is selected from the group consisting of 229E, NL63, OC43, and HKU1, MERS-CoV, SARS-CoV, and SARS-CoV-2.
28. 28. The method of claim 27, wherein multiple SARS-CoV-2 variants are detected.
29. 25. The method of claim 24, wherein the nucleic acid target is a human nucleic acid sequence.
30. 25. The method of claim 24, wherein the amplification zone comprises dried amplification and detection reagents therein.
31. 31. The method of claim 30, wherein the dried amplification and detection reagents are prepared by air drying.
32. 25. The method of claim 24, wherein the amplification zone further comprises means for performing a melting curve analysis.
33. The method of claim 24, wherein the laser diode is used in conjunction with a ball lens.
34. The method of claim 24 , wherein the multi-channel spectrometer is used in conjunction with a ball lens.
Citation Information
Patent Citations
Reaction container and reaction method
JP2011182728A
Filled vial
JP2014533176A
Isolation tube
JP2020529915A
Integrated apparatus for performing nucleic acid extraction and diagnostic testing on multiple biological samples
US20090221059A1
Systems and Methods for Performing Biological Assays
US20190083975A1