A drug delivery system for increased endosomal escape

Abstract

A drug delivery system comprising a liposome having (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) between 1 and 20 mol percent of an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering.

Description

[0001] A drug delivery system for increased endosomal escape Specification The present invention relates to a drug delivery liposome formulation to increase escape from endosomes within cells and to improve drug delivery to cells and tissues as well as enhance the subsequent release of the delivered drug within such cells and tissues. The lipid bilayer of the liposome comprises an encapsulating agent, a fusogenic agent, and an acid-cleavable PEGylated lipid. The liposome encapsulates a therapeutic agent, such as a nucleic acid (RNA; DNA), a peptide, a protein, a small molecule, or a non-lipinski molecule. The lipid bilayer may comprise further helper lipids for enhancing endosomal escape or increasing system stability, such as cholesterol, solasodine, ceramide, or diosgenin. Background of the invention The biggest challenge for the delivery of macromolecular therapeutics "cargos" in general, such as mRNA, is to target them to the correct cells and, once endocytosed, let them cross the endosomal membrane in a process called "endosomal escape". Indeed, only a small fraction of exogenous macromolecules can escape from endosomes into the cytosol where they can exert their activity. As a consequence, the efficiency of cargo delivery and importantly the desired cargo effect is usually quite low. In recent years, several types of RNA have emerged as potentially powerful therapeutics to inhibit gene expression, e.g. siRNA, to express proteins, e.g. mRNA, or for gene editing (e.g. CRISPR / Cas9 system). The plasma membrane of cells is a biological barrier that prevents access of macromolecules, especially RNAs, into the cell’s interior as cell defense mechanism. Consequently, numerous delivery systems have focused on facilitating the transport of molecular cargos across this membrane. In particular, eukaryotic cells internalize extracellularly administered cargos by endocytosis. This can be mediated by specific cell surface interactions, or simply involve non-specific engulfment of molecules present in the extracellular fluid. Upon internalization, cargos are sequestered within membrane-bound endosomes. Through fusion and fission events, endosomes exchange some of their luminal content, and cargos can subsequently distribute throughout a complex endosomal pathway that includes early endosomes, recycling

[0002] GAR-P04383WO55 Application (final).docx endosomes, multivesicular bodies, late endosomes, and lysosomes. Cargos trapped in this pathway may either be recycled to the cell surface or undergo degradation by exposure to lysosomal enzymes. Notably, while conceptually in the cell, endosomally-trapped cargos do not have access to the cytosol, i.e. the space between cytoplasmic organelles such as the nucleus. Thus, delivery systems that simply promote endocytosis of cargos but not the crossing of the endosomal membranes are not sufficient to permit successful cytosolic penetration. Instead, cargos have to cross the membrane of endosomes. Therefore, delivery remains a membrane translocation challenge and some of the issues previously described in the context of crossing the plasma membrane apply. Yet, the endosomal pathway includes membrane systems that are different from the plasma membrane. Consequently, the mechanisms by which translocation is mediated, the efficiencies with which this is achieved, and the cellular responses that accompany delivery may all be distinct. The idea of promoting endosomal escape so as to increase cytosolic delivery has been pursued for several decades. The ability to cross the endosomal membrane for successful delivery into the cytosol of target cells is a major challenge also for RNA-based therapeutics. It has been shown that only 1 % or less of endocytosed RNA therapeutics escape the endosome. Therefore, it is very difficult to experimentally investigate where and how this small quantity of RNA escapes from endosomes. Previous research tried to solve the problem posed by low endosomal escape by administering therapeutic RNA at higher doses, in order to achieve the desired effect; however, this causes side effects such as cytotoxicity and innate immune system activation. A major step forward was the development of lipid nanoparticles (LNP) to deliver siRNA and mRNA. LNPs are not liposomes because they do not have a lipid bilayer only but have an amorphous lipid core matrix, and thus are not designed to fuse with cellular membranes as membrane vesicles and organelles can fuse. However, also this delivery vehicle suffers from the problem of low escape efficacy and cytotoxicity. Therefore, there is still a need for new and efficient delivery systems to specifically increase crossing of endosomal membranes by macromolecule drugs. It is the objective of the present invention to provide a liposomal drug delivery system for therapeutic agents inducing an increased endosomal escape, and thus an increased delivery of the therapeutic agent in the cell cytosol.

[0003] GAR-P04383WO55 Application (final).docx The objective of the present invention is solved by the teaching of the independent claims. Further advantageous features, aspects and details of the invention are evident from the dependent claims, the description, the figures, and the examples of the present application. Brief description of the invention The present invention relates to a drug delivery liposome formulation to increase escape from endosomes within cells and to improve drug delivery to cells and tissues as well as enhance the subsequent release of the delivered drug within such cells and tissues. The lipid bilayer of the liposome comprises an encapsulating agent, a fusogenic agent, and an acid-cleavable PEGylated lipid. The liposome encapsulates a therapeutic agent, such as a nucleic acid (RNA; DNA), a peptide, a protein, a small molecule, a non-lipinski molecule or another type of molecule. The lipid bilayer may further comprise helper lipids enhancing endosomal escape or increasing system stability, such as cholesterol, solasodine, ceramide, or diosgenin. The inventors have surprisingly found that, when transfecting Hela cells with siRNA against eGFP delivered by a liposome composition, the combination of a fusogenic agent such as LBPA with an acid-cleavable PEG-lipid in said composition shows an unexpected synergetic effect on eGFP downregulation (Figure 3c). Indeed, the eGFP downregulation reached by liposomes comprising both components amount to much more than the sum of the effects reached by the liposomes comprising only one of the two components. This effect is even more surprising as introduction of LBPA as fusogenic agent in MC3-based lipid nanoparticles (LNP) does not show a comparable improved effect on drug delivery and activity, such as siRNA mediated GFP downregulation. It is well known that lipid nanoparticles differ from liposomes for having an amorphous core structure made up of lipids, whereas liposomes in contrast have an aqueous core surrounded by one or multiple lipid bilayers. Moreover, this effect even more surprisingly when considering that prior art (Matsuo et al., 2004, Role of LBPA and Alix in multivesicular liposome formation and endosome organization. Science, New Series, 303, 5657, 531-534) shows that LBPA drives formation of membrane invaginations within acidic liposomes, thus stimulating MVL formation, and controls inward fission process by transient interaction between LBPA membranes and Alix.

[0004] GAR-P04383WO55 Application (final).docx Remarkably, a similar effect to using LBPA as fusogenic agent can be obtained by using the compounds MGDG, PLPE (Figure 12 f-j), IsostA, GMO, POPE (eGFP- knock down efficiency by siRNA-liposomes, Figure 9b) , NPPE, MO, OIA, PalmA (Table 11), and with the isoforms Hemi-LBPA, 3,3'-R,R, 2,2'-S,S-C18:0, 2,2’-S,S- C12:0, 3,3'-S,S, and 3,3'-R,S (liposome-siRNA-mediated GFP downregulation Figure 7d). Therefore, the present invention provides a drug delivery system comprising a liposome having (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) between 1 and 20 mol percent of an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume, wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm as determined by dynamic light scattering. Another preferred embodiment of the invention is directed to the drug delivery system as disclosed above, wherein the encapsulating agent is a cationic lipid selected from 1,2-dialkanyloxy-3-trialkylammonium propane halide, 1,2-dialkenyloxy- 3-trialkylammonium propane halide, 1,2-dialkanoyloxy-3-trialkylammonium propane halide, 1,2-dialkenoyloxy-3-trialkylammonium propane halide, tetraalkylammonium halide, 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine, and / or a lipidated polypeptide PD740. Another preferred embodiment of the invention is directed to the drug delivery system as disclosed above, wherein the encapsulating agent is a cationic lipid selected from 1,2-di-C12-C20 alkanyloxy-3-tri-C1-C6 alkylammonium propane halide, 1,2-di-C12-C20 alkenyloxy-3-tri-C1-C6 alkylammonium propane halide, 1,2-di-C12-C20 alkenoyloxy-3-tri-C1-C6 alkylammonium propane halide, di-C12-C20 alkyl di-C1-C6 alkyl ammonium halide, and / or a lipidated polypeptide PD740. Another more preferred embodiment of the invention is directed to the drug delivery system as disclosed above, wherein the encapsulating agent is a cationic lipid selected from the group consisting of 1,2-didodecyloxy-3-trimethylammonium propane chloride, 1,2-ditridecyloxy-3-trimethylammonium propane chloride, 1,2- ditetradecyloxy-3-trimethylammonium propane chloride, 1,2-dipentadecyloxy-3-

[0005] GAR-P04383WO55 Application (final).docx trimethylammonium propane chloride, 1,2-dihexadecyloxy-3-trimethylammonium propane chloride, 1,2-diheptadecyloxy-3-trimethylammonium propane chloride, 1,2- dioctadecyloxy-3-trimethylammonium propane chloride, 1,2-dinonadecyloxy-3- trimethylammonium propane chloride, 1,2-diicosyloxy-3-trimethylammonium propane chloride, 1,2-didodecenyloxy-3-trimethylammonium propane chloride, 1,2- ditridecenyloxy-3-trimethylammonium propane chloride, 1,2-ditetradecenyloxy-3- trimethylammonium propane chloride, 1,2-dipentadecenyloxy-3-trimethylammonium propane chloride, 1,2-dihexadecenyloxy-3-trimethylammonium propane chloride, 1,2-diheptadecenyloxy-3-trimethylammonium propane chloride, 1,2- dioctadecenyloxy-3-trimethylammonium propane chloride, 1,2-dinonadecenyloxy-3- trimethylammonium propane chloride, 1,2-diicosenyloxy-3-trimethylammonium propane chloride, 1,2-dilauroleoyloxy-3-trimethylammonium propane chloride, 1,2- dimyristoleoyloxy-3-trimethylammonium propane chloride, 1,2-dipalmitoleoyloxy-3- trimethylammonium propane chloride, 1,2-dipetroseloyloxy-3-trimethylammonium propane chloride, 1,2-dipetroselaidoyloxy-3-trimethylammonium propane chloride, 1,2-dioleoylloxy-3-trimethylammonium propane chloride, 1,2-dielaidoyloxy-3- trimethylammonium propane chloride, 1,2-divaccenoyloxy-3-trimethylammonium propane chloride, 1,2-digadoleoyloxy-3-trimethylammonium propane chloride, dimethyldidodecylammonium bromide, dimethylditridecylammonium bromide, dimethylditetradecylammonium bromide, dimethyldipentadecylammonium bromide, dimethyldihexadecylammonium bromide, dimethyldiheptadecylammonium bromide, dimethyldioctadecylammonium bromide, dimethyldinonadecylammonium bromide, dimethyldiicosylammonium bromide, and / or a lipidated polypeptide PD740. Another still more preferred embodiment of the invention is directed to the drug delivery system as disclosed above, wherein the encapsulating agent is a cationic lipid selected from the group consisting of 1,2-di-O-octadecenyl-3- trimethylammonium propane chloride, dimethyldioctadecylammonium bromide, 1,2- dioleoyl-3-trimethylammonium propane chloride, and / or a lipidated polypeptide PD740. A further more preferred embodiment of the invention is directed to the drug delivery system as disclosed above, wherein the encapsulating agent is a cationic lipid 1,2-dioleoyl-3-trimethylammonium propane chloride and / or a lipidated polypeptide PD740. A preferred embodiment of the invention is further directed to the drug delivery system as disclosed above, wherein the acid-cleavable polyethylene glycol conjugated lipid is an acid-cleavable polyethylene glycol conjugated with a C12-C20 alkyl, or with a C12-C20 acyl, or with a mono-C12-C20 acylglycerol, or with a di-C12-C20 acylglycerol. A further preferred embodiment of the invention is directed to the

[0006] GAR-P04383WO55 Application (final).docx drug delivery system as disclosed above, wherein the acid-cleavable polyethylene glycol conjugated lipid comprises an acid-cleavable linkage selected from the group comprising an orthoester linkage, a hydrazone linkage, an acetal linkage, a vinyl ether linkage, and an imine linkage, and preferably a 2-methyl-2-alkoxy-1,3-dioxane or a 2-alkoxy-1,3-dioxolane, or an hydrazone. A further more preferred embodiment of the invention is directed to the drug delivery system as disclosed above, wherein the acid-cleavable polyethylene glycol conjugated lipid is selected from the group consisting of: N-(2-methyl-2-dodecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2-tridecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2- tetradecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2- pentadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2- hexadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2- heptadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2- octadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2- nonadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, and N-(2-methyl-2- icosyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol. A further still more preferred embodiment of the invention is directed to the drug delivery system as disclosed above, wherein the acid-cleavable polyethylene glycol conjugated lipid comprises polyethylene glycol having a number average molar mass Mn comprised between 400 and 5000 Da (Dalton). A further still more preferred embodiment of the invention is directed to the drug delivery system as disclosed above, wherein the acid-cleavable polyethylene glycol conjugated lipid is α-methoxy- ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}-polyethylene glycol45. A preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the fusogenic agent is a glycolipid, a phosphatidylethanolamine, a phosphatidylglycerol, a fatty acid, or a fatty acid ester. A further preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the fusogenic agent is a galactolipid, preferably an unsaturated monogalactosyldiacylglycerol. A more preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the fusogenic agent is a 1,2-diacyl-sn-glycero-3-phosphoethanolamine or an N-acyl-1,2- diacyl-sn-glycero-3-phosphoethanolamine. A still more preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the fusogenic agent is a phosphatidylethanolamine selected from the group consisting of 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine, 1,2-dipentadecanoyl-sn-glycero- 3-phosphoethanolamine, 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine, 1,2- dimargaroyl-sn-glycero-3-phosphoethanolamine, 1,2-distearoyl-sn-glycero-3-

[0007] GAR-P04383WO55 Application (final).docx phosphoethanolamine, 1,2-dipalmitoleoyl-sn-glycero-3-phosphoethanolamine, 1,2- dioleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3- phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2- didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn- glycero-3-phosphoethanolamine, 1,2-dierucoyl-sn-glycero-3-phosphoethanolamine, 1-pentadecanoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2- linoleoyl-sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2-oleoyl-sn-glycero-3- phosphoethanolamine, 1-stearoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine, 1- palmitoyl-2-arachidonoyl-sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2- docosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1-stearoyl-2-linoleoyl-sn- glycero-3-phosphoethanolamine, 1-stearoyl-2-arachidonoyl-sn-glycero-3- phosphoethanolamine, 1-stearoyl-2-docosahexaenoyl-sn-glycero-3- phosphoethanolamine, and N-palmitoyl-1,2-dipalmitoyl-sn-glycero-3- phosphoethanolamine. A further more preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the fusogenic agent is a phosphatidylglycerol selected from the group consisting of bis(monoacylglycerol)phosphate, 3-acylglycero-1-phospho-3'-(1',2'-diacyl)-glycerol, 3-acylglycero-1-phospho-glycerol, and 1,2-diacylglycero-3-phospho-glycerol. A particular more preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the fusogenic agent is a bis(monoacylglycerol)phosphate selected from the group consisting of 2,2'-S,S- bis(monoacylglycerol)phosphate, 3,3'-S,S-bis(monoacylglycerol)phosphate, 3,3'-R,R- bis(monoacylglycerol)phosphate, and 3,3'-R,S-bis(monoacylglycerol)phosphate. A particular still more preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the fusogenic agent is a bis(monoacylglycerol)phosphate selected from the group consisting of bis(monododecylglycerol)phosphate, bis(monotridecylglycerol)phosphate, bis(monotetradecylglycerol)phosphate, bis(monopentadecylglycerol)phosphate, bis(monohexadecylglycerol)phosphate, bis(monoheptadecylglycerol)phosphate, bis(monooctadecylglycerol)phosphate, bis(monononadecylglycerol)phosphate, bis(monoicosylglycerol)phosphate, bis(monolauroleoylglycerol)phosphate, bis(monomyristoleoylglycerol)phosphate, bis(monopalmitoleoylglycerol)phosphate, bis(monopetroseloylglycerol)phosphate, bis(monopetroselaidoylglycerol)phosphate, bis(monooleoylglycerol)phosphate, bis(monoelaidoylglycerol)phosphate, bis(monovaccenoylglycerol)phosphate, and bis(monogadoleoylglycerol)phosphate. A further embodiment of the invention provides a drug delivery system as disclosed above, wherein the fusogenic agent is a 3-acylglycero-1-phospho-3'-(1',2'-diacyl)- glycerol selected from the group consisting of 3-dodecylglycero-1-phospho-3'-(1',2'-

[0008] GAR-P04383WO55 Application (final).docx didodecyl)-glycerol, 3-tridecylglycero-1-phospho-3'-(1',2'-ditridecyl)-glycerol, 3- tetradecylglycero-1-phospho-3'-(1',2'-ditetradecyl)-glycerol, 3-pentadecylglycero-1- phospho-3'-(1',2'-dipentadecyl)-glycerol, 3-hexadecylglycero-1-phospho-3'-(1',2'- dihexadecyl)-glycerol, 3-heptadecylglycero-1-phospho-3'-(1',2'-diheptadecyl)- glycerol, 3-octadecylglycero-1-phospho-3'-(1',2'-dioctadecyl)-glycerol, 3- nonadecylglycero-1-phospho-3'-(1',2'-dinonadecyl)-glycerol, 3-icosylglycero-1- phospho-3'-(1',2'-diicosyl)-glycerol, 3-lauroleoylglycero-1-phospho-3'-(1',2'- dilauroleoyl)-glycerol, 3-myristoleoylglycero-1-phospho-3'-(1',2'-dimyristoleoyl)- glycerol, 3-palmitoleoylglycero-1-phospho-3'-(1',2'-dpalmitoleoyl)-glycerol, 3- petroseloylglycero-1-phospho-3'-(1',2'-dipetroseloyl)-glycerol, 3- petroselaidoylglycero-1-phospho-3'-(1',2'-dipetroselaidoyl)-glycerol, 3-oleoylglycero- 1-phospho-3'-(1',2'-dioleoyl)-glycerol, 3-elaidoylglycero-1-phospho-3'-(1',2'- dielaidoyl)-glycerol, 3-vaccenoylglycero-1-phospho-3'-(1',2'-divaccenoyl)-glycerol, and 3-gadoleoylglycero-1-phospho-3'-(1',2'-digadoleoyl)-glycerol. A further preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the fusogenic agent is a 3-acylglycero-1-phospho-glycerol selected from the group consisting of 3-dodecylglycero-1-phospho-glycerol, 3- tridecylglycero-1-phospho-glycerol, 3-tetradecylglycero-1-phospho-glycerol, 3-pentadecylglycero-1-phospho-glycerol, 3-hexadecylglycero-1-phospho-glycerol, 3-heptadecylglycero-1-phospho-glycerol, 3-octadecylglycero-1-phospho-glycerol, 3-nonadecylglycero-1-phospho-glycerol, 3-icosylglycero-1-phospho-glycerol, 3-lauroleoylglycero-1-phospho-glycerol, 3-myristoleoylglycero-1-phospho-glycerol, 3-palmitoleoylglycero-1-phospho-glycerol, 3-petroseloylglycero-1-phospho-glycerol, 3-petroselaidoylglycero-1-phospho-glycerol, 3-oleoylglycero-1-phospho-glycerol, 3-elaidoylglycero-1-phospho-glycerol, 3-vaccenoylglycero-1-phospho-glycerol, and 3-gadoleoylglycero-1-phospho-glycerol. A further more preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the fusogenic agent is a 1,2-diacylglycero-3-phospho-glycerol selected from the group consisting of 1,2-didodecylglycero-3-phospho-glycerol, 1,2- ditridecylglycero-3-phospho-glycerol, 1,2-ditetradecylglycero-3-phospho-glycerol, 1,2-dipentadecylglycero-3-phospho-glycerol, 1,2-dihexadecylglycero-3-phospho-glycerol, 1,2-diheptadecylglycero-3-phospho- glycerol, 1,2-dioctadecylglycero-3-phospho-glycerol, 1,2-dinonadecylglycero-3- phospho-glycerol, 1,2-diicosylglycero-3-phospho-glycerol, 1,2-dilauroleoylglycero-3- phospho-glycerol, 1,2-dimyristoleoylglycero-3-phospho-glycerol, 1,2-dipalmitoleoylglycero-3-phospho-glycerol, 1,2-dipetroseloylglycero-3-phospho- glycerol, 1,2-dipetroselaidoylglycero-3-phospho-glycerol, 1,2-dioleoylglycero-3- phospho-glycerol, 1,2-dielaidoylglycero-3-phospho-glycerol, 1,2-divaccenoylglycero-

[0009] GAR-P04383WO55 Application (final).docx 3-phospho-glycerol, and 1,2-digadoleoylglycero-3-phospho-glycerol. A further still more preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the fusogenic agent is a fatty acid selected from the group consisting of myristic acid, pentadecanoic acid, palmitic acid, margaric acid, stearic acid, isostearic acid, nonadecylic acid, arachidic acid, myristoleic acid, palmitoleic acid, sapienic acid, oleic acid, elaidic acid, vaccenic acid, and linoleic acid; or a methyl ester or a glyceryl ester of one of the aforementioned fatty acids. A further still more preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the fusogenic agent is selected from the group consisting of monogalactosyldilinolenoylglycerol, 1-palmitoyl-2-linoleoyl-sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine, N-palmitoyl-1,2-dipalmitoyl- sn-glycero-3-phosphoethanolamine, 2,2'-S,S-bis(monododecylglycerol)phosphate, 3,3'-S,S-bis(monododecylglycerol)phosphate, 3,3'-R,R-bis(monododecylglycerol)- phosphate, 3,3'-R,S-bis(monododecylglycerol)phosphate, 2,2'-S,S-bis(monooctadecylglycerol)phosphate, 3,3'-S,S-bis(monoocta- decylglycerol)phosphate, 3,3'-R,R-bis(monooctadecylglycerol)phosphate, 3,3'-R,S- bis(monooctadecylglycerol)phosphate, 2,2'-S,S-bis(monooleoylglycerol)phosphate, 3,3'-S,S-bis(monooleoylglycerol)phosphate, 3,3'-R,R-bis(monooleoylglycerol)phosphate, 3,3'-R,S-bis(monooleoylglycerol)- phosphate, 3-dodecylglycero-1-phospho-3'-(1',2'-didodecyl)-glycerol, 3- octadecylglycero-1-phospho-3'-(1',2'-dioctadecyl)-glycerol, 3-oleoylglycero-1- phospho-3'-(1',2'-dioleoyl)-glycerol, glyceryl monoloeate, methyl oleate, isostearic acid, palmitoleic acid, and oleic acid. In another aspect, the present invention provides a drug delivery system as disclosed above, wherein the lipid bilayer comprises: iv) between 2.5 and 35 mol percent of at least one neutral lipid. In another preferred aspect, the present invention provides a drug delivery system as disclosed above, wherein the lipid bilayer comprises: iv) between 2.5 and 35 mol percent of at least one neutral lipid selected from the group consisting of cholesterol, diosgenin, solasodine, and ceramide. It is also herein provided a drug delivery system as disclosed above, wherein the therapeutic agent is a peptide, protein, an antibody, a nanobody, a nucleic acid, a ribonucleoprotein, a small molecule, a non-lipinski molecule, a biomimetic, or a natural compound. It is further herein provided a drug delivery system as disclosed above, wherein the therapeutic agent is a CRISPR / Cas9 ribonucleoprotein, a

[0010] GAR-P04383WO55 Application (final).docx CRISPR guide RNA, or a Cas protein. A particular embodiment of the invention provides a drug delivery system as disclosed above, wherein the therapeutic agent is a nucleic acid selected from the group comprising ssDNA, dsDNA, ssRNA, dsRNA, aiRNA, miRNA, siRNA, piRNA, sdRNA, snRNA, snoRNA, PAR, tsRNA, endo-siRNA, MSY-RNA, tel-sRNA, crasiRNA, moRNA, xiRNA, lncRNA, ncRNA, circRNA, mRNA, sgRNA, crRNA, tracr RNA, guide RNA mix, self-amplifying RNA, ribozymes, and antisense oligonucleotides. A particularly preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride and / or PD740, ii) between 1 and 20 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy- [1,3]dioxan-5-yl)-amido}-polyethylene glycol45, iii) between 15 and 45 mol percent of 2,2'-S,S- bis(monooleoylglycerol)phosphate, and iv) between 13 and 35 mol percent of cholesterol. Another embodiment of the invention provides a drug delivery system as disclosed above, wherein the lipid bilayer comprises i) 50 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride, ii) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5- yl)-amido}-polyethylene glycol45, iii) 20 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate, and iv) 25 mol percent of cholesterol. Another preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the lipid bilayer comprises i) 50 mol percent of PD740, ii) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5- yl)-amido}-polyethylene glycol45, iii) 20 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate, and iv) 25 mol percent of cholesterol. A further preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the lipid bilayer comprises ia) 25 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride, ib) 25 mol percent of PD740, GAR-P04383WO55 Application (final).docx ii) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5- yl)-amido}-polyethylene glycol45, iii) 20 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate, and iv) 25 mol percent of cholesterol. A further more preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the lipid bilayer comprises i) 33 mol percent of PD740, ii) 7 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5- yl)-amido}-polyethylene glycol45, iii) 27 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate, and iv) 33 mol percent of cholesterol. An alternative embodiment of the invention provides a drug delivery system as disclosed above, wherein the lipid bilayer comprises i) 42 to 50 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride, ii) 4 to 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy- [1,3]dioxan-5-yl)-amido}-polyethylene glycol45, iii) 4 to 15 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate, iva) 13 to 15 mol percent of cholesterol, and ivb) 15 to 36 mol percent of solasodine. A further alternative embodiment of the invention provides a drug delivery system as disclosed above, wherein the lipid bilayer comprises ia) 25 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride, ib) 25 mol percent of PD740, ii) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5- yl)-amido}-polyethylene glycol45, iii) 20 mol percent of monogalactosyldiacylglycerol or 1-palmitoyl-2-linoleoyl- sn-glycero-3-phosphoethanolamine, and iv) 25 mol percent of cholesterol. A particular aspect of the present invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 1:1 to about 50:1. Finally, another particular aspect of the present invention provides a drug delivery system as disclosed above, wherein the liposome is a unilamellar and / or univesicular liposome. GAR-P04383WO55 Application (final).docx Description of the Figures Figure 1 shows (a) schematic representation of endosomal escape induced by the drug delivery system disclosed herein; (b) Structure of labile, acid- cleavable PEG-lipid; (c) Structure of fusogenic lipid 2,2’-LBPA and isomerization to 3,3’ isoform. Figure 2 shows in vitro characterization of the delivery system. (a) Liposomes of composition LP1 visualized by cryo transmission electron microscopy (scale bar 100 nm). (b) Extruded liposomes embedded in methyl cellulose and stained with sodium tungstate and uranyl acetate visualized by transmission electron microscopy (scale bar 100 nm). (c) Size distribution of extruded liposomes by dynamic light scattering (n = 6, mean ± SEM). (d) siRNA encapsulation in extruded liposomes, analyzed by Ribogreen assay (n = 12, mean ± SEM). (e) siRNA content before and after extrusion, analyzed by Ribogreen assay (n = 8 (without extrusion), 12 (with extrusion), mean ± SEM). (f,g) Agarose gel images and quantification of kinetic of RNase A treatment of naked siRNA (dark grey in (g)) and siRNA encapsulated in liposomes (light grey in (g)) (n = 3, mean ± SD). (h) Comparison of size distribution of extruded liposomes analyzed by dynamic light scattering directly after formation and after 9 months, 1.6 years and 2.4 years storage at 4°C (n = 16 (fresh), 12 (9 months), 15 (1.6 years), 14 (2.4 years), mean ± SEM). (i) Comparison of siRNA encapsulation analyzed by Ribogreen assay directly after formation and after 9 months, 1.6 and 2.4 years of storage at 4°C (n = 12 (fresh), 10 (9 months), 10 (1.6 years), 14 (2.4 years), mean ± SEM). (j) Comparison of siRNA amount after 2.4 years of storage at 4°C, expressed as percentage of the siRNA amount measured directly after liposome formation (n = 8, mean ± SEM). (k) Comparison of siRNA encapsulation analyzed by Ribogreen assay between liposomes made with siRNA at N / P ratio 20:1 and 5:1 (n=1, mean± SD). Figure 3 shows uptake and eGFP downregulation in HeLa eGFP cells. (a) HeLa cells control (right) and after 4 h uptake of liposomes with 10 nM Alexa 647-labeled siRNA (left) (scale bar 25 µm). A vesicular pattern of Alexa 647 labeled siRNA can be detected in the treated cells, but not in the untreated ones. (b) Downregulation of eGFP and toxicity (nuclei number) by siRNA encapsulated in liposomes compared to naked siRNA, both at 10 nM, in HeLa cells. Mean eGFP expression intensity GAR-P04383WO55 Application (final).docx and number of nuclei are expressed as percentage of untreated control (n = 6, mean ± SEM). (c) Comparison of eGFP downregulation by siRNA liposomes containing the two active components, LBPA and labile PEG lipid, to that by liposomes containing one active component and one non-active replacing component (n = 6, mean ± SEM, siRNA conc. = 10 nM). (d) eGFP downregulation in HeLa eGFP cells treated with different concentrations of siRNA in extruded liposomes for 5 h in the presence of serum (72 h after transfection, scale bar 100 µm). Decreased amount of GFP fluorescent signal can be detected with increasing amount of siRNA concentration. (e) Single cell distribution of eGFP intensity normalized to median of untreated control after treatment with different concentrations of siRNA in extruded liposomes (n = 1, mean ± SD). (f) Comparison of eGFP downregulation mediated by siRNA-liposomes containing different LBPA isomers (n = 36-53 (2,2’- LBPA), 11-17 (3,3’-LBPA), mean ± SEM). (g) Comparison of toxicity by siRNA-liposomes containing different LBPA isomers (n = 36-53 (2,2’- LBPA), 11-17 (3,3’-LBPA), mean ± SEM). (h) Dose response curve of eGFP downregulation and toxicity (n = 4, line: fit with four-parameter log-logistic model, shading: 95% confidence interval). (i) Reproducibility of eGFP downregulation liposomes comprising 2,2’-LBPA (n = 36-53). (j) Reproducibility of toxicity by siRNA-liposomes comprising 2,2’-LBPA (n = 36-53). (k) Comparison of eGFP downregulation by siRNA-liposomes directly after their formation and after 9 months, 1.6 years and 2.4 years of storage at 4°C (n = 10 (fresh), 11 (9 months), 14 (1.6 years), and 14 (2.4 years), mean ± SD); (l) Dose-response curve for eGFP downregulation and toxicity (nuclei number) in Hela cells by siRNA- liposomes used fresh directly after preparation or after 5 h of serum pre- incubation (n = 3, mean ± SD). Figure 4 shows uptake and eGFP downregulation in primary bone marrow- derived macrophages and hepatocytes from LifeAct-GFP mice. (a) Primary bone marrow-derived mouse macrophages after 6 h uptake of Alexa 647-labeled siRNA-liposomes and untreated control (scale bar 25 µm, c = 5 nM). ). A vesicular pattern can of Alexa 647 labeled siRNA can be detected in the treated cells, but not in the untreated ones. (b) eGFP downregulation in primary macrophages treated with different concentrations of siRNA-liposomes for 5 h in the presence of serum (72 h after transfection, scale bar 100 µm). Decrease of GFP signal can be seen with increased concentrations of siRNA. (c) Quantification of GAR-P04383WO55 Application (final).docx eGFP downregulation and toxicity in primary macrophages (n = 9, mean ± SEM). (d) Dose response curve of eGFP downregulation and toxicity in primary macrophages (n = 4, line: fit with four-parameter log-logistic model, shading: 95% confidence interval). (e) Reproducibility of eGFP downregulation in primary macrophages (n = 37-49). (f) Reproducibility of toxicity in primary macrophages (n = 37-49). (g) eGFP downregulation in primary hepatocytes treated with different concentrations of siRNA-liposomes for 5 h in the presence of serum (72 h after transfection, scale bar 100 µm). Decrease of GFP signal can be detected with increased concentrations of siRNA. (h) Quantification of eGFP downregulation and toxicity in primary hepatocytes (n = 2, mean ± SEM) treated with different concentrations of siRNA-liposomes. Figure 5 shows in vitro characterization of liposomes with mRNA and delivery of mRNA in HeLa cells, primary macrophages and hepatocytes. (a) Encapsulation efficiency of mRNA in liposomes at charge ratio 6:1, analyzed by Ribogreen assay (n = 9, mean ± SEM). (b) Conventional transmission electron microscopy of liposomes with mRNA (scale bar 100 nm). (c) Size distribution of liposomes analyzed by dynamic light scattering before and after addition of mRNA at charge ratio 6:1 (n = 2, mean ± SD). (d) HeLa cells treated with different concentrations of eGFP mRNA-liposomes at charge ratio 6:1 in the presence of serum for 24 h (scale bar 100 µm). Number of cells expressing GFP and GFP fluorescence intensity increases with increasing mRNA dose treatment. (e) Quantification of eGFP expression and toxicity in the HeLa cells shown in (d) (n = 3, mean ± SEM). (f) Quantification of eGFP expression and toxicity in HeLa cells at charge ratio 3:1 (n = 2, mean ± SEM). (g) Quantification of eGFP expression by intensity in HeLa cells after treatment with liposomes of composition LP1 and mRNA mixed at different N / P ratios (n = 1, mean ± SD). (h) Quantification of percentage of cells positive for eGFP expression in HeLa cells after treatment with liposomes of composition LP1 and mRNA mixed at different N / P ratios (n = 1, mean ± SD). (i) Quantification of toxicity by analyzing total cell number normalized to untreated control in HeLa cells after treatment with liposomes of composition LP1 and mRNA mixed at different N / P ratios (n = 1, mean ± SD). (j) Primary bone marrow-derived mouse macrophages treated with different concentrations of eGFP mRNA- liposomes at charge ratio 6:1 in the presence of serum for 24 h (scale bar 100 µm). Number of cells expressing GFP and GFP fluorescence GAR-P04383WO55 Application (final).docx intensity increases with increasing mRNA concentration. (k) Quantification of eGFP expression and toxicity in the primary mouse macrophages shown in (j) (n = 3, mean ± SEM). (l) Quantification of eGFP expression and toxicity in primary mouse macrophages at charge ratio 3:1 (n = 3, mean ± SEM). (m) Primary hepatocytes treated with different concentrations of eGFP mRNA-liposomes at charge ratio 3:1 in the presence of serum for 24 h (scale bar 50 µm). Number of cells expressing GFP and GFP fluorescence intensity increases with increasing mRNA dose treatment. (n) Quantification of eGFP expression in the primary hepatocytes shown in (m) (n = 1, mean ± SEM). In (e), (f), (k) and (l): line a) is "total cell number", line b) is "GFP positive cell number", line c) is "mean GFP intensity"; c: concentration. Figure 6 shows delivery of CRISPR Cas9 ribonucleoprotein complex (Cas9 RNP) and guide RNA in HeLa eGFP cells. (a) Downregulation of eGFP and toxicity of Cas9 RNP-liposomes in HeLa eGFP cells (n = 3, mean ± SEM). b) Comparison of downregulation efficiency of eGFP with Cas9 RNP in liposomes at charge ratio 9.10:1 (as in panel a) and 5.46:1 in HeLa eGFP cells (n = 3, mean ± SEM). (c) Comparison of toxicity by analyzing the number of nuclei compared to untreated control in HeLa eGFP cells treated with Cas9 RNP in liposomes at charge ratio 9.10:1 (as in panel a) and 5.46:1 (n = 3, mean ± SEM). (d) Comparison of different liposome compositions for the transfection of guide RNA mix against eGFP into HeLa cells previously transfected with BacMam Cas9; GFP intensity is normalized to untreated control. (n=5 (3,3’- and 2,2,’-LBPA), 3 (LP4), 1 (EPC), mean ± SEM). (e) Toxicity data for treatment of panel (b). (n=5 (3,3’- and 2,2,’-LBPA), 3 (LP4), 1 (EPC), mean ± SEM). (f) Comparison of downregulation efficiency of eGFP with guide RNA mix in liposomes at charge ratio 8,45:1 (as in panel c,d) and 5,07:1 in HeLa cells transfected with BacMan Cas9 (n = 3, mean ± SEM). (c) Comparison of toxicity by analyzing the number of nuclei compared to untreated control in HeLa cells expressing Cas9 after BacMam transfection treated with guide in liposomes at charge ratio 8.45:1 (as in panel c,d) and 5.07:1 (n = 3, mean ± SEM). Figure 7 shows exploration of suitable variations from the identified liposomal composition LP1. (a) Overview of different variations screened to optimize liposome formulation with siRNA as cargo in HeLa eGFP cells. (b) Identification of effective percentage ranges of the indicated components of the initial composition LP1 (black) with 10 nM siRNA in GAR-P04383WO55 Application (final).docx HeLa eGFP cells (n=3, mean ± SD). (c) Helper lipid variation in the basis formulation LP1 (n=12 (Solasodine), 1 (Ceramide), 2 (Diosgenin), 10 (LP1), mean ± SD). (d) Several isoforms of LBPA show a similar activity when replacing LBPA in LP1 formulation (n=3, mean ± SD). (e) Encapsulating agent variation in LP1 formulation. PD740 (LP2) showed increased activity compared to DOTAP (LP1) (n=6 (LP1), 3 (others), mean ± SD). (f) Test of formulations LP2, LP3, and LP4 containing PD740 to find optimal composition for eGFP knock down efficiency (n= 17 (LP1), 8 (LP2), 2 (LP3), 5 (LP4), mean ± SD). (g) Toxicity profiles of formulations from (f). (h, i) Dose response curves for eGFP intensity and nuclei number obtained using LP1-LP4 liposome formulations at 10 concentrations to extract EC50 and TC50 (n = 6 (LP1), 2 (LP2), 7 (LP3), 2 (LP4), mean ± SD). (j) Difference in GFP intensity normalized to untreated control for HeLa eGFP cells treated with siRNA in liposomes at different N / P ratios compared to N / P ratio 20:1 (n= 2 (for N / P = 40:1, 20:1, 10:1), 1 (for N / P = 5:1), mean ± SD). (k) Difference in nuclei number normalized to untreated control for HeLa eGFP cells treated with siRNA in liposomes at different N / P ratios compared to N / P ratio 20:1 (n= 2 (for N / P = 40:1, 20:1, 10:1), 1 (for N / P = 5:1), mean ± SD). Figure 8 shows screening of potential fusogenic agents. (a) Similar eGFP knock down in HeLa eGFP cells reached by replacing LBPA in formulation LP3 with MGDG or PLPE (n= 7 (LP3), 2 (PLPE), 3 (MGDG), mean ± SD, fit: 4 parameter logistic). (b) Formulation containing MGDG shows a lower toxicity profile than LP3 (n= 7 (LP3), 2 (PLPE), 3 (MGDG), mean ± SD, fit: 4 parameter logistic). (c) Effect of substituting LBPA with GMO, POPE or IsostA in LP3 composition on GFP downregulation efficiency by siRNA-liposomes, comparison with formulation LP1 (n= 6 (LP1), 2 (GMO, POPE), 3 (IsostA), mean ± SD, fit: 4 parameter logistic); (d) Toxicity profile for compositions from (c) (n= 6 (LP1), 2 (GMO, POPE), 3 (IsostA), mean ± SD, fit: 4 parameter logistic); (e, f) Compositions combining LBPA and fusogenic agents reach a similar KD efficiency and toxicity profile (n= 7 (LP3), 1 (all others), mean ± SD, fit: 4 parameter logistic). Figure 9 shows changed downregulation profiles in primary mouse macrophages in response to different liposome compositions. (a) Comparison of eGFP knock down efficiency of LP1 (classic) with compositions containing varying amount of PD740 (n= 5 (LP3), 4 (LP1), 1 (LP2, LP4), mean ± SD, fit: 4 parameter logistic). (b) Comparison of eGFP knock GAR-P04383WO55 Application (final).docx down efficiency of siRNA-liposomes with LP3 composition and compositions where LBPA has been replaced with other fusogenic agents (n= 5 (LP3), 2 (MGDG, IsostA), 1 (GMO, POPE), mean ± SD, fit: 4 parameter logistic). (c) Comparison of eGFP knockdown efficiency of siRNA-liposomes with LP3 compositions containing both LBPA and another fusogenic agent (n= 5 (LP3), 1 (others), mean ± SD, fit: 4 parameter logistic). Figure 10 shows (a) phenotypic comparison of siRNA-liposome treatment with treatment with the endosomal disruptive agent L-leucine methyl ester (LLOMe). HeLa cells were transfected with GFP-tagged galectin-8 by BacMam virus. Endosomal disruption is characterized by appearance of aggregated galectin-8 foci as seen for LLOME treatment, which are not visible upon liposome treatment (scale bar 20 µm). (b) Phenotypic comparison of siRNA-liposome treatment with treatment with siRNA lipoplexes. HeLa cells were treated with A647-labeled siRNA complexed with lipofectamine 2000, resulting in endosomal bursting events (cells with release events are marked with arrows). Cells treated with A647-labeled siRNA in liposomes show a vesicular pattern on the same timescale. Background GFP fluorescence was used to visualize cellular position (scale bar 20 µm), shown in the left panel. A647-siRNA was imaged at 6.4 s intervals for 5 min in the same position. Figure 11 (a) Screening in HeLa eGFP cells of structural analogues of E18 to identify potential endosomal escape enhancers. Cells were treated with both chol-siRNA (200 nM) and the indicated compounds (6 µM (treatments 1-24) and 7 µM (treatments 25-32)). Downregulation of eGFP and nuclei number were quantified as percentage of untreated control. (n=2 (treatments 1-24), 1 (treatments 25-32), mean ± SEM). (b) Dose response curves of hits from screening showed in (a). HeLa cells were treated with varying concentrations of the indicated compounds in the presence of chol-siRNA (150 nM). (n=3, mean ± SEM). Figure 12 shows comparison of different liposomal compositions for mRNA transfection in HeLa cells. HeLa cells were treated for 24 h with liposomes of varying composition containing eGFP mRNA in the presence of serum: (a,b) Quantification of eGFP expression (percentage of positive cells (a) and fluorescence intensity (b)) for treatment with mRNA-liposomes containing endosomal escape enhancer solasodine at two different concentrations. (n = 3, mean ± SEM). (c,d) Quantification of eGFP expression (percentage of positive GAR-P04383WO55 Application (final).docx cells (c) and fluorescence intensity (d)) for treatment with mRNA- liposomes with formulations LP3 and LP4 containing PD740 compared to LP1. (n = 2, mean ± SEM). (e) Quantification of toxicity of mRNA- liposome formulations shown in (c) and (d). (n = 2, mean ± SEM). (f, g, i, j) Quantification of eGFP expression (percentage of positive cells (f, i) and fluorescence intensity (g, j)) for the treatment with mRNA- liposomes LP-MGDG or LP-PLPE that comprise both PD740 as additional encapsulating agent and the alternative fusogenic agents MGDG or PLPE, respectively (n = 2 (f, g), mean ± SEM, n = 1 (i, j), mean ± SD), in comparison to LP1 and LP3. (h) Quantification of toxicity of mRNA-liposome formulations showed in (f, g). (n = 2, mean ± SEM). Figure 13 shows semi-automated production of liposomes with NanoAssemblr microfluidic system. (a) Liposomes of composition LP1 produced by NanoAssemblr showed same transfection efficiency for mRNA in HeLa cells in terms of percentage of cells expressing eGFP as liposomes produced by extrusion (n = 1, mean ± SD). (b) Liposomes of composition LP1 produced by NanoAssemblr showed similar level of eGFP expression with mRNA in HeLa cells in terms of GFP intensity as liposomes produced by extrusion. (n = 1, mean ± SD). (c) Size distribution by DLS of liposomes of composition LP1 produced by NanoAssemblr compared to liposomes produced by extrusion. (n = 1, mean). Figure 14 shows interchangeability of HeLa eGFP and HeLa dsGFP cell line for siRNA downregulation experiments and stability of liposomes towards freezing at -80°C. (a) Comparison of eGFP downregulation with extruded liposomes of composition LP1 in HeLa eGFP and HeLa dsGFP cells (n = 7 (HeLa dsGFP), 4 (HeLa eGFP), mean ± SD). (b) Comparison of toxicity of treatment with extruded liposomes of composition LP1 in HeLa eGFP and HeLa dsGFP cells (n = 7 (HeLa dsGFP), 4 (HeLa eGFP), mean ± SD). (c) Size distribution measured by DLS for liposomes stored in different buffers at -80 °C and 4 °C. (n=1, mean). (d) Comparison of siRNA mediated knock down efficiency in HeLa dsGFP cells in terms of GFP intensity normalized to untreated control using liposomes stored at -80 °C and 4 °C. (n=1, mean ± SD). (e) Comparison of toxicity of siRNA containing liposomes stored at -80 °C and 4 °C for treatment of HeLa dsGFP cells. (n=1, mean ± SD). GAR-P04383WO55 Application (final).docx Description of the invention The present invention relates to a drug delivery liposome formulation to increase escape from endosomes within cells and to improve drug delivery to cells and tissues as well as enhance the subsequent release of the delivered drug within such cells and tissues. The lipid bilayer of the liposome comprises an encapsulating agent, a fusogenic lipid agent for endosomal escape, and an acid- labile PEG lipid for specific activation inside the endosomal system. The liposome-based drug delivery system disclosed herein is structurally and compositionally different from current LNP-based systems. The liposome according to the present invention allows a combination of functions using a modular and bioinspired approach, and can fuse with endosomal membranes. The encapsulating lipid or agent has the function of interacting with the negatively charged endosomal membrane as well as binding negatively charged macromolecules such as oligonucleotides. The liposome-based delivery system disclosed herein allows specific activation by acidification: the PEG coat / PEG-lipid conjugate around liposomes is in a non- active state at pH 7. Under these conditions, the PEG coat also acts as a shield prior to acidification. The PEG is attached to a lipid anchor by an acid-labile linker that breaks between pH 5 and 6. The acid-cleavable PEGylated lipid increases the hydrophilicity of the liposome and provides a steric barrier against opsonisation (shield effect), whereas the adverse steric hindrance of PEG in regard to cellular uptake and subsequent endosomal escape is circumvented by cleavage of the PEG under acidic conditions within the endosomes. Thus, the present invention provides a drug delivery system comprising a liposome having (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) between 1 and 20 mol percent of an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, and GAR-P04383WO55 Application (final).docx (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume, wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm as determined by dynamic light scattering. As used herein, the term “liposome” is meant to refer to lipid molecules assembled in a spherical configuration encapsulating an interior aqueous volume that is segregated from an aqueous exterior. Liposomes are vesicles that possess at least one lipid bilayer. Liposomes are typically used as carriers for drug / therapeutic delivery in the context of pharmaceutical development. The liposomes described in the invention are designed using a bio-inspired approach, i.e. work by fusing the lipid bilayer with a cellular membrane and repositioning its lipid structure to deliver a therapeutic agent, drug or active pharmaceutical ingredient. As such, the liposomes are structurally different from the LNPs that contain an amorphous lipid-containing core and lack lipids compatible with functionally interacting with the cellular (endosomal) membranes. An "aqueous volume" is used herein interchangeably with "aqueous core" or with "aqueous phase" or with "aqueous compartment" or with "aqueous lumen" or with "aqueous pocket". As used herein, the term “lipid” is meant to refer to a group of organic compounds characterized by being insoluble in water, but soluble in many organic solvents. Lipid molecules are amphiphilic meaning that they have a hydrophilic or polar end and a hydrophobic or nonpolar end. The shape and amphipathic nature of the lipid molecules cause them to organize spontaneously into structures such as bilayers, and micelles in aqueous environments. Lipid molecules are usually divided into at least three classes: (1) “simple lipids,” which include fats and oils as well as waxes; (2) “compound lipids,” which include phospholipids and glycolipids; and (3) “derived lipids” such as steroids. "Liposome component ratios" "Liposome component ratio" also abbreviated as "compound ratio" or "liposome agent ratio" or "agent ratio" or "component ratio" is defined as the molar ratio of that "Liposome component" or "compound" and is calculated as: [n(agent) / n(total)]*100 GAR-P04383WO55 Application (final).docx wherein "n" is the molar amount or the number of moles used to prepare the liposomes. The molar ratios of each liposome component of the optimized liposome compositions disclosed herein are listed in Table 1. The molar ratios of each liposome component of the tested liposome compositions in the Examples disclosed herein are listed in Tables 2 - 12. The compound ratio of an encapsulating agent in the drug delivery system disclosed herein is not specifically restricted, but it is preferable that the liposome of the drug delivery system disclosed herein has 12.5, 15, 25, 30, 33, 35, 37.5, 40, 45, 47.5, 50, 52.5, 54, 55, 60 or 70 mol percent of at least one encapsulating agent. Preferably the liposome of the drug delivery system disclosed herein has between 10 and 90 mol percent, preferably between 12 and 90 mol percent, preferably between 15 and 90 mol percent, preferably between 20 and 90 mol percent, preferably between 25 and 90 mol percent, preferably between 30 and 90 mol percent, preferably between 40 and 90 mol percent, preferably between 10 and 80 mol percent, preferably between 12 and 80 mol percent, preferably between 15 and 80 mol percent, preferably between 20 and 80 mol percent, preferably between 25 and 80 mol percent, preferably between 30 and 80 mol percent, preferably between 40 and 80 mol percent, preferably between 10 and 75 mol percent, preferably between 12 and 75 mol percent, preferably between 15 and 75 mol percent, preferably between 20 and 75 mol percent, preferably between 25 and 75 mol percent, preferably between 30 and 75 mol percent, preferably between 40 and 75 mol percent, preferably between 10 and 70 mol percent, preferably between 12 and 70 mol percent, preferably between 15 and 70 mol percent, preferably between 20 and 70 mol percent, preferably between 25 and 70 mol percent, preferably between 30 and 70 mol percent, preferably between 40 and 70 mol percent, preferably between 10 and 60 mol percent, preferably between 12 and 60 mol percent, preferably between 15 and 60 mol percent, preferably between 20 and 60 mol percent, preferably between 25 and 60 mol percent, preferably between 30 and 60 mol percent, preferably between 40 and 60 mol percent, preferably between 10 and 55 mol percent, preferably between 12 and 55 mol percent, preferably between 15 and 5 mol percent, preferably between 20 and 55 mol percent, preferably between 25 and 5 mol percent, preferably between 30 and 5 mol percent, preferably between 40 and 55 mol percent, more preferred between 30 and 75 mol percent of at least one encapsulating agent. GAR-P04383WO55 Application (final).docx The compound ratio of an acid-cleavable polyethylene glycol conjugated lipid in the drug delivery system disclosed herein is not specifically restricted, but it is preferable that the liposome of the drug delivery system disclosed herein has 1, 2, 2.5, 3, 4, 5, 6, 7, 7.5, 8, 9, 10, 11, or 20 mol percent of an acid-cleavable polyethylene glycol conjugated lipid. Preferably the liposome of the drug delivery system disclosed herein has between 1 and 20 mol percent, preferably between 1 and 11 mol percent, preferably between 1 and 10 mol percent, preferably between 1 and 8 mol percent, preferably between 1 and 7 mol percent, preferably between 1 and 6 mol percent, preferably between 1 and 5 mol percent, preferably between 2 and 20 mol percent, preferably between 2 and 11 mol percent, preferably between 2 and 10 mol percent, preferably between 2 and 8 mol percent, preferably between 2 and 7 mol percent, preferably between 2 and 6 mol percent, preferably between 2 and 5 mol percent, preferably between 3 and 20 mol percent, preferably between 3 and 11 mol percent, preferably between 3 and 10 mol percent, preferably between 3 and 8 mol percent, preferably between 3 and 7 mol percent, preferably between 3 and 6 mol percent, preferably between 3 and 5 mol percent, preferably between 4 and 20 mol percent, preferably between 4 and 11 mol percent, preferably between 4 and 10 mol percent, preferably between 4 and 8 mol percent, preferably between 4 and 7 mol percent, preferably between 4 and 6 mol percent of an acid- cleavable polyethylene glycol conjugated lipid. The compound ratio of a fusogenic agent in the drug delivery system disclosed herein is not specifically restricted, but it is preferable that the liposome of the drug delivery system disclosed herein has 10, 15, 20, 25, 27, 30, 35, 40, 45, 50, 55, 60 mol percent of at least one fusogenic agent. Preferably the liposome of the drug delivery system disclosed herein has between 10 and 60 mol percent, preferably between 15 and 60 mol percent, preferably between 20 and 60 mol percent, preferably between 25 and 60 mol percent, preferably between 27 and 60 mol percent, preferably between 30 and 60 mol percent, preferably between 35 and 60 mol percent, preferably between 40 and 60 mol percent, between 10 and 55 mol percent, preferably between 15 and 55 mol percent, preferably between 20 and 55 mol percent, preferably between 25 and 55 mol percent, preferably between 27 and 55 mol percent, preferably between 30 and 55 mol percent, preferably between 35 and 55 mol percent, preferably GAR-P04383WO55 Application (final).docx between 40 and 55 mol percent, between 10 and 50 mol percent, preferably between 15 and 50 mol percent, preferably between 20 and 50 mol percent, preferably between 25 and 50 mol percent, preferably between 27 and 50 mol percent, preferably between 30 and 50 mol percent, preferably between 35 and 50 mol percent, between 10 and 45 mol percent, preferably between 20 and 45 mol percent, preferably between 25 and 45 mol percent, preferably between 27 and 45 mol percent, preferably between 30 and 45 mol percent, preferably between 35 and 45 mol percent, between 10 and 35 mol percent, preferably between 20 and 35 mol percent, preferably between 25 and 35 mol percent, more preferred between 15 and 45 mol percent of at least one fusogenic agent. The compound ratio of a neutral lipid n the drug delivery system disclosed herein is not specifically restricted, but it is preferable that the liposome of the drug delivery system disclosed herein has 1, 2.5, 5, 10, 13, 20, 22.5, 25, 33, 36, 37.5, 40 mol percent of at least one neutral lipid, or is free of neutral lipid. Preferably the liposome of the drug delivery system disclosed herein has preferably between 1 and 40 mol percent, preferably between 2.5 and 40 mol percent, preferably between 5 and 40 mol percent, preferably between 10 and 40 mol percent, preferably between 13 and 40 mol percent, preferably between 20 and 40 mol percent, preferably between 22.5 and 40 mol percent, preferably between 25 and 40 mol percent, between 1 and 37.5 mol percent, preferably between 2.5 and 37.5 mol percent, preferably between 5 and 37.5 mol percent, preferably between 10 and 37.5 mol percent, preferably between 13 and 37.5 mol percent, preferably between 20 and 37.5 mol percent, preferably between 22.5 and 37.5 mol percent, preferably between 25 and 37.5 mol percent, preferably between 2.5 and 36 mol percent, preferably between 5 and 36 mol percent, preferably between 10 and 36 mol percent, preferably between 13 and 36 mol percent, preferably between 20 and 36 mol percent, preferably between 22.5 and 36 mol percent, preferably between 25 and 36 mol percent, preferably between 2.5 and 33 mol percent, preferably between 5 and 33 mol percent, preferably between 10 and 33 mol percent, preferably between 13 and 33 mol percent, preferably between 20 and 33 mol percent, preferably between 22.5 and 33 mol percent, preferably between 25 and 33 mol percent, preferably between 2.5 and 25 mol percent, preferably between 5 and 25 mol percent, preferably between 10 and 25 mol percent, preferably between 13 and 25 mol, preferably between 2.5 and 20 mol percent, preferably between 5 and 20 mol GAR-P04383WO55 Application (final).docx percent, preferably between 10 and 20 mol percent, more preferred between 13 and 36 mol percent of at least one neutral lipid. "Liposome size" As used herein, "size" or "mean size" in the context of liposome compositions refers to the mean diameter measured as Z-average by DLS of a liposome. The Z-average particle diameter of a liposome is a value measured by a dynamic light scattering method. "Z average" is defined as the intensity weighted mean hydrodynamic size of the ensemble collection of particles measured by dynamic light scattering (DLS). As defined by Malvern Panalytical Ltd., the Z average is derived from a Cumulants analysis of the measured correlation curve, wherein a single particle size is assumed and a single exponential fit is applied to the autocorrelation function. The sizes of the liposomes in the liposome delivery system of the present invention are not specifically restricted, but it is preferable that the Z-Average diameter size range is comprised between 20 nm and 200 nm as determined by dynamic light scattering. In some embodiments, the Z-Average diameter size range is comprised between 30 nm and 200 nm as determined by dynamic light scattering. In some embodiments, the Z-Average diameter size range is comprised between 45 nm and 200 nm as determined by dynamic light scattering. In some embodiments, the Z-Average diameter size range is comprised between 60 nm and 200 nm as determined by dynamic light scattering. In some embodiments, the Z-Average diameter size range is comprised between 70 nm and 200 nm as determined by dynamic light scattering. In some embodiments, the Z-Average diameter size range is comprised between 80 nm and 200 nm as determined by dynamic light scattering. In other embodiments, the Z-Average diameter size range is comprised between 20 nm and 180 nm as determined by dynamic light scattering. In other embodiments, the Z-Average diameter size range is comprised between 30 nm and 180 nm as determined by dynamic light scattering. In other embodiments, the Z-Average diameter size range is comprised between 45 nm and 180 nm as determined by dynamic light scattering. In other embodiments, the Z-Average diameter size range is comprised between 60 nm and 180 nm as determined by dynamic light scattering. In other embodiments, the Z-Average diameter size range is comprised between 70 nm and 180 nm as determined by dynamic light scattering. In other embodiments, the Z-Average diameter size range is comprised between 80 nm and 180 nm as determined by dynamic light scattering. In further embodiments, the Z-Average diameter size GAR-P04383WO55 Application (final).docx range is comprised between 20 nm and 160 nm, or between 30 and 160 nm, or between 45 nm and 160 nm as determined by dynamic light scattering. In further embodiments, the Z-Average diameter size range is comprised between 60 nm and 160 nm as determined by dynamic light scattering. In further embodiments, the Z-Average diameter size range is comprised between 70 nm and 160 nm as determined by dynamic light scattering. In further embodiments, the Z-Average diameter size range is comprised between 80 nm and 160 nm as determined by dynamic light scattering. In alternative embodiments, the Z-Average diameter size range is comprised between 20 nm and 150 nm, or between 30 nm and 150 nm, between 45 nm and 150 nm as determined by dynamic light scattering. In alternative embodiments, the Z-Average diameter size range is comprised between 60 nm and 150 nm as determined by dynamic light scattering. In alternative embodiments, the Z-Average diameter size range is comprised between 70 nm and 150 nm as determined by dynamic light scattering. In alternative embodiments, the Z-Average diameter size range is comprised between 80 nm and 150 nm as determined by dynamic light scattering. In other alternative embodiments, the Z-Average diameter size range is comprised between 20 nm and 140 nm, or between 30 nm and 140 nm, or between 45 nm and 140 nm as determined by dynamic light scattering. In other alternative embodiments, the Z-Average diameter size range is comprised between 60 nm and 140 nm as determined by dynamic light scattering. In other alternative embodiments, the Z-Average diameter size range is comprised between 70 nm and 140 nm as determined by dynamic light scattering. In other alternative embodiments, the Z-Average diameter size range is comprised between 80 nm and 140 nm as determined by dynamic light scattering. In further alternative embodiments, the Z-Average diameter size range is comprised between 20 nm and 130 nm, or between 30 nm and 130 nm, or between 45 nm and 130 nm as determined by dynamic light scattering. In further alternative embodiments, the Z- Average diameter size range is comprised between 60 nm and 130 nm as determined by dynamic light scattering. In further alternative embodiments, the Z- Average diameter size range is comprised between 70 nm and 130 nm as determined by dynamic light scattering. In further alternative embodiments, the Z- Average diameter size range is comprised between 80 nm and 130 nm as determined by dynamic light scattering. In preferred embodiments, the Z-Average diameter size is greater than 20 nm, 25 nm, 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, or 100 nm. In preferred embodiments, the Z-Average diameter size is also lower than 220 nm, 215 nm, 210 nm, 205 nm, 200 nm, 195 nm, 190 nm, 185 nm, 180 nm, 175 nm, GAR-P04383WO55 Application (final).docx 170 nm, 165 nm, 160 nm, 155 nm, 150 nm, 145 nm, 140 nm, 135 nm, 130 nm, 125 nm, 120 nm, 115 nm, or 100 nm. As used herein, the "polydispersity index" is a ratio that describes the homogeneity of the particle size distribution of a system, which is derived from the dynamic light scattering correlation data. It can assume values between 0 and 1. A small value, e.g., less than 0.3, indicates a narrow particle size distribution. As used herein, the "zeta potential" is the electrokinetic potential of a lipid, e.g., in a liposome composition. As used herein, a "lipid component" is that component of a "liposome composition" that includes one or more lipids. For example, the lipid component may include one or more cationic / ionizable, PEGylated, structural, or other lipids, such as phospholipids. The lipid components of the inventive liposome delivery system compositions developed and tested in the present invention are listed in Tables 1 – 12. The lipid components of the inventive liposome delivery system are a fusogenic agent, an encapsulating agent or therapeutic encapsulating agent, a labile PEG lipid, optionally, a helper or enhancer lipid. "Encapsulating agent" The wording "encapsulating agent" refers to a compound able to interact and bind a therapeutic agent of interest, so that when the encapsulating agent is present in the lipid bilayer enclosing an aqueous volume of a liposome composition, the therapeutic agent is encapsulated within the aqueous volume of said liposome. An encapsulating agent also refers to a molecule acting as trapping agent forming a complex with the drug (ie therapeutic agent) PD740 (C45H82N4O6S2) is a lipidated tripeptide analogue. PD740 is able to bind the therapeutic agent, such as RNA, probably by an electrostatic interaction due to the pKa of PD740. The inventive liposome composition may also include one or more cationic and / or ionizable lipids (e.g., lipids that may have a positive or partial positive charge at physiological pH) as "encapsulating agent" in addition to the other liposome components listed elsewhere. As used herein, the term “cationic lipid” or "cationic agent" is meant to refer to a lipid, having a positively charged head group and one or two hydrocarbon chains. GAR-P04383WO55 Application (final).docx Liposome compositions with the encapsulating agents PD740, DOTAP, DOTMA, DOMA showed highest siRNA mediated downregulation efficiency in HeLa cells. Liposome compositions with the cationic lipid EPC 18:1 as encapsulating agent showed intermediate siRNA mediated downregulation efficiency in HeLa cells. Liposome compositions with the encapsulating agents TTAB, CTAB, 16-BAC, SA, PD739, Gl67, MVL5, TAP 18:0 showed no siRNA mediated downregulation in Hela cells. As used herein, the term “ionizable lipid” is meant to refer to a lipid, e.g., cationic lipid, having at least one protonatable or deprotonatable group, such that the lipid is positively charged at a pH at or below physiological pH (e.g., pH 7.4), and neutral at a second pH, preferably at or above physiological pH. It will be understood by one of ordinary skill in the art that the addition or removal of protons as a function of pH is an equilibrium process, and that the reference to a charged or a neutral lipid refers to the nature of the predominant species and does not require that all of the lipid be present in the charged or neutral form. Generally, ionizable lipids have a pKa of the protonatable group in the range of about 4 to about 7. Preferred ionizable lipids are 3ß-[N-(N',N'-dimethylaminoethane)- carbamoyl]cholesterol hydrochloride, N-(4-carboxybenzyl)-N,N-dimethyl-2,3- bis(oleoyloxy)propan-1-aminium, 1,2-distearoyl-3-dimethylammonium-propane, 1,2-dipalmitoyl-3-dimethylammonium-propane, 1,2-dimyristoyl-3-dimethyl- ammonium-propane, 1,2-dioleoyl-3-dimethylammonium-propane (DODAP), 1,2- dioleyloxy-3-dimethylaminopropane (DODMA), 6-((2-hexyldecanoyl)oxy)-N-(6-((2- hexyldecanoyl)oxy)hexyl)-N-(4-hydroxybutyl)hexan-1-aminium, YSK05, Dlin-DMA, DLin-KC2-DMA, DLin-MC3-DMA (MC3), C12-200, SM-102, ALC-0315, Lipid 5. Further ionizable lipids can be found at ionizable cationic lipid https: / / broadpharm.com / product-categories / lipid / ionizable-lipid. In some embodi- ments, a ionizable lipid may include “cleavable lipid” or “SS- cleavable lipid”. An encapsulating agent for the drug delivery system disclosed herein is a cationic lipid selected from 1,2-dialkanyloxy-3-trialkylammonium propane halide, 1,2- dialkenyloxy-3-trialkylammonium propane halide, 1,2-dialkanoyloxy-3- trialkylammonium propane halide, 1,2-dialkenoyloxy-3-trialkylammonium propane halide, tetraalkylammonium halide, and / or a lipidated polypeptide PD740. Preferentially, an encapsulating agent for the drug delivery system disclosed herein is a cationic lipid selected from 1,2-di-C12-C20 alkanyloxy-3-tri-C1-C6 alkylammonium propane halide, 1,2-di-C12-C20 alkenyloxy-3-tri-C1-C6 alkylammonium propane halide, GAR-P04383WO55 Application (final).docx 1,2-di-C12-C20 alkenoyloxy-3-tri-C1-C6 alkylammonium propane halide, di-C12-C20 alkyl di-C1-C6 alkyl ammonium halide, and / or a lipidated polypeptide PD740. More preferentially, an encapsulating agent for the drug delivery system disclosed herein is a cationic lipid selected from the group consisting of 1,2-didodecyloxy-3- trimethylammonium propane chloride, 1,2-ditridecyloxy-3-trimethylammonium propane chloride, 1,2-ditetradecyloxy-3-trimethylammonium propane chloride, 1,2- dipentadecyloxy-3-trimethylammonium propane chloride, 1,2-dihexadecyloxy-3- trimethylammonium propane chloride, 1,2-diheptadecyloxy-3-trimethylammonium propane chloride, 1,2-dioctadecyloxy-3-trimethylammonium propane chloride, 1,2- dinonadecyloxy-3-trimethylammonium propane chloride, 1,2-diicosyloxy-3- trimethylammonium propane chloride, 1,2-didodecenyloxy-3-trimethylammonium propane chloride, 1,2-ditridecenyloxy-3-trimethylammonium propane chloride, 1,2- ditetradecenyloxy-3-trimethylammonium propane chloride, 1,2-dipentadecenyloxy-3- trimethylammonium propane chloride, 1,2-dihexadecenyloxy-3-trimethylammonium propane chloride, 1,2-diheptadecenyloxy-3-trimethylammonium propane chloride, 1,2-dioctadecenyloxy-3-trimethylammonium propane chloride, 1,2- dinonadecenyloxy-3-trimethylammonium propane chloride, 1,2-diicosenyloxy-3- trimethylammonium propane chloride, 1,2-dilauroleoyloxy-3-trimethylammonium propane chloride, 1,2-dimyristoleoyloxy-3-trimethylammonium propane chloride, 1,2- dipalmitoleoyloxy-3-trimethylammonium propane chloride, 1,2-dipetroseloyloxy-3- trimethylammonium propane chloride, 1,2-dipetroselaidoyloxy-3-trimethylammonium propane chloride, 1,2-dioleoylloxy-3-trimethylammonium propane chloride, 1,2- dielaidoyloxy-3-trimethylammonium propane chloride, 1,2-divaccenoyloxy-3- trimethylammonium propane chloride, 1,2-digadoleoyloxy-3-trimethylammonium propane chloride, dimethyldidodecylammonium bromide, dimethylditridecylammonium bromide, dimethylditetradecylammonium bromide, dimethyldipentadecylammonium bromide, dimethyldihexadecylammonium bromide, dimethyldiheptadecylammonium bromide, dimethyldioctadecylammonium bromide, dimethyldinonadecylammonium bromide, and dimethyldiicosylammonium bromide, and / or a lipidated polypeptide PD740. Still more preferentially, an encapsulating agent for the drug delivery system disclosed herein is a cationic lipid selected from the group consisting of 1,2-di-O-octadecenyl-3-trimethylammonium propane chloride, dimethyldioctadecylammonium bromide, and 1,2-dioleoyl-3-trimethylammonium propane chloride, and / or a lipidated polypeptide PD740. Particularly preferred, an encapsulating agent for the drug delivery system disclosed herein is a cationic lipid 1,2-dioleoyl-3-trimethylammonium propane chloride and / or a lipidated polypeptide PD740. GAR-P04383WO55 Application (final).docx "Labile PEG-lipids" The lipid component of a liposome composition as disclosed herein may include one or more labile PEG or labile PEG-modified lipids. A "pH-labile PEG-lipid" or "acid-labile PEG-lipid" refers to an "acid-cleavable PEG-lipid", i.e. a lipid attached to a PEG by a pH-sensitive acid-labile linkage, such as an orthoester or an hydrazone, (Fang Y et al., Cleavable PEGylation: a strategy for overcoming the "PEG dilemma" in efficient drug delivery. Drug Deliv. 2017;24(sup1):22-3), that breaks at pH between 5 and 6. A "labile linkage" refers to a covalent bond that is capable of being selectively broken. Consequently, the labile bond may be broken in the presence of other covalent bonds in the liposome without the breakage of other covalent bonds eventually present. "pH-labile linkage " or "pH-sensitive linkage" refers to a linkage or bond the can be selective broken under acidic conditions (pH < 7). This means that a pH-labile bond may be broken under acidic conditions in the presence of other covalent bonds without their breakage. A labile PEG-lipid forms a PEG coat around the liposomes acting as a shield at neutral pH, i.e. pH around 7. As used herein, a "PEG lipid" or "PEGylated lipid" refers to a lipid comprising a polyethylene glycol component. In other words, the acid-cleavable PEGylated lipid increases the hydrophilicity of the liposome and provides a steric barrier against opsonisation (shield effect), whereas the endosomal escape after cellular uptake is allowed by the activating cleavage of the PEG in the acidic conditions within endosomes. Particularly suitable acid-labile linkages have been described in the prior art and include orthoester linkages, hydrazone linkages, acetal linkages, vinyl ether linkages, and imine linkages (Fang Y et al., 2017). pH-sensitive PEG lipids containing orthoester linkers have been described by Masson C. et al., 2004, pH- sensitive PEG lipids containing orthoester linkers: new potential tools for nonviral gene delivery, J. Controlled Release, (99)3, 423-434. Therefore, an embodiment of the present invention discloses a drug delivery system as described herein, wherein the acid-cleavable polyethylene glycol conjugated lipid is an acid-cleavable polyethylene glycol conjugated with a C12-C20 alkyl, or with a C12-C20 acyl, or with a mono-C12-C20 acylglycerol, or with a di-C12- C20 acylglycerol, preferably an acid-cleavable polyethylene glycol conjugated with a mono-C12-C20 alkyl or a mono-C12-C20 acyl. A more preferred embodiment of the present invention discloses a drug delivery system as described herein, wherein GAR-P04383WO55 Application (final).docx the acid-cleavable polyethylene glycol conjugated lipid comprises an acid- cleavable linkage selected from the group comprising an orthoester linkage, a hydrazone linkage, an acetal linkage, a vinyl ether linkage, and an imine linkage, preferably a 2-methyl-2-alkoxy-1,3-dioxane or a 2-alkoxy-1,3-dioxolane. A still more preferred embodiment of the present invention discloses a drug delivery system as described herein, wherein the acid-cleavable polyethylene glycol conjugated lipid is selected from the group consisting of: N-(2-methyl-2-dodecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2-tridecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2-tetradecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2-pentadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2-hexadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2-heptadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2-nonadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, and N-(2-methyl-2-icosyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol. A further more preferred embodiment of the present invention discloses a drug delivery system as described herein, wherein the acid-cleavable polyethylene glycol conjugated lipid is α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)- amido}-polyethylene glycol45 (PEG2000-orthoester-C18). A further still more preferred embodiment of the present invention discloses a drug delivery system as described herein, wherein the acid-cleavable polyethylene glycol conjugated lipid comprises polyethylene glycol having a number average molar mass Mn comprised between 400 and 5000 Da. In a further still more preferred embodiment of the present invention, the acid-cleavable polyethylene glycol conjugated lipid comprises polyethylene glycol having a number average molar mass Mn comprised between 500 and 5000 Da, or between 600 and 5000 Da, or between 700 and 5000 Da, or between 800 and 5000 Da, or between 900 and 5000 Da, or between 1000 and 5000 Da, or between 2000 and 5000 Da, or between 500 and 4000 Da, or between 600 and 4000 Da, or between 700 and 4000 Da, or between 800 and 4000 Da, or between 900 and 4000 Da, or between 1000 and 4000 Da, or between 2000 and 4000 Da, or between 500 and 3000 Da, or between 600 and 3000 Da, or between 700 and 3000 Da, or between 800 and 3000 Da, or between 900 and 3000 Da, or between 1000 and 3000 Da, or between 2000 and 3000 Da, or between 500 and 2000 Da, or between 600 and 2000 Da, or between 700 and 2000 Da, or between 800 and 2000 Da, or between 900 and 2000 Da, or between 1000 and 2000 Da. GAR-P04383WO55 Application (final).docx "Fusogenic agent" A "fusogenic agent" or "fusogenic lipid" are used herein interchangeably to indicate a lipid that is recognized by the cellular machinery, either by cellular proteins or endosomal lipids and sugar moieties, and facilitates the fusion of the lipid bilayer of the delivery system with the limiting membrane of the endosome. However, fusogenic lipids can also be lipids that prefer non-lamellar phase behavior. Preferably, a "fusogenic agent" or "fusogenic lipid" is selected from the group comprising a glycolipid, a phosphatidylethanolamine, a phosphatidylglycerol, a fatty acid, or a fatty acid ester. A particularly preferred fusogenic agent according to this invention is acylated diglycerolphosphate Liposome compositions with MGDG, PLPE; S,S-3,3’- or S,S-2,2'-LBPA; as fusogenic agent showed highest activity for siRNA mediated downregulation in HeLa cells. Liposome compositions with POPE, GMO, NPPE, MO or IsostA as fusogenic agent showed intermediate activity for siRNA mediated downregulation in HeLa cells. Liposome compositions with OIA or PalmA as fusogenic agent showed low activity for siRNA mediated downregulation in HeLa cells. Liposome compositions with NAPE as fusogenic agent showed no activity for siRNA mediated downregulation in HeLa cells. Also different LBPA isoforms were tested as fusogenic agents: LBPA isomers S,S-2,2'-LBPA, R,R-3,3'-LBPA, S,S-3,3'-LBPA, R,S-3,3'-LBPA and isoformsS,R-Hemi, S,S-2,2'-C18:0-ether-LBPA and S,S-2,2'-C12:0-ether-LBPA showed a similar effect as LBPA in siRNA liposome compositions in terms of GFP downregulation in Hela cells. LBPA isoforms S,S-BDP, DOPG, lysoPG showed a lower effect as LBPA in siRNA liposome compositions in terms of GFP downregulation in Hela cells. LBPA isoforms R,S-C16:0-LBPA and R,S-C14:0- LBPA showed no activity in siRNA liposome compositions in terms of GFP downregulation in Hela cells. In some embodiments of the drug delivery system disclosed herein, the fusogenic agent is a glycolipid, a phosphatidylethanolamine, a phosphatidylglycerol, a fatty acid, or a fatty acid ester. In preferred embodiments of the drug delivery system disclosed herein, the fusogenic agent is a galactolipid, preferably an unsaturated monogalactosyldiacylglycerol. In further preferred embodiments of the drug delivery system disclosed herein, the fusogenic agent is a 1,2-diacyl-sn-glycero-3- phosphoethanolamine or an N-acyl-1,2-diacyl-sn-glycero-3-phosphoethanolamine. In further more preferred embodiments of the drug delivery system disclosed herein, the fusogenic agent is a phosphatidylethanolamine selected from the group GAR-P04383WO55 Application (final).docx consisting of 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine, 1,2- dipentadecanoyl-sn-glycero-3-phosphoethanolamine, 1,2-dipalmitoyl-sn-glycero-3- phosphoethanolamine, 1,2-dimargaroyl-sn-glycero-3-phosphoethanolamine, 1,2- distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dipalmitoleoyl-sn-glycero-3- phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine, 1,2- dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3- phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-dierucoyl-sn-glycero-3- phosphoethanolamine, 1-pentadecanoyl-2-oleoyl-sn-glycero-3- phosphoethanolamine, 1-palmitoyl-2-linoleoyl-sn-glycero-3-phosphoethanolamine, 1- palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine, 1-stearoyl-2-oleoyl-sn- glycero-3-phosphoethanolamine, 1-palmitoyl-2-arachidonoyl-sn-glycero-3- phosphoethanolamine, 1-palmitoyl-2-docosahexaenoyl-sn-glycero-3- phosphoethanolamine, 1-stearoyl-2-linoleoyl-sn-glycero-3-phosphoethanolamine, 1- stearoyl-2-arachidonoyl-sn-glycero-3-phosphoethanolamine, 1-stearoyl-2- docosahexaenoyl-sn-glycero-3-phosphoethanolamine, and N-palmitoyl-1,2- dipalmitoyl-sn-glycero-3-phosphoethanolamine. In still more preferred embodiments of the drug delivery system disclosed herein, the fusogenic agent is a phosphatidylglycerol selected from the group consisting of bis(monoacylglycerol)phosphate, 3-acylglycero-1-phospho-3'-(1',2'-diacyl)-glycerol, 3-acylglycero-1-phospho-glycerol, and 1,2-diacylglycero-3-phospho-glycerol. An aspect of the present invention relates to the drug delivery system as disclosed herein, wherein the fusogenic agent is a bis(monoacylglycerol)phosphate selected from the group consisting of 2,2'-S,S-bis(monoacylglycerol)phosphate, 3,3'-S,S- bis(monoacylglycerol)phosphate, 3,3'-R,R-bis(monoacylglycerol)phosphate, and 3,3'- R,S-bis(monoacylglycerol)phosphate. A further aspect of the present invention relates to the drug delivery system as disclosed herein, wherein the fusogenic agent is a bis(monoacylglycerol)phosphate selected from the group consisting of bis(monododecylglycerol)phosphate, bis(monotridecylglycerol)phosphate, bis(monotetradecylglycerol)phosphate, bis(monopentadecylglycerol)phosphate, bis(monohexadecylglycerol)phosphate, bis(monoheptadecylglycerol)phosphate, bis(monooctadecylglycerol)phosphate, bis(monononadecylglycerol)phosphate, bis(monoicosylglycerol)phosphate, bis(monolauroleoylglycerol)phosphate, bis(monomyristoleoylglycerol)phosphate, bis(monopalmitoleoylglycerol)phosphate, bis(monopetroseloylglycerol)phosphate, bis(monopetroselaidoylglycerol)phosphate, bis(monooleoylglycerol)phosphate, bis(monoelaidoylglycerol)phosphate, bis(monovaccenoylglycerol)phosphate, and bis(monogadoleoylglycerol)phosphate. GAR-P04383WO55 Application (final).docx A further preferred aspect of the present invention relates to the drug delivery system as disclosed herein, wherein the fusogenic agent is a 3-acylglycero-1-phospho-3'- (1',2'-diacyl)-glycerol selected from the group consisting of 3-dodecylglycero-1- phospho-3'-(1',2'-didodecyl)-glycerol, 3-tridecylglycero-1-phospho-3'-(1',2'-ditridecyl)- glycerol, 3-tetradecylglycero-1-phospho-3'-(1',2'-ditetradecyl)-glycerol, 3- pentadecylglycero-1-phospho-3'-(1',2'-dipentadecyl)-glycerol, 3-hexadecylglycero-1- phospho-3'-(1',2'-dihexadecyl)-glycerol, 3-heptadecylglycero-1-phospho-3'-(1',2'- diheptadecyl)-glycerol, 3-octadecylglycero-1-phospho-3'-(1',2'-dioctadecyl)-glycerol, 3-nonadecylglycero-1-phospho-3'-(1',2'-dinonadecyl)-glycerol, 3-icosylglycero-1- phospho-3'-(1',2'-diicosyl)-glycerol, 3-lauroleoylglycero-1-phospho-3'-(1',2'- dilauroleoyl)-glycerol, 3-myristoleoylglycero-1-phospho-3'-(1',2'-dimyristoleoyl)- glycerol, 3-palmitoleoylglycero-1-phospho-3'-(1',2'-dpalmitoleoyl)-glycerol, 3- petroseloylglycero-1-phospho-3'-(1',2'-dipetroseloyl)-glycerol, 3- petroselaidoylglycero-1-phospho-3'-(1',2'-dipetroselaidoyl)-glycerol, 3-oleoylglycero- 1-phospho-3'-(1',2'-dioleoyl)-glycerol, 3-elaidoylglycero-1-phospho-3'-(1',2'- dielaidoyl)-glycerol, 3-vaccenoylglycero-1-phospho-3'-(1',2'-divaccenoyl)-glycerol, and 3-gadoleoylglycero-1-phospho-3'-(1',2'-digadoleoyl)-glycerol. A further more preferred aspect of the present invention relates to the drug delivery system as disclosed herein, wherein the fusogenic agent is a 3-acylglycero-1- phospho-glycerol selected from the group consisting of 3-dodecylglycero-1- phospho-glycerol, 3-tridecylglycero-1-phospho-glycerol, 3-tetradecylglycero-1- phospho-glycerol, 3-pentadecylglycero-1-phospho-glycerol, 3-hexadecylglycero-1- phospho-glycerol, 3-heptadecylglycero-1-phospho-glycerol, 3-octadecylglycero-1- phospho-glycerol, 3-nonadecylglycero-1-phospho-glycerol, 3-icosylglycero-1- phospho-glycerol, 3-lauroleoylglycero-1-phospho-glycerol, 3-myristoleoylglycero-1- phospho-glycerol, 3-palmitoleoylglycero-1-phospho-glycerol, 3-petroseloylglycero-1- phospho-glycerol, 3-petroselaidoylglycero-1-phospho-glycerol, 3-oleoylglycero-1- phospho-glycerol, 3-elaidoylglycero-1-phospho-glycerol, 3-vaccenoylglycero-1- phospho-glycerol, and 3-gadoleoylglycero-1-phospho-glycerol. A still more preferred aspect of the present invention relates to the drug delivery system as disclosed herein, wherein the fusogenic agent is a 1,2-diacylglycero-3- phospho-glycerol selected from the group consisting of 1,2-didodecylglycero-3- phospho-glycerol, 1,2-ditridecylglycero-3-phospho-glycerol, 1,2-ditetradecylglycero- 3-phospho-glycerol, 1,2-dipentadecylglycero-3-phospho-glycerol, 1,2- dihexadecylglycero-3-phospho-glycerol, 1,2-diheptadecylglycero-3-phospho-glycerol, 1,2-dioctadecylglycero-3-phospho-glycerol, 1,2-dinonadecylglycero-3-phospho- glycerol, 1,2-diicosylglycero-3-phospho-glycerol, 1,2-dilauroleoylglycero-3-phospho- GAR-P04383WO55 Application (final).docx glycerol, 1,2-dimyristoleoylglycero-3-phospho-glycerol, 1,2-dipalmitoleoylglycero-3- phospho-glycerol, 1,2-dipetroseloylglycero-3-phospho-glycerol, 1,2- dipetroselaidoylglycero-3-phospho-glycerol, 1,2-dioleoylglycero-3-phospho-glycerol, 1,2-dielaidoylglycero-3-phospho-glycerol, 1,2-divaccenoylglycero-3-phospho- glycerol, and 1,2-digadoleoylglycero-3-phospho-glycerol. A particularly preferred aspect of the present invention relates to the drug delivery system as disclosed herein, wherein the fusogenic agent is a fatty acid selected from the group consisting of myristic acid, pentadecanoic acid, palmitic acid, margaric acid, stearic acid, isostearic acid, nonadecylic acid, arachidic acid, myristoleic acid, palmitoleic acid, sapienic acid, oleic acid, elaidic acid, vaccenic acid, and linoleic acid; or a methyl ester or a glyceryl ester of one of the aforementioned fatty acids. A particularly preferred aspect of the present invention relates to the drug delivery system as disclosed herein, wherein the fusogenic agent is selected from the group consisting of monogalactosyldilinolenoylglycerol, 1-palmitoyl-2-linoleoyl-sn-glycero-3- phosphoethanolamine, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine, N- palmitoyl-1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine, 2,2'-S,S- bis(monododecylglycerol)phosphate, 3,3'-S,S-bis(monododecylglycerol)phosphate, 3,3'-R,R-bis(monododecylglycerol)phosphate, 3,3'-R,S- bis(monododecylglycerol)phosphate, 2,2'-S,S-bis(monooctadecylglycerol)phosphate, 3,3'-S,S-bis(monooctadecylglycerol)phosphate, 3,3'-R,R- bis(monooctadecylglycerol)phosphate, 3,3'-R,S-bis(monooctadecylglycerol)- phosphate, 2,2'-S,S-bis(monooleoylglycerol)phosphate, 3,3'-S,S- bis(monooleoylglycerol)phosphate, 3,3'-R,R-bis(monooleoylglycerol)phosphate, 3,3'- R,S-bis(monooleoylglycerol)phosphate, 3-dodecylglycero-1-phospho-3'-(1',2'- didodecyl)-glycerol, 3-octadecylglycero-1-phospho-3'-(1',2'-dioctadecyl)-glycerol, 3- oleoylglycero-1-phospho-3'-(1',2'-dioleoyl)-glycerol, glyceryl monoloeate, methyl oleate, isotearic acid, palmitoleic acid, and oleic acid. As used herein, the term “non-cationic lipid” is meant to refer to any amphipathic lipid as well as any other neutral lipid or anionic lipid. "Helper Lipids" A liposome composition disclosed herein may include one or more components in addition to those described in the preceding sections. For example, a liposome composition may include one or more "enhancer lipids" or "helper lipids" that enhance endosomal escape, and, consequently, delivery of the cargo by the liposome composition. Preferred enhancers are neutral lipids selected from the group consisting of sterol-based compound E18, compounds 1-32 of Figure 11a GAR-P04383WO55 Application (final).docx being analogs of E18, solasodine, solasodine acetate, diosgenin, ceramide, cholesterol. Further preferred enhancers are neutral lipids selected from the group consisting of cholesterol, diosgenin, solasodine, and ceramide. Therefore, a particular aspect of the present invention provides a drug delivery system comprising a liposome having: (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, iv) between 2.5 and 35 mol percent of at least one neutral lipid, and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering. A more particular aspect of the present invention provides a drug delivery system comprising a liposome having: (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) between 1 and 20 mol percent of an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, iv) between 2.5 and 35 mol percent of at least one neutral lipid selected from the group consisting of cholesterol, diosgenin, solasodine, and ceramide, and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume, wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering. Endosomal escape is the process of cytosolic entry of macromolecules such as small interfering RNAs (siRNAs) from a vesicular compartment, following initial endocytosis of the macromolecule and delivery vehicle into the target cell. GAR-P04383WO55 Application (final).docx A "helper lipid" is usually a lipid that contributes either to 1) the formation of the lipid bilayer, or 2) the recognition of the delivery system by the limiting membrane of the endosome and 3) the membrane fusion of the delivery system with the limiting membrane of the endosome. Therefore, a "helper lipid" can be used to improve efficiency or physical characteristics such as stability, but is not essential for the function of the liposomal delivery system. The preferred lipids Cholesterol, Diosgenin, Solasodine, and ceramide showed high "helper" activity for siRNA transfection in HeLa cells. The lipid DOPE showed intermediate "helper" activity for siRNA delivery in HeLa cells, whereas DOPC and sphingomyelin showed no "helper" activity for siRNA transfection in HeLa cells. In other words, a particular aspect of the present invention provides a drug delivery system comprising a liposome having: (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) between 1 and 20 mol percent of an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, iv) between 13 and 35 mol percent of at least one helper lipid, and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume, wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering. A more particular aspect of the present invention provides a drug delivery system comprising a liposome having: (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) between 1 and 20 mol percent of an acid-cleavable polyethylene glycol conjugated lipid; GAR-P04383WO55 Application (final).docx iii) between 15 and 45 mol percent of at least one fusogenic agent, iva) between 13 and 15 mol percent of cholesterol, and ivb) between 15 and 36 mol percent of solasodine, and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume, wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering. A still more particular aspect of the present invention provides a drug delivery system comprising a liposome having: (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, iva) 13 mol percent of cholesterol, and ivb) 36 mol percent of solasodine; and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume, wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering. A further more particular aspect of the present invention provides a drug delivery system comprising a liposome having: (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, iva) 15 mol percent of cholesterol, and ivb) 15 mol percent of solasodine; and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume, wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering. GAR-P04383WO55 Application (final).docx As used herein, the term “neutral lipid” is meant to refer to any of a number of lipid species that exist either in an uncharged or neutral zwitterionic form at a selected pH. At physiological pH, such lipids include, for example, diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, sphingomyelin, cephalin, cholesterol, cerebrosides, and diacylglycerols. Therapeutic agents The liposome compositions disclosed herein may include one or more therapeutic agents and / or prophylactic agents (or abbreviated as just therapeutic / s or prophylactic / s). The term "therapeutic agent" or "prophylactic agent" as used herein refers to any agent that, when administered to a subject, has a therapeutic, diagnostic, and / or prophylactic effect and / or elicits a desired biological and / or pharmacological effect. Therapeutic agents are also referred to as "actives" or "active agents". Moreover, the term "therapeutic agent" is meant to refer to a drug, a protein, a peptide, a gene, an oligonucleotide, a compound, an antibody, a nanobody, a nucleic acid, a ribonucleoprotein, a small molecule, a non-Lipinski molecule, a biomimetic, or a natural compound, or another pharmaceutically active ingredient. In a preferred embodiment, a therapeutic agent such as a therapeutic siRNA is encapsulated in the lipid portion of the particle, thereby protecting it from enzymatic degradation. As used herein, the term "non-Lipinski molecule" refers to molecules that do not conform to Lipinski's rule of five, which is a rule to predict high probability of success or failure due to drug likeness for molecules complying with 2 or more of the following rules: 1) Molecular mass less than 500 Dalton; 2) High lipophilicity (expressed as LogP less than 5); 3) Less than 5 hydrogen bond donors; 4) Less than 10 hydrogen bond acceptors; 5) Molar refractivity should be between 40-130. The rule was formulated by Christopher A. Lipinski in 1997, based on the observation that most orally administered drugs are relatively small and moderately lipophilic molecules. The rule is indicative of molecular properties such as absorption, distribution, metabolism, and excretion ("ADME"), which are important for drug's pharmacokinetics in the human body. Capecchi et al., described that seven million entries of the PubChem database are non-Lipinski molecules (non-Lipinski PubChem (NLP)), 183,185 of which are also found in the GAR-P04383WO55 Application (final).docx ChEMBL database (non-Lipinski ChEMBL (NLC)) (Capecchi et al., PubChem and ChEMBL beyond Lipinski. Mol. Inf.2019, 38, 1900016). The term "biomimetics" refers to a compound that mimics a biological compound in its structure or function. The term "natural products (NPs)" refers to small molecules produced by living organisms with potential applications in pharmacology and other industries as many of them are bioactive. Exemplary "natural products (NPs)" can be found in COlleCtion of Open Natural prodUcTs (COCONUT), https: / / coconut.naturalproducts.net. In some embodiments, a therapeutic agent is a polynucleotide or nucleic acid (e.g., ribonucleic acid or deoxyribonucleic acid). The term "polynucleotide," in its broadest sense, includes any compound and / or substance that is or can be incorporated into an oligonucleotide chain. Exemplary polynucleotides for use in accordance with the present disclosure include, but are not limited to, one or more of deoxyribonucleic acid (DNA), ribonucleic acid (RNA) including messenger mRNA (mRNA), hybrids thereof, RNAi-inducing agents, RNAi agents, siRNAs, shRNAs, miRNAs, antisense RNAs, ribozymes, catalytic DNA, RNAs that induce triple helix formation, aptamers, vectors, guide RNA, etc. In some embodiments, a therapeutic and / or prophylactic is an RNA as described above. As used herein, an "RNA" refers to a ribonucleic acid that may be naturally or non-naturally occurring. For example, an RNA may include modified and / or non-naturally occurring components such as one or more nucleobases, nucleosides, nucleotides, or linkers. An RNA may include a cap structure, a chain terminating nucleoside, a stem loop, a polyA sequence, and / or a polyadenylation signal. An RNA may have a nucleotide sequence encoding a polypeptide of interest. RNAs useful in the compositions and methods described herein can be selected from the group consisting of, but are not limited to, shortmers, antagomirs, antisense, ribozymes, small interfering RNA (siRNA), asymmetrical interfering RNA (aiRNA), microRNA (miRNA), piRNA, sdRNA, snRNA, snoRNA, PAR, tsRNA, endo-siRNA, MSY-RNA, tel-sRNA, crasiRNA, moRNA, xiRNA, lncRNA, circRNA, regulatory non-coding RNA (ncRNA), Dicer-substrate RNA (dsRNA), small hairpin RNA (shRNA), transfer RNA (tRNA), messenger RNA (mRNA) (e.g Cas9 mRNA), single-guide RNA (sgRNA), guide RNA, CRISPR RNA (crRNA), tracr RNA, and mixtures thereof. In certain embodiments, the RNA is an mRNA. GAR-P04383WO55 Application (final).docx In other embodiments, a therapeutic and / or prophylactic is a siRNA. A siRNA may be capable of selectively knocking down or down regulating expression of a gene of interest. For example, a siRNA could be selected to silence or downregulating a gene associated with a particular disease, disorder, or condition upon administration to a subject in need thereof of a liposome composition including the siRNA. A siRNA may comprise a sequence that is complementary to a mRNA sequence that encodes a gene or protein of interest. In some embodiments, the siRNA may be an immunomodulatory siRNA. In some embodiments, a therapeutic agent is a shRNA or a vector or plasmid encoding the same. A shRNA may be produced inside a target cell upon delivery of an appropriate construct to the nucleus. Constructs and mechanisms relating to shRNA are well known in the relevant arts In certain embodiments, a therapeutic and / or prophylactic is a "CRISPR guide RNA" such as a sgRNA, a crispr guide RNA (also referred to as cr guide RNA), or a tracr RNA, a guide RNA mix. SgRNA, crispr guide RNA, tracr RNA and / or a guide RNA mix can be used as gene editing tools. For example, a guide RNA- Cas9 complex can affect mRNA translation of cellular genes. Thus, the term "CRISPR guide RNA" as used herein refer to a specific RNA sequence selected from the group comprising sgRNA, crRNA, tracr RNA, a guide RNA mix. A "guide RNA" (gRNA) or "guide RNA mix" refers to a specific RNA sequence that recognizes the target DNA region of interest and directs the Cas nuclease there for editing. The "guide RNA mix" is made up of two parts: crispr RNA ("crRNA"), a 17-20 nucleotide sequence complementary to the target DNA, and a "tracr RNA", which serves as a binding scaffold for the Cas nuclease. A “single guide RNA” or "sgRNA" refers to a single RNA molecule that contains both a target DNA specific "crRNA" fused to the scaffold "tracrRNA". Moreover, in some embodiments the therapeutic agent is a ribonucleoprotein. The term "ribonucleoprotein" refers to a protein present in the nucleus and cytoplasm that is complexed with, and influences the processing of different low molecular weight ribonucleic acids. An exemplary ribonucleoprotein is a ribonucleoprotein complex consisting of Cas9 protein and single guide RNA (sgRNA). In some embodiments, a therapeutic agent for the liposome delivery system disclosed herein is a regulatory long non coding RNA. The term "LncRNA" refers GAR-P04383WO55 Application (final).docx to RNA species longer than 200 nt, lacking protein-coding ability, and involved in regulation of genes expression and of diverse cellular functions. In some embodiments, a therapeutic agent for the liposome delivery system disclosed herein is a regulatory circular noncoding RNAs (circRNAs). In some embodiments, a therapeutic agent for the liposome delivery system disclosed herein is a regulatory small non coding RNA. The term "small non coding RNA" refers to RNA species 18–200 nts long, lacking protein-coding ability, and having diverse roles. Small non coding RNA comprise microRNAs (miRNA), Small interfering RNAs (siRNA), PIWI-interacting RNAs (piRNAs), Sno- derived RNAs (sdRNAs), small nuclear RNA (snRNA), Small nucleolar RNAs (snoRNAs), Promoter-associated RNAs (PARs), tRNA-derived small RNAs (tsRNAs), endo-siRNA, MSY2-associated RNAs (MSY-RNAs), Telomere small RNAs (tel-sRNAs), Centrosome-associated RNAs (crasiRNAs), microRNA-offset RNAs (moRNAs), and X-inactivation RNAs (xiRNAs). Thus, a preferred therapeutic agent for the liposome delivery system disclosed herein is a peptide, a protein, an antibody, a nanobody, a nucleic acid, a ribonucleoprotein, a small molecule, a non-lipinski molecule, a biomimetic, or a natural compound. A further preferred therapeutic agent for the liposome delivery system disclosed herein is a CRISPR / Cas9 ribonucleoprotein, a CRISPR guide RNA, or a CRISPR associated Cas protein. A further more preferred therapeutic agent for the liposome delivery system disclosed herein is a nucleic acid selected from the group comprising ssDNA, dsDNA, ssRNA, dsRNA, aiRNA, miRNA, siRNA, piRNA, sdRNA, snRNA, snoRNA, PAR, tsRNA, endo-siRNA, MSY-RNA, tel-sRNA, crasiRNA, moRNA, xiRNA, lncRNA, ncRNA, circRNA, mRNA, sgRNA, crRNA, tracr RNA, guide RNA mix, self-amplifying RNA, ribozymes, and antisense oligonucleotides. Thus, the present invention also discloses a drug delivery system comprising a liposome having (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) between 1 and 20 mol percent of an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, and GAR-P04383WO55 Application (final).docx (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering, and wherein the therapeutic agent is a drug, a protein, a peptide, a gene, an oligonucleotide, a compound, an antibody, a nanobody, a nucleic acid, a ribonucleoprotein, a small molecule, a non-lipinski molecule, a biomimetic, or a natural compound. In particular, the present invention also discloses a drug delivery system comprising a liposome having (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) between 1 and 20 mol percent of an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering, and wherein the therapeutic agent is a CRISPR / Cas9 ribonucleoprotein, a CRISPR guide RNA, or a CRISPR associated Cas protein. More in particular, the present invention also discloses a drug delivery system comprising a liposome having (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) between 1 and 20 mol percent of an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and GAR-P04383WO55 Application (final).docx wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering, and wherein the therapeutic agent is a nucleic acid selected from the group comprising ssDNA, dsDNA, ssRNA, dsRNA, aiRNA, miRNA, siRNA, piRNA, sdRNA, snRNA, snoRNA, PAR, tsRNA, endo-siRNA, MSY-RNA, tel-sRNA, crasiRNA, moRNA, xiRNA, lncRNA, ncRNA, circRNA, mRNA, sgRNA, crRNA, tracr RNA, guide RNA mix, self-amplifying RNA, ribozymes, and antisense oligonucleotides. Therapeutic proteins useful to be delivered with the liposome delivery system of this disclosure include vaccine proteins, antibodies against intracellular targets / intrabodies, a nanobodies, gene editing enzymes, cytotoxic proteins (for cancer therapeutics). More in particular useful therapeutic proteins can be insulin, erythropoietin (EPO), granulocyte-colony stimulating factor (G-CSF), granulocyte- macrophage colony stimulating factor (GM-CSF), luteinizing hormone-releasing hormone (LHRH) analogs, interferons, Hepatitis B surface antigen, a vaccine protein. As used herein, the term "polypeptide" or "polypeptide of interest" refers to a polymer of amino acid residues typically joined by peptide bonds that can be produced naturally (e.g., isolated or purified) or synthetically. As used herein, "modified" means non-natural. For example, an RNA may be a modified RNA that is an RNA including one or more nucleobases, nucleosides, nucleotides, or linkers that are non-naturally occurring. A "modified" species may also be referred to herein as an "altered" species. Species may be modified or altered chemically, structurally, or functionally. For example, a modified nucleobase species may include one or more substitutions that are not naturally occurring. As used herein, "naturally occurring" means existing in nature without artificial aid. As used herein, a "linker" is a moiety connecting two moieties, for example, the connection between two nucleosides of a cap species. A linker may include one or more groups including but not limited to phosphate groups (e.g., phosphates, boranophosphates, thiophosphates, selenophosphates, and phosphonates), alkyl groups, amidates, amides, esters, ethers, or glycerols. Polynucleotides and nucleic acids may be naturally or non-naturally occurring. Polynucleotides and nucleic acids may include one or more modified (e.g., altered GAR-P04383WO55 Application (final).docx or alternative) nucleobases, nucleosides, nucleotides, or combinations thereof. The nucleic acids and polynucleotides useful in the drug delivery system disclosed herein can include any useful modification or alteration, such as to the nucleobase, the sugar, or the internucleoside linkage (e.g., to a linking phosphate / to a phosphodiester linkage / to the phosphodiester backbone). In certain embodiments, alterations are present in each of the nucleobase, the sugar, and the internucleoside linkage. Modifications according to the present disclosure may be alterations of ribonucleic acids (RNAs) to deoxyribonucleic acids (DNAs), e.g., the substitution of the 2'-OH of the ribofuranosyl ring to 2'-H, threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs), unlocked nucleic acid (UNA), or hybrids thereof. Modifications can concern modified nucleobases such as hypoxanthine, 6-methyladenine, 5-methyl pyrimidines, particularly 5-methylcytosine, (5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC, gentobiosyl HMC, synthetic nucleobases, such as 2- aminoadenine, 2-(methylamino) adenine, 2-(imidazolylalkyl)adenine, 2- (aminoalklyamino)adenine or other heterosubstituted alkyladenines, 2-thiouracil, 2- thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7- deazaguanine, N6 (6-aminohexyl)adenine and 2,6-diaminopurine. Preferred RNA modifications are 2'-O-Methylation (2'-OMe), 2'-O-methoxyethyl (2'-MOE), 2'- Fluoro (2'-F), 5-methoxy-uridine (5moU), N1-methylpseudouridine, pseudouridine, phosphorothioate (s).The phrase "pharmaceutically acceptable" is used herein to refer to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. As used herein, "pharmaceutically acceptable salts" refers to derivatives of the disclosed compounds wherein the parent compound is altered by converting an existing acid or base moiety to its salt form (e.g., by reacting a free base group with a suitable organic acid). Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like. Representative acid addition salts include acetate, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2- GAR-P04383WO55 Application (final).docx hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, valerate salts, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like. The pharmaceutically acceptable salts of the present disclosure include the conventional non-toxic salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. The pharmaceutically acceptable salts of the present disclosure can be synthesized from the parent compound which contains a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. Lists of suitable salts are known in the art. The phrase "pharmaceutically acceptable excipient," as used herein, refers to any ingredient other than the compounds described herein (for example, a vehicle capable of suspending, complexing, or dissolving the active compound) and having the properties of being substantially nontoxic and non-inflammatory in a patient. Excipients may include, for example: anti-adherents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (colors), emollients, emulsifiers, fillers (diluents), film formers or coatings, flavors, fragrances, glidants (flow enhancers), lubricants, preservatives, printing inks, sorbents, suspending or dispersing agents, sweeteners, and waters of hydration. Exemplary excipients include, but are not limited to: butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, cross-linked polyvinyl pyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methyl paraben, microcrystalline cellulose, polyethylene glycol, polyvinyl pyrrolidone, povidone, pregelatinized starch, propyl paraben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethyl cellulose, sodium citrate, sodium starch glycolate, sorbitol, GAR-P04383WO55 Application (final).docx starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E (alpha-tocopherol), vitamin C, xylitol, and other species disclosed herein. As used herein, the term "therapeutically effective amount" means an amount of an agent to be delivered (e.g., nucleic acid, drug, composition, therapeutic agent, diagnostic agent, prophylactic agent, etc.) that is sufficient, when administered to a subject suffering from or susceptible to an infection, disease, disorder, and / or condition, to treat, improve symptoms of, diagnose, prevent, and / or delay the onset of the infection, disease, disorder, and / or condition. The efficacy concentration "EC50" of a therapeutic agent, such as an mRNA or a siRNA, is the concentration associated with efficacy in approximately 50% of the population. For example, the EC50 of a particular mRNA or siRNA delivered by the inventive liposome composition is the is the concentration associated with expression or downregulation of the mRNA target, in approximately 50% of the population. The method for EC50 calculation is described in Example 12. More in particular, the EC50 refers to a statistically or graphically estimated concentration that is expected to cause one or more specified effects in 50% of a group of organisms under specified conditions. Another important parameter is the toxic concentration TC50 that refers to a dose of a substance administered to test organisms (here Hela cells or primary cells) that produces toxic effects in 50 percent of test organisms. The method for TC50 calculation is described in Example 12. On the basis of the EC50 and TC50 can be calculated the "Therapeutic Index" of a particular agent. The therapeutic index is defined as the ratio between TC50 and EC50: Therapeutic index = TC50 / EC50 As used herein, "transfection" refers to the introduction of a species (e.g., an RNA) into a cell. Transfection may occur, for example, in vitro, ex vivo, or in vivo. "N / P ratio" As used herein, the "N / P ratio", also referred as "amine to phosphate" or "positive to negative" is the molar ratio of positively-chargeable amine (N = nitrogen) groups in a lipid to negatively-charged nucleic acid phosphate (P) groups in a nucleic acid molecule, such as an oligonucleotide, being encapsulated in the GAR-P04383WO55 Application (final).docx drug delivery system. Thus, the N / P ratio states the relative proportion of molar amount of positive to negative charges in the formulation As a consequence, the "N / P ratio" is a measure to ensure encapsulation, and is used to determine how much encapsulating agent is necessary for a given amount of cargo or viceversa. More in particular, the number of positive charges per molecule equals the number of amino groups present on each individual molecule (N) of encapsulating agent. For the cargo (in case of oligonucleotides) the number of negative charges per molecule is the number of phosphate groups present. n(positive charges) = n(encapsulating agent) * Namino groups per molecule n(negative charges) = n(oligonucleotide)*Nphosphate groups per oligonucleotide With n(encapsulating agent) and n(oligonucleotide) being the molar amount of respective entity, Namino groups per molecule the number of amino groups present on the encapsulating agent, Nphosphate groups per oligonucleotide the number of phosphate groups on the oligonucleotide. For the latter, in case it is a double stranded oligonucleotide (e.g. siRNA) or several single oligonucleotides (e.g. guide RNA mix) the sum of phosphates of both strands is considered. More details about the calculation are given in Example 31. Preferentially, in the drug delivery system of the invention the N / P ratio is from about 1:1 to about 50:1. Therefore, a preferred embodiment of the present invention provides a drug delivery system comprising a liposome having (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) between 1 and 20 mol percent of an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and GAR-P04383WO55 Application (final).docx wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering, and wherein the N / P ratio is from about 1:1 to about 50:1. A more preferred embodiment of the present invention provides a drug delivery system comprising a liposome having (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) between 1 and 20 mol percent of an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering, and wherein the therapeutic agent is a nucleic acid selected from the group comprising ssDNA, dsDNA, ssRNA, dsRNA, miRNA, siRNA, mRNA, sgRNA, crRNA, tracr RNA, guide RNA mix, self-amplifying RNA, ribozymes, and antisense oligonucleotides; wherein the N / P ratio is from about 1:1 to about 50:1. An embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 1:1 to about 6:1. A preferred embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 1:1 to about 10:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 1:1 to about 20:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 1:1 to about 30:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 1:1 to about 40:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 1:1 to about 50:1. An embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 2:1 to about 6:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 2:1 to about 10:1. A embodiment of the invention relates to a drug delivery system as GAR-P04383WO55 Application (final).docx disclosed herein, wherein the N / P ratio is from about 2:1 to about 20:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 2:1 to about 30:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 2:1 to about 40:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 2:1 to about 50:1. An embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 3:1 to about 6:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 3:1 to about 10:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 3:1 to about 20:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 3:1 to about 30:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 3:1 to about 40:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 3:1 to about 50:1. A more particular aspect of the invention relates to a drug delivery system as disclosed herein, comprising (b) a siRNA as therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; and wherein the N / P ratio is from about 1:1 to about 40:1, and preferably from 5:1 to 40:1. A further more particular aspect of the invention relates to a drug delivery system as disclosed herein, comprising (b) a mRNA as therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; and wherein the N / P ratio is from about 1:1 to about 20:1. A further more particular aspect of the invention relates to a drug delivery system as disclosed herein, comprising (b) a guide RNA mix as therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume, said guide RNA mix comprising a crRNA and a tracr RNA; and wherein the N / P ratio is from about 5:1 to about 10:1. GAR-P04383WO55 Application (final).docx A further more particular aspect of the invention relates to a drug delivery system as disclosed herein, comprising (b) a guide RNA mix as therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume, said guide RNA mix comprising a crRNA and a tracr RNA; and wherein the N / P ratio is 5.46:1, or 5.07:1, or 8.45:1, or 9.10:1 or any value comprised inbetween. "Liposome compositions" As used herein, a "liposome composition" refers to the composition of a liposome in term of lipids and therapeutic agents. More in particular, a "liposome composition" refers to the composition of a liposome as disclosed herein in terms of fusogenic agent, encapsulating agent, acid-cleavable PEG conjugated lipid, therapeutic agent, and optionally helper lipid. In other word, a preferred liposome composition of the inventive drug delivery system disclosed herein comprises the following liposome components (also referred to as "agents" or "compounds"): an "encapsulating agent", an "acid- cleavable agent or acid-cleavable PEG-lipid", a "fusogenic agent", a "therapeutic agent", and optionally an "helper lipid or agent" (also referred to as "enhancer" or "enhancer lipid" or "enhancer agent") The wording liposome component is used within the meaning of the disclosed invention interchangeably with the terms "agent" and "compound". A "liposome composition variation" or "variation" refers to a liposome composition resulting from the replacement of a liposome component or from the variation of its ratio. An embodiment of the present invention refers to a drug delivery system comprising a liposome having: (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride and / or PD740, ii) between 1 and 11 mol percent of α-methoxy-ω-{N-(2-methyl-2- octadecyloxy-[1,3]dioxan-5-yl)-amido}-polyethylene glycol45, iii) between 15 and 45 mol percent of 2,2'-S,S- bis(monooleoylglycerol)phosphate, and GAR-P04383WO55 Application (final).docx iv) between 13 and 35 mol percent of cholesterol; and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering. A preferred embodiment of the present invention refers to a drug delivery system comprising a liposome having: (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) 50 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride, ii) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5- yl)-amido}-polyethylene glycol45, iii) 20 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate, and iv) 25 mol percent of cholesterol; and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering. A further preferred embodiment of the present invention refers to a drug delivery system comprising a liposome having: (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) 50 mol percent of PD740, ii) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5- yl)-amido}-polyethylene glycol45, iii) 20 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate, and iv) 25 mol percent of cholesterol; and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering. A further more preferred embodiment of the present invention refers to a drug delivery system comprising a liposome having: (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises GAR-P04383WO55 Application (final).docx ia) 25 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride, ib) 25 mol percent of PD740, ii) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5- yl)-amido}-polyethylene glycol45, iii) 20 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate, and iv) 25 mol percent of cholesterol; and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between20 nm and 200 nm, as determined by dynamic light scattering. A still more preferred embodiment of the present invention refers to a drug delivery system comprising a liposome having: (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) 33 mol percent of PD740, ii) 7 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5- yl)-amido}-polyethylene glycol45, iii) 27 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate, and iv) 33 mol percent of cholesterol; and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering. An alternative embodiment of the present invention refers to a drug delivery system comprising a liposome having: (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 42 and 50 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride, ii) between 4 and 5 mol percent of α-methoxy-ω-{N-(2-methyl-2- octadecyloxy-[1,3]dioxan-5-yl)-amido}-polyethylene glycol45, iii) between 4 and 15 mol percent of 2,2'-S,S- bis(monooleoylglycerol)phosphate, iva) between 13 and 15 mol percent of cholesterol, and ivb) between 15 and 36 mol percent of solasodine. GAR-P04383WO55 Application (final).docx (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering. A further alternative embodiment of the invention provides a drug delivery system comprising a liposome having: (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises ia) 25 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride, ib) 25 mol percent of PD740, ii) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5- yl)-amido}-polyethylene glycol45, iii) 20 mol percent of monogalactosyldiacylglycerol or 1-palmitoyl-2-linoleoyl- sn-glycero-3-phosphoethanolamine, and iv) 25 mol percent of cholesterol; and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering. "Unilamellar liposomes" Thus, a preferred aspect of the present invention relates to a drug delivery system as disclosed herein, wherein the liposome is a unilamellar and / or univesicular liposome. Unilamellar liposomes are characterized for having one aqueous compartment, delimited by a single bilayer membrane. Unilamellar liposomes are usually spherical vesicles. In contrast, multilamellar liposomes are characterized by a liposome structure having plural concentric circular membranes similar to “coats layers of onion” and having shell-like concentric circular aqueous compartments present between said membranes. Moreover, the inventive drug delivery system comprises essentially only "univesicular liposomes". However, the inventive drug delivery system can also comprises some "multivesicular liposome". GAR-P04383WO55 Application (final).docx In the present invention, “univesicular liposome” (ULV, the same meaning as that of mononuclear liposome) indicates a liposome structure having a single inner aqueous phase, and such liposomes have a Z-average particle diameter size of nanometer order, usually about 20 to 500 nm. On the other hand, the “multivesicular liposome” (MVL) indicates a liposome structure comprising a lipid membrane surrounding plural non-concentric circular inner aqueous phases. Multivesicular liposomes and the multilamellar liposomes have a Z-average particle diameter of micrometer order, usually about 0.2 to 25 μm. As used herein, the term "delivering" means providing an entity to a destination. For example, delivering a therapeutic and / or prophylactic to a subject may involve administering a liposome composition including the therapeutic and / or prophylactic to the subject (e.g., by an intravenous, intramuscular, intradermal, or subcutaneous route). Administration of a liposome composition to a mammal or mammalian cell may involve contacting one or more cells with the liposome composition. As used herein, the term "enhanced delivery" means delivery of more (e.g., at least 1.5 fold more, at least 2-fold more, at least 3-fold more, at least 4-fold more, at least 5-fold more, at least 6-fold more, at least 7-fold more, at least 8-fold more, at least 9-fold more, at least 10-fold more) of a therapeutic and / or prophylactic by a liposome to a target tissue or cell of interest compared to the level of delivery of a therapeutic and / or prophylactic without that liposome or by a previously known delivery system (e.g. lipofectamine) to a target tissue or cell of interest. As used herein, the term "isomer" means any geometric isomer, tautomer, zwitterion, stereoisomer, enantiomer, or diastereomer of a compound. Compounds may include one or more chiral centers and / or double bonds and may thus exist as stereoisomers, such as double-bond isomers (i.e., geometric E / Z isomers) or diastereomers (e.g., enantiomers (i.e., (+) or (-)) or cis / trans isomers). The present disclosure encompasses any and all isomers of the compounds described herein, including stereomerically pure forms (e.g., geometrically pure, enantiomerically pure, or diastereomerically pure) and enantiomeric and stereoisomeric mixtures, e.g., racemates. Enantiomeric and stereomeric mixtures of compounds and means of resolving them into their component enantiomers or stereoisomers are well- known. As used herein, the term “isoform” refers to compounds that for example share the same backbone structure but include a different number of fatty acids attached, or include fatty acids of different chain length or with a different linkage. GAR-P04383WO55 Application (final).docx Chemical structures Chemical structures of tested Solasodine E18 ((5alpha,7alpha)-7-bromo-5-hydroxy-6- oxospirostan - 3-yl acetate) Ceramide GAR-P04383WO55 Application (final).docx Sphingomyelin (porcine brain extract, mixture of different chain lengths) Chemical structures of tested LBPA isoforms S,S-3,3'-LBPA R,S-3,3'-LBPA ether-LBPA S,R - Hemi-LBPA ether-LBPA GAR-P04383WO55 Application (final).docx Chemical structures of encapsulating agents GAR-P04383WO55 Application (final).docx MVL5 GAR-P04383WO55 Application (final).docx MGDG (plant extract, the chemical structure represents the main species of a mixture of different chain length) GAR-P04383WO55 Application (final).docx GAR-P04383WO55 Application (final).docx PalmA Acid- cleavable PEG Lipid α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}-polyethylene glycol45 (PEG2000-orthoester-C18 or PEGOEC18) GAR-P04383WO55 Application (final).docx Cholesterol conjugated siRNA sense strand (Chol-siRNA (SEQ ID NO 7)) The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the scope of the invention. Further modifications and alternative embodiments of various aspects of the invention will be apparent to those skilled in the art in view of this description. Accordingly, this description is to be construed as illustrative only and is for the purpose of teaching those skilled in the art the general manner of carrying out the invention. It is to be understood that the forms of the invention shown and described herein are to be taken as examples of embodiments. Elements and materials may be substituted for those illustrated and described herein, parts and processes may be reversed, and certain features of the invention may be utilized GAR-P04383WO55 Application (final).docx independently, all as would be apparent to one skilled in the art after having the benefit of this description of the invention. Changes may be made in the elements described herein without departing from the scope of the invention as described in the following claims. Examples Abbreviations list: 2'-OMe – 2'-O-methyl 2'-MOE – 2'-O-methoxyethyl 5-Me-C – 5-methylcytosine 5moU – 5-methoxyuridine AcOH – acetic acid aiRNA – asymmetrical interfering RNA AllocCl – allyloxycarbonyl chloride BACMAM – Baculovirus gene transfer into Mammalian cells BHT – butylated hydroxytoluene ( BSA – bovine serum albumin CAS – Chemical Abstracts Service Cas – CRISPR associated protein Cas9 – CRISPR associated protein 9 Chol – cholesterol Chol-siRNA – cholesterol siRNA conjugate CMB – Cell Mask Blue conc. – concentration COVID – coronavirus disease 2019 cr guide RNA – CRISPR guide RNA crasiRNA – centrosome-associated RNA CRISPR – Clustered Regularly Interspaced Short Palindromic Repeats cryoEM – cryogenic electron microscopy DAPI – 4',6-Diamidino-2-phenylindol DCM – dichlormethane DDQ – 2,3-Dichloro-5,6-dicyano-1,4-benzoquinone DIPEA – diisopropylethyl amine DMAP – 4-(Dimethylamino)pyridin DMEM – Dulbecco's Modified Eagle Medium DMF – dimethylformamide GAR-P04383WO55 Application (final).docx DMSO – dimethylsulfoxid DMTP – dimethylterephthalate DNA – desoxyribonucleic acid dsRNA – double stranded RNA DLS – dynamic light scattering dsGFP – destabilized eGFP DSPE – 1,2-distearoyl-sn-glycero-3-phosphoethanolamine E18 – (5alpha,7alpha)-7-bromo-5-hydroxy-6-oxospirostan - 3-yl acetate EC50 – half maximal effective concentration EDTA – Ethylenediaminetetraacetic acid EDC – N-Ethyl-N′-carbodiimide hydrochloride eGFP / GFP – (enhanced) green fluorescent protein EGTA – ethylene glycol-bis(β-aminoethyl ether)-N,N,N′,N′-tetraacetic acid ELSD – evaporative light scattering detector EM – electron microscopy EPO – Erythropoietin EtOAc – ethyl acetate EtOH – ethanol eq. – equivalents ESI – electrospray ionization FACS – fluorescence-activated cell sorting FBS – fetal bovine serum FTMS – Fourier Transform Mass Spectrometry G418 – geneticin G-CSF – granulocyte-colony stimulating factor eGFP / GFP – (enhanced) green fluorescent protein HEPES GM-CSF – granulocyte-macrophage colony stimulating factor GNA – glycol nucleic acid guide RNA – mix of tracr RNA and cr guide RNA HBTU – 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate HEPES – 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid HMC – 5-hydroxymethylcytosine HOBt – hydroxybenzotriazole HPLC – high performance liquid chromatography KD – knock down LBPA – lysobisphophatidic acid LHRH – luteinizing hormone-releasing hormone LLOMe – L-leucine methyl ester GAR-P04383WO55 Application (final).docx LMV – large multilamellar vesicle LNA – locked nucleic acid LNP – lipid nanoparticle MCFS – macrophage colony-stimulating factor MeCN – acetonitrile MeOH – methanol MM – mouse macrophages MPI-CBG – Max Planck Institute of Molecular Cell Biology and Genetics mRNA – messenger RNA miRNA – micro RNA moRNA – microRNA-offset RNA MSY-RNA – MSY2-associated RNA MVL – multivesicular liposome ncRNA – regulatory non-coding RNA NMR – nuclear magnetic resonance spectroscopy ORF – open reading frame PAR – promoter-associated RNA PBS – phosphate buffered saline PDI – polydispersity index PEG – polyethylene glycol PEGOEC18 – PEG2000-orthoester-C18 PEPC – protein expression, purification and characterization facility PEST amino acid sequence – proline-glutamate-serine-threonine-rich amino acid sequence (to target proteins for degradation) piRNA – PIWI-interacting RNA PNA – peptide nucleic acid PMBCl – para-methoxybenzyl chloride PTFE – Polytetrafluoroethylene pTosOH – p-toluene sulfonic acid Rf – retention factor RNA – ribonucleic acid RNP – ribonucleoprotein complex rt – room temperature SD – standard deviation sdRNA – sno-derived RNA SEM – standard error of the mean shRNA – small hairpin RNA siRNA – small interfering RNA GAR-P04383WO55 Application (final).docx sgRNA – single guide RNA snRNA – small nuclear RNA snoRNA – small nucleolar RNA ssRNA – single stranded RNA TBAF – tetrabutylammonium fluoride TBDMSCl – tert-butyldimethylsilyl chloride TBE – tris-borate-EDTA buffer tBuOOH – tert-Butyl hydroperoxide TC50 – half maximal toxic concentration TE – tris-EDTA buffer tel-sRNA – telomere small RNA TFA – trifluoroacetic acid THF – tetrahydrofuran TLC – thin layer chromatography TNA – threose nucleic acid tracr RNA – trans-activating crRNA tRNA – transfer RNA Tris – tris(hydroxymethyl)aminomethan tsRNA – tRNA-derived small RNA ULV – univesicular liposome UNA – unlocked nucleic acid UV – ultraviolet xiRNA – X-inactivation RNA General methods: RNase free handling All handling of liposome components to be used with RNA was done in an RNase free area using RNase free instruments. Area and instruments where cleaned with RNase zap (ThermoFisher Scientific, AM9780) repeatedly and regularly. RNase free plasticware was used (Eppendorf tubes, Falcon tubes, tips). All pipetting of compound solutions was done with RNase free filtered tips (ART tips, ThermoFisher Scientific) and Gilson Pipetman®pipettes. Glassware was made RNase free by heating to 220 °C for 2h. Lids for vials were made RNase free with RNase zap and subsequently washed with RNase free water and EtOH. RNA quantification RNA concentration was quantified by UV absorption at 260 nm using a NanoDrop instrument. GAR-P04383WO55 Application (final).docx Compound aliquoting and solvent selection Compounds were weighed into RNase-free glass vials (either 4 ml (Supelco 27138, screw top with solid green melamine cap with PTFE liner) or 1.5 ml (Certified CD™ Vial (Center Draining) Kit, 9 mm thread with cap / septa, Sigma Aldrich, 29307-U)) and dissolved in a suitable solvent as mentioned below. Compound Solvent 2,2’-LBPA Chloroform, dried over K2CO3 (see handling of 2,2’- LBPA) labile PEG lipid CD3CN 16:0 BMP, 14:0 BMP MeOH NAPE MeOH / CHCl3(2.5:1) all other compounds Chloroform Compound concentration was verified with quantitative NMR on a Bruker Avance III using ERETIC method (Akoka, Barantin and Trierweiler, 1999. Concentration Measurement by Proton NMR Using the ERETIC Method’, Analytical Chemistry, 71(13), pp. 2554–2557) against a reference solution of DMTP (Standard for quantitative NMR, TraceCERT®, Merck, 07038). Handling labile PEG lipid PEG2000-orthoester-C18 PEG2000-orthoester-C18 is not stable in chloroform. Deuterated acetonitrile was used as the solvent of choice to allow monitoring of the stability of aliquots over a longer time and quantification of compound concentration by quantitative NMR on a Bruker Avance III using ERETIC method (Akoka, Barantin and Trierweiler, 1999) against a reference solution of DMTP (Standard for quantitative NMR, TraceCERT®, Merck, 07038). Glassware and commonly used lab equipment used for handling PEG2000-orthoester-C18 was thoroughly cleaned beforehand to avoid contamination with acids. The compound was handled at temperatures below 30 °C, including a lowered water bath temperature for solvent evaporation. Handling 2,2’-LBPA Isomerization of 2,2’- isomer to 3,3’ is increased under acidic conditions. Therefore, chloroform used for aliquotation of 2,2’-LBPA was pretreated with K2CO3(0.1 g / ml) for 1 h to remove residual HCl. Verification of correct isomer was performed using a phospholipase digestion assay and detection by quantitative TLC (Kobayashi et al., 2002. Separation and characterization of late endosomal membrane domains, The Journal of Biological Chemistry, 277(35), 32157–32164). GAR-P04383WO55 Application (final).docx Solvents used during purification were precooled on ice to avoid isomerization during the purification process. Evaporation of solvents was done at 35°C maximum. Example 1 – Liposome formation with siRNA using extrusion or sonication Liposomes (lipid vesicles) are formed when thin lipid films or lipid cakes are hydrated and stacks of liquid crystalline bilayers become fluid and swell. The hydrated lipid sheets detach during agitation and self-close to form large, multilamellar vesicles (LMV) which prevents interaction of water with the hydrocarbon core of the bilayer at the edges. Once these particles have formed, they are subjected to downsizing, i.e. size reduction, by sonication, wherein the energy input is in the form of sonic energy, or by extrusion, wherein the energy input is in the form of mechanical energy. Individual lipid components were dissolved in suitable solvents as specified in Table 15. siRNA was dissolved in a suitable buffer and its concentration was determined by UV absorption at 260 nm using a NanoDrop instrument. The following protocol has actual amounts for preparation of 500 µl of liposome solution of composition LP1 (DOTAP:Chol:LBPA:labile PEG lipid= 50:25:20:5) at an siRNA concentration of 2 µM in 5% glucose solution (w / w) with eGFP siRNA (Sigma Aldrich, custom synthesis). Individual components such as buffer, concentrations, total volume as well as the drug binding agent, helper lipid, fusogenic agent, PEG lipid, siRNA and the stoichiometry of components can be varied. The preparation was prepared at a charge ratio N:P (amine to phosphate) of 20:1. The charge ratio N:P is calaculated as described in example 31. The siRNA in this example has 42 charges per molecule (number of phosphate groups), while the liposomes have one charge per DOTAP molecule included (number of amino groups). This charge ratio can be varied. Amounts need to be adjusted depending on compounds and siRNA used. Lipid film generation: Suitable volumes of DOTAP solution in CHCl3 (0.59 mg, 8.40*10^(-7) mol, 50 eq.) and cholesterol solution in CHCl3 (0.16 mg, 4.20*10^(-7) mol, 25 eq.) were added to an RNase-free glass vial (4 ml) (screw top vial with Thermoset cap with PTFE liner, Supelco 27138 (Merck)) and dried down under nitrogen stream. The dried film was kept for 15 min at room temperature to ensure full evaporation. Suitable volume of a solution of LBPA in CHCl3 (0.27 mg, 3.36*10^(-7) mol, 20 eq.) was added to the existing film and dried down under nitrogen stream. The dried film GAR-P04383WO55 Application (final).docx was kept for 15 min at room temperature to ensure full evaporation. Suitable volume of labile PEG lipid in deuterated acetonitrile (0.20 µg, 8.40*10^(-8) mol, 5 eq.) was added to the existing film and dried down under nitrogen stream. The dried film was kept for 15 min at room temperature or dried under vacuum for 2 h to ensure full evaporation. Lipid film hydration: A 2 µM solution of eGFP siRNA (1 nmol, charges: 42 nmol) in sterile 5% glucose solution (w / w) in RNase free water (500 µl) was added to the dried film in a sterile environment. The sample was vortexed for 5 min and left to mature at room temperature for 30 min. Total lipid concentration after hydration is 3.36 mM. Downsizing can be achieved by 2 methods: Downsizing by extrusion: In a sterile environment, the sample was extruded with a disposable NanoSizer MINI extruder (T&T Scientific) containing a 100 nm membrane with 22 passes and collected from the receiving syringe. Alternatively, an Avanti Mini Extruder and 100 nm polycarbonate membranes (Sigma Aldrich, 610005) can be used. The sample was incubated at room temperature for 30 min before storing it at 4 °C. This method was used for final compositions. Downsizing by sonication: The sample was sonicated in a water bath sonicator (Bandelin Sonorex Super RK 102 H) for 45 min. The sample was incubated at room temperature for 30 min before storing it at 4 °C. This method is high throughput and was used for compositional screening. Quality control: Dynamic light scattering was used to check the presence of particles and analyse their size distribution (Example 6 for experimental details). The RiboGreen assay was used to assess siRNA concentration and siRNA encapsulation (Example 7 for experimental details). Example 2 – Liposome formation without cargo using extrusion or sonication Individual lipid components were dissolved in suitable solvents as specified in Table 15. The following protocol has actual amounts for preparation of 500 µl of liposome solution of composition LP1 (DOTAP:Chol:LBPA:labile PEG lipid= 50:25:20:5) in 5% glucose solution (w / w) at a total lipid concentration of 3.36 mM. GAR-P04383WO55 Application (final).docx Individual components such as buffer, concentrations, total volume as well as encapsulating agent, helper lipid, fusogenic agent, PEG lipid and stoichiometry of components can be varied. Lipid film generation was performed as described in Example 1 using the same components, amounts, and experimental conditions. Lipid film hydration: A sterile 5% glucose solution (w / w) in RNase free water (500 µl) was added to the dried film in a sterile environment. The sample was vortexed for 5 min and left to mature at room temperature for 30 min. Downsizing was achieved by extrusion or sonication as described in Example 1 above. Quality control: Dynamic light scattering was used to check the presence of particles and analyse their size distribution (Example 6 for experimental details). The lipid concentration was quantified using a variation of Cholesterol / Cholesterol Ester-Glo™ Assay (Promega J3190) (Example 28 for experimental details). Example 3 - Liposome formation with mRNA Liposomes were prepared without cargo according to protocol from example 2. Prior to transfection they were mixed with mRNA at an N / P ratio of 6:1. This ratio can be varied; and similar transfection data were obtained with a N / P ratio of 3:1. The mRNA-containing liposomes were obtained mixing a liposome composition LP1 in 5% glucose solution (w / w) with CleanCap®EGFP mRNA (5moU) (Trilink, L- 7201, 996 charges) at an N / P ratio of 6:1. To this aim, EGFP mRNA (10 µl, 100 µg / ml, PBS) was added to a solution of LP1 (10.92 µl, 3.36 mM total lipid) and mixed by pipetting up and down several times. The mixture was incubated for 15 min at room temperature and diluted to the concentration needed for transfection with 5% glucose solution, i.e.12.5 µg / ml mRNA concentration. Quality control: Dynamic light scattering was used to analyse particle size distribution (Example 6 for experimental details). The RiboGreen assay was used to assess mRNA concentration and mRNA encapsulation (Example 7 for experimental details). GAR-P04383WO55 Application (final).docx Example 4 – Liposome formation with guide RNA Liposomes were prepared without cargo according to the protocol described in example 2. Prior to transfection they were mixed with guide RNA mix at an N / P ratio of 8.45:1. This ratio can be varied. A liposome solution of composition LP1 in 5% glucose (w / w) at a total lipid concentration of 3.36 mM was prepared as described in example 2 and mixed with GFP cr guide and tracr RNA at an N / P ratio of 8.45:1. The guide RNA mix was prepared by mixing GFP cr guide 1 (0.84 µl, 100 µM, 50 charges) and tracr RNA (0.84 µl, 100 µM, 50 charges) and diluting it to 30 µl total volume using 20 mM Hepes, pH 7.5, 150 mM KCl. This mix was incubated for 15 min at 37 °C. Afterwards, 3.55 µl of this mix were mixed with LP1 solution (5 µl) by pipetting up and down and then incubated at room temperature for 30 min. It was then diluted with 5% glucose solution to the concentration needed for transfection, i.e.100 nM GFP cr guide RNA prior to transfection. Example 5 – Liposome formation with Cas9 RNP Liposomes were prepared without cargo according to the protocol described in example 2. Prior to transfection they were mixed with Cas9 protein / guide RNA complex at an N / P ratio of 9.10:1. This ratio can be varied A liposome solution of composition LP1 in 5% glucose (w / w) at a total lipid concentration of 3.36 mM was mixed with Cas9 protein guide RNA ribonucleoprotein complex at an N / P ratio of 9.10:1. Cas9 protein guide RNA ribonucleoprotein complex was prepared by mixing GFP cr guide (0.84 µl, 100 µM, 50 negative charges), tracer RNA (0.84 µl, 100 µM, 50 negative charges) and Cas9 protein (4.29 µl, 3 mg / ml, 22 positive charges) diluting it to 30 µl total volume using 20 mM Hepes, pH 7.5, 150 mM KCl. This mix was incubated for 15 min at 37 °C. Afterwards, 3.55 µl of this mix were mixed with LP1 solution (5 µl) by pipetting up and down and then incubated at room temperature for 30 min. It was then diluted to the concentration needed for transfection, i.e.100 nM GFP cr guide RNA prior to transfection. Example 6 – Liposome size analysis by dynamic light scattering Description of method: The liposome sample (3.36 mM, 1 µl) was diluted 1:150 in the initial "preparation" buffer (e.g. 5% Glucose (w / w) in RNase free water) to a total lipid concentration around 20 µM and transferred to a micro UV cuvette (Brand®, BR759200). The sample was measured with the size program of a Malvern Zetasizer Nano ZS GAR-P04383WO55 Application (final).docx (laser 632.8 nm) at 25°C using 173° backscatter, automatic measurement settings and 120 s preequilibration time.3 repeat measurements were conducted for each sample. Data analysis: The size Z-average, (Z-Ave), which corresponds to the liposome diameter in nm, and polydispersity index (PDI) were calculated on the basis of the light scattering data by the Malvern Zetasizer software and averaged over 3 measurements. The size distribution based on intensity, volume and number was exported as an average of 3 measurements. Distributions based on number of particles are shown in Figures 2c, h, 5c, 12c and 13c. Results: Size distribution of extruded siRNA- liposomes Dynamic light scattering analysis of extruded liposomes containing siRNA (prepared according to example 1) showed a narrow size distribution around 100 nm (Fig.2c). The average diameter Z-Ave was 121.3 ± 2.8 nm and the average polydispersity index was 0.123 ± 0.007 (n=6, error: SEM). siRNA-liposome size stability over time After storage at 4 °C for 9 months, and 1.6 and 2.4 years the size distribution of extruded liposomes containing siRNA (prepared according to example 1) was unchanged (Fig.2h), demonstrating high stability of the liposomal system. Size distribution of mRNA-liposomes Dynamic light scattering several hours after mixing of empty extruded liposomes with mRNA (prepared according to example 3) showed a slight shift of the size distribution towards larger sizes for extruded liposomes with mRNA compared to the same liposomes without mRNA (Fig.5c). Example 7 – RNA quantification with RiboGreen assay Description of method: The concentration and encapsulation efficiency of RNA was determined using the Quant-it™ RiboGreen RNA Assay Kit from Invitrogen™ (ThermoFisher Scientific, R11490). The assay was performed in a Nunc™ F96 MicroWell™ Black Polystyrene Plate (ThermoFisher Scientific, 237105). Each sample was assayed in triplicate both in the absence and in the presence of 0.5% Triton X. The individual GAR-P04383WO55 Application (final).docx samples were compared to a four-point standard curve of the same RNA with and without 0.5% Triton X. The standard curve for siRNA was recorded in the range between 10 and 50 nM, while the standard curve for mRNA was recorded in the range between 0.05 and 0.5 µg / ml. Specific example for analysis of liposomes containing 2 µM siRNA (prepared according to example 1): 3 replicates of the sample (1.5 µl) were diluted to 50 µl using Tris-HCl buffer (10 mM, 1 mM EDTA, pH 7.5), another 3 replicates were diluted to 45 µl with Tris-HCl buffer, and addition of 5 µl of a 10% triton solution in RNase free water. The standard curve samples were prepared from an siRNA aliquot with fitting volumes with the same procedure. The Quant-it™ RiboGreen RNA Reagent was warmed to room temperature and diluted 200-fold in Tris-HCl buffer.50 µl of this solution were added to each well. The fluorescence intensity was measured using a Perkin Elmer Envision plate reader using a 492 nm excitation and a 535 nm emission filter. The gain was adjusted for each measurement. Data analysis: The fluorescence intensity was plotted against the RNA concentration for the standard curves with and without triton and analyzed using the software R employing a weighted linear fit. The concentration (c(RNA)) and subsequently molar amount of RNA (n(RNA)) for each well was calculated based on the extracted slope and intercept of the relevant standard curve and averaged for each condition. RNA content compared to theoretical RNA content in percentage was quantified as follows: RNA loss to theoretical content is calculated as follows: nwith triton is the molar amount detected in the triton treated sample, which equals the total RNA content of the sample, and ntheoretical is the theoretical molar amount of the triton treated sample, based on the input. Encapsulation is as follows: GAR-P04383WO55 Application (final).docx nwith triton is the molar amount detected in the triton treated sample, which equals the total RNA content of the sample after liposome lysis, and nwithout triton is the molar amount detected in the untreated sample, which equals the RNA content outside the liposomes. The molar concentration of the original sample (c(RNA)) was calculated by dividing the average molar amount per well of the triton treated sample by the original sample volume VSample . This value was used as the concentration of the sample for subsequent transfections. Change in concentration between two measurements (e.g. at a later timepoint) in percentage is calculated as follows: "Measurement 1" is the original measurement, "measurement 2" is the one at a later timepoint. Results: siRNA encapsulation and content of extruded siRNA liposomes Ribogreen assay shows successful binding of siRNA and average encapsulation efficiency of 97.0 ± 0.83 % at charge ratio N / P 20:1 (positive / negative) for liposomes containing siRNA prepared by extrusion according to the protocol of example 1 (n=12, error: SEM) (Fig.2d). Average siRNA content loss due to extrusion for samples made according to the protocol in example 1 was 14.5 ± 2.21 % (n=12, error: SEM) (Fig.2e). siRNA encapsulation and content of extruded siRNA liposomes – stability over time siRNA encapsulation efficiency of extruded liposomes made according to example 1 was unchanged after 9 months, 1.6 and 2.4 years of storage at 4°C (Fig. 2i).Also, siRNA concentration of these samples was not reduced after prolonged storage, even after 2.4 years at 4°C. (Fig.2j). siRNA encapsulation of liposomes at different N / P ratios siRNA liposomes prepared at charge ratio N / P 5:1 showed an average encapsulation efficiency of 93%, which is close to full encapsulation that can be GAR-P04383WO55 Application (final).docx seen at N / P ratio 20:1 (Fig. 2k). By extension any N / P ratio in between or above should also lead to high encapsulation. siRNA encapsulation and content of extruded mRNA liposomes For mRNA-liposomes made according to protocol in example 3 at charge ratio 6:1 (positive / negative) around 40% of total mRNA was encapsulated while the rest was detected on the outside of the liposomes (Fig.5a). Example 8 – Cryogenic electron microscopy (EM) Description of method: Grids preparation and plunge-freezing For cryo electron microscopy aquoeous samples are cooled to cryogenic temperatures to preserve the sample in the most native state in vitreous ice by plunge freezing.. Samples are spread into a thin film across an EM grid before rapidly submerging it in a cryogen, e.g. liquid ethane. A Lacey Carbon Supported Copper Grid (200 mesh) was glow-discharged for 12 s before insertion in the chamber of a plunge freezer EM GP2EM (Leica). eGFP siRNA containing liposomes of composition LP1 prepared according to the protocol detailed in example 1 were diluted to a total lipid concentration of 400 µM in 20 mM TRIS, 150 mM NaCl. 3 μl of this sample and 1 μl of 10 nm of gold nanoparticles suspension (BBI Solutions, EM.GC10) were added to the grid just before blotting. The plunge-freezing parameters were set to 30 °C, 99% humidity. Blotting was done on the sample-side of the grid for 1.4 s, and immediately followed by plunging in liquid ethane at -180°C. Frozen grids were preserved in liquid nitrogen. Cryo-electron imaging Transmission Electron Microscopy was done on a Titan Halo 300 kV FEG-TEM (FEI, Hillsboro, Oregon, USA) equipped with a field emission gun and an energy filter BioQuantum Model 967 from Gatan (Gatan, Pleasanton, California, USA). The images were zero loss filtered with a slit width of 20 eV and taken on a Gatan K2 summit direct detector in the counted mode. The program DigitalMicrograph (Gatan) was used to control the energy filter and the K2 detector. Images were taken with the program SerialEM (Mastronarde, D.N., Automated electron microscope tomography using robust prediction of specimen movements. J. Struct. Biol. (2005) 152, 36–51) at a resolution of 3710 x 3838 pixels at a magnification resulting in a pixel size of 0.31 nm. The beam intensity was set between 6 and 10 electrons per pixel per second and the overall dose per image was adjusted to the range 50 - 100 electrons per Square-Ångstrom. Instead of a GAR-P04383WO55 Application (final).docx single image, twenty sub frames were taken with frame times between 0.1 s and 0.25 s and aligned using K2 align software, which is based on the MotionCorr algorithm, to compensate for any drift. The sample was in a Gatan 626 Cryoholder, cooled by liquid nitrogen without counter-heating so that the final sample temperature was constant and always below -165 °C. Results: CryoEM imaging shows that liposomal structure is unilamellar and univesicular (Fig. 2a). This means that the liposomes are composed of a single membrane layer around an aqueous core, making it possible for them to fuse with other membranes such as the endosomal membrane. They are in a diameter size range around 100 nm, in accordance with the data obtained by dynamic light scattering (Fig.2c). Their morphology in solution is spherical. Example 9 – conventional electron microscopy Description of method: For siRNA-liposomes, a sample (0.5 µl) of extruded liposomes of composition LP1 containing eGFP siRNA (prepared according to protocol detailed in example 1) was diluted 10x with water and 5 µl of the solution were incubated for 3 min on a non-carbon coated and not glow-discharged, copper, square 400-mesh grid (Plano G2400C), coated with formvar film. For mRNA liposomes, a sample of liposomes of composition LP1 (prepared according to protocol detailed in example 2) (1 µl) was mixed mRNA solution (100 µg / ml, 1,83 µl) at charge ratio 3:1 and incubated for 15 min at room temperature (according to protocol detailed in example 3). The solution was diluted to 10 µl with 5% Glucose and incubated for 5 min at room temperature.5 µl of the solution were incubated for 5 min on a non-carbon coated and not glow-discharged, copper, square 400-mesh grid (Plano G2400C), coated with formvar film. The grid was washed on 3 drops of water for 5 s per drop. For the first staining step, the grid was incubated on a drop of 1% sodium tungstate (Electron Microscopy Sciences 21400) in water for 2 min, followed by washing on 3 drops of water, 1 s per drop. For the second staining step, the grid was incubated with 0.1% uranyl formate (Electron Microscopy Sciences 22450) in 1.8% methyl cellulose (pH 4.5, Sigma Aldrich M6385) on 3 consecutive drops, on ice, for a total of 2 min. The grid was lifted from the last drop using a nichrome wire loop, excess uranyl formate / methyl cellulose solution was removed using a filter paper, and the grid was air dried at room temperature. The protocol was adapted from Asadi et al., 2017 (Asadi, J. et al. Enhanced imaging of lipid rich nanoparticles embedded GAR-P04383WO55 Application (final).docx in methylcellulose films for transmission electron microscopy using mixtures of heavy metals. Micron 99, 40–48 (2017)). The grid was imaged at 13,000x magnification in a Tecnai T12 transmission electron microscope (FEI, now Thermo Fisher Scientific), operated at 100 kV and equipped with an axial 2k CCD camera (TVIPS) and EM-MENU software (TVIPS). Results: Size and morphology of siRNA containing liposomes Conventional electron microscopy (EM) imaging showed the size distribution and morphology of extruded liposomes containing siRNA in fixed state (Fig. 2b). During the fixation in methyl cellulose liposomes collapse onto themselves which results in a folded or donut shape. This is in accordance with literature examples of particles containing an aqueous core. Their size distribution is in accordance with data in solution obtained by dynamic light scattering (Fig.2c). Size and morphology of mRNA containing liposomes Conventional EM imaging showed the size distribution and morphology of extruded liposomes containing mRNA at charge ratio 3:1 in fixed state (Fig.5b). EM grids were prepared directly after mixing mRNA and liposomes for 15 min (preparation of mRNA containing liposomes according to protocol described in example 3). Extruded liposomes with mRNA appear to be smaller than liposomes with siRNA when embedded in methyl cellulose (Comparison Figs. 2b and 5b, Figs.2c and 5c). Example 10 – RNase degradation assay Description of method: A 4% (w / w) suspension of NuSieve GTG agarose (FMC Bioproducts (now Lonza), 50082) in Tris-borate-EDTA buffer (TBE, 89 mM TRIS base, 89 mM boric acid, 2 mM EDTA in RNAse free water (ThermoFisher Scientific, AM9938)) was prepared. After soaking for 15 min, it was heated in a microwave at 360 W for 1 min, then kept for 15 min in a 60 °C water bath. Ethidium bromide (1 µl) was added to 27 ml of this molten solution and it was cast into a gel cast with a comb. The gel was left to set at room temperature and covered with TBE buffer afterwards. Samples were prepared using eGFP siRNA (c= 1.85 µM, volume (V)= 7.5 µl) or siRNA-containing, extruded liposomes of composition LP1 made by the protocol detailed in example 1 (c (siRNA)= 1.73 uM, V= 7.5 µl). The siRNA or liposome solutions and RNase A (Sigma Aldrich, R6513) stock in TBE buffer (c=0.01 mg / ml) were incubated at 37 °C for 5 min. RNase A stock solution (V= 1 µl) was added to GAR-P04383WO55 Application (final).docx each sample to reach a final concentration 0.001 mg / ml and followed by addition of RNase inhibitor RNaseOUTTM(ThermoFisher Scientific, 10777019, 40 U / µl, V= 1.25 µl) after the indicated time of incubation (0-60 min, 9 time points) to stop the reaction. After treatment the samples were incubated for 2 min at 37 °C, then a 10% triton X solution (V= 1 µl) was added to each sample to lyse the liposomes. After 3 min incubation at room temperature, Orange G / bromophenol blue loading buffer (0.15% (w / v) Orange G, 0.03% (w / v) bromophenol blue in glycerol / TBE buffer (3:2), V= 2 µl) was added and 10 µl of this solution was loaded into the gel pockets. The gel was run with 80 V for 20 min using an Amersham Pharmacia Biotech Electrophoresis Power Supply EPS 301. Imaging and data analysis: The gels were imaged using a Vilber Bio-Vision Gel Doc system with transillumination at 312 nm and an exposure of 440 ms. The images were analyzed with Fiji by creating an intensity plot for each lane with the gels submenu and calculating the area under the curve for the RNA band. The amount of RNA present in each sample relative to the starting point of the kinetic experiment was calculated by normalizing the area under the curve obtained to the one obtained for t= 0 min. Results: siRNA formulated in liposomes resulted in being protected from degradation by RNase A over time, in stark contrast to naked siRNA which was degraded within minutes at the same RNase concentration (Fig.2f, g). Example 11 – uptake of liposomes containing labeled siRNA in HeLa cells Description of method: HeLa cells stably expressing eGFP were obtained as described by Bramsen, J.B. et al. 2009 (Bramsen, J.B. et al., A large-scale chemical modification screen identifies design rules to generate siRNAs with high activity, high stability and low toxicity. Nucleic Acids Res. 37, 2867–2881 (2009)). Liposomes containing Alexa 647 labeled eGFP siRNA made by the protocol described in example 1 were transfected in HeLa eGFP cells to assess their uptake. HeLa eGFP cells were cultured in DMEM media complemented with 10% FBS at 37 °C and 5% CO2 and seeded the day before the transfection into a black 384 well cell culture microplate (Greiner 781092) in DMEM medium with 10% FBS and 50 µg / ml gentamicin. The transfection mixes were prepared in a 96 well master plate: the liposomes were diluted to 12x the final siRNA concentration (i.e. 120 GAR-P04383WO55 Application (final).docx nM) in 5% glucose. Untreated control samples were prepared using only buffer. Directly before transfection, equal volume of DMEM containing 20% FBS was added to each transfection mix to have a concentration of siRNA of 6x the final concentration of the transfection and 10% FBS.10 µl of this transfection mix was added to each well of the 384 well plate containing 50 µl of medium, resulting in a final concentration of 10 nM. Each condition was tested in quadruplicate. The plate was incubated at 37 °C and 5% CO2. After 5 h the plate was fixed with 3.7% formaldehyde in PBS for 15 min. After additional washing with PBS each well was stained with 6 µg / ml Hoechst 33342 and 0.5 µg / ml HCS CellMask™ Blue Stain (Invitrogen, H32720) in PBS containing 0.04% sodium azide. Every treatment was performed in quadruplicate. Imaging and data analysis: The plate was imaged at 40x magnification on a Yokogawa CellVoyager CV7000 automated laser spinning disk microscope.4 fields per well were imaged. Images were adjusted and exported with MotionTracking (http: / / motiontracking.mpi- cbg.de). Results: Alexa 647-labeled siRNA in liposomes is taken up by HeLa cells and shows a specific vesicular pattern as expected for uptake by endocytosis (Fig. 3a). No Alexa 647 uptake can be seen in untreated cells. Example 12 – transfection of HeLa eGFP cells with siRNA containing liposomes Description of method: Liposomes made by the protocol described in example 1 containing eGFP siRNA or AF647 labeled eGFP siRNA were transfected in HeLa eGFP cells to assess downregulation efficiency. The following description is for a dose response experiment with concentration points taken at 10, 5, 2.5 and 1 nM. This can be adjusted to use different concentrations, more or less points if necessary. HeLa eGFP cells (obtained as described in Bramsen, J. B. et al. (2009)) were cultured in DMEM media complemented with 10% FBS at 37°C and 5% CO2 and seeded the day before the transfection into a black 384 well cell culture microplate (Greiner 781092) in DMEM medium with 10% FBS and 50 µg / ml gentamicin. The transfection mixes were prepared in a 96 well master plate: the liposomes were diluted to 10x the concentration of the highest concentration point (100 nM) in the GAR-P04383WO55 Application (final).docx "preparation" buffer (e.g. 5% glucose). Serial dilution was performed to obtain solutions at 10x concentration for the other concentration points. Untreated control samples were prepared using only buffer. Directly before transfection, equal volume of DMEM containing 20% FBS was added to each transfection mix to have a concentration of siRNA of 5x the final concentration of the transfection and 10% FBS. 10 µl of this transfection mix was added to each well of the 384 well plate containing 40 µl of medium. Each condition was tested in quadruplicate. The plate was incubated at 37°C and 5% CO2. After 5 h, the transfection mix was washed away by replacing the medium three times with fresh DMEM and aspirating to 25 µl with a Biotek EL406 washer. Afterwards, 25 µl of DMEM containing 20% FBS and 100 µg / ml gentamicin was added. The plate was further incubated for 72 h and then fixed with 3.7% formaldehyde in PBS for 15 min. After additional washing with PBS each well was stained with 1 µg / ml DAPI (Sigma Aldrich, D9542-5MG) and 0.25 µg / ml HCS CellMask™ Blue Stain (Invitrogen, H32720) in PBS containing 0.04% sodium azide. Every treatment was performed in quadruplicate. Imaging and data analysis: The plate was imaged at 10x magnification on a Perkin Elmer Operetta high throughput microplate imager or a Yokogawa CellVoyager CV7000 automated laser spinning disk microscope.9 fields per well were imaged. The nuclei and cells were segmented based on the DAPI / CMB staining and the mean GFP intensity for each nucleus was recorded. The nuclei number in percentage was calculated as follows: The number of nuclei per image was summed up per well and then averaged per condition. This value was normalized to the value calculated in the same way from the untreated control wells. The GFP intensity in percentage was calculated as follows: Median of the mean GFP intensity per nucleus or per cell was calculated per image, averaged per well and averaged per condition. This value was normalized to the value calculated in the same way from the untreated control wells. The analysis was conducted using Perkin Elmer Harmony software or CellProfiler for segmentation and parameter extraction and Knime Analytics platform for averaging and normalization. The calculation for the single cell distribution plot of percentage GFP intensity was performed as follows: GAR-P04383WO55 Application (final).docx The mean GFP intensity per nucleus was normalized to the median value of GFP intensity per nucleus of the untreated condition. The percentage was rounded up to the next integer number for each nucleus. For each condition (treatment, concentration) the occurrence of nuclei for each GFP intensity value was counted per well and then averaged over the quadruplicate repeats. The difference in normalized GFP intensity and nuclei number for different N / P ratios was calculated as follows: The GFP intensity or nuclei number in percentage for a specific N / P ratio at a specific concentration was calculated as above. Then the value of N / P ratio 20:1 at this concentration was subtracted the initial value. EC50 / TC50 calculation EC50 and TC50 values for 4 and 10 concentration datasets were calculated by fitting a 4-parameter logistic equation to the GFP intensity and nuclei number normalized to untreated control in response to siRNA concentration respectively. Calculations were done using Knime Analytics platform. The lower limit was constrained to 100%, while the lower limit was left unconstraint for GFP intensity and set to 0 for Nuclei number. Fits were scored as non-applicable if the lower limit was estimated to be above 40% or below -10%. The therapeutic index is defined as the ratio between TC50 and EC50, as previously described in section "Therapeutic agents". Scoring Calculated based on result at dose 10 nM, if not stated otherwise. Toxicity scoring: Score Nuclei number normalized to untreated - > 80% † 60-80% †† 40-60% ††† 20-40% †††† < 20% Effect scoring to distinguish between non-working preparations (following toxicity or no effect) and low-working preparations (knock down (KD) effect visible, but fitting not possible): (Normalized GFP intensity) / (Normalized Nuclei Score number) GAR-P04383WO55 Application (final).docx KD < 0.8 no KD > 0.8 Results: siRNA downregulation with liposomes The treatment of HeLa eGFP cells with 10 nM eGFP siRNA in LP1 liposomes caused 80% downregulation of eGFP intensity compared to untreated control, while treatment with the same concentration of naked siRNA showed no effect (Fig 3b). Dependence of siRNA downregulation efficiency of liposomes on both active agents To show that the functionality of the invention depends on the specific combination of the active agents as contained in the inventive liposome composition, i.e. on the combination of a fusogenic agent with an acid-cleavable PEG lipid, liposomes were prepared in which each of the active agents was replaced with a non-active form and compared with those comprising both active agents. The eGFP siRNA- liposomes were prepared according to the protocol in example 1. The non- fusogenic liposome sample was prepared by replacing the fusogenic agent LBPA in the composition LP1 with the non-fusogenic lipid DOPC. The non-acid cleavable sample was prepared by replacing the acid-cleavable PEG lipid in the composition LP1 with the non-acid cleavable PEG lipid DSPE-PEG2000. The downregulation of eGFP in HeLa eGFP cells transfected with formulations without active agents or comprising only one active agent was compared to the formulation containing both active agents (LP1). The downregulation effect was only successful if both active agents were present. Indeed compositions comprising only the non-fusogenic lipid or only the non-acid cleavable lipid as active agent did not show any eGFP downregulation (Fig. 3c). These results show that both active agents in the liposomal system have a surprising synergistic effect on inducing endosomal escape and efficient siRNA delivery. Dose dependence of eGFP downregulation with siRNA-liposomes (four concentrations) Testing the effect of liposomes containing siRNA against eGFP made by the protocol detailed in example 1 at different siRNA concentrations (10, 5, 2.5 and 0.5 nM) showed that the downregulation effect was dose dependent (Fig. 3d). A single cell analysis of distribution of mean GFP intensity per nucleus in the dose dependent experiment (Fig 3e) showed that the untreated control has a very wide GAR-P04383WO55 Application (final).docx distribution of mean eGFP intensities per nucleus. A clear, dose-dependent shift is visible with eGFP siRNA-liposome treatment, culminating in a narrow distribution around 20% of the median of the untreated condition at 10 nM dose. This indicates that GFP downregulation is achieved in the majority of treated cells. Dose dependence of siRNA downregulation with liposomes containing different LBPA isomers siRNA-LP1 liposomes containing one of the main isomer forms of LBPA, 2,2’-S,S and 3,3’-S,S, were prepared according to the protocol in Example 1. These liposome compositions showed same dose response in eGFP downregulation (Fig.3f) and same low toxicity response (Fig.3g). The EC50 for downregulation (determined from four point curve) was very similar: 2,2’-S,S-LBPA containing liposomes showed EC50 2.34 ± 0.18 nM, 3,3’-S,S-LBPA containing liposomes showed EC502.50 ± 0.35 nM. Effectiveness of delivery system does not depend on a specific LBPA isomer. Dose dependency of GFP downregulation with siRNA liposomes (10 concentrations) To explore the dose dependency of siRNA-mediated downregulation with liposomes of composition LP1 made by the protocol detailed in example 1 in greater detail, a dose response curve with 10 concentration points was explored. This allows for a more exact calculation of the effect (EC50) and toxic (TC50) concentration (Fig. 3h). By fitting a four-parameter log-logistics model, these values were calculated as being EC50: 0.93 nM, and TC50: 19.44 nM. Therefore, therapeutic index (TC50 / EC50): 21. Reproducibility of dose dependent siRNA mediated downregulation with liposomes siRNA mediated downregulation at four concentrations using liposomes of composition LP1 containing 2,2’-LBPA as fusogenic agent prepared according to the protocol detailed in example 1 was shown to be reproducible over a large number of repeated experiments (Fig.3i). The toxicity profile was reproducible as well (Fig.3j). Effect of liposome storage on siRNA mediated downregulation. Extruded siRNA liposomes of composition LP1 prepared according to the protocol detailed in example 1 were tested for downregulation efficiency at four concentrations directly after formation as well as after 9 months, 1.6 and 2.4 years of storage at 4°C. The downregulation profile resulted in a similar curve showing GAR-P04383WO55 Application (final).docx that liposomes with siRNA are stable over years without losing efficiency of downregulation (Fig.3k). Stability of siRNA containing liposomes towards serum Transfection is often done in serum free conditions to increase success rates. In contrast, all the experiments herein were performed within serum presence to be closer to in vivo conditions. Therefore, to check the stability of siRNA liposomes towards serum exposure, LP1 liposomes prepared according to the protocol detailed in example 1 were pretreated with serum for 5 h at room temperature. Their dose-dependent siRNA downregulation and toxicity was compared with a sample of the same liposome batch that was not pretreated with serum (Fig.3l). No difference in downregulation efficiency (eGFP intensity) or toxicity profile (number of nuclei) could be observed indicating that downregulation efficiency of siRNA in liposomes is stable towards prolonged serum exposition (Fig.3l). Example 13 – Variation of chemical composition of the identified siRNA delivery system Different compositional variations of eGFP siRNA-containing liposomes made by the protocol detailed in example 1 were prepared and tested for their downregulation efficiency and toxicity in HeLa eGFP cells at different siRNA concentrations according to experimental procedure described in example 12. In vitro parameters (size, stability, encapsulation and siRNA content) were analyzed for each liposome composition variation with the techniques detailed in examples 6 and 7. Results from the different compositions are detailed in the following paragraphs. 1. Stoichiometry variation The percentage of each compound in the composition LP1 was varied resulting in 20 different liposome composition variations. Each of these liposome compositions was tested at 4 siRNA concentrations (Table 2, Fig. 7b, only 10 nM siRNA dose shown). Effective compositions were identified by the GFP downregulation assay in HeLa eGFP cells as having the following percentage ranges for each component: DOTAP: 30-75% Cholesterol: 0-35% LBPA: 15-30% or 45% for cholesterol = 0% Labile PEG lipid: 1-10% GAR-P04383WO55 Application (final).docx 2. Variation of helper lipid The helper lipid cholesterol in formulation LP1 was replaced with similar compounds or delivery enhancers, which structures are shown in the section "Chemical Structures" (identified by the protocol detailed in example 25) generating 14 liposome composition variations. Each of these liposome variations was tested for knock down of eGFP in HeLa eGFP cells at 4 siRNA concentrations (table 3). The three compounds solasodine, ceramide, and diosgenin showed a similar effect as cholesterol in this composition (Fig.7c). 3. LBPA isomer and isoform variation 6 LBPA isoforms and four structurally similar molecules were explored in the formulation LP1 (table 4). The resulting liposome composition variations were tested in HeLa eGFP cells at 4 siRNA concentrations each. Several LBPA isomers show a similar activity: in addition to 2,2’-S,S and 3,3’-S,S isomers (Fig.3f,g) five more isomers or isoforms were showing a similar effect (3,3’-R,S, 3,3’-R,R, 2,2’- S,S with 18:0 or 12:0 fatty acids and hemi-LBPA (3 fatty acids)) (Fig.7d). 4. Encapsulating agent variation PD740 was tested as encapsulating agent. PD740 (N-[3-(Hexadecan-1- sulfonylamino)propionyl]-4-(S)-(aminoethyl)-L -prolyl-S-farnesyl-L - cysteinmethylester) has been first synthetized by Biel et al. 2006 as a single isomer (Biel et al. Synthesis and Evaluation of Acyl Protein Thioesterase 1 (APT1) Inhibitors. Chem. Eur. J.2006, 12, 4121 - 4143). It was tested by Gilleron et al. for siRNA transfection and identified as a delivery enhancer (Gilleron, J. et al. Identification of siRNA delivery enhancers by a chemical library screen. Nucleic Acids Res.2015, 43, 7984–8001). PD740 was custom synthetized to prepare the inventive liposomes, obtaining PD740 as mixture of isomers of different ratios, which all had the same effect, so that the particular isomer ratio has not influence on the liposome drug delivery efficiency. DOTAP in formulation LP1 was replaced with 12 different cationic agents or ionizable lipids, and the resulting liposome compositions were tested in HeLa cells at 4 siRNA concentrations (Table 5). One drug binding agent, PD740 showed increased activity at lower concentration (composition LP2 (see Table 1)) (Fig. 7e). Two other cationic lipids, DOMA and DOTMA, showed a similar activity profile as DOTAP (Fig. 7e). Another cationic lipid, EPC 18:1, shows downregulation activity, but at a lower EC50. GAR-P04383WO55 Application (final).docx Variation of PD740 percentage As liposomes with PD740 were identified as being more active than those with DOTAP as a encapsulating agent in the same composition, different variations of LP2 composition were explored using varying percentages of PD740 and mixtures of PD740 and DOTAP.9 liposome composition variations were tested using HeLa eGFP knock down assay at 4 siRNA concentrations (Table 6, Fig. 7f, 7g). The composition LP3 containing equal amounts of PD740 and DOTAP showed an even higher effect than composition LP2 (Fig.7f). The composition LP4 containing a lower amount of PD740 showed a similar efficiency profile as composition LP2, while exhibiting a decreased toxicity effect (Fig.7f,g). The most effective compositions LP1, LP2, LP3 and LP4 were further explored with a 10-concentration dose response experiment using lower siRNA concentrations to be able to extract both EC50 and TC50 values with higher accuracy (Table 7). Composition LP3 was confirmed as the most effective, while composition LP4 was slightly less effective, but showed lower toxicity (Fig. 7h,i) confirming the results of Fig.7f,g. Variation of N / P ratio All previous data were obtained with liposomes containing siRNA at an N / P ratio of 20:1. To explore the scope of possible N / P ratios for the delivery system, liposome formulations of composition LP1 containing siRNA against eGFP were also prepared at charge ratios 40:1, 10:1 and 5:1. The encapsulation of siRNA was 93% at N / P 5:1 (see example 7 and Fig. 2k), leading to the conclusion that any higher charge ratio will lead to an encapsulation above this value, close to 100%. eGFP downregulation with these liposomes was tested at 4 concentrations in HeLa eGFP cells. The GFP intensity and nuclei number were calculated as difference to the same formulation at N / P ratio 20:1 by subtracting the value for the N / P = 20:1 control formulation from the one obtained at the same concentration for the specific formulation in the same experiment. This leads to negative values if the percentage was lower and positive values if it was higher. At concentration 10 nM all N / P ratios showed a similar downregulation result. At lower concentrations the 5:1 formulation was less effective, while the 40:1 is more effective. At the lowest concentration tested (1 nM) the downregulation result was again close to within error for all ratios tested (Fig. 7j). The toxicity of all preparations is within error for all N / P ratios tested (Fig.7k). Screening of potential fusogenic agents To show that other fusogenic agents than LBPA can be used to reach the same effect, LBPA in siRNA containing liposomes of composition LP3 was replaced with GAR-P04383WO55 Application (final).docx different fusogenic agents. The 14 resulting liposome variations were tested each at 10 siRNA concentrations for their GFP downregulation efficiency and toxicity in HeLa eGFP cells (Table 8). The compounds used were identified from literature as either being fusogenic or being lipids that prefer hexagonal or cubic phase packing. Liposome variations with MGDG and PLPE showed the same efficiency in downregulation as those with LBPA (Fig. 8a). Liposomes containing PLPE showed a similar toxicity profile as LP3 composition with LBPA, while liposomes containing MGDG were less toxic (Fig.8b). Liposomes containing GMO, IsostA, and POPE showed an activity comparable to composition LP1 (Fig. 8c), with higher or comparable toxicity (Fig.8d). These results show that other compounds can be used as fusogenic agents for the developed delivery system. Combination of different fusogenic agents with LBPA in the same composition Four liposome composition variations of LP3 containing both LBPA and an additional active fusogenic agent were tested at 10 siRNA concentrations in HeLa eGFP (Table 9). The downregulation efficiency of liposome compositions with MGDG and PLPE was comparable to LP3, while compositions with GMO and isostearic acid were lower in efficiency (Fig.8e). All compositions tested show a similar toxicity profile (Fig. 8f). These results suggest that the effect in HeLa cannot be boosted by a fusogenic agent combination, but is also not decreased. Example 14 – uptake of liposomes containing labeled siRNA in primary bone marrow derived mouse macrophages Description of method: Murine Macrophage Purification from Bone Marrow Homogeneous population of quiescent murine monocytes were derived from bone marrow protocol to seed them in 38 multi well plates (Greiner 781092). Briefly, femurs and tibia from C57Bl6 mouse strain were extracted from the mouse after euthanasia following cervical dislocation. The bones were mechanically cleaned from contaminating tissues and resuspended in cold PBS. Samples were transferred to a sterile laminar flow hood for extraction of bone marrow and purification of the relevant cell type. Always working on ice, the cleaned bones were cut at both ends using a surgical scalpel. Using a 10 cc syringe with a 25 Gauge needle filled with 3 ml of cold PBS, the bone marrow was flushed in an empty 50 ml tube (Corning, 430829) until the cavity of the bone resulted empty. The process was repeated with each available bone, and at the end the cell suspension was disaggregated by continuous pipetting using a 5 ml pipette (Sarstedt, 86.1253.001). The cell suspension was GAR-P04383WO55 Application (final).docx passed through a wet 40 micron sieve (Falcon, 352340) to filter out big tissue clumps, and the filter was washed with cold PBS. The tube was centrifuged at 300xg for 10 minutes on a tabletop centrifuge (Beckman Coultr, Allegra X-22R), and after the centrifugation the supernatant was removed and the cellular pellet was resuspended in PBS, 0.5%BSA, 2mM EDTA. The viable cell number of the complex mixture was determined using the Luna2 automated cell counter. A volume containing a total of 5x107cells was then transferred to an empty 15 ml tube and the cell suspension was centrifuged at 300xg for 10 minutes, after which the supernatant was completely aspirated, being careful not to disrupt the cell pellet, which was then resuspended in 350 microliters of PBS, 0.5% BSA, 2mM EDTA. A Mouse Monocyte isolation kit (Miltenyi, 130- 091-153) was used to purify the monocytes: 25 microliters of FCR Blocking reagent was added to the cell suspension, followed by addition of 50 microliters of Monocyte-Biotin antibody cocktail. The suspension was then incubated for 5 minutes on ice, after which 10 ml of cold PBS, 0.5%BSA, 2mM EDTA was added to the mix. Suspension was then centrifuged at 300xg for 10 minutes, supernatant was discarded and the pellet was again resuspended in 400 µl of PBS, 0.5% BSA, 2mM EDTA. 100 µl of AntiBiotin Cocktail solution was added to the suspension and incubated for 10 minutes on ice. During this incubation, LS columns (Miltenyi Biotec, 130-042-401) were assembled on a MACS magnetic stand (Miltenyi Biotec, 130-042-303) and rinsed with 3 ml of cold PBS, 0.5% BSA, 2 mM EDTA to drip in an empty beaker. Upon the end of the drip, the beaker was substituted with an empty 15 ml falcon tube on ice. Cell suspension was applied to the column, and the column was washed 3 times with 3 ml of PBS, 0.5% BSA, 2 mM EDTA collecting the flow through. This cell suspension was again centrifuged at 300xg, supernatant discarded and pellet resuspended in 2 ml of PBS, 0.5% BSA, 2 mM EDTA. After evaluation of cell number using the LUNA2 automated cell counter, an appropriate number of cells were resuspended in DMEM / F12 (Gibco, 21331-020), 10% FBS (GE Healthcare, A15-102), 50 µg / ml of Gentamicin and 10 ng / ml of macrophage colony-stimulating factor MCSF (Peprotech, 315-02-100UG) to differentiate the monocytes into mouse macrophages (MM): typically MM cells were seeded and cultured at 37 °C and 5% CO2 in 384 well format , using 15,000 cells per well, in 50 microliters of medium. Assessment of uptake of liposomes LP1-liposomes containing Alexa 647 labeled siRNA made by the protocol described in example 1 were transfected in MM in 384 well format to assess their GAR-P04383WO55 Application (final).docx uptake. Prior to transfection, MM were cultured for at least 5 days in DMEM / F12 10% FBS, 50 µg / ml of gentamicin, 10 ng / ml of MCSF into a black 384 well cell culture microplate (Greiner 781092). The transfection mixes were prepared in a 96 well master plate: the liposomes were diluted to 10x the siRNA concentration of the final concentration (5 nM) in 5% glucose. Untreated control samples were prepared using only buffer. Directly before transfection, equal volume of DMEM containing 20% FBS was added to each transfection mix to have a concentration of siRNA of 5x the final concentration for the transfection and 10% FBS.10 µl of this transfection mix was added to each well of the 384 well plate containing 40 µl of medium, resulting in a final concentration of 5 nM. Each condition was typically tested in quadruplicate. The plate was cultured at 37 °C and 5% CO2. After 5 h the plate was washed with PBS using the automated PowerWasher cell washer (TECAN) and fixed with 3.7% formaldehyde in PBS for 15 min. After additional washing with PBS each well was stained with 1 µg / ml DAPI (SIGMA, D9542-5MG) and 0.25 µg / ml HCS CellMask™ Blue Stain (Invitrogen, H32720) in PBS containing 0.02% sodium azide. Every treatment was performed in quadruplicate. Imaging and data analysis: The plate was imaged at 40x magnification on a Yokogawa CellVoyager CV7000 automated laser spinning disk microscope.4 fields per well were imaged. Images were adjusted and exported with MotionTracking (http: / / motiontracking.mpi- cbg.de). Results: MM were incubated with Alexa 647-labeled siRNA formulated in LP1-liposomes. Internalization of labelled siRNA visualized by confocal microscopy yielded a specific vesicular pattern as expected for uptake by endocytosis (Fig. 4a). No aspecific signal could be seen in the 647 channel in untreated cells. Example 15 – transfection of bone marrow derived macrophages from LifeAct eGFP mice with siRNA containing liposomes Description of method Isolation of primary cells Primary mouse macrophages (MM) cells were isolated from a mouse strain expressing the LifeAct reporter: the procedure for isolations and differentiation is as described in example14. The transfections were routinely made in 384 well formats, using 15,000 cells per well. GAR-P04383WO55 Application (final).docx Transfection Liposomes containing eGFP siRNA or A647 labeled eGFP siRNAmade by the protocol described in example 1 were transfected in MM from LifeAct reporter mouse to assess eGFP downregulation efficiency. The following description is for a dose response experiment with concentration points taken at 20, 10, 5, 1 and 0.1 nM. This can be adjusted to use different concentrations, more or less points if necessary. The transfection mixes were prepared in a 96 well master plate: the liposomes were diluted to 10x the concentration of the highest concentration point (100 nM) in the same buffer used for liposome preparation(e.g. 5% glucose). A serial dilution was performed using automated multichannel pipettes (Eppendorf) to obtain solutions at 10x concentration for the other concentration points. Untreated control samples were prepared using only buffer. Directly before transfection, equal volume of DMEM / F12 containing 20% FBS and 20 ng / ml of MCSF was added to each transfection mix to have a concentration of siRNA of 5x the final concentration of the transfection and 10% FBS.10 µl of this transfection mix was added to each well of the 384 well plate containing 40 µl of medium. Each condition was tested in quadruplicate. The plate was further cultured for 72 h and then fixed with 3.7% formaldehyde in PBS for 15 min. After additional washing with PBS each well was stained with 1 µg / ml DAPI and 0.25 µg / ml HCS CellMask™ Blue Stain in PBS containing 0.02% sodium azide. Every treatment was performed in quadruplicate. Imaging and data analysis was performed as described in Example 12, except that 9 fields per well were recorded with the Perkin Elmer Operetta high throughput microplate imager and 4 fields per well, sufficient to cover >90% of the well, were recorded with the Yokogawa Cell Voyager CV7000 automated laser spinning disk microscope. EC50 / TC50 calculation EC50 and TC50 values for 4 and 10 siRNA concentration datasets were calculated by fitting a 4-parameter logistic equation to the GFP intensity and nuclei number normalized to untreated control in response to siRNA concentration as described in example 12. For the 4 and 10 concentration datasets in macrophages only the GFP intensity data could be fitted, as mainly non-toxic concentrations were explored. Scoring Scoring of toxicity and effect was done as described in example 12. GAR-P04383WO55 Application (final).docx Results: siRNA downregulation with liposomes MM isolated from a LifeAct-eGFP reporter mouse were incubated with various eGFP siRNA concentrations (1-20 nM) formulated in LP1 liposomes made according to protocol in example 1 for 5 hours. Downregulation of eGFP was determined by confocal microscopy imaging and quantitative image analysis as described above. Downregulation of eGFP intensity compared to untreated control increase in response to siRNA concentration, reaching value of 70% eGFP downregulation at of 20 nM, while no evident effect on cell viability as determined by the number of nuclei was detected (Fig 4c). Dose dependency of siRNA downregulation with liposomes (10 concentrations) To explore the dose dependency of siRNA downregulation with liposomes of composition LP1 made by the protocol detailed in example 1 in greater detail, a dose response curve with 10 concentration points was conducted. This allowed for a more exact calculation of the effect and toxic concentration (Fig.4d). By fitting a four-parameter log-logistics model, the half maximal effective concentration (EC50) was calculated to be 6.37 nM. It was not possible to calculate the half maximal toxic concentration from this experiment as the fitting was not applicable. Toxicity would need to be explored at higher concentrations. Reproducibility of dose dependent GFP downregulation and toxicity profile mediated by siRNA in liposomes Downregulation by siRNA at four concentrations in liposomes of composition LP1 containing 3,3’-LBPA as the fusogenic agent and prepared according to the protocol detailed in example 1 was shown to be reproducible over a large number of repeated experiments (Fig. 4e). The toxicity profile was reproducible as well (Fig.4f). Example 16 – Variation of chemical composition of the identified siRNA delivery system in MM 20 liposome composition variations of initial compositions LP1 and LP3 previously tested on HeLa cells (datasets from tables 7-9, using PD740 and DOTAP as encapsulating agents, and other potential fusogenic compounds to replace LBPA or in combination with LBPA) were tested on bone-marrow derived macrophages from LifeAct eGFP mice at 10 concentrations to compare efficiency profiles (Tables 10, 11, 12). The different composition variations of eGFP siRNA- containing liposomes were made by the protocol detailed in example 1 and tested GAR-P04383WO55 Application (final).docx for their downregulation efficiency and toxicity in HeLa eGFP cells at different siRNA concentrations prior to testing on macrophages (example 13). In vitro parameters (size, stability, encapsulation and siRNA content) were analyzed for each liposome variation with the techniques detailed in examples 6 and 7. Results obtained with the different liposome compositions are detailed in the following paragraphs. Encapsulating agent variation Similar as in HeLa cells, composition LP3 showed a higher downregulation (KD) efficiency and statistically significant lower EC50 than formulation LP1. The difference between the values is not as pronounced as in HeLa cells. Formulation LP4 is significantly less active in macrophages than in HeLa (Fig.9a, Table 10). Generalization of fusogenic agent concept Replacement of LBPA in formulation LP3 with different fusogenic agents leads to a different downregulation efficiency in macrophages. Compositions with MGDG and PLPE that showed similar activity as LP3 with LBPA for HeLa transfection showed reduced activity compared to LP3 or no activity in mouse macrophages. Compositions with POPE, which in HeLa showed a reduced activity compared to LP3, showed a similar effect as LP3 in macrophages (Fig.9 b, Table 11). Combination of different fusogenic agents with LBPA in the same composition In contrast to the result in HeLa, combinations of LBPA with an additional fusogenic agent within LP3 formulation had increased downregulation activity compared to LP3 (containing only LBPA) as showed by a significantly lower EC50 (Fig.9c, Table 12). Conclusion: The efficiency of different compositions resulted to be cell type specific. Composition LP3 showed increased GFPdownregulation efficiency in response to siRNA compared to LP1 in macrophages, but different fusogenic agents showed a different effect in macrophages compared to HeLa cells. A combination of LBPA with an additional fusogenic agent can boost the efficiency of LP3 in macrophages, but not in HeLa cells. Example 17 – transfection of primary hepatocytes from LifeAct eGFP mice with siRNA containing liposomes Description of method GAR-P04383WO55 Application (final).docx Hepatocyte isolation Primary mouse hepatocytes were isolated from LifeAct eGFP mice via collagenase perfusion using a previously described protocol. Mice were anaesthetized using i.p. injection with Ketamin:Rompun (1.6:1) and fixed unto a sterile surface. The abdominal wall was opened to expose the organs and intestine and fat tissue are moved to expose the venae cavae and the hepatic portal vein. A needle (20G x 1 ½’’, 0.9x40 mm, not sharpt) attached to a peristaltic pump was inserted into the venae cavae, running with a flow rate of 10 ml / min, and the hepatic portal vein was cut to drain solutions. The liver was rinsed for 10 min with EGTA buffer (0.19 g / l EGTA, 0.04 M NaOH, 5.67 g / l glucose, 6.10 g / l NaCl, 0.18 g / l KCl, 0.16 g / l KH2PO4, 6.10 g / l HEPES, 0.07 g / l glutamine, 0.04 g / l L- alanine, 0.02 g / l L-aspartic acid, 0.06 g / l asparagine, 0.04 g / l citrulline, 0.02 g / l L- cysteine, 0.15 g / l L-histidine, 0.15 g / l L-glutamic acid, 0.15 g / l glycine, 0.06 g / l L- isoleucine, 0.12 g / l L-leucine, 0.20 g / l L-lysine, 0.08 g / l L-methionine, 0.10 g / l L- ornithine, 0.08 g / l L-phenylalanine, 0.08 g / l L-proline, 0.10 g / l L-serine, 0.20 g / l L- threonine, 0.10 g / l L-tryptophan, 0.08 g / l L-tyrosine, 0.12 g / l L-valine). The solution was switched to collagenase (0.35 g / l collagenase (1-2.5 U / ml) in collagenase buffer (5.46 g / l glucose, 5.87 g / l NaCl, 0.17 g / l KCl, 0.16 g / l KH2PO4, 5.87 g / l HEPES, 0.07 g / l glutamine, 0.74 g / l CaCl2, 0.04 g / l L-alanine, 0.02 g / l L-aspartic acid, 0.06 g / l asparagine, 0.04 g / l citrulline, 0.02 g / l L-cysteine, 0.15 g / l L-histidine, 0.15 g / l L-glutamic acid, 0.15 g / l glycine, 0.06 g / l L-isoleucine, 0.12 g / l L-leucine, 0.20 g / l L-lysine, 0.08 g / l L-methionine, 0.10 g / l L-ornithine, 0.08 g / l L- phenylalanine, 0.08 g / l L-proline, 0.10 g / l L-serine, 0.20 g / l L-threonine, 0.10 g / l L- tryptophan, 0.08 g / l L-tyrosine, 0.12 g / l L-valine)) and perfused for 8 min. After the perfusion the liver was removed from the animal and put into 15 ml suspension buffer (5.63 g / l glucose, 6.05 g / l NaCl, 0.18 g / l KCl, 0.16 g / l KH2PO4, 6.05 g / l HEPES, 0.07 g / l glutamine, 0.15 g / l CaCl2, 0.10 g / l MgSO4, 0.04 g / l L-alanine, 0.02 g / l L-aspartic acid, 0.06 g / l asparagine, 0.04 g / l citrulline, 0.02 g / l L-cysteine, 0.15 g / l L-histidine, 0.15 g / l L-glutamic acid, 0.15 g / l glycine, 0.06 g / l L-isoleucine, 0.12 g / l L-leucine, 0.20 g / l L-lysine, 0.08 g / l L-methionine, 0.10 g / l L-ornithine, 0.08 g / l L-phenylalanine, 0.08 g / l L-proline, 0.10 g / l L-serine, 0.20 g / l L-threonine, 0.10 g / l L-tryptophan, 0.08 g / l L-tyrosine, 0.12 g / l L-valine). Hepatocytes were extracted from the liver tissue using forceps. The cell suspension was filtered though a cell strainer (100µm pore size) and diluted to 50 ml with suspension buffer. The cells were pelleted by centrifugation at 4 °C with 50xg for 5 ml and the pellet was washed with 50 ml suspension buffer and recentrifuged before being resuspended in 10 ml suspension buffer by gentle inversion. GAR-P04383WO55 Application (final).docx Hepatocyte plating Cells were plated into 96 well plates (Greiner 655090) precoated with collagen using a previously published protocol. Rat tail collagen (10 mg, Roche 11179179001) was dissolved in sterile 0.2% acetic acid (10 ml) and incubated at 4 °C for at least 6 h, this solution was diluted to a concentration of 0.9 mg / ml in 10x DMEM and the pH was adjusted to 7.4. The collagen bottom layer was added to the wells by adding 25 µl of this solution and letting it polymerize at 37°C for 1h before adding 150 µl Williams E medium (Pan Biotech P04-29150), substituted with 10% FBS (Pan Biotech P40-37500), 100 nM dexamethasone (Sigma D4902- 500MG) and penicillin / streptomycin (Gibco 15140-122). The medium was removed and replaced by cell solution containing 30,000 cells per well. Cells were incubated for 1,5 h at 37°C in an atmosphere with 5% CO2 atmosphere for attachment, washed two times with PBS and 90 µl Williams E medium was added. Hepatocyte transfection siRNA liposomes of composition LP1 containing eGFP siRNA prepared to protocol described in example 1 were diluted to 10x the desired concentration for transfection in a master plate and 10 µl of this solution was added to each well. The plate was incubated for 5 h, washed with PBS and a second collagen layer was added on top by adding 50 µl of 0.6 mg / ml collagen solution. The plate was incubated for 1 h at 37 °C before 150 µl of Williams E medium was added on top. The plate was incubated for 3 d at 37 °C and the medium was replaced with fresh medium each day. For fixation medium is removed and 100 µl of 3.7% formaldehyde solution is added and incubated at room temperature for 15 min. The plate is washed three times with PBS and stained with 1 µg / ml DAPI (SIGMA, D9542-5MG) and 0.5 µg / ml HCS CellMask™ Blue Stain (Invitrogen, H32720) in PBS containing 0.02% sodium azide. Imaging and data analysis: The plate was imaged with 10x magnification on a Yokogawa CellVoyager CV7000 automated laser spinning disk microscope (6 fields per well). The cell area was masked based on the DAPI / CMB staining and the total GFP intensity normalized by masked area for each image was analyzed. The GFP intensity in percentage was calculated as follows: The mean GFP intensity per well was averaged per condition. This value was normalized to the value calculated the same way from the untreated control wells. The analysis was conducted using MotionTracking software (http: / / motiontracking.mpi-cbg.de, Collinet, C. et al., Systems survey of GAR-P04383WO55 Application (final).docx endocytosis by multiparametric image analysis. Nature 464, 243–249 (2010)) for segmentation, parameter extraction, averaging and normalization. Results: Primary hepatocytes isolated from a LifeAct-eGFP reporter mouse were incubated with various concentrations (0.1-20 nM) of siRNA against eGFP formulated in liposomes of composition LP1 made according to protocol in example 1 for 5 hours. Downregulation of eGFP was determined by confocal microscopy imaging and quantitative image analysis as previously described (Fig. 4g). Increasing concentrations of liposome-siRNA caused up to 97% downregulation of eGFP intensity compared to untreated control, while it had limited effect on cell viability as determined by the number of nuclei (Fig 4h). Example 18 – transfection of HeLa cells with mRNA containing liposomes Description of method Liposomes were made by the protocol described in example 3 containing an mRNA coding for eGFP fluorescent reporter (TriLink Biotechnologies, L-7201) and were used to transfect HeLa cells, (Accession: CVCL_1922, https: / / www.cellosaurus.org / CVCL_1922) (2000 cells / well in a 384 well plate). to assess the ability to induce expression of the fluorescent reporter, as monitored by automated microscopy. The cells were plated and cultured as in example 12. The following description is for a dose response experiment with concentration points ranging from 1.25 µg / ml to 0.039 µg / ml This can be adjusted to use different concentrations, more or less points if necessary. Liposomes containing mRNA were prepared (e.g. 5% glucose) at the highest concentration necessary for transfection as described in example 3 using a lipid to mRNA ratio of 6:1. Serial dilution was performed using automated multichannel pipettes (Eppendorf) to obtain solutions at 10x concentration for the other concentration points. Untreated control samples were prepared using only buffer. Directly before transfection, equal volume of DMEM containing 20% FBS was added to each transfection mix to have a concentration of mRNA of 5x the final concentration of the transfection and 10% FBS.10 µl of this transfection mix was added to each well of the 384 well plate containing 40 µl of medium. Each condition was tested in quadruplicate. The plate was further cultured for 24 hours and then fixed with 3.7% formaldehyde for 15 min. After additional washing with PBS each well was stained with 1 µg / ml DAPI and 0.25 µg / ml HCS CellMask™ Blue Stain in PBS containing 0.02% sodium azide. Every treatment was performed in quadruplicate. GAR-P04383WO55 Application (final).docx Imaging and data analysis: The plate was imaged with 10x magnification on a Yokogawa CellVoyager CV7000 automated laser spinning disk microscope.4 fields per well were imaged. The nuclei and cells were segmented based on the DAPI / CMB staining and the mean GFP intensity for each nucleus was recorded. The total cell number in percentage was calculated as follows: The number of nuclei per image was summed up per well and then averaged per condition. This value was normalized to the value calculated the same way from the untreated control wells and multiplied by 100. The GFP intensity was calculated as follows: Median of the mean GFP intensity per nucleus or per cell was calculated per image, averaged per well and averaged per condition. Additionally, the number of cells expressing GFP was calculated from single cell data, utilizing a threshold evaluated on the comparison of the distribution of the value of the mean intensity of eGFP in the untreated cells and cells transfected with the eGFP mRNA. The threshold was chosen in order to exclude false positives due to cell autofluorescence: cells having values of mean eGFP fluorescence above that threshold were considered as GFP positive, while cells below were considered GFP negative. For each well, the number of cells that were evaluated as positives was counted and the percentage of GFP expressing cells was evaluated calculating the ratio of these positive cells and the total number of cells per condition, and multiplying it by 100. The analysis was conducted using CellProfiler for segmentation and parameter extraction and Knime Analytics platform for averaging and normalization. Results: Liposomes of composition LP1 carrying eGFP mRNA can induce eGFP expression in HeLa cells at a low charge ratio of 6:1 (positive / negative) in a dose- dependent manner within 24 h. Over 90% of all cells were GFP positive by using liposomes with eGFP mRNA at a dose of 0.31 µg / ml without toxicity (Fig.5d, e). A similar result can be obtained at a charge ratio of 3:1 (Fig.5f). Comparing a wider range of N / P ratios ranging between 1:1 and 20:1 showed that similar number of cells can be transfected at the same concentration with any ratio above 3:1 (Fig. 5h), the highest eGFP expression at the same concentration can be reached with 3:1 ratio. Both the lower and higher ratios show lower expression (Fig. 5g). Toxicity for all N / P ratios above 3:1 was similar and is lower for the less effective N / P ratio 1:1 (Fig.5i). GAR-P04383WO55 Application (final).docx Exploration of chemical space of the identified delivery system for mRNA delivery Different liposomal compositions were tested for their transfection efficiency of mRNA in HeLa cells and compared with the initial composition LP1. Compositions containing varying amounts of solasodine showed a similar response in terms of total cell number expressing eGFP at a specific mRNA concentration (Fig. 12a). In terms of eGFP intensity, solasodine containing compositions show slightly increased expression levels in one out of three experiments (Fig.12b). Compositions LP3 and LP4 (the most effective compositions for siRNA delivery in HeLa cells and primary macrophages (see figure 7h, 7i and 9a; Tables 7 and 10)) did not result to be the most effective for mRNA delivery. mRNA containing LP3 showed a similar effect as mRNA containing LP1, while mRNA containing LP4 was much less effective (Fig. 12c,d). Both showed higher toxicity at concentrations 0.3125 and 0.625 µg / ml compared to LP1 (Fig.12e). Compositions with MGDG and PLPE (combining PD740, DOTAP and MGDG / PLPE as fusogenic agents) were among the most effective compositions for siRNA delivery and GFP downregulation in HeLa and primary macrophages (see Fig.8e,f and 9b, Tables 8 and 11). For mRNA delivery in HeLa cells they showed a response at much lower concentration than the original composition LP1, reaching most cells already at the lowest concentration tested (Fig.12f). GFP expression intensity was also increased at the lowest concentration (Fig 12g). Toxicity levels were within the error range of the treatment with LP1 and not as pronounced as for treatment with LP3 (same formulation except LBPA as fusogenic agent) (Fig. 12h). These compositions were also tested at lower concentrations to see full dose response curve. These experiments confirmed that by using LP-MGDG and LP-PLPE compositions for mRNA delivery more cells were reached and GFP expression was higher at lower concentrations of mRNA compared to composition LP1 (Fig.12i,j). Example 19 – transfection of primary bone marrow derived mouse macrophages with mRNA containing liposomes Description of method Isolation of primary cells Primary MM cells were isolated from wild type C57Bl6 mouse strain. The procedure for isolations and differentiation is as described in example 14. The transfections were routinely made in 384 well formats, using 15,000 cells per well and 4 replicates for each condition GAR-P04383WO55 Application (final).docx Transfection Liposomes complexed with an mRNA coding for fluorescent reporter eGFP (as described in example 3) were transfected in MM to assess the ability to induce expression of the fluorescent reporter, which was monitored by automated microscopy. Transfection of MM cells with mRNA containing liposomes was performed as described in Example 18 for Hela cells. Imaging and data analysis was performed as described in Example 18. Results: eGFP expression in primary bone marrow-derived mouse macrophages after delivery of eGFP mRNA in liposomes at a charge ratio of 6:1 is dose-dependent with the majority of cells expressing eGFP at a dose of 1.25 µg / ml after 24 h without toxic effects (Fig.5j,k). ). Liposome mRNA complexes at a charge ratio of 3:1 also show downregulation, albeit with lower efficiency, reaching 60% of cells at a dose of 1.25 µg / ml and showing lower fluorescence intensity (Fig.5l). Example 20 – transfection of primary mouse hepatocytes with mRNA containing liposomes Description of method Hepatocyte isolation and plating Primary mouse hepatocytes were isolated from wild type C57Bl6 mice via collagenase perfusion and plated as described in example 17. Hepatocyte transfection Liposomes prepared as in example 2 were complexed with an mRNA coding for eGFP (as described in example 3) at ratio N / P 3:1 were transfected into hepatocytes to assess the ability to induce expression of the fluorescent reporter. The following description is for a dose response experiment with concentrations ranging from 2,5 to 0,3125 µg / ml. Liposome mRNA complexes were diluted to 10x the desired concentration for transfection in a master plate and 10 µl of this solution was added to each well of a 96-well plate containing 90 µl of cells in Williams E medium. The plate was incubated for 5 h, washed with PBS and a second collagen layer was added on top by adding 50 µl of 0.6 mg / ml collagen solution. The plate was incubated for 1 h at 37 °C before 150 µl of Williams E medium was added on top. The plate was incubated for 24 h at 37 °C before GAR-P04383WO55 Application (final).docx removing the medium and adding 100 µl of 3.7% formaldehyde solution for fixation. The plate was incubated at room temperature for 15 min. The plate was washed three times with PBS and stained with 1 µg / ml DAPI (SIGMA, D9542- 5MG) and 0,5 µg / ml HCS CellMask™ Blue Stain (Invitrogen, H32720) in PBS containing 0.02% sodium azide. Imaging and data analysis: The plate was imaged with 40x magnification on a Yokogawa CellVoyager CV7000 automated laser spinning disk microscope (9 fields per well). The cell area was masked based on the DAPI / CMB staining and the total GFP intensity normalized by masked area for each image was analyzed. The GFP intensity in percentage was calculated as follows: The mean GFP intensity per well was averaged per condition. The value was substracted with the mean GFP intensity calculated the same way for untreated conditions (background). The analysis was conducted using MotionTracking software (http: / / motiontracking.mpi-cbg.de) for segmentation, parameter extraction, averaging and normalization. Results: eGFP expression in primary hepatocytes could be generated using eGFP mRNA liposomes at N / P ratio 3:1 and was dose dependent (Fig.5m,n). Example 21 – transfection of HeLa eGFP cells with CRISPR Cas9 RNP containing liposomes Description of method Liposomes were complexed with CRISPR Cas9 ribonucleoprotein complex as described in example 5 and transfected in HeLa eGFP cells to assess their ability to induce sequence specific editing of eGFP: the functional result of the sequence specific gene editing would be the lack of eGFP expression, which is evaluated by automated microscopy. Complex Cas9 / guide formation The first step in the process is the preparation of the complex between the guide / tracer and a recombinant CAS9 protein. The recombinant Cas9 protein (https: / / www.uniprot.org / uniprotkb / Q99ZW2 / entry) was obtained from the Protein Expression, Purification and Characterization (PEPC) facility of the MPI-CBG, where the protein is available in aliquots of 10µl, at the concentration of 5 mg / ml. GAR-P04383WO55 Application (final).docx A custom designed guide sequence against eGFP (target sequence: GGAGCGCACCATCTTCTTCA, SEQ ID NO 5) and tracr RNA were purchased from IDT (Table 14) and are available as a 100 µM stock. A typical complexing reaction was performed in a total volume of 35 µL, mixing 3 µL of Cas9 protein, 32 µL of protein buffer (20 mM Hepes, pH 7.5, 150 mM KCl), 0.98 µL of GFP cr guide RNA and 0.98 µL of tracr RNA for 15 minutes at 37°C. The resulting concentration of the GFP cr guide RNA in the complexing solution is 2.8 µM. Transfection of liposome-RNP complex The ribonucleic protein complex (RNP) was then incubated with liposomes as in example 5. The transfection mixes were prepared in a 96 well master plate: the complexes were diluted to 10x the concentration of the highest concentration point (100 nM) of GFP cr guide RNA in the preparation buffer (e.g.5% glucose). The following description is for a dose response experiment with GFP cr guide RNA concentrations of 10, 5, 2.5, 1 and 0.1 nM. HeLa eGFP cells were cultured in DMEM media complemented with 10% FBS at 37 °C and 5% CO2 and seeded the day before the transfection into a black 384 well cell culture microplate (Greiner 781092) in DMEM medium with 10% FBS and 50 µg / ml gentamicin. Serial dilution of liposome composition and cell transfection were performed as described in Example 12. Imaging was performed using a Yokogawa CellVoyager CV7000 automated laser spinning disk microscope as described in Example 12, but imaging only 4 fields per well. Data analysis was performed using CellProfiler for segmentation and parameter extraction and Knime analytics platform for averaging and normalization as described in Example 12. Results: Using liposomes of composition LP1 loaded with Cas9 ribonucleoprotein with guide RNA mix containing GFP cr guide RNA and tracr RNA at charge ratio 9.10:1 downregulation of eGFP intensity to 20% of expression compared to untreated control is possible at 2.5 nM RNA concentration with low toxicity. Increased toxicity is observed at higher concentrations (Fig.6a). Lowering the charge ratio to 5,46:1 shows a similar result both for downregulation and toxicity response (Fig.6b,c). Example 22 – transfection of HeLa eGFP cells with guide RNA containing liposomes Description of method GAR-P04383WO55 Application (final).docx Liposomes made by the protocol described in example 4 were transfected in HeLa eGFP cells to assess their ability to induce sequence specific editing of eGFP: the functional result of the gene editing would be the lack of eGFP expression evaluated with automated microscopy. Differently from Example 21 the Cas9 protein is not delivered by the liposomes, but is independently delivered by infection of the Hela cells with a BACMAM virus containing an orf for it.The BACMAM virus was produced by the Protein Expression and Purification (PEPC) facility of the MPI-CBG. Guide complex formation The first step in the process is the preparation of the cr guide / tracr RNA complex as species of RNA to be transfected in cells infected with a BACMAM virus containing Cas9. A custom designed guide sequence against eGFP (GFP cr guide RNA, target sequence: GGAGCGCACCATCTTCTTCA) and tracr RNA were purchased from IDT and are available as a 100 µM stock. A typical complexing reaction was performed in a total volume of 30 µL, using 28.32 µL of 20 mM Hepes, pH 7.5, 150 mM KCl, 0.84 µL of GFP cr guide RNA and 0.84 µL of tracr RNA for 15 minutes at 37°C. The resulting concentration of the GFP cr guide RNA in the complexing solution is 2.8 µM. Transfection of guide RNA liposomes The guide RNA complex was then incubated with liposomes prepared by the protocol detailed in example 2 as described in example 4. The transfection mixes were prepared in a 96 well master plate: the complexes were diluted to 10x the concentration of the highest concentration point (100 nM) in the buffer that they were prepared in (e.g.5% glucose). For Cas9 expression HeLa eGFP cells were mixed with 0.71 µl of BACMAM virus solution per 1000 cells during seeding. Seeding, culture and transfection of Hela eGFP cells as well as imaging and data analysis were performed in Example 21. Results: After testing the delivery of the Cas9 protein and guide RNA mix together in form of the Cas9-guide RNA ribonucleoprotein complex (Example 21), this Example aims to determine the delivery of guide RNA mix alone into HeLa eGFP cells that were expressing the Cas9 protein. Cas9 protein was expressed in these cells prior to transfection using a BacMam system. GAR-P04383WO55 Application (final).docx Different liposome compositions were tested using a charge ratio of 8.45:1 which corresponds to the same amount of guide RNA mix as for the delivery of Cas9 RNP at charge ratio 9.10:1 (as used in Fig. 6a). Both isoforms of LBPA in composition LP1 showed similar activity for knock out of eGFP in response to RNA concentration. A similar level could also be reached using composition LP4, while replacing the encapsulating agent for EPC 18:1 resulted in a slightly lower efficiency (Fig.6d). Toxicity was comparable for both LBPA isoforms and EPC 18:1, while it was increased for composition LP4 (Fig. 6e). Toxicity is decreased compared to transfection of Cas9 RNP at the same concentration (see Fig.6 a). Using a lower charge ratio of 5.07:1 for transfection with guide RNA mix and liposomes of composition LP1 results in a similar dose response both for eGFP reduction as well as for toxicity (Fig.6f,g). Example 23 – Galectin recruitment Description of method Following method is to investigate the question if the liposomal delivery system causes endosomal damage by disrupting endosomal membranes during the escape process using galectin recruitment assay similar to a previous report. HeLa eGFP cells (Bramsen, J. B. et al., 2009) were cultured DMEM media complemented with 10% FBS at 37 °C and 5% CO2. The cells were seeded at the density of 600cells / 40ul / well into a black 384 well cell culture microplate (Greiner 781092) in DMEM medium with 10% FBS and 50 µg / ml gentamicin. GFP-Galectin 8 plasmid (Galectin 8 / LGALS8 cDNA ORF Clone, Human, C-GFPSpark® tag, SinoBiological HG10301-ACG) and lipofectamine 3000 were prepared in OptiMEM at 10x the final concentration and mixed in a 1:1 ratio via pipetting to reach 5x the final concentration. The transfection mix was incubated at room temperature for 15 min and 10 µl were added to each well of cells containing 40 µl total volume. The final concentrations were 10 ng / well for the Galectin plasmid and 0.1 µl / well for lipofectamine. The cells were incubated for 72h at 37 °C and 5% CO2 before being washed with BioTek EL406 washer using serum medium for 2 cycles. In each cycle, the medium was aspirated to 20 µl and 90 µl of medium was added. For final aspiration, the medium was aspirated to 40 µl. Stock solutions of the lysosomal permeating agent L-leucyl-L-leucine methyl ester (LLOMe) (final concentration of 2 mM) at 5x the final concentration in medium, liposomes prepared according to protocol detailed in example 1 at 5x the final concentration (5 nM) in Glucose solution with 10% FBS and glucose with 10% FBS without liposomes as a control were prepared in 96 well plate format. 10 µl of these GAR-P04383WO55 Application (final).docx solutions were added to cells containing 40 µl medium. The plate was incubated at 37 °C and 5% CO2 for 2h. Afterwards the plate was washed three times with PBS with a Tecan Microplate Power Washer PW384 and fixed with 3.7% formaldehyde in PBS for 10 min. After additional washing with PBS each well was stained with 1 µg / ml DAPI (SIGMA, D9542-5MG) and 0.25 µg / ml HCS CellMask™ Blue Stain (Invitrogen, H32720). Imaging and data analysis: The plates were imaged in Yokogawa CV7000 cell voyager automated laser spinning disk microscope at a magnification of 60x.12 fields were imaged per well. The resulting images were adjusted and exported with MotionTracking (http: / / motiontracking.mpi-cbg.de, Collinet, C. et al, 2010). Results: Galectins (soluble, cytosolic carbohydrate-binding proteins) are recruited to galactoside sugars on the luminal membrane of endosomes after damage, resulting in a punctuate aggregation pattern. This pattern is visible for release events with lipoplexed siRNA (lipofectamine 2000) and siRNA in lipid nanoparticles. GFP-tagged Gal-8 was expressed in HeLa cells and the galectin recruitment pattern was observed after treatment with the inventive liposomal delivery system compared to endosomal disruption agent L-Leucine methyl ester (LLOMe). No distinct pattern could be detected and liposome treated cells looked like untreated control (Fig.10a). This means that the escape of siRNA from endosomes with the liposomal system does not disturb the endosomal integrity and no part of the internal membrane is exposed to the cytosolic side. Example 24 – endosome bursting visualization Description of method Lipoplexes and liposomes containing fluorescently labelled siRNAs were incubated in HeLa eGFP cells to investigate siRNA escape mechanism, adapting a protocol that has previously been used to study lipoplexes and lipid nanoparticles (Wittrup, A. et al. Visualizing lipid-formulated siRNA release from endosomes and target gene knockdown. Nat. Biotechnol. 33, 870–876 (2015)). The following description is an experimental procedure for live cell fluorescence microscopy imaging of siRNA escape. HeLa eGFP cells (Bramsen, J. B. et al., 2009) were cultured DMEM media complemented with 10% FBS at 37 °C and 5% CO2 and seeded the day before the GAR-P04383WO55 Application (final).docx transfection into a black 384 well cell culture microplate (Greiner 781092) in DMEM medium with 10% FBS and 50 µg / ml gentamicin. On the day of transfection, eGFP siRNA labeled with Alexa Fluor 647 (5 µl, 1000 nM) was mixed with lipofectamine 2000 (4 µl) as reported previously to form siRNA lipoplex transfection mix (Wittrup, A. et al., 2015).5 µl of this transfection mix was added to the well containing cells in 45 µl of medium. Liposomes of composition LP1 containing A647 labeled eGFP siRNA were prepared as reported in example 1 and diluted to a working concentration of 250 nM (5x final concentration 50 nM). 10 µl of this transfection mix was added to the well containing cells in 40 µl of medium. Each transfection was done in triplicate. Imaging and data analysis: For live cell imaging, the plate was incubated at 37 °C and 5% CO2 in CV7000 cell voyager microscope imaging chamber. Imaging at a magnification of 60x was started immediately after adding the transfection mix to the respective well. All wells were imaged in the GFP channel (525 nm) first to confirm the location of the cells, then a time course measurement in the Alexa647 channel (676 nm) was started. For each timepoint a Z-stack of 14 planes spaced 0.7µm apart was acquired first with short exposure (25 ms) to capture the siRNA uptake, and then one image was taken in one plane with long exposure (250 ms) at low laser power to visualize a faint cytoplasmic stain of escaped siRNA Alexa 647. Each field was imaged for 5 min with timepoints taken at 6.4 s intervals. 6 fields per well were imaged. The resulting image datasets were analyzed with MotionTracking (http: / / motiontracking.mpi-cbg.de, Collinet, C. et al, 2010). For visualizing the cellular location a mask was put on top of the GFP image with a threshold of 120 to distinguish cells from background. The mask was exported. For each timepoint the short and long exposure images in the A647 channel were maximum projected. Individual images as well as videos were exported. Results: Lipoplexes such as lipofectamine 2000 show a typical release pattern of whole cell fluorescence when labeled cargo is used, while endosomal release by softer methods (which show effective gene downregulation using far lower concentrations) such as transfection with lipid nanoparticles does not show such pattern. Treatment with liposomes loaded with siRNA labeled with Alexa647 showed a vesicular staining pattern which is similar to those observed for LNPs, and different GAR-P04383WO55 Application (final).docx from the whole cell fluorescence pattern induced by lipofectamine treatment (Fig. 10b). Example 25 – enhancer screening by transfection of HeLa eGFP cells with cholesterol conjugated siRNA and small molecule enhancers Description of method HeLa eGFP cells were incubated with siRNAs conjugated with cholesterol and candidate enhancer compounds to assess their effect on downregulation efficiency mediated by cholesterol conjugated siRNAs. HeLa eGFP cells were cultured as described for Example 12. On the day of transfection, the test compounds and Chol-siRNA mixes were prepared in a 96 well format master plate. The compounds were diluted to 6x of the final concentration 36 or 42 µM, i.e. 6 µM for compounds 1-24, and 7 µM for compounds 25-32 in reduced serum medium, OptiMEM (ThermoFisher 31985070). Chol-siRNAs against eGFP was custom synthetized by Axolabs. Cholesterol was conjugated to the 3'-end of sense strand of the siRNA molecule by a short L-prolinol-N-6-hexanoyl aminocarbonyl (Structure on page 61). Chol- siRNA against eGFP (Axolabs, custom synthesis) was prepared at 6X (1200 nM) of the final concentration 200 nM in OptiMEM. The cell plates were washed with OptiMEM using Biotek EL406 washer for 2 cycles. In each cycle, the medium was aspirated to 20 µl and 90µL of OpiMEM was added. For final aspiration, the medium was aspirated to 50 µl.10 µl of preprepared master mixes of compounds and Chol-siRNA were added to each well of the 384 well plate containing 50 µl of OptiMEM. Each condition was tested in quadruplicate. The plate was incubated at 37 °C and 5% CO2. After 5 h, the compound and Chol-siRNA mixes were washed away from the cells by replacing the medium three times with fresh DMEM (80 µl) and aspirating to 25 µl with a Biotek EL406 washer. Afterwards, 25 µl of DMEM containing 20% FBS and 100 µg / ml gentamicin was added. The plate was further cultured for 72 h and then fixed with 3.7% formaldehyde in PBS for 10 min. After additional washing with PBS each well was stained with 1 µg / ml Hoechst 33324 and 0.5 µg / ml HCS CellMask™ Blue Stain (Invitrogen, H32720). Imaging and data analysis: The plate was imaged with 10x magnification on a Perkin Elmer Operetta high throughput microplate imager.9 fields per well were imaged. The nuclei and cells were segmented based on the Hoechst 33324 / CMB staining and the mean GFP intensity for each nucleus was recorded. GAR-P04383WO55 Application (final).docx The nuclei number in percentage and GFP intensity in percentage were calculated as described in Example 12. Results: In a screen of structural analogues of sterol-based compound E18 (Table 13), some sterols were identified to increase downregulation efficiency of Chol-siRNA at suboptimal concentration in HeLa eGFP cells (Fig.11a). Example 26 – enhancer dose response pattern with a fixed concentration of cholesterol-conjugated siRNA Description of method Compounds solasodine, solasodine acetate and diosgenin were identified as hits in the screening described in Example 25, and further characterized by determining their dose response in combination with 150 nM Chol-siRNA (Fig. 10d). HeLa eGFP cells were cultured as described in the previous example 12. On the day of transfection, the test compounds and Chol-siRNA mixes were prepared in a glass vial in a 96 well format master plate. The test compounds were diluted to 160 nM (4x the highest concentration of the final 18 concentrations (40, 32, 25.6, 20.5, 16.4, 13.1, 10.5, 8.4, 6.7, 5.4, 4.3, 3.4, 2.7, 2.2, 1.8, 1.4, 1.1, 0.9 µM) in reduced serum medium, OptiMEM. Chol-siRNA samples were prepared at 4x of the final concentration 150 nM in OptiMEM. The cell plates were washed with OptiMEM using Biotek EL406 washer for 2 cycles. In each cycle, the medium was aspirated till 20 µL and 90 µL of OptiMEM was added. For final aspiration, the medium was aspirated till 40 µl.10 µl of preprepared master mixes of compounds and Chol-siRNA were added to each well of the 384 well plate containing 40 µl of OptiMEM. Each condition was tested in quadruplicate. The plate was incubated at 37 °C and 5% CO2. After 5 h, the compound and Chol-siRNA mixes were washed away from the cells by replacing the medium three times with fresh DMEM (80 µl) and aspirating to 25 µl with a Biotek EL406 washer. Afterwards, 25 µl of DMEM containing 20% FBS and 100 µg / ml gentamicin was added. The plate was further cultured for 72 h and then fixed with 3.7% formaldehyde in PBS for 10 min. After additional washing with PBS each well was stained with 1 µg / ml DAPI (SIGMA, D9542-5MG) and 0.25 µg / ml HCS CellMask™ Blue Stain (Invitrogen, H32720). Imaging and data analysis were performed as described for Example 25, except that nuclei and cells were segmented based on the DAPI / CMB staining. GAR-P04383WO55 Application (final).docx Results: The dose response curve for eGFP downregulation by chol-siRNA combined with solasodine, or solasodine acetate or diosgenin is shown in Fig.11b. Compounds solasodine and diosgenin were tested as siRNA delivery enhancer in combination with the helper lipid cholesterol or as replacement of cholesterol in the inventive liposomal delivery system. Hela cells incubated with siRNA-liposomes comprising solasodine or diosgenin instead of cholesterol showed a similar downregulation pattern as those incubated with siRNA-liposomes comprising cholesterol (Fig.7c, example 13). Moreover, compositions LP-Solasodine2 and LP-Solasodine3 containing both solasodine and cholesterol showed a similar effect on expression pattern for mRNA containing liposomes (Fig.12a,b, example 18). Example 27 – liposome formation with NanoAssemblr Description of method Empty liposomes of composition LP1 were produced with a NanoAssemblr Ignite microfluidic system using NxGen cartridges. A lipid film of composition LP1 was produced according to the protocol detailed in example 1. The dried film was kept at vacuum for 1 h and stored at -20 °C before usage. The lipids were dissolved in ethanol at a final total lipid concentration of 12.5 mM. This solution was used as the organic phase in the NanoAssemblr setup. The aqueous phase was 10 mM TRIS, pH 7.4. These solutions were run at a flow rate ratio of 1:1 with a total flow rate of 10 ml / min. The total run volume was 0.95 ml, of which 0.3 ml were discarded as initial waste and 0.05 ml were discarded as final waste. The rest was collected as the sample and directly post-processed to remove residual ethanol. Post processing Dialysis 250 µl of the sample were diluted with 240 µl of TRIS buffer (10 mM, pH 7.4). They were dialyzed against 13.5 ml TRIS buffer (10 mM, pH 7.4) using a Slide-A- LyzerTMMINI dialysis device (10K MWCO, 0.5 ml, ThermoFisher 88401) for 2 h with orbital shaking at room temperature. The buffer was exchanged and the dialysis was continued for another 2 h under the same conditions before collecting the sample. Diafiltration 350 µl of the sample were diluted 40x with 13.65 ml TRIS buffer (10 mM, pH 7.4). The sample was sterile filtered through an Acrodisc® syringe filter (Supor® GAR-P04383WO55 Application (final).docx Membrane; 13mm, 0.2μm, PALL 4602). The solution was transferred into an Amicon® Ultra-15 centifugal filter unit (10K MWCO, Merck UFC901024D) and centrifuged with 2000 rcf at 20 °C for 65 min using a Heraeus Megafuge 1.0 R. The sample was collected. Quality control To compare this liposome production techniques with previous methods for manual production (Examples 1-5) the liposomes were analyzed with the same techniques as the previous ones. Their size was checked with dynamic light scattering as detailed in example 6. For lipid concentration quantification, a Chol- Glo assay was used to estimated cholesterol content (example 28). The efficiency was analyzed by combining these empty liposomes produced with the NanoAssemblr with mRNA the same way as detailed in example 3 and transfecting HeLa cells with them using the protocol described in example 18. This was compared to liposomes produced with extrusion as detailed in example 2. Results: To increase production of liposomes to a higher throughput it is desirable to move from a manual manufacturing protocol to an automated one. The method of choice is microfluidics, as employed for LNP production. Liposomes were produced by Precision NanoSystem’s NanoAssemblr Ignite microfluidic system.The working principle is to combine lipids in ethanol with an aqueous solution under controlled flow and geometrical conditions. Due to high content of ethanol a post-production step is needed. Ethanol can be removed either by dialysis or by diafiltration. Both methods were tested. Liposomes produced with microfluidics were mixed with eGFP mRNA as described in example 3 at an N / P ratio of 6:1. They were tested for dose response of eGFP expression in HeLa cells as described in example 18. They showed the same dose response for mRNA transfection in HeLa cells in terms of GFP positive cells independently from the post-production technique used as liposomes produced by extrusion (Fig.13a). The overall expression of GFP seemed to be a bit lower for liposomes where ethanol was removed by diafiltration, while dialysis- treated liposomes showed the same expression levels as extruded liposomes (Fig.13b). Size of liposomes made with the different described techniques was assessed by dynamic light scattering as described in example 6. Before post-processing, liposomes made by NanoAssemblr reached much smaller sizes than those produced by extrusion. The size increased during post-processing, but both GAR-P04383WO55 Application (final).docx treatments still yielded liposomes with a smaller size distribution than those manually produced by extrusion (Fig.13c). Example 28 – Lipid concentration quantification with Cholesterol-Glo assay Description of method The lipid concentration of liposomes without cargo was analyzed using the Cholesterol / Cholesterol Ester-GloTMassay from Promega (J3190), in which cholesterol from detergent lysed liposomes is metabolized enzymatically in combination with activation of luciferin production, which is then detected by luminescence of a luciferase reaction. The assay was performed in a white polystyrene Corning®96 Well Half-Area Microplate (Merck, CLS3696). Each sample was assayed in triplicate. The individual samples were compared to a four-point standard curve of pure cholesterol, in the range between 1 and 20 µM. The samples (liposomes produced by either of examples 1-5, 24) were aimed to have a final concentration of 7.5 µM. For a simultaneous test of 5 samples cholesterol detection reagent was prepared by mixing cholesterol detection solution (1550 µl) with reductase substrate solution (15 µl). This solution was kept at room temperature in the dark until further usage. 3 replicates of fitting volume of the sample or the standard curve points were pipetted into each well and diluted to 40 µl with Cholesterol lysis solution. The plate was briefly shaken by handed and incubated for 30 min at 37 °C. 40 µl of cholesterol detection reagent prepared before were added to each well, the plate was briefly shaken by hand and incubated at room temperature in the dark for 1 h. The luminescence was read with a Tecan Spark®20M multimode microplate reader. Data analysis The luminescence was plotted against the cholesterol concentration for the standard curve and analyzed using R employing a weighted linear fit. The cholesterol concentration for each well was calculated based on the extracted slope and intercept of the standard curve and averaged for each sample condition. The original cholesterol concentration of each sample was calculated using the input information (volumes). The concentration of the other lipids in the formulation was estimated based on the input ratio of compounds. Example 29 – transfection of HeLa dsGFP cells with siRNA containing liposomes Description of method GAR-P04383WO55 Application (final).docx In addition to the HeLa eGFP cell line used, we generated an additional cell line derived from HeLa cells, expressing a destabilized form of eGFP (dsGFP) with an in vivo half-life of ~1 hour which allows for determination of protein downregulation within a reduced timeframe: 16 hours against the usual 72 hr for HeLa eGFP. dsGFP is a fusion protein of eGFP with mouse ornithine decarboxylase which contains a proline-glutamate-serine-threonine-rich (PEST) amino acid sequence that targets the protein for degradation and thus results in rapid protein turnover.17Cell line generation The cell line has been generated by stable transfection of the pOCC447-pd1GFP DNA construct in HeLa cells. The transfection was performed in 6 well format (ThermoFisher, 140675) using 1 µg of DNA and FuGENE®6 (Promega, E2691) as a transfection reagent using manufacturer recommendation to have the optimal ratio of volume of FuGENE®6 to microgram of plasmid (3:1). Briefly, 100,000 cells were seeded in a well of 6 well plate in a volume of 2 ml of complete medium DMEM (ThermoFisher, 31966), 10% FBS (Merck, S0615) and incubated at 37°C overnight. Afterwards the medium was exchanged with 1900 microliters of complete medium. The transfection reaction was prepared by combining 1 µg of plasmid DNA and 3 µl of FUGENE for 15 minutes in 100 µl of OptiMEM (ThermoFisher, 11058). At the end of the incubation, the transfection mix (100 µl) was added to cells to reach a total volume of 2000 µl. After one day, the cell culture medium was changed to full medium containing 200 µg / ml of Geneticin (G418, ThermoFisher 10131035) and after another day G418 was raised to 400 µg / ml. The selection was kept until day 15, when mock transfected cells were completely dead, while the cells containing the plasmid were showing surviving clones, expressing dsGFP. Transfected cells surviving the antibiotic selection, were treated with trypsin (ThermoFisher, 25300-54) for 5 minutes to produce a monodisperse solution of cells which was subjected to FACS analysis to sort single expressing clones in each well of a 384 well plate (Greiner, 781092). The growth of the single clones was followed by fluorescence microscopy to finally identify clones having homogeneous expression of dsGFP and a growth comparable to the parental cell line. 10 clones were identified to follow these criteria, and where subsequently tested in experiments using siRNA against eGFP to finally identify a clone showing a good downregulation of the protein in response to siRNA used for downregulation with the HeLa eGFP line. GAR-P04383WO55 Application (final).docx Transfection with siRNA containing liposomes The cells were cultured and transfected as described in example 12, with the only difference that they were fixed 24 h after transfection, not 72 h after transfection. Imaging and Data Analysis Imaging and data analysis were conducted as described in example 12. Results: Comparison of eGFP downregulation in HeLa dsGFP cells with HeLa eGFP cells HeLa eGFP and HeLa dsGFP were transfected with the same batch of extruded liposomes of composition LP1 containing siRNA against eGFP. The downregulation response is the same at each concentration in both cell lines (Fig. 14a). The toxicity analyzed with the number of nuclei compared to untreated control is also within error and non-toxic over the whole concentration range (Fig. 14b). HeLa dsGFP can be used as a replacement of HeLa eGFP to increase experimental throughput due to shorter experiment time. Example 30 – Liposome storage at -80°C Description of method The robustness of liposomes towards freezing at -80 °C was tested. To asses this question, liposomes containing siRNA against eGFP produced by extrusion according to the protocol detailed in example 1 were stored overnight at -80 °C and compared to samples that were kept at 4 °C overnight. Liposomes of composition LP1 (6 µl) were either used in 5% glucose solution without further dilution or diluted with 2x cryoprotectant buffer (20 mM TRIS, 600 mM sucrose, pH 7.4) (6 µl). One sample of each was snap frozen in liquid nitrogen and transferred into a -80 °C freezer overnight. Another sample of each was kept at 4 °C overnight. Samples for size measurement by dynamic light scattering and transfection in HeLa cells expressing eGFP were taken. Samples for dynamic light scattering were prepared and measured as detailed in example 6. siRNA downregulation was tested by transfection of liposomes in HeLa dsGFP cells as described in example 29. Results: One of the main strategies to stabilize mRNA-containing particles and protect them from degradation for long-term storage is storage at low temperature (<- 70°C). Extruded liposomes containing siRNA produced by the protocol described in example 1 were tested for both size and functionality after storage at -80°C in GAR-P04383WO55 Application (final).docx different buffers. The buffer used for most of the shown experiments was 5% glucose solution. This was compared to a cryoprotectant buffer used by Pfizer for their COVID vaccine Comirnaty (10 mM TRIS, 300 mM sucrose, pH 7.4). The size of liposomes was assessed by dynamic light scattering as described in example 6 and compared after storage at 4°C and -80°C. Liposomes stored in cryoprotectant buffer at -80°C were slightly increased in size compared to overlapping size distributions of those stored in cryoprotectant buffer at 4°C and in 5% Glucose at both -80°C and 4°C (Fig.14c). siRNA downregulation in HeLa dsGFP cells was assessed for liposome samples stored in different buffers at different temperatures as described in example 29. Both dose response and toxicity were unchanged after low temperature storage; they were also independent of buffer choice (Fig.14d,e). Liposomes were stable towards freezing and storage at -80°C in the original buffer. Therefore, it can be concluded that inclusion of a cryoprotectant agent in the buffer is not needed. Example 31 Calculation of N / P ratio Preparation of 1 ml of a liposome solution of composition LP1 (encapsulating agent DOTAP) containing 2 µM eGFP siRNA with an N / P ratio of 20:1. From these parameters, the necessary amount of DOTAP is calculated as follows: N^=^20 Nphosphate^groups^per^oligonucleotide^=^42 (21 on each strand) n(negative^charges) =^n(eGFP^siRNA) *^Nphosphate^groups^per^oligonucleotide = 2 * 10-9mol * 42 = 8.4 * 10-8mol n(positive^charges)^=^20*^n(negative^charges) =^20 * 8.4 * 10-8mol =^ 1.68 * 10-6molNamino^groups^per^DOTAP^molecule = 1 n(DOTAP)^=^^^^^^^^^^n(positive^charges)^^^^^^^^^ =^^^^^^1.68 * 10-6mol^^=^1.68 * 10-6mol Namino^groups^per^DOTAP^molecule 1 GAR-P04383WO55 Application (final).docx The lipid film is prepared accordingly with the molar amount of DOTAP calculated. From the percentages of each individual other compound of the liposome composition, the molar amounts of each other component can be calculated. In case of the Cas9 ribonucleoprotein complex the number of negative charges is determined by the sum of charges present on the protein and both oligonucleotides. As the protein has a net positive charge, the number of negative charges is lower than the total number of phosphates present on the oligonucleotides. n(negative^charges) =^n^(phosphate^groups^on oligonucleotides) ^^^^^^^^^^^^^^^^^^^^^^- n^(net^charge^of^Cas9^protein) n^(net^charge^of^Cas9^protein)^=^n(Cas9)^*^Nnet^charge With n(x) being the molar amount of respective entity x, Nnet chargethe net charge of Cas9 protein being +22 as reported in literature (Zuris, J. A. et al.. Efficient delivery of genome-editing proteins in vitro and in vivo. Nat. Biotechnol.2015, 33, 73–80), Nphosphate groups on xthe number of phosphate groups present on the respective oligonucleotide Example 32 – Synthesis of 2,2’-LBPA, PEG2000-orthoester-C18, PD740. All reagents for the described syntheses were purchased from commercial sources (Sigma Aldrich / Merck, Roth, AppliChem, AcrosOrganics, Biozol, ChemImpex, AlfaAesar, TCI, Avanti Lipids (abbreviated as Avanti in the Tables)) and were used without further purification, except where noted. Dry solvents were purchased from Sigma Aldrich. All reactions were performed in oven-dried glassware, unless noted otherwise. Solvents for flash chromatography were obtained from VWR. Performance under inert gas atmosphere is indicated. Analytical thin layer chromatography (TLC) was performed on precoated silica plates (Merck, 60 F254). The TLC plates were visualized with UV light (254 or 366 nM) and by staining either with 3% phosphomolybdic acid in EtOH, 1% KMnO4 in water, 1.2% ninhydrin in EtOH containing 1.5% acetic acid or 2% formaldehyde in GAR-P04383WO55 Application (final).docx concentrated sulphuric acid. Preparative column chromatography was performed on 40-63 um silica gel (230-400 mesh) from VWR with a pressure of 1-1.5 bar. 1H and 13C NMR spectra were measured on a 400 MHz Bruker AscendTMNanobay spectrometer. NMR chemical shifts (δ) were recorded in ppm and coupling constants (J) were reported in Hz. Splitting patterns are designated as follows: s, singlet; d, doublet; t, triplet; q, quartett; m, multiplet; b, broad. 13C- NMR-spectra were broadband hydrogen decoupled. Mass spectra (ESI) were recorded using a QExactive instrument (Thermo Fisher Scientific) equipped with a robotic nanoflow ion source. FTMS spectra were acquired within the range of m / z 200-1200 with the target mass resolution of m / z 200=140000. The spectra were evaluated using the Xcalibur Qual Browser software. HPLC purification was performed on a Knauer HPLC (pump: AZURA P2.1S, UV / VIS detector: AZURA UVD 2.1S, Evaporative Light-Scattering Detector: SEDEX LT-ELSD Model 85LT). Synthesis of 2,2’-LBPA 2,2’-LBPA was synthesized according to literature protocols with slight modifications. 2 was synthesized according to Chen, et al., 1996, Synthesis of Photoactivatable 1,2-O-Diacyl-sn-glycerol Derivatives of 1-L-Phosphatidyl-D-myo- inositol 4,5-Bisphosphate (PtdInsP 2) and 3,4,5-Trisphosphate (PtdInsP 3)’, J. Org. Chem., 61(18), 6305–6312. Synthesis of compound 3 was conducted according Näser et al., 2005, Synthesis of 13C-labeled γ-hydroxybutyrates for EPR studies with 4-hydroxybutyryl-CoA dehydratase, Bioorganic Chemistry, 33(1), 53–66. The rest of the steps were conducted according to Jiang, G., et al., 2006, Practical Enantiospecific Syntheses of Lysobisphosphatidic Acid and Its Analogues, The Journal of Organic Chemistry, 71(3), 934–939. The final product was purified by gradient flash chromatography using precooled solvents to avoid isomerization. Ion exchanged was performed according to the protocol published in Jiang, G. et al. (2005) Concise synthesis of ether analogues of lysobisphosphatidic acid, Organic letters, 7(18), 3837–3840. MS m / z: 792.577 [M+NH4]+. 1H-NMR (400 MHz, CDCl3, 22 °C): δ = 0.88 (t, 6H, CH3), 1.20 – 1.38 (m, 40H, CH2), 1.51 – 1.64 (m, 4H, CH2CH2CO), 1.96 – 2.06 (m, 8H, CH2-CH=CH), 2.31 (t, 4H, CH2CO), 3.68 – 3.89 (m, 4H, 3,3’-CH2), 3.96 – 4.20 (m, 4H, 1,1’-CH2), 4.89 – 5.02 (m, 2H, 2,2’-CH), 5.30 – 5.40 (m , 4H, CH=CH). GAR-P04383WO55 Application (final).docx Synthesis of labile PEG lipid PEG2000-orthoester-C18 MeO-PEG2000-COOH Ethyl 2-(poly(ethylene glycol) methyl ether)acetate 9 GAR-P04383WO55 Application (final).docx Poly(ethylene glycol) methyl ether 8 (2.06 g, 1.03 mmol, 1.00 eq., average molecular weight ~2,000) was dissolved in dry THF (40 ml) under argon atmosphere and cooled to 0°C. Sodium hydride (0.25 g, 10.30 mmol, 10.00 eq.) was added in portions. The mixture was stirred at 0°C for 5 min. Ethylbromoacetate (0.86 ml, 1.29 g, 7.73 mmol, 7.50 eq.) was added and the mixture was warmed up to room temperature and stirred at room temperature for 2 d. The reaction was quenched with saturated ammonium chloride solution (15 ml) before removing the solvent under reduced pressure. The solution was diluted with dichloromethane (200 mL) and washed with brine (2x100 ml). The solvent was evaporated under reduced pressure. 2-(Poly(ethylene glycol) methyl ether)acetate 10 9 (0.46 g) was dissolved in THF (20 mL). Potassium hydroxide (0.31 g) in water (2 ml) was added. The mixture was stirred for 19 h at room temperature. THF was removed under reduced pressure. Water (40 ml) was added and the solution was acidified with hydrochloric acid (1 M in water, 7 ml). The product was extracted with DCM (3x40 ml). The organic solution was dried over sodium sulfate, filtered and the solvent was removed under reduced pressure. The crude product was purified by HPLC (Macherey-Nagel Nucleodur HTec, C18, VP 250 / 32, 20 µm, gradient: 0-52% B in 35 min, A= 10% acetonitrile in water, B= 90% acetonitrile in water, 20 ml / min). MS m / z: 1850.072 (C83H165O43, n=40), 1894.097 (C85H169O44, n=41), 1938.123 (C87H173O45, n=42), 1982.148 (C89H177O46, n=43), 2026.177 (C91H181O47, n=44), 2070.200 (C93H185O48, n=45), 2114.225 (C95H189O49, n=46), 2158.251 (C97H193O50, n=47), 2202.277 (C99H197O51, n=48), 2246.302 (C101H201O52, n=49), 2290.327 (C103H205O53, n=50) [M-H]-. 1H-NMR (400 MHz, CDCl3, 22 °C): δ = 3.38 (s, 3H, OMe), 3.44-3.86 (m, 190H, O- CH2-CH2-O), 4.16 (s, 2H, O-CH2-COOMe). PEG2000-orthoester-C18 PEG2000-orthoester-C18 was synthesized according to a literature procedure (Masson et al., 2004) with a slight modification in the last step using different coupling reagents. 1H-NMR (400 MHz, CD3CN, 22 °C): δ = 0.92 (t, 3H, CH3), 1.25 – 1.50 (m, 33H, 15x CH2, 1x CH3), 1.52 - 1.68 (m, 2H, CH2), 3.34 (s, 3H, OCH3), 3.38 – 3.83 (m, 193H, OCH2CH2O), 3.99 (s, 2H, OCH2), 4.27 (m, 2H, OCH2). GAR-P04383WO55 Application (final).docx Synthesis of PD740 PD740 was obtained by custom synthesis in collaboration with Chemveda Life Science Pvt. Ltd. according to previously published protocols (Biel, M. et al. (2006) Synthesis and evaluation of acyl protein thioesterase 1 (APT1) inhibitors, Chemistry - A European Journal, 12(15), 4121–4143) which were slightly modified. MS m / z: 839.574 [M+H]+. 1H-NMR (400 MHz, CDCl3, 22 °C): δ = 0.88 (t, 3H, SO2(CH2)16CH3), 1.25 (m, 24H, SO2(CH2)3(CH2)12CH3), 1.39 (m, 2H, SO2(CH2)2CH2(CH2)12CH3), 1.60 (s, 6H, 2x terminal farnesyl CH3), 1.67 (s, 6H, 2x internal farnesyl CH3), 1.76 (m, 4H, CH2CH2NH2and SO2CH2CH2(CH2)13CH3), 1.94 – 2.15 (m, 8H, internal farnesyl CH2), 2.22 – 2.55 (m, 3H, β-CH2and γ-CH Pro), 2.65 (m, 2H, α-CH2β-Ala), 2.73 – 3.30 (m, 9H, SO2CH2(CH2)14CH3, CH2NH2, farnesyl SCH2, β-CH2Cys, δ-CH2aPro), 3.39 (m, 2H, β-CH2β-Ala), 3.74 (s, 3H, OCH3), 3.92 (m, 1H, β-CH2bPro), 4.48 (m, 1H, α-CH Pro), 4.66 (m, 1H, α-CH Cys), 5.10 (m, 2H, 2x farnesyl CH), 5.20 (m, 1H, farnesyl SCH2CH=C). GAR-P04383WO55 Application (final).docx

[0011] GAR-P04383WO55 Application (final).docx Tables Table 1: Composition of most successful formulations Component Composition Encapsulating Helper Fusogenic Labile PEG Compound Name agent lipid Agent lipid ratio* LP1 DOTAP Chol LBPA PEGOEC18 50:25:20:5 LP2 PD740 Chol LBPA PEGOEC18 50:25:20:5 LP3 PD740,DOTAP Chol LBPA PEGOEC18 25:25:25:20:5 LP4 PD740 Chol LBPA PEGOEC18 33:33:27:7 LP- DOTAP Chol, LBPA PEGOEC18 50:15:15:15:5 Solasodine 2 Solasodine LP- DOTAP Chol, LBPA PEGOEC18 42:13:36:4:4 Solasodine 3 Solasodine LP-MGDG PD740, Chol MGDG PEGOEC18 25:25:25:20:5 DOTAP LP-PLPE PD740, Chol PLPE PEGOEC18 25:25:25:20:5 DOTAP *The compound ratio is reported for each compound in the same order as shown in the columns "Component", (also referred to as "Composition agent"). The compound ratio is calculated as (n(agent) / n(total) %), wherein "n" is the chemical amount in moles or molar concentration. In all tables, the symbol "," between two compounds means that both compounds are present to exert the function of that particular component, e.g as "encapsulating agent". PEGOEC18 is an abbreviation for "α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)- amido}-polyethylene glycol45" or α-methyl-ω-[2-[[2-methyl-2-(octadecyloxy)-1,3-dioxan-5- yl]amino]-2-oxoethoxy]- poly(oxy-1,2-ethanediyl)45 Table 2: Stoichiometric variation within composition LP1 - – compositions tested - HeLa Component Compound Encapsulating Helper Fusogenic Labile PEG varied agent lipid Agent lipid Compound ratio - DOTAP Chol LBPA PEGOEC18 50:25:20:5 DOTAP Chol LBPA PEGOEC18 12.5:37.5:25:20:5 DOTAP DOTAP Chol LBPA PEGOEC18 25:25:25:20:5 Cholesterol DOTAP - LBPA PEGOEC18 70:25:5 GAR-P04383WO55 Application (final).docx (Chol) DOTAP Chol LBPA PEGOEC18 60:15:20:5 DOTAP Chol LBPA PEGOEC18 40:35:20:5 DOTAP Chol DOPC PEGOEC18 50:25:20:5 DOTAP Chol - PEGOEC18 70:25:5 DOTAP Chol LBPA PEGOEC18 55:25:15:5 DOPC / PEGOEC18 DOTAP Chol LBPA 50:5:25:15:5 DOTAP Chol LBPA PEGOEC18 45:25:25:5 DOTAP Chol LBPA PEGOEC18 40:25:30:5 DOTAP Chol LBPA PEGOEC18 35:25:35:5 DOTAP - LBPA PEGOEC18 50:45:5 LBPA DOTAP Chol LBPA PEGOEC18 25:25:50:5 DOTAP Chol LBPA PEGOEC18 54:25:20:1 DOTAP Chol LBPA PEGOEC18 52.5:25:20:2.5 Labile PEG DOTAP Chol LBPA PEGOEC18 47.5:25:20:7.5 lipid DOTAP Chol LBPA PEGOEC18 45:25:20:10 Table 3: Helper lipid variation - – 4 concentration dose response – HeLa Composition Encapsulating PD740, PD740, agent DOTAP DOTAP DOTAP DOTAP Helper lipid Chol, Chol, amide Di Chol, Solasodine Cer osgenin Solasodine Fusogenic Agent LBPA LBPA LBPA LBPA Labile PEG lipid PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 Compound ratio 25:25:15: 25:25:15: 50:22.5: :5 50 2.5: 15:15:5 15:15 :25:20:5 20:5 EC50 Calculation EC50 (nM) 0.91 1.34 1.65 1.81 EC50 S.E. 0.23 0.2 0.24 0.82 EC50 model fitting app. app. app. app. n 2 2 2 1 Toxicity score †††† †††† †† - Eff. score no KD no KD KD KD Composition Encapsulating agent DOTAP DOTAP DOTAP DOTAP Helper lipid Solasodine Ceramide Chol, Chol, Solasodine Solasodine Fusogenic Agent LBPA LBPA LBPA LBPA Labile PEG lipid PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 Compound ratio 50:25:20:5 50:25:20:5 50:15:15: 50:20:5: 15:5 20:5 GAR-P04383WO55 Application (final).docx EC50 Calculation EC50 (nM) 1.95 1.96 2.11 2.32 EC50 S.E. 0.96 1.97 0.76 0.66 EC50 model fitting app. app. app. app. n 1 1 12 3 Toxicity score - - - - Eff. score KD KD KD KD Composition Encapsulating agent DOTAP DOTAP DOTAP DOTAP Chol, Helper lipid Chol Diosgenin, Chol, Sola DOPE Solasodine sodine Fusogenic Agent LBPA LBPA LBPA LBPA Labile PEG lipid PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 Compound ratio 50:25:20:5 50:10:10:5: 20:5 50:24:1: 20:5 50:25:20:5 EC50 Calculation EC50 (nM) 2.37 2.47 2.48 3.74 EC50 S.E. 0.9 0.7 2.89 0.78 EC50 model fitting app. app. n.a. n.a. n 28 1 1 2 Toxicity score - - - - Eff. score KD KD KD KD Composition Encapsulating agent DOTAP DOTAP Helper lipid DOPC Spingomyelin Fusogenic Agent LBPA LBPA Labile PEG lipid PEGOEC18 PEGOEC18 Compound ratio 50:25:20:5 50:25:20:5 EC50 Calculation EC50 (nM) 83.64 109.72 EC50 S.E. 396.41 484.86 EC50 model fitting n.a. n.a. n 1 1 Toxicity score - - Eff. score KD KD Abbreviations: S.E.: Standard Error; app.: applicable; n.a.: not applicable; n = repetition number; KD: knock down; PEGOEC18: PEG2000- orthoester-C18; composition: Compos.; Eff.= effect. GAR-P04383WO55 Application (final).docx Table 4: LBPA isoform variation – 4 concentration dose response – HeLa Composition Encapsulating DOTAP DOTAP DOTAP DOTAP DOTAP DOTAP agent Helper lipid Chol Chol Chol Chol Chol Chol Fusogenic 3,3'-R,S- LBPA 3,3'-R,R- S,S-2,2'- Hemi-LBPA S,S-2,2'- Agent LBPA LBPA C18:0- C12:0-ether- ether-LBPA LBPA Labile PEG PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 lipid Compound 50:25:20:5 50:25:20:5 50:25:20:5 50:25:20:5 50:25:20:5 50:25:20:5 ratio EC50 Calculation EC50 (nM) 1.36 1.56 1.64 1.76 1.78 1.95 EC50 S.E. 0.25 0.16 0.4 0.42 0.87 0.28 EC50 model app. app. app. app. app. app. fitting n 3 9 3 3 3 3 Toxicity score † - - † - † Effect score KD KD KD KD KD KD Composition Encapsulating DOTAP DOTAP DOTAP DOTAP DOTAP agent Helper lipid Chol Chol Chol Chol Chol Fusogenic 3,3'-C16:0- BDP DOPG lysoPG 3,3'-C14:0- Agent LBPA LBPA Labile PEG PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 lipid Compound 50:25:20:5 50:25:20:5 50:25:20:5 50:25:20:5 50:25:20:5 ratio EC50 Calculation EC50 (nM) 0.12 4.34 36.85 59.72 561.59 EC50 S.E. 234.34 5.59 300.81 395.38 EC50 model n.a. n.a. n.a. n.a. n.a. fitting n 3 3 3 3 3 Toxicity score - - - - - Effect score no KD KD KD KD no KD Abbreviations: S.E.: Standard Error; app.: applicable; n.a.: not applicable; n = repetition number; KD: knock down. GAR-P04383WO55 Application (final).docx Table 5: Cationic agent variation – 4 concentration dose response – HeLa Composition Encapsulating PD740 CTAB DOTAP TTAB DOMA agent Helper lipid Chol Chol Chol Chol Chol Fusogenic Agent LBPA LBPA LBPA LBPA LBPA Labile PEG lipid PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 Compound ratio 50:25:20:5 50:25:20:5 50:25:20:5 50:25:20:5 50:25:20:5 EC50 calculation EC50 (nM) 0.48 0.48 1.47 1.57 2.24 EC50 S.E. 0.06 0.15 0.18 0.49 0.24 EC50 model fitting app. app. app. app. app. n 3 3 7 3 3 Toxicity score †† †††† - †††† † Effect score KD no KD KD KD KD Composition Encapsulating DOTMA EPC 18:1 TAP 18:0 MVL5 GL67 agent Helper lipid Chol Chol Chol Chol Chol Fusogenic Agent LBPA LBPA LBPA LBPA LBPA Labile PEG lipid PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 Compound ratio 50:25:20:5 50:25:20:5 50:25:20:5 50:25:20:5 50:25:20:5 EC50 calculation EC50 (nM) 2.8 6.97 61.74 0.79 1.12 EC50 S.E. 1.25 8.5 236.22 1 1.06 EC50 model fitting app. app. app. n.a. n.a. n 3 3 3 1 1 Toxicity score † - - - - Effect score KD KD no KD no KD no KD Composition Encapsulating 16-BAC PD739 SA agent Helper lipid Chol Chol Chol Fusogenic Agent LBPA LBPA LBPA Labile PEG lipid PEGOEC18 PEGOEC18 PEGOEC18 Compound ratio 50:25:20:5 50:25:20:5 50:25:20:5 EC50 calculation EC50 (nM) 5.46 65.93 82.96 EC50 S.E. 5.31 231.32 237.77 EC50 model fitting n.a. n.a. n.a. n 3 3 3 Toxicity score †††† - † Effect score no KD no KD no KD Abbreviations: S.E.: Standard Error; app.: applicable; n.a.: not applicable; n = repetition number; KD: knock down. GAR-P04383WO55 Application (final).docx Table 6: PD740 % variation – 4 concentration dose response – HeLa Composition Name LP3 LP4 - - - Encapsulating PD740, PD740 PD740 PD740, PD740 agent DOTAP DOTAP Helper lipid Chol Chol Chol Chol Chol, Solasodine Fusogenic LBPA LBPA LBPA LBPA LBPA Agent Labile PEG PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 lipid Compound 25:25:25: 33:33:27:7 50:25:20:5, 37.5:12.5: 50:15:15: 15:5 ratio 20:5 N / P=40:1 25:20:5 EC50 calculation EC50 (nM) 0.42 0.58 0.67 0.9 0.91 EC50 S.E. 0.02 0.06 0.02 0.05 0.23 EC50 model app. app. app. app. app. fitting n 2 5 2 2 2 siRNA 10 nM Toxicity score †††† ††† ††† †††† †††† Effect score KD KD KD no KD no KD siRNA 5 nM Toxicity score †† † †† †† ††† Effect score KD KD KD KD KD Composition Name LP2 LP1 Encapsulating PD740 PD740 DOTAP PD740, agent DOTAP Helper lipid Chol Chol, Chol Chol Ceramide Fusogenic LBPA LBPA LBPA LBPA Agent Labile PEG PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 lipid Compound 50:25:20:5 50:15:15: 50:25:20:5 12.5:37.5: ratio 15:5 25:20:5 EC50 calculation EC50 (nM) 1 1.34 1.45 0.5 EC50 S.E. 0.05 0.2 0.13 0.65 EC50 model app. app. app. n.a. fitting n 8 2 17 2 siRNA 10 nM Toxicity score †††† †††† - - Effect score no KD no KD KD no KD siRNA 5 nM Toxicity score † †† - - Effect score KD KD KD no KD Abbreviations: S.E.: Standard Error; app.: applicable; n.a.: not applicable; n = repetition number; KD: knock down. GAR-P04383WO55 Application (final).docx Table 7: PD740 % variation – 10 concentration dose response – HeLa Composition Name LP3 LP4 LP4 LP1 LP2 Encapsulating DOTAP, PD740 DOTAP, DOTAP PD740 agent PD740 PD740 Helper lipid Chol Chol Chol Chol Chol Fusogenic LBPA LBPA LBPA LBPA LBPA Agent Labile PEG lipidPEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 Compound 25:25:20:15:533:33:27:7 37.5:12.5:20: 50:20:15:5 50:20:15:5 ratio 15:5 EC50 calculation EC50 (nM) 0.21 0.29 0.65 0.7 0.73 EC50 S.E. 0.01 0.01 0.05 0.03 0.05 EC50 model app. app. app. app. app. fitting n 7 2 2 6 2 TC50 (nM) 3.15 8.53 10.26 17.92 4.85 TC50 S.E. 0.14 0.57 0.48 0.57 0.33 TC50 model app. app. app. app. app. fitting Abbreviations: S.E.: Standard Error; app.: applicable; n.a.: not applicable; n = repetition number; KD: knock down. GAR-P04383WO55 Application (final).docx Table 8: Fusogenic agent variation in combination with PD740 – 10 concentration dose response – HeLa Composition Name - - LP3 - - - Encapsulating DOTAP, DOTAP, DOTAP, DOTAP, DOTAP, DOTAP, agent PD740 PD740 PD740 PD740 PD740 PD740 Helper lipid Chol Chol Chol Chol Chol Chol Fusogenic PLPE MGDG LBPA IsostA GMO POPE Agent Labile PEG PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 lipid Compound 25:25:20:15:525:25:20:15:525:25:20:15:525:25:20:15:525:25:20:15:525:25:20:15:5 ratio EC50 calculation EC50 (nM) 0.14 0.2 0.21 0.54 0.65 0.7 EC50 S.E. 0.15 0.02 0.01 0.04 0.07 0.05 EC50 model app. app. app. app. app. app. fitting n 2 3 7 3 2 2 TC50 TC50 (nM) 3.34 6.66 3.15 9.3 5.42 5.64 TC50 S.E. 0.18 0.82 0.14 0.68 0.32 0.43 TC50 model app. app. app. app. app. app. fitting Composition Name LP1 - - - - - Encapsulating DOTAP DOTAP, DOTAP, DOTAP, DOTAP, DOTAP, agent PD740 PD740 PD740 PD740 PD740 Helper lipid Chol Chol Chol Chol Chol Chol Fusogenic LBPA NPPE MO PalmA OlA NAPE Agent Labile PEG PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 lipid Compound 50:20:15:5 25:25:20:15:525:25:20:15:525:25:20:15:525:25:20:15:525:25:20:15:5 ratio EC50 calculation EC50 (nM) 0.7 0.73 0.77 0.97 0.97 10.05 EC50 S.E. 0.03 0.05 0.12 0.11 0.19 86 EC50 model app. app. app. app. app. n.a. fitting n 6 2 2 2 2 2 TC50 TC50 (nM) 17.92 8.11 5.89 12.43 9.96 8.86 TC50 S.E. 0.57 0.71 0.46 1.79 1.57 1.73 TC50 model app. app. app. app. app. app. fitting Abbreviations: S.E.: Standard Error; app.: applicable; n.a.: not applicable; n = repetition number; KD: knock down. GAR-P04383WO55 Application (final).docx Table 9: Combination of fusogenic agents with LBPA – 10 concentration dose response - HeLa Composition Name - - LP3 - - LP1 Encapsulating DOTAP, DOTAP, DOTAP, DOTAP, DOTAP, agent PD740 PD740 PD740 PD740 PD740 DOTAP Helper lipid Chol Chol Chol Chol Chol Chol Fusogenic LBPA, LBPA, LBPA, LBPA, Agent MGDG PLPE LBPA GMO Isost.A. LBPA Labile PEG lipid PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 Compound 25:25:15: 25:25:15: 25:25:20: 25:25:15: 25:25:15: ratio 15:15:5 15:15:5 15:5 15:15:5 15:15:5 50:20:15 :5 EC50 EC50 (nM) 0.19 0.19 0.21 0.3 0.57 0.7 EC50 S.E. 0.01 0.01 0.01 0.02 0.06 0.03 EC50 model fitting app. app. app. app. app. app. n 1 1 7 1 1 6 TC50 TC50 (nM) 4.4 2.88 3.15 2.59 2.59 17.92 TC50 S.E. 0.43 0.38 0.14 0.16 0.16 0.57 TC50 model fitting app. app. app. app. app. app. Abbreviations: S.E.: Standard Error; app.: applicable; n.a.: not applicable; n = repetition number; KD: knock down. Table 10: PD740 percentage variation – 10 concentration dose response – MMP Composition Name LP3 LP3 LP2 - LP1 LP4 Encapsula- DOTAP, DOTAP, PD740 DOTAP, DOTAP PD740 ting agent PD740 (1stPD740 PD740 batch) (different 2ndbatch ) GAR-P04383WO55 Application (final).docx Helper lipid Chol Chol Chol Chol Chol Chol Fusogenic LBPA LBPA LBPA LBPA LBPA LBPA Agent Labile PEG PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 lipid Compound 25:25:20:15: 25:25:20:15: 50:20:15:5 37.5:12.5:2050:20:15:5 33:33:27:7 ratio 5 5 :15:5 EC50 calculation EC50 (nM) 4.05 4.35 5.1 6.11 6.21 23.02 EC50 S.E. 0.2 0.62 0.67 0.61 0.34 5.86 EC50 model app. app. app. app. app. app. fitting n 5 1 1 1 4 1 TC50 Toxicity - - - - - - score (12.5 nM) Effect score KD KD KD KD KD no KD (12.5 nM) Abbreviations: S.E.: Standard Error; app.: applicable; n.a.: not applicable; n = repetition number; KD: knock down. Table 11: Fusogenic agent variation in combination with PD740 – 10 concentration dose response - MMP Composition Name LP3 Encapsulating DOTAP, PD740 DOTAP, PD740 DOTAP, PD740 DOTAP, PD740 agent Helper lipid Chol Chol Chol Chol Fusogenic Agent POPE LBPA OlA GMO Labile PEG lipid PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 Compound ratio 25:25:20:15:5 25:25:20:15:5 25:25:20:15:5 25:25:20:15:5 EC50 calculation EC50 (nM) 3.82 4.05 5.42 5.79 EC50 S.E. 0.32 0.2 0.57 0.21 EC50 model fitting app. app. app. app. n 1 5 1 1 Toxicity score 12.5 - - - - nM Effect score 12.5 nMKD KD KD KD GAR-P04383WO55 Application (final).docx Composition Name LP1 Encapsulating DOTAP DOTAP, PD740 DOTAP, PD740 DOTAP, PD740 agent Helper lipid Chol Chol Chol Chol Fusogenic Agent LBPA PalmA MO IsostA Labile PEG lipid PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 Compound ratio 50:20:15:5 25:25:20:15:5 25:25:20:15:5 25:25:20:15:5 EC50 calculation EC50 (nM) 6.21 6.51 7.24 7.36 EC50 S.E. 0.34 0.37 0.41 0.46 EC50 model fitting app. app. app. app. n 4 1 1 1 Toxicity score 12.5 - - - - nM Effect score 12.5 nMKD KD KD KD Composition Name Encapsulating DOTAP, PD740 DOTAP, PD740 DOTAP, PD740 DOTAP, PD740 agent Helper lipid Chol Chol Chol Chol Fusogenic Agent NAPE NPPE MGDG PLPE Labile PEG lipid PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 Compound ratio 25:25:20:15:5 25:25:20:15:5 25:25:20:15:5 25:25:20:15:5 EC50 calculation EC50 (nM) 8.89 12.65 1.95 4.61 EC50 S.E. 1.3 1.35 0.7 0.82 EC50 model fitting app. app. n.a. n.a. n 1 1 1 1 Toxicity score 12.5 - - †† †† nM Effect score 12.5 nMKD KD no KD no KD Abbreviations: S.E.: Standard Error; app.: applicable; n.a.: not applicable; n = repetition number; KD: knock down. GAR-P04383WO55 Application (final).docx Table 12: Combination of fusogenic agents with LBPA – 10 concentration dose response - MMP Composition Name LP3 LP1 Cationic DOTAP, DOTAP, DOTAP, DOTAP, DOTAP, DOTAP agent PD740 PD740 PD740 PD740 PD740 Helper lipid Chol Chol Chol Chol Chol Chol Fusogenic LBPA,MGD LBPA, LBPA,GMO LBPA,PLPE LBPA LBPA Agent G Isost.A. Labile PEG PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 PEGOEC18 lipid Compound 25:25:15: 25:25:15: 25:25:15: 25:25:15: 25:25:20: 50:20:15:5 ratio 15:15:5 15:15:5 15:15:5 15:15:5 15:5 EC50 calculation EC50 (nM) 3 3 3.06 3.58 4.05 6.21 EC50 S.E. 0.55 0.22 0.27 2.19 0.2 0.34 EC50 model app. app. app. app. app. app. fitting n 1 1 1 1 5 4 Toxicity - - - - - - score 12.5 nM Effect score KD KD KD KD KD KD 12.5 nM Abbreviations: S.E.: Standard Error; app.: applicable; n.a.: not applicable; n = repetition number; KD: knock down. GAR-P04383WO55 Application (final).docx Table 13: Treatment conditions with small molecule enhancers from figure 11a Nr Chol- Compound Supplier Catalogue number CAS number siRNA 1 no EtOH - - - 2 no untreated - - - 3 no interferin Polyplus- 101000028 transfection SA 4 yes DMSO 5 yes interferin Polyplus- 101000028 transfection SA 6 yes Phar129414 MolPort MolPort-000-795-0451029083-66-6 7 yes Hecogenin Santa Cruz sc-295139 915-35-5 acetate Biotechnology 8 yes Phar175861 MolPort MolPort-000-836-4341262296-77-4 9 yes Peimine LKT Laboratories P1634 23496-41-5 Inc. 10 yes U18666A Sigma Aldrich U3633 3039-71-2 11 yes EtOH 12 yes Stock1N-55313 MolPort MolPort-002-527-9571268849-74-6 13 yes Stock1N-30551 MolPort MolPort-002-515-4941262295-27-1 14 yes Stock1N-19417 MolPort MolPort-002-512-728897043-62-8 15 yes Hecogenin Santa Cruz SC-295138 467-55-0 Biotechnology 16 yes Stock1N-55183 MolPort MolPort-002-527-8664952-51-6 17 yes Tomatidine MedChemExpress HY-N2149 77-59-8 18 yes Laxogenin MolPort 000-713-417 1177-71-5 19 yes Neoruscogenin AvaChem scientific 3160 17676-33-4 20 yes Sarasapogenin Target Molecule T2733 126-19-2 Corp. 21 yes Ruscogenin BioZol TRC-R701750-5mg 472-11-7 22 yes E18 ChemDiv N039-0029 1818436-99-5 23 yes Diosgenin Sigma Aldrich D1634 512-04-9 24 yes Solasidine Santa Cruz sc-296408 126-17-0 Biotechnology 25 no EtOH 26 yes EtOH 27 yes STOCK1N- MolPort MolPort-002-507-2054860-15-5 41490 28 yes 4185-0010 MolPort MolPort-000-733-972125443-26-7 29 yes Solanidine Carbosynth limited FS765161801 80-78-4 30 yes Spirostan 6 one ChemDiv 1554-0030 1092561-88-0 31 yes O- MolPort MolPort-002-507-2366159-99-5 Acetylsolasodine 32 yes STOCK1N- MolPort MolPort-002-526-2943669-17-8 52849 GAR-P04383WO55 Application (final).docx Table 14: Sequences used in this study Abbreviation Full name Source Sequen Notes ce eGFP siRNA siRNA against eGFP, 2'- Sigma Aldrich, SEQ ID Purity: HPLC in vivo sense OMe-modified custom NO 1 quality synthesis eGFP siRNA siRNA against eGFP, 2'- SEQ ID antisense OMe-modified NO 2 AF647 eGFP Alexa647-labeled siRNA Sigma Aldrich, SEQ ID purity: HPLC; siRNA sense against eGFP custom NO 3 synthesis AF647 eGFP Alexa647-labeled siRNA SEQ ID siRNA against eGFP NO 4 antisense GFP cr guide GFP cr guide RNA IDT, custom SEQ ID Target sequence 1 , GFP_cr4 synthesis NO 5 tracr RNA Alt-R® CRISPR-Cas9 IDT, Cat. No: commer Sequence not tracrRNA 1072532 cial publicly available GFP-Gal8 pCMV3-LGALS8- SinoBiological, commer Sequence only plasmid GFPSpark (Human Cat.No: cial contains ORF, linker LGALS8 transcript variant HG10301- and GFP 1 Gene ORF cDNA clone ACG) expression plasmid, C- GFPSpark tag ) Cas9 protein CRISPR-associated PEPC facility, online Source of sequence endonuclease Cas9 / Csn1 MPI-CBG db https: / / www.uniprot.o rg / uniprotkb / Q99ZW 2 / entry dsGFP pOCC447-pd1GFP PEPC facility, SEQ ID plasmid plasmid MPI-CBG NO 6 antiGFP Chol- Cholesterol-conjugated Axolabs, SEQ ID siRNA sense siRNA against eGFP, custom NO 7 cholesterol-bearing sense synthesis strand antiGFP Chol- Cholesterol-conjugated Axolabs, SEQ ID It forms a double siRNA siRNA against eGFP, custom NO 8 stranded siRNA with antisense antisense strand synthesis SEQ ID NO 7 eGFP mRNA CleanCap®EGFP mRNA Trilink, Cat. online Sequence: only open (5moU) No: L-7201 reading frame; full sequence not publicly available guide RNA Mix of GFP cr guide RNA (mix) (GFP_cr4) and tracr RNA (Alt-R® CRISPR-Cas9 tracrRNA) Table 15 Compound CAS Supplier, Full name Suitable order Solvent number DOTAP 113669-21-9 Avanti, 2,3-bis[[(Z)-octadec-9-enoyl]oxy]propyl- CHCl3 890890 trimethylazanium Chol 57-88-5 Avanti, Cholesterol CHCl3 700000P GAR-P04383WO55 Application (final).docx DSPE-PEG 474922-77-5 Avanti, 18:0 PEG2000 PE CHCl3 880120C- 200mg S,S-3,3'- 1246303-12-7 Avanti, 18:1 BMP (S,S) CHCl3 LBPA 857135P DOPC 4235-95-4 Avanti, 18:1 (Δ9-Cis) PC (DOPC) CHCl3 850375P R,S-3,3'- 326495-20-9 Avanti, sn-(3--(9Z-octadecenoyl)-2-hydroxy)-glycerol-1- CHCl3 LBPA 857133P phospho-sn-3′-(1′--(9Z-octadecenoyl)-2′- hydroxy)-glycerol (ammonium salt) Diosgenin 512-04-9 Sigma, (25R)-5-Spirosten-3β-ol CHCl3 D1634 Ceramide 5966-28-9 Avanti, C18:1 Ceramide (d18:1 / 18:1(9Z)) CHCl3 860519P DOPG 67254-28-8 Avanti, 18:1 (Δ9-Cis) PG, 1,2-dioleoyl-sn-glycero-3- CHCl3 840475 phospho-(1'-rac-glycerol) (sodium salt) 18:1 Lyso 326495-24-3 Avanti, 1-(9Z-octadecenoyl)-sn-glycero-3-phospho-(1'- CHCl3 PG 858125 rac-glycerol) (sodium salt), chloroform R,S-C16:0- 97466-60-9 Avanti, Hexadecanoic acid, phosphinicobis[oxy(2- MeOH LBPA 110728 hydroxy-3,1-propanediyl)] ester, (R*,S*)- (9CI) S,S-BDP 1246298-28-1 Avanti, sn-[2,3-dioleoyl]-glycerol-1-phospho-sn-1’-[2’,3’- CHCl3 857137 dioleoyl]-glycerol (ammonium salt) R,R-3,3'- 1246303-13-8 Avanti, sn-(1-oleoyl-2-hydroxy)-glycerol-3-phospho-sn- CHCl3 LBPA 857136 3'-(1'-oleoyl-2'-hydroxy)-glycerol (ammonium salt) R,S-C14:0- 325466-03-3 Avanti, sn-(3-tetradecanoyl-2-hydroxy)-glycerol-1- MeOH LBPA 857131 phospho-sn-3'-(1'-tetradecanoyl-2'-hydroxy)- glycerol (ammonium salt) S,R-Hemi- 474943-36-7 Avanti, sn-(3-oleoyl-2-hydroxy)-glycerol-1-phospho-sn- CHCl3 LBPA 857134 3'-(1',2'-dioleoyl)-glycerol (ammonium salt) 16-BAC 122-18-9 Sigma, cetalkonium chloride CHCl3 B4136-25G DOMA 3700-67-2 Sigma dioctadecyldimethylammonium bromide CHCl3 Aldrich, D2779 Stearyl 124-30-1 Sigma stearylamine CHCl3 amine (SA) Aldrich, 74750 TTAB 1119-97-7 Sigma (1-Tetradecyl)trimethylammonium bromide; CHCl3 Aldrich, 98% T4762 CTAB 57-09-0 ABCR, (1-Hexadecyl)trimethylammonium bromide; CHCl3 AB117004 98% S,S-2,2'- Echelon, L- CHCl3 C18:0-ether- B180e LBPA S,S-2,2'- Echelon, L- CHCl3 C12:0-ether- B120e LBPA DOPE 4004-05-1 Avanti, 1,2-di-(9Z-octadecenoyl)-sn-glycero-3- CHCl3 850725 phosphoethanolamine TAP 18:0 220609-41-6 Avanti, 2,3-di(octadecanoyloxy)propyl- CHCl3 890880P- trimethylazanium;chloride 25mg DOTMA 104872-42-6 Avanti, 1,2-di-O-octadecenyl-3-trimethylammonium CHCl3 890898P propane (chloride salt) EPC 18:1 474945-24-9 Avanti, 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine CHCl3 890704 (chloride salt) Solasodine 126-17-0 Santa Cruz CHCl3 GAR-P04383WO55 Application (final).docx (Sola) Biotechnolo gy, sc-296408 GL67 179075-30-0 Avanti, N4-Cholesteryl-Spermine CHCl3 - (cholesteryls 890893P- only permine) 5mg soluble with sonicatio n MVL5 464926-03-2 Avanti, CHCl3 890000P- 1mg Sphingomye 383907-91-3 Avanti, Sphingomyelin (Brain, Porcine) CHCl3 lin (mix from 860062 porcine brain) Solasodine- 6159-99-5 MolPort, (3beta,25R)-spirosol-5-en-3-ylacetate, IUPAC: CHCl3 Oac MolPort- (1S,2S,4S,5'R,7S,8R,9S,12S,13R,16S)- (SolaOAc) 002-507- 5',7,9,13-tetramethyl-5-oxaspiro[pentacyclo 236 [10.8.0.02,9.04,8.013,18] icosane-6,2'-piperidin]-18- en-16-yl acetate NPPE (16:057984-41-5 Enzo, BML- N-Palmitoyl phosphatidylethanolamine CHCl3 NAPE LP108-0001 (+2x16:0)) NAPE (12:0474944-08-6 Avanti, N-Palmitoyl phosphatidylethanolamine MeOH, amine, 870140 CHCl3 2X16:0) (around 2.5:1) - barely soluble glycerol 111-03-5 sigma, 1-Oleoyl-rac-glycerol CHCl3 mono oleate M7765 (GMO) palmitoleic 373-49-9 Sigma, cis-9-Hexadecenoic acid CHCl3 acid P9417- (PalmA) 100MG methyl 112-62-9 Sigma, Oleic acid methyl ester CHCl3 oleate (MO) 311111-5G oleic acid 112-80-1 Sigma, CHCl3 (OlA) O1008 isostearic 2724-58-5 Sigma, 16-Methylheptadecanoic acid CHCl3 acid (IsostA) M6281- 25MG POPE 26662-94-2 Avanti, 1-palmitoyl-2-oleoyl-sn-glycero-3- CHCl3 850757P- phosphoethanolamine 25mg monogalact 426820-72-6 Avanti, mixture of differenct chain lengths CHCl3 osyldiacylgly 840523P- cerol 5mg (MGDG) PLPE 26662-95-3 Avanti, 1-palmitoyl-2-linoleoyl-sn-glycero-3- CHCl3 (palmitoyl 850756C- phosphoethanolamine linoleoyl) 25mg (16:0, 18:2) PD739 866888-46-2 donation by methyl N-((2S,11aS)-10-(2-aminoethyl)-2- CHCl3 Waldmann (hexadecylsulfonamido)-5,11-dioxo- laboratory, 2,3,5,10,11,11a-hexahydro-1H- MPI of benzo[e]pyrrolo[1,2-a][1,4]diazepine-7- Molecular carbonyl)-S-((2E,6E)-3,7,11-trimethyldodeca- Physiology 2,6,10-trien-1-yl)-L-cysteinate GAR-P04383WO55 Application (final).docx

Claims

Claims 1. A drug delivery system comprising a liposome having (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) between 1 and 20 mol percent of an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering.

2. The drug delivery system according to claim 1, wherein the encapsulating agent is a cationic lipid selected from 1,2-dialkanyloxy-3-trialkylammonium propane halide, 1,2-dialkenyloxy-3-trialkylammonium propane halide, 1,2- dialkanoyloxy-3-trialkylammonium propane halide, 1,2-dialkenoyloxy-3- trialkylammonium propane halide, tetraalkylammonium halide, 1,2-dioleoyl-sn- glycero-3-ethylphosphocholine, and / or a lipidated polypeptide PD740.

3. The drug delivery system according to claim 1 or 2, wherein the encapsulating agent is a cationic lipid selected from 1,2-di-C12-C20 alkanyloxy-3-tri-C1-C6 alkylammonium propane halide, 1,2-di-C12-C20 alkenyloxy-3-tri-C1-C6 alkylammonium propane halide, 1,2-di-C12-C20 alkenoyloxy-3-tri-C1-C6 alkylammonium propane halide, di-C12- C20 alkyl di-C1-C6 alkyl ammonium halide, and / or a lipidated polypeptide PD740.

4. The drug delivery system according to any one of the claims 1 to 3, wherein the encapsulating agent is a cationic lipid selected from the group consisting of 1,2- didodecyloxy-3-trimethylammonium propane chloride, 1,2-ditridecyloxy-3- trimethylammonium propane chloride, 1,2-ditetradecyloxy-3- trimethylammonium propane chloride, 1,2-dipentadecyloxy-3- trimethylammonium propane chloride, 1,2-dihexadecyloxy-3- GAR-P04383WO55 Application (final).docxtrimethylammonium propane chloride, 1,2-diheptadecyloxy-3- trimethylammonium propane chloride, 1,2-dioctadecyloxy-3- trimethylammonium propane chloride, 1,2-dinonadecyloxy-3- trimethylammonium propane chloride, 1,2-diicosyloxy-3-trimethylammonium propane chloride, 1,2-didodecenyloxy-3-trimethylammonium propane chloride, 1,2-ditridecenyloxy-3-trimethylammonium propane chloride, 1,2- ditetradecenyloxy-3-trimethylammonium propane chloride, 1,2- dipentadecenyloxy-3-trimethylammonium propane chloride, 1,2- dihexadecenyloxy-3-trimethylammonium propane chloride, 1,2- diheptadecenyloxy-3-trimethylammonium propane chloride, 1,2- dioctadecenyloxy-3-trimethylammonium propane chloride, 1,2- dinonadecenyloxy-3-trimethylammonium propane chloride, 1,2-diicosenyloxy-3- trimethylammonium propane chloride, 1,2-dilauroleoyloxy-3- trimethylammonium propane chloride, 1,2-dimyristoleoyloxy-3- trimethylammonium propane chloride, 1,2-dipalmitoleoyloxy-3- trimethylammonium propane chloride, 1,2-dipetroseloyloxy-3- trimethylammonium propane chloride, 1,2-dipetroselaidoyloxy-3- trimethylammonium propane chloride, 1,2-dioleoylloxy-3-trimethylammonium propane chloride, 1,2-dielaidoyloxy-3-trimethylammonium propane chloride, 1,2-divaccenoyloxy-3-trimethylammonium propane chloride, 1,2- digadoleoyloxy-3-trimethylammonium propane chloride, dimethyldidodecylammonium bromide, dimethylditridecylammonium bromide, dimethylditetradecylammonium bromide, dimethyldipentadecylammonium bromide, dimethyldihexadecylammonium bromide, dimethyldiheptadecylammonium bromide, dimethyldioctadecylammonium bromide, dimethyldinonadecylammonium bromide, and dimethyldiicosylammonium bromide, and / or a lipidated polypeptide PD740.

5. The drug delivery system according to any one of the claims 1 to 4, wherein the encapsulating agent is a cationic lipid selected from the group consisting of 1,2- di-O-octadecenyl-3-trimethylammonium propane chloride, dimethyldioctadecylammonium bromide, and 1,2-dioleoyl-3-trimethylammonium propane chloride, and / or a lipidated polypeptide PD740.

6. The drug delivery system according to any one of the claims 1 to 5, wherein the encapsulating agent is a cationic lipid 1,2-dioleoyl-3-trimethylammonium propane chloride and / or a lipidated polypeptide PD740. GAR-P04383WO55 Application (final).docx7. The drug delivery system according to any one of the claims 1 to 6, wherein the acid-cleavable polyethylene glycol conjugated lipid is an acid-cleavable polyethylene glycol conjugated with a C12-C20 alkyl, or with a C12-C20 acyl, or with a mono-C12-C20 acylglycerol, or with a di-C12-C20 acylglycerol.

8. The drug delivery system according to any one of the claims 1 to 7, wherein the acid-cleavable polyethylene glycol conjugated lipid comprises an acid- cleavable linkage selected from the group comprising an orthoester linkage, a hydrazone linkage, an acetal linkage, a vinyl ether linkage, and an imine linkage, and preferably 2-methyl-2-alkoxy-1,3-dioxane or 2-alkoxy-1,3- dioxolane.

9. The drug delivery system according to any one of the claims 1 to 8, wherein the acid-cleavable polyethylene glycol conjugated lipid is selected from the group consisting of: N-(2-methyl-2-dodecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2- methyl-2-tridecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2- tetradecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2- pentadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2- hexadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2- heptadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2- octadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2- nonadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, and N-(2-methyl-2- icosyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol. 10 The drug delivery system according to any one of the claims 1 to 9, wherein the acid-cleavable polyethylene glycol conjugated lipid comprises polyethylene glycol having a number average molar mass Mn comprised between 400 and 5000 Da. 11 The drug delivery system according to any one of the claims 1 to 10, wherein the acid-cleavable polyethylene glycol conjugated lipid is α-methoxy-ω-{N-(2- methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}-polyethylene glycol45.

12. The drug delivery system according to any one of the claims 1 to 11, wherein the fusogenic agent is a glycolipid, a phosphatidylethanolamine, a phosphatidylglycerol, a fatty acid, or a fatty acid ester. GAR-P04383WO55 Application (final).docx13. The drug delivery system according to claim 12, wherein the fusogenic agent is a galactolipid, preferably an unsaturated monogalactosyldiacylglycerol.

14. The drug delivery system according to claim 12, wherein the fusogenic agent is a 1,2-diacyl-sn-glycero-3-phosphoethanolamine or an N-acyl-1,2-diacyl-sn- glycero-3-phosphoethanolamine.

15. The drug delivery system according to claim 12, wherein the fusogenic agent is a phosphatidylethanolamine selected from the group consisting of 1,2- dimyristoyl-sn-glycero-3-phosphoethanolamine, 1,2-dipentadecanoyl-sn- glycero-3-phosphoethanolamine, 1,2-dipalmitoyl-sn-glycero-3- phosphoethanolamine, 1,2-dimargaroyl-sn-glycero-3-phosphoethanolamine, 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dipalmitoleoyl-sn- glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3- phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2- dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn- glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3- phosphoethanolamine, 1,2-dierucoyl-sn-glycero-3-phosphoethanolamine, 1-pentadecanoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2- linoleoyl-sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2-oleoyl-sn-glycero-3- phosphoethanolamine, 1-stearoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2- docosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1-stearoyl-2-linoleoyl- sn-glycero-3-phosphoethanolamine, 1-stearoyl-2-arachidonoyl-sn-glycero-3- phosphoethanolamine, 1-stearoyl-2-docosahexaenoyl-sn-glycero-3- phosphoethanolamine, and N-palmitoyl-1,2-dipalmitoyl-sn-glycero-3- phosphoethanolamine.

16. The drug delivery system according to claim 12, wherein the fusogenic agent is a phosphatidylglycerol selected from the group consisting of bis(monoacylglycerol)phosphate, 3-acylglycero-1-phospho-3'-(1',2'-diacyl)- glycerol, 3-acylglycero-1-phospho-glycerol, and 1,2-diacylglycero-3-phospho- glycerol.

17. The drug delivery system according to claim 16, wherein the fusogenic agent is a bis(monoacylglycerol)phosphate selected from the group consisting of 2,2'- S,S-bis(monoacylglycerol)phosphate, 3,3'-S,S- GAR-P04383WO55 Application (final).docxbis(monoacylglycerol)phosphate, 3,3'-R,R-bis(monoacylglycerol)phosphate, and 3,3'-R,S-bis(monoacylglycerol)phosphate.

18. The drug delivery system according to claim 16, wherein the fusogenic agent is a bis(monoacylglycerol)phosphate selected from the group consisting of bis(monododecylglycerol)phosphate, bis(monotridecylglycerol)phosphate, bis(monotetradecylglycerol)phosphate, bis(monopentadecylglycerol)phosphate, bis(monohexadecylglycerol)phosphate, bis(monoheptadecylglycerol)phosphate, bis(monooctadecylglycerol)phosphate, bis(monononadecylglycerol)phosphate, bis(monoicosylglycerol)phosphate, bis(monolauroleoylglycerol)phosphate, bis(monomyristoleoylglycerol)phosphate, bis(monopalmitoleoylglycerol)phosphate, bis(monopetroseloylglycerol)phosphate, bis(monopetroselaidoylglycerol)phosphate, bis(monooleoylglycerol)phosphate, bis(monoelaidoylglycerol)phosphate, bis(monovaccenoylglycerol)phosphate, and bis(monogadoleoylglycerol)phosphate.

19. The drug delivery system according to claim 16, wherein the fusogenic agent is a 3-acylglycero-1-phospho-3'-(1',2'-diacyl)-glycerol selected from the group consisting of 3-dodecylglycero-1-phospho-3'-(1',2'-didodecyl)-glycerol, 3- tridecylglycero-1-phospho-3'-(1',2'-ditridecyl)-glycerol, 3-tetradecylglycero-1- phospho-3'-(1',2'-ditetradecyl)-glycerol, 3-pentadecylglycero-1-phospho-3'- (1',2'-dipentadecyl)-glycerol, 3-hexadecylglycero-1-phospho-3'-(1',2'- dihexadecyl)-glycerol, 3-heptadecylglycero-1-phospho-3'-(1',2'-diheptadecyl)- glycerol, 3-octadecylglycero-1-phospho-3'-(1',2'-dioctadecyl)-glycerol, 3- nonadecylglycero-1-phospho-3'-(1',2'-dinonadecyl)-glycerol, 3-icosylglycero-1- phospho-3'-(1',2'-diicosyl)-glycerol, 3-lauroleoylglycero-1-phospho-3'-(1',2'- dilauroleoyl)-glycerol, 3-myristoleoylglycero-1-phospho-3'-(1',2'-dimyristoleoyl)- glycerol, 3-palmitoleoylglycero-1-phospho-3'-(1',2'-dpalmitoleoyl)-glycerol, 3- petroseloylglycero-1-phospho-3'-(1',2'-dipetroseloyl)-glycerol, 3- petroselaidoylglycero-1-phospho-3'-(1',2'-dipetroselaidoyl)-glycerol, 3- oleoylglycero-1-phospho-3'-(1',2'-dioleoyl)-glycerol, 3-elaidoylglycero-1- phospho-3'-(1',2'-dielaidoyl)-glycerol, 3-vaccenoylglycero-1-phospho-3'-(1',2'- divaccenoyl)-glycerol, and 3-gadoleoylglycero-1-phospho-3'-(1',2'-digadoleoyl)- glycerol. GAR-P04383WO55 Application (final).docx20. The drug delivery system according to claim 16, wherein the fusogenic agent is a 3-acylglycero-1-phospho-glycerol selected from the group consisting of 3- dodecylglycero-1-phospho-glycerol, 3-tridecylglycero-1-phospho-glycerol, 3-tetradecylglycero-1-phospho-glycerol, 3-pentadecylglycero-1-phospho- glycerol, 3-hexadecylglycero-1-phospho-glycerol, 3-heptadecylglycero-1- phospho-glycerol, 3-octadecylglycero-1-phospho-glycerol, 3-nonadecylglycero- 1-phospho-glycerol, 3-icosylglycero-1-phospho-glycerol, 3-lauroleoylglycero-1- phospho-glycerol, 3-myristoleoylglycero-1-phospho-glycerol, 3- palmitoleoylglycero-1-phospho-glycerol, 3-petroseloylglycero-1-phospho- glycerol, 3-petroselaidoylglycero-1-phospho-glycerol, 3-oleoylglycero-1- phospho-glycerol, 3-elaidoylglycero-1-phospho-glycerol, 3-vaccenoylglycero-1-phospho-glycerol, and 3-gadoleoylglycero-1-phospho- glycerol.

21. The drug delivery system according to claim 16, wherein the fusogenic agent is a 1,2-diacylglycero-3-phospho-glycerol selected from the group consisting of 1,2-didodecylglycero-3-phospho-glycerol, 1,2-ditridecylglycero-3-phospho- glycerol, 1,2-ditetradecylglycero-3-phospho-glycerol, 1,2-dipentadecylglycero-3- phospho-glycerol, 1,2-dihexadecylglycero-3-phospho-glycerol, 1,2- diheptadecylglycero-3-phospho-glycerol, 1,2-dioctadecylglycero-3-phospho- glycerol, 1,2-dinonadecylglycero-3-phospho-glycerol, 1,2-diicosylglycero-3- phospho-glycerol, 1,2-dilauroleoylglycero-3-phospho-glycerol, 1,2- dimyristoleoylglycero-3-phospho-glycerol, 1,2-dipalmitoleoylglycero-3-phospho-glycerol, 1,2-dipetroseloylglycero-3- phospho-glycerol, 1,2-dipetroselaidoylglycero-3-phospho-glycerol, 1,2- dioleoylglycero-3-phospho-glycerol, 1,2-dielaidoylglycero-3-phospho-glycerol, 1,2-divaccenoylglycero-3-phospho-glycerol, and 1,2-digadoleoylglycero-3- phospho-glycerol.

22. The drug delivery system according to claim 12, wherein the fusogenic agent is a fatty acid selected from the group consisting of myristic acid, pentadecanoic acid, palmitic acid, margaric acid, stearic acid, isostearic acid, nonadecylic acid, arachidic acid, myristoleic acid, palmitoleic acid, sapienic acid, oleic acid, elaidic acid, vaccenic acid, and linoleic acid; or a methyl ester or a glyceryl ester of one of the aforementioned fatty acids.

23. The drug delivery system according to any one of the claims 1 to 22, wherein the fusogenic agent is selected from the group consisting of monogalactosyl- GAR-P04383WO55 Application (final).docxdilinolenoylglycerol, 1-palmitoyl-2-linoleoyl-sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine, N-palmitoyl-1,2- dipalmitoyl-sn-glycero-3-phosphoethanolamine, 2,2'-S,S- bis(monododecylglycerol)phosphate, 3,3'-S,S- bis(monododecylglycerol)phosphate, 3,3'-R,R-bis(monododecylglycerol)- phosphate, 3,3'-R,S-bis(monododecylglycerol)phosphate, 2,2'-S,S- bis(monooctadecylglycerol)phosphate, 3,3'-S,S-bis(monoocta- decylglycerol)phosphate, 3,3'-R,R-bis(monooctadecylglycerol)phosphate, 3,3'- R,S-bis(monooctadecylglycerol)phosphate, 2,2'-S,S- bis(monooleoylglycerol)phosphate, 3,3'-S,S-bis(monooleoylglycerol)phosphate, 3,3'-R,R-bis(monooleoylglycerol)phosphate, 3,3'-R,S-bis(monooleoylglycerol)- phosphate, 3-dodecylglycero-1-phospho-3'-(1',2'-didodecyl)-glycerol, 3- octadecylglycero-1-phospho-3'-(1',2'-dioctadecyl)-glycerol, 3-oleoylglycero-1- phospho-3'-(1',2'-dioleoyl)-glycerol, glyceryl monoloeate, methyl oleate, isotearic acid, palmitoleic acid, and oleic acid.

24. The drug delivery system according to any one of the claims 1 to 23, wherein the lipid bilayer further comprises: iv) between 2.5 and 35 mol percent of at least one neutral lipid.

25. The drug delivery system according to any one of the claims 1 to 24, wherein the lipid bilayer further comprises: iv) between 2.5 and 35 mol percent of at least one neutral lipid selected from the group consisting of cholesterol, diosgenin, solasodine, and ceramide.

26. The drug delivery system according to any one of the claims 1 to 25, wherein the therapeutic agent is a drug, a protein, a peptide, a gene, an oligonucleotide, a compound, an antibody, a nanobody, a nucleic acid, a ribonucleoprotein, a small molecule, a non-lipinski molecule, a biomimetic, or a natural compound.

27. The drug delivery system according to any one of the claims 1 to 26, wherein the therapeutic agent is a CRISPR / CAS9 ribonucleoprotein, a CRISPR guide RNA or a CRISPR associated Cas protein.

28. The drug delivery system according to claim 26, wherein the therapeutic agent is a nucleic acid selected from the group comprising ssDNA, dsDNA, ssRNA, dsRNA, aiRNA, miRNA, siRNA, piRNA, sdRNA, snRNA, snoRNA, PAR, GAR-P04383WO55 Application (final).docxtsRNA, endo-siRNA, MSY-RNA, tel-sRNA, crasiRNA, moRNA, xiRNA, lncRNA, ncRNA, circRNA, mRNA, sgRNA, crRNA, tracr RNA, guide RNA mix, self- amplifying RNA, ribozymes, and antisense oligonucleotides.

29. The drug delivery system according to any one of the claims 1 to 26, wherein the therapeutic agent is selected from the group comprising a CRISPR / CAS9 ribonucleoprotein, a siRNA, a mRNA, or a guide RNA mix.

30. The drug delivery system according to any one of the claims 1 to 29, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride and / or PD740, ii) between 1 and 20 mol percent of α-methoxy-ω-{N-(2-methyl-2- octadecyloxy-[1,3]dioxan-5-yl)-amido}-polyethylene glycol45, iii) between 15 and 45 mol percent of 2,2'-S,S- bis(monooleoylglycerol)phosphate or of 3,3'-S,S- bis(monooleoylglycerol)phosphate, and iv) between 13 and 35 mol percent of cholesterol.

31. The drug delivery system according to any one of the claims 1 to 29, wherein the lipid bilayer comprises i) 50 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride, ii) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5- yl)-amido}-polyethylene glycol45, iii) 20 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate or of 3,3'- S,S-bis(monooleoylglycerol)phosphate, and iv) 25 mol percent of cholesterol.

32. The drug delivery system according to any one of the claims 1 to 29, wherein the lipid bilayer comprises i) 50 mol percent of PD740, ii) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5- yl)-amido}-polyethylene glycol45, iii) 20 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate or of 3,3'- S,S-bis(monooleoylglycerol)phosphate, and iv) 25 mol percent of cholesterol. GAR-P04383WO55 Application (final).docx33. The drug delivery system according to any one of the claims 1 to 29, wherein the lipid bilayer comprises ia) 25 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride, ib) 25 mol percent of PD740, ii) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5- yl)-amido}-polyethylene glycol45, iii) 20 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate or of 3,3'- S,S-bis(monooleoylglycerol)phosphate, and iv) 25 mol percent of cholesterol.

34. The drug delivery system according to any one of the claims 1 to 29, wherein the lipid bilayer comprises i) 33 mol percent of PD740, ii) 7 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5- yl)-amido}-polyethylene glycol45, iii) 27 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate or of 3,3'- S,S-bis(monooleoylglycerol)phosphate, and iv) 33 mol percent of cholesterol.

35. The drug delivery system according to any one of the claims 1 to 29, wherein the lipid bilayer comprises i) between 42 and 50 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride, ii) between 4 and 5 mol percent of α-methoxy-ω-{N-(2-methyl-2- octadecyloxy-[1,3]dioxan-5-yl)-amido}-polyethylene glycol45, iii) between 4 and 15 mol percent of 2,2'-S,S- bis(monooleoylglycerol)phosphate or of 3,3'-S,S- bis(monooleoylglycerol)phosphate, iva) between 13 and 15 mol percent of cholesterol, and ivb) between 15 and 36 mol percent of solasodine.

36. The drug delivery system according to any one of the claims 1 to 29, wherein the lipid bilayer comprises ia) 25 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride, ib) 25 mol percent of PD740, ii) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5- yl)-amido}-polyethylene glycol45, GAR-P04383WO55 Application (final).docxiii) 20 mol percent of monogalactosyldiacylglycerol or 1-palmitoyl-2-linoleoyl- sn-glycero-3-phosphoethanolamine, and iv) 25 mol percent of cholesterol.

37. The drug delivery system according to any one of the claims 1 to 37, wherein the N:P ratio is from about 1:1 to about 50:

1.

38. The drug delivery system according to any one of the claims 1 to 37, wherein the liposome is a unilamellar and / or univesicular liposome. GAR-P04383WO55 Application (final).docx

Images