Pharmaceutical composition for treating osteoarthritis, comprising mitochondria-encapsulated cell membrane fusogenic liposomes

Abstract

The present invention provides a pharmaceutical composition for treating osteoarthritis, comprising mitochondria-encapsulated cell membrane fusogenic liposomes as an active ingredient.

Description

Pharmaceutical composition for treating osteoarthritis comprising membrane fusion-inducing liposomes encapsulating mitochondria

[0001] The present invention relates to a pharmaceutical composition for treating osteoarthritis, comprising fusogenic liposomes encapsulating mitochondria as an active ingredient.

[0002] Mitochondria (MTs) are vital cellular organelles with their own DNA (termed "mtDNA"). They are responsible for ATP synthesis, supplying energy to cells, including chondrocytes, through the TCA cycle and oxidative phosphorylation. Beyond their role in ATP production, MTs participate in essential cellular physiological processes, such as the production and regulation of reactive oxygen species (ROS) and the mediation of MT-dependent apoptosis. MTs also play a crucial role in the pathogenesis and progression of many diseases. Recent studies have suggested that MT dysfunction may play a key role in the pathogenesis of osteoarthritis (OA) [M. Fernandez-Moreno, et al., Ann Rheum Dis. 76(6), 1114-1122 (2017)].

[0003] Osteoarthritis (OA), a degenerative disease affecting cartilage, is primarily caused by inflammation and degeneration of cartilage. As OA progresses, chondrocytes, the primary cells of joint tissue, undergo pathological changes characteristic of chondrocyte aging, including changes in the morphology and function of MTs, the cells responsible for energy synthesis. In chondrocytes, MT dysfunction maintains a pro-inflammatory environment, which interferes with chondrocyte maintenance of the extracellular matrix (ECM), ultimately leading to cartilage degradation.

[0004] Current treatments for OA that target MT dysfunction are limited in their ability to restore MT function and prevent chondrocyte apoptosis [HA Kim, et al., Curr Drug Targets. 8(2), 333-345 (2007)]. These treatments have limitations in addressing the underlying problem of MT. Therefore, many researchers are exploring methods to directly deliver normal MT to chondrocytes as a treatment for OA. Such treatments could reduce inflammation-mediated cell death and enhance autophagy [R. Wang, et al., Chin Med J (Engl). 134(2), 212-218 (2020); AR Lee, et al., Immune Netw. 22(2), e14 (2022)].

[0005] MT transfer is an intriguing mechanism of intercellular communication that has attracted considerable attention in recent years. Spontaneous mitochondrial transfer, including through tunneling nanotubes, extracellular vesicles, and gap junction channels, has been studied in various cell types: from Jurkat cells to mesenchymal stem cells (MSCs), from astrocytes to injured neurons, and from bone marrow MSCs to injured neurons. The beneficial therapeutic effects of MT transfer have been reported in various diseases. For example, MT isolated from skeletal muscle of C57BL / 6 mice, co-cultured with BV2 microglia, was reported to alleviate sepsis-associated brain dysfunction [C. Yan et al., Mol Neurobiol. 57(9), 3875-3890 (2020)]. Similarly, it has been reported that MT isolated from human pluripotent adipose-derived stem cells, when co-cultured with cardiac cells, can treat myocardial infarction [M. Mahrouf-Yorgov, et al., Cell Death Differ. 24(7), 1224-1238 (2017)]. It has also been reported that MT isolated from mouse liver, when co-cultured with mouse hepatocytes, can treat liver damage [Z. Zhao, et al., Bioeng Transl Med. 6(2), e10209 (2021)].

[0006] Despite the potential benefits of MT delivery, delivering MT to damaged cells or tissues remains a significant challenge. Spontaneous MT delivery is rare, and not all tissues and organs exhibit robust transfer capacity [Z. Liu, et al., Cell Biosci. 12(1), 66 (2022)]. Therefore, current therapies rely on the delivery of isolated MT rather than enhancing spontaneous transfer.

[0007] The present inventors conducted various studies to develop a method for actively delivering MT. In particular, the present inventors designed various membrane fusion-inducing liposomes by encapsulating MT within liposomes, and conducted various studies to develop a method for effectively delivering MT into chondrocytes using these liposomes. As a result, the present inventors discovered that membrane fusion-inducing liposomes, obtained by encapsulating MT in liposomes composed of cationic and neutral lipids, can effectively treat osteoarthritis by actively delivering MT into chondrocytes through a membrane fusion mechanism, rather than endocytosis.

[0008] Accordingly, the present invention aims to provide a pharmaceutical composition for treating osteoarthritis, which comprises a cell membrane fusion-inducing liposome obtained by encapsulating MT as an active ingredient.

[0009] In one aspect of the present invention, a pharmaceutical composition for treating osteoarthritis is provided, which comprises, as an active ingredient, a cell membrane fusion-inducing liposome formed by encapsulating mitochondria inside a liposome made of a lipid including a cationic lipid.

[0010] In the pharmaceutical composition of the present invention, the lipid including the cationic lipid may include a neutral lipid and a cationic lipid.

[0011] The neutral lipid may be at least one selected from the group consisting of 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE), 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE), and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE). In one embodiment, the neutral lipid may be 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE).

[0012] The cationic lipid may be at least one selected from the group consisting of 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), dioctadecylamidoglycylspermine (DOGS), N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), 2,3-dioleyloxy-N-[2-(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate (DOSPA), and 3β-[N-(N',N'-dimethylaminoethyl)-carbamoyl]cholesterol (DC-Chol). In one embodiment, the cationic lipid may be 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP).

[0013] The molar ratio of the neutral lipid and the cationic lipid may be preferably 1:1 to 5, more preferably 1:1 to 3, and particularly preferably about 1:2.

[0014] The above mitochondria may preferably be mitochondria derived from human mesenchymal stem cells.

[0015] The above cell membrane fusion-inducing liposome can be obtained by a method comprising the steps of (a) preparing an aqueous dispersion comprising liposomes made of lipids including cationic lipids; and (b) mixing an aqueous dispersion comprising mitochondria with the aqueous dispersion of step (a) to form a cell membrane fusion-inducing liposome. In one embodiment, the mass ratio of the liposomes made of lipids including mitochondria and the cationic lipids may be preferably 1:1 to 10, more preferably 1:1 to 5, and particularly preferably about 1:2.

[0016] In the pharmaceutical composition of the present invention, the average diameter of the cell membrane fusion-inducing liposome may be 550 to 650 nm, and the zeta potential of the cell membrane fusion-inducing liposome may be 25 to 60 mV.

[0017] The membrane fusion-inducing liposomes obtained according to the present invention possess a positive Zeta potential due to their inclusion of cationic lipids, enabling effective active delivery of mitochondria into cartilage cells via a membrane fusion mechanism. Therefore, the membrane fusion-inducing liposomes can be useful for the treatment of osteoarthritis.

[0018] Figure 1 shows the characterization of FCs and FMCs and the nMT encapsulation of FCs.

[0019] A: This is a schematic diagram of FCs and FMCs.

[0020] B: Results of size distribution measurements of nMT, FCs, and FMCs.

[0021] C: Zeta potential measurement results of nMT, FCs, and FMCs.

[0022] D: Results of evaluating the morphology of FCs and FMCs using TEM.

[0023] E: CLSM and voxel images of FCs and FMCs. Green and red represent nMT and FCs, respectively.

[0024] F: FRET analysis results to evaluate mitochondrial encapsulation of FCs

[0025] G: AFM images and flexibility measurement results of FCs.

[0026] Figure 2 shows the results of evaluating the stability of FMCs and the stability of internal mitochondria compared to nMT.

[0027] A: This is the result of measuring the size change of FC over time at 4℃ to confirm stability compared to nMT and FMCs.

[0028] B: This is the result of observing CLSM and voxel images.

[0029] C: TEM images confirming the morphological stability of nMT and FMCs over time. Green and red represent nMT and FCs, respectively.

[0030] D: Time-course measurements of cytochrome C levels in internalized mitochondria from nMT and FMC2.

[0031] Figure 3 shows the results demonstrating that membrane fusion of FMC is faster and transfers a larger number of mitochondria than endocytosis of nMT.

[0032] A: These are the results of measuring the dose-dependent cytotoxicity of FCs and the time-dependent cytotoxicity of FC2.

[0033] B: CLSM image comparing the intracellular mitochondrial transfer efficiency of nMT versus FMCs.

[0034] C: Results comparing the efficiency of nMT and FMCs in transferring intracellular mitochondria into C28 / I2 cells by PCR and quantifying rat mtDNA copy number.

[0035] D: Fluorescence analysis of co-localization after C28 / I2 membrane staining following mitochondrial transfer by nMT and FMC2.

[0036] Figure 4 shows the differences in the mitochondrial transfer pathways used by nMT and FMC2 and the fate of the transferred mitochondria.

[0037] A: Schematic diagram showing the intracellular mitochondrial transport pathway used by nMT and FMC2.

[0038] B and C: CLSM images and line profiles showing the localization of mitochondria transported by nMT and FMC2 in early endosomes (B) or lysosomes (C). Line profiles were analyzed to further investigate the localization.

[0039] D: Western blot analysis for expression of the transferred MT degradation marker.

[0040] E: Heterogeneity analysis results and CLSM images showing the efficiency of mitochondrial transfer into C28 / I2 cells by nMT and FMC2 under endocytosis inhibition conditions.

[0041] Figure 5 shows the results of evaluating the therapeutic efficacy of mitochondria delivered to LPS-treated C28 / I2 cells by FMC2 in a two-dimensional model.

[0042] A: Schematic showing the basic repair mechanism of LPS-treated C28 / I2 cells treated with nMT and FMC2.

[0043] B: Western blot analysis of the expression of ECM markers and NF-kB signaling factors by LPS-treated C28 / I2 cells treated with nMT and FMC2.

[0044] C: Expression of mRNA encoding inflammatory factors (as measured by qRT-PCR) in LPS-treated C28 / I2 cells treated with nMT and FMC2.

[0045] D: Cytokine secretion (measured by ELISA) by LPS-treated C28 / I2 cells treated with nMT and FMC2.

[0046] Figure 6 shows the results of evaluating the degree of joint tissue formation and the therapeutic efficacy of mitochondria delivered by FMC2 in a 3D model (LPS-treated C28 / I2 spheroids).

[0047] A: Results of measuring cell proliferation and cell size in 3D cultures of LPS-treated C28 / I2 treated with nMT and FMC2 (n=20).

[0048] B: Expression (by qRT-PCR) of mRNA encoding ECM components, chondrogenic markers, and inflammatory factors in 3D spheroids of LPS-treated C28 / I2 cells treated with nMT and FMC2.

[0049] C: Immunostaining results of ECM and chondrogenic markers expressed by LPS-treated C28 / I2 spheroid sections treated with nMT and FMC2.

[0050] Figure 7 shows the results of evaluating cartilage penetration and recovery after mitochondria transfer to MIA-induced osteoarthritis model mice.

[0051] A: Schematic diagram showing the protocol for injecting nMT and FMC2 into damaged cartilage tissue of MIA-induced osteoarthritis mice.

[0052] B: CLSM images showing penetration of nMT and FMC2 into cartilage tissue after low and high dose injections, respectively, into the mouse knee joint.

[0053] C: Results of measuring the amount of serum IFN-γ (measured by ELISA) in MIA-induced osteoarthritis mice injected with high or low doses of nMT and FMC2.

[0054] D: Safranin-O and alcian blue staining of knee joints of MIA-induced osteoarthritic mice injected with low or high doses of nMT and FMC2 [femur (f) and tibia (t)].

[0055] E: Mankin score of MIA-induced osteoarthritic mice infected with low or high doses of nMT and FMC2.

[0056] Figure 8 shows the results of mitochondrial extraction and purity from human-derived mesenchymal stem cells. The expression of Lamin B1, TOMM20, and α-tubulin was measured in nuclear, mitochondrial, and cytoplasmic fractions generated during the isolation of mitochondria from human mesenchymal stem cells.

[0057] Figure 9 shows the results of evaluating (A) ATP production and (B) cytochrome C oxidase activity according to the amount of mitochondria extracted from mesenchymal stem cells.

[0058] Figure 10 shows the results of FRET analysis to determine the optimal ratio of isolated mitochondria to FCs for efficient encapsulation.

[0059] A: This is the result of FRET analysis on the mass ratio between isolated mitochondria and FC1.

[0060] B: This is the result of calculating FRET efficiency.

[0061] Figure 11 shows the results of heterogeneity analysis to determine the optimal mitochondria to FCs ratio for efficient delivery of FMCs into C28 / I2 cells.

[0062] A: Shows uptake of L6-driven mitochondria by C28 / I2 cells detected by PCR.

[0063] B: Results of quantitative analysis of uptake using ImageJ software.

[0064] Figure 12 shows confocal laser microscopy and voxel images of nMT and FMCs from day 0 to day 4.

[0065] Figure 13 shows the results of evaluating the optimal delivery time and dose of FC1 for delivery to C28 / I2 cells. That is, the results of analyzing the fusion efficiency as the delivery time and amount of FC1 delivered to C28 / I2 cells increase.

[0066] Figure 14 shows representative Z-stack (x and y sections) CLSM images showing the fusion of FC2 and C28 / I2 cell membranes. FC2 was delivered to the plasma membrane of C28 / I2 cells for 30 min, and co-localization with the cell membrane was confirmed by fluorescent staining.

[0067] Figure 15 shows the results of evaluating mitochondrial damage due to endosome formation during endocytosis.

[0068] Figure 16 shows the results of evaluating the efficiency of mitochondrial transfer into C28 / I2 cells by nMT and FMC2 under conditions that inhibit endocytosis by heterologous MT transfer. A temperature of 4°C inhibits cell membrane activity, and AML inhibits macropinocytosis. CPM inhibits clathrin-mediated endocytosis, and FLP inhibits caveolin-mediated endocytosis.

[0069] Figure 17 shows the results of evaluating whether LPS induces a pro-inflammatory (pro-osteoarthritis) environment in chondrocytes. A is the result of Western blotting detecting ECM components and inflammatory factors in C28 / I2 cells treated with LPS, and B is the result of measuring ATP production in C28 / I2 cells treated with LPS.

[0070] Figure 18 shows the results of measuring the tissue penetration efficiency of nMT and FMC2 when mitochondria were delivered to cartilage tissue.

[0071] Figure 19 shows CT-PET images of cartilage tissue of osteoarthritis model mice treated with nMT and FMC2.

[0072] There have been many attempts to use mitochondria (MT) to treat human diseases. We developed a delivery strategy based on membrane fusion. Specifically, we designed and synthesized fusogenic mitochondrial capsules (FMCs) containing neutral lipid (PE), cationic lipid (DOTAP), and aromatic lipid (Liss Rhod PE) and three types of fusogenic liposomes (FMC0, FMC1, and FMC2). The amount of DOTAP, which affects membrane fusion efficiency, varied among the FMC formulations. The characteristics of these FMCs were analyzed by DLS, TEM, and AFM, and the encapsulation and fusion efficiencies between FMC-MT and FMC-chondrocytes were determined by FRET, mtDNA copy number, and CLSM, respectively. Compared to native MTs, FMCs delivered into chondrocytes more quickly and efficiently. Furthermore, membrane fusion was a more stable delivery method than endocytosis, as evidenced by reduced expression of mitophagy (as measured by Western blot). In vitro and in vivo experiments revealed that FMCs reduced the expression of inflammatory cytokines and MMP13, increased the expression of extracellular matrix components, and promoted cartilage regeneration. These results suggest that FMCs are a highly effective and promising strategy for MT delivery to promote cartilage regeneration and have potential as a new platform for MT delivery therapies.

[0073] The present invention provides a pharmaceutical composition for treating osteoarthritis, which comprises, as an active ingredient, a cell membrane fusion-inducing liposome formed by encapsulating mitochondria inside a liposome composed of a lipid including a cationic lipid.

[0074] Liposomes have a lipid bilayer structure formed from, for example, cationic, anionic, and / or neutral lipids. In the pharmaceutical composition of the present invention, the liposome is formed from a lipid comprising a cationic lipid. For example, the lipid comprising the cationic lipid may include a neutral lipid and a cationic lipid.

[0075] The above neutral lipid may be selected from the group consisting of, but is not limited to, one or more selected from the group consisting of 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE), 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE), and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE). In one embodiment, the neutral lipid may be 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE).

[0076] The cationic lipids are 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), dioctadecylamidoglycylspermine (DOGS), N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), 2,3-dioleyloxy-N-[2-(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate, DOSPA), and 3β-[N-(N',N'-dimethylaminoethyl)-carbamoyl]cholesterol (3β-[N-(N',N'-dimethylaminoethyl)-carbamoyl]cholesterol, DC-Chol). In one embodiment, the cationic lipid may be 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP).

[0077] The ratio of neutral lipid and cationic lipid is not particularly limited, and for example, the molar ratio of the neutral lipid and cationic lipid may be preferably 1:1 to 5, more preferably 1:1 to 3, and particularly preferably about 1:2.

[0078] The above mitochondria may be used without limitation as mitochondria isolated from human cells or tissues. Unless otherwise specified herein, "mitochondrion" means "mitochondrion isolated from the body." Isolation of mitochondria may be performed according to methods commonly used in the field of biotechnology. Preferably, the mitochondria may be mitochondria derived from (i.e., isolated from) human mesenchymal stem cells (human MSCs). MT derived from human MSCs can be preferably applied to the regeneration of chondrocytes due to their unique characteristics such as excellent self-renewal capacity, excellent differentiation potential, and paracrine function.

[0079] The above-described cell membrane fusion-inducing liposome can be obtained by various encapsulation methods using liposomes composed of lipids including mitochondria and cationic lipids. For example, the cell membrane fusion-inducing liposome can be obtained by a method including the steps of: (a) preparing an aqueous dispersion comprising liposomes composed of lipids including cationic lipids; and (b) mixing the aqueous dispersion containing mitochondria with the aqueous dispersion of step (a) to form the cell membrane fusion-inducing liposome. The aqueous dispersion of step (a) can be obtained by dispersing liposomes (i.e., liposomes composed of lipids including lipids) in an aqueous medium such as distilled water. The aqueous dispersion containing mitochondria can be obtained by dispersing mitochondria in an aqueous medium such as DPBS. The mixing can be performed by a conventional method, and can be performed by, for example, multiple pipetting two or more times. The volume ratio of the above mitochondria-containing dispersion and liposome-containing dispersion is not particularly limited. For example, when the mass ratio of mitochondria (MT) and liposomes (FCs) is 1:2, the volume ratio of the MT dispersion and the FCs dispersion may be about 1:5, but is not limited thereto.

[0080] It has been discovered by the present invention that the mass ratio of the liposomes composed of the mitochondria and the lipids including the cationic lipids affects the shear mechanism of the resulting cell membrane fusion-inducing liposomes. That is, in the step (a), the mass ratio of the liposomes composed of the mitochondria and the lipids including the cationic lipids may be preferably 1:1 to 10, more preferably 1:1 to 5, and particularly preferably about 1:2.

[0081] The cell membrane fusion-inducing liposomes obtained by the above method can be stored and / or used by drying (e.g., lyophilization) according to a conventional method. The obtained cell membrane fusion-inducing liposomes may have, for example, an average diameter of 550 to 650 nm and a zeta potential of 25 to 60 mV.

[0082] The pharmaceutical composition of the present invention can be formulated into various dosage forms that include, in addition to the cell membrane fusion-inducing liposome as an active ingredient, a pharmaceutically acceptable carrier. That is, the pharmaceutical composition of the present invention can be in the form of a preparation for parenteral administration such as an injection, for example, a form suitable for intramuscular, intraperitoneal, subcutaneous, or intravenous administration, and can be in a single-dose or multiple-dose dosage form. The injection is usually prepared as a sterile solution of the cell membrane fusion-inducing liposome of the present invention, and the pH of the solution should be suitably adjusted and buffered. In the case of intravenous administration, the total concentration of the solute should be adjusted to impart isotonicity to the preparation. The pharmaceutical composition can be in the form of an aqueous solution containing a pharmaceutically acceptable carrier, such as saline having a pH of 7.4. In one embodiment, the pharmaceutical composition of the present invention can be administered once or multiple times daily at a dosage of 0.5 to 2 mg / kg of the cell membrane fusion-inducing liposome. Of course, the above dosage and frequency of administration can be appropriately adjusted depending on the patient's condition, age, severity, etc.

[0083] Hereinafter, the present invention will be described in more detail through examples. However, these examples are intended to illustrate the present invention and the present invention is not limited to them.

[0084] Example

[0085] 1. Materials and experimental methods

[0086] (1) Materials

[0087] Neutral lipid 18:0 PE (1,2-distearoyl-sn-glycero-3-phosphoethanolamine), cationic lipid 18:1 DOTAP (1,2-dioleoyl-3-trimethylammonium-propane), and fluorescently labeled lipid 18:1 Liss Rhod PE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(lissamine rhodamine B sulfonyl) (ammonium salt)) were purchased from Avanti Polar Lipids (Alabama, USA). Dulbecco's modified Eagle's medium (high glucose, DMEM-high), fetal bovine serum (FBS), and Dulbecco's phosphate-buffered saline (DPBS) were purchased from HyClone (Logan, Canada). Dulbecco's modified Eagle's medium F-12 (DMEM-F12) was purchased from Welgene (Gyeongsangbuk-do, South Korea). Antibiotic-antimycotic solution and trypsin-EDTA were purchased from Gibco (Massachusetts, USA). The mitochondrial isolation kit was purchased from Thermo Fisher Scientific (Massachusetts, USA). Mitotracker Green FM, Mitotracker Deep Red FM, Green dextran, and Lysotracker Deep Red were purchased from Invitrogen (California, USA). Wortmannin and lipopolysaccharide (LPS) were purchased from Sigma-Aldrich (Missouri, USA).

[0088] (2) Cell culture

[0089] Human mesenchymal stem cells (hMSCs) were obtained from Lonza (Basel, Switzerland), and the rat L6 cell line was obtained from ATCC (Virginia, USA). hMSCs and L6 cells were cultured in DMEM-high (SH30243.01, HyClone) supplemented with 10% FBS and 1% antibiotic-antimycotic solution at 37°C / 5% CO2. The culture medium was changed every 2 days, and most experiments were performed using cells at passage 7–9. The C28 / I2 cell line was purchased from Sigma-Aldrich (Burlington, USA) and cultured in DMEM F-12 (LM002-04, Welgene) supplemented with 10% FBS and 1% antibiotic-antimycotic solution at 37°C / 5% CO2. The culture medium was changed every 2 days, and most experiments were performed using cells at passage 25–30.

[0090] (3) Isolation of MT from donor cells

[0091] MTs were isolated from hMSCs and L6 cells by differential centrifugation using the MT Isolation Kit (89874, Thermo Fisher Scientific). Cells were thawed in 150 mm cell culture plates (150468, Thermo Fisher Scientific) and harvested using a cell scraper (90030, SPL) when 90% confluence was reached. The resulting pellet was suspended in isolation buffer containing protease inhibitors. The suspension was then centrifuged at 700 × g for 10 min at 4°C. The resulting supernatant was further centrifuged at 12,000 × g for 15 min at 4°C to pellet mitochondria. The supernatant was discarded, and the MT pellet was resuspended in DPBS at 4°C. For quantification, isolated MTs were lysed in 2% CHAPS in TBS (C3023, Thermo Fisher Scientific) for 1 min, and the concentration of isolated MTs was measured using a BCA protein assay kit (23227, Thermo Fisher Scientific).

[0092] (4) Synthesis and characterization of FCs and FMCs

[0093] Membrane fusion-inducing liposomes were synthesized using a film hydration method. Lipid components containing PE (850715P), DOTAP (890890P, Avanti Polar Lipids), and Liss Rhod PE (810150P) were mixed in chloroform at a PE / DOTAP / LissRhod PE molar ratio of 1 / 0 / 0.1 for FC0, 1 / 1 / 0.1 for FC1, and 1 / 2 / 0.1 for FC2. The chloroform was evaporated overnight in air, and the lipids were dispersed in distilled water (lipid concentration, 6 mg / mL). The FCs were stored at 4°C before use. FMCs were formed by mixing the MT dispersion in DPBS with the FCs dispersion by multiple pipetting so that the MT and FCs had a predetermined mass ratio. When the mass ratio of the isolated MTs and FCs was 1:2, the volume ratio of the MT dispersion and the FCs dispersion was approximately 1:5. The sizes and surface charges of the FCs and FMCs were analyzed by dynamic light scattering (DLS; Zetasizer Nano ZS, Malvern Panalytical, Malvern, UK), and observed by TEM (Hitachi, Tokyo, Japan) and CLSM (Olympus FV3000, Tokyo, Japan). Voxel images were obtained using CellSens software (Olympus, Japan). The MT encapsulation efficiency of the FCs was analyzed by FRET (Fluorescence Resonance Energy Transfer assay), and the surface roughness of the FCs was analyzed by AFM (PSIA XE150, Korea).

[0094] (5) Stability evaluation of nMT and FMC

[0095] Long-term size changes in FCs and short-term size changes in FMCs were analyzed by DLS. Structural changes in FMCs were observed by TEM and CLSM, and voxel images were obtained using CellSens software. On days 0 and 1, nMT and FMC2 were solubilized using CHAPS and Tween 20, and the expression of cytochrome c and TOMM20 (a translocase of the mitochondrial membrane complex subunit 20) proteins was analyzed with specific antibodies (ab76107, Abcam; and sc-17764, Santa Cruz, respectively).

[0096] (6) Evaluation of MT delivery to recipient cells by nMT and FMCs

[0097] C28 / I2 cells were seeded at 5.0 x 10 per well in a 12-well plate. 4Cells were seeded at a density of 100 μg and cultured at 37°C / 5% CO2. MTs were isolated from L6 cells using an MT isolation kit (89874, Thermo Fisher Scientific). FMCs were synthesized by mixing 2 μg of the isolated MTs with FCs at a 1:2 ratio. Subsequently, nMTs and FMCs were delivered to the cells for 1 hour. Genomic DNA was extracted from C28 / I2 cells using a gDNA prep kit (106-101, GeneAll). PCR was performed under appropriate conditions using the primers listed in Table 1 below, and the PCR products were visualized using a gel documentation imaging system (BR170-8265; Bio-Rad Laboratories, Korea). Isolated MTs stained with MitoTracker Green FM (M7514, Invitrogen) were transferred to C28 / I2 cells stained with MitoTracker Deep Red FM (M22426, Invitrogen) and observed by CLSM. In addition, C28 / I2 membranes were stained with PlasMem Bright Green (P504, DOJINDO), and FMC2 was transferred to the cells, and co-localization with the membrane was observed by CLSM.

[0098] Gene sequence number sequence (5' → 3') Human mtDNA1 Forward TTAACTCCACCATTAGCACC2 Reverse GAGGATGGTGGTCAAGGGARat mtDNA3 Forward CCTCCCATTCATTATCGCCGCCCTTGC4 Reverse GTCTGGGGTCTCCTAGTAGGTCTGGGAAAggrecan5 Forward CTACCAGTGGATCGGCCTGAA6 Reverse CGTGCCAGATCATCACCACACOL Ⅹ7 Forward CCACCAGGCATTCCAGGATT8 Reverse AAGACCAGGCTCTCCAGAGTMMP-39 Forward CAAGGAGGCAGGCAAGACAGC10 Reverse GCCACGCACAGCAACAGTAGGMMP-1311 Forward TTGTTGCTGCGCATGAGTTCG12 Reverse GGGTGCTCATATGCAGCATCASOX913 Forward GGTGCTCAAGGGCTACGACT14 Reverse GGGTGGTCTTTCTTGTGCTGIL-615 Forward ACTCACCTCTTCAGAACGAATTG16 Reverse CCATCTTTGGAAGGTTCAGGTTGTNFα17 Forward CCTCTCTCTAATCAGCCCTCTG18 Reverse GAGGACCTGGGAGTAGATGAGGAPDH19 Forward CGCTGAGTACGTCGTGGAGT20 Reverse ATGATGTTCTGGAGAGCCCC

[0099] (7) MT delivered to recipient cells

[0100] C28 / I2 cells were seeded at 1.5 × 10 per well in 35-mm confocal dishes (103350, SPL). 5Cells were seeded at a density of 100 μg and cultured at 37°C / 5% CO2. MTs were isolated from hMSCs and labeled with MitoTracker Deep Red FM (M22426, Invitrogen). Next, 4 μg of nMT and FMC2 were delivered to C28 / I2 cells pretreated with 100 nM wortmannin (W1628, Sigma-Aldrich) for 30 min, along with the endocytosis marker green dextran (P35368, Invitrogen). After 30 min of delivery, co-localization of MTs with endosomes was visualized by CLSM. Similarly, isolated MTs were labeled with MitoTracker Green FM (M7514, Invitrogen) and transferred to C28 / I2 cells pre-labeled with LysoTracker Deep Red (L12492, Invitrogen) for 4 h. Co-localization of lysosomes and MTs was also visualized by CLSM. To analyze co-localization between MTs and endosomes or lysosomes, line profiles were generated using CellSens software.

[0101] (8) Functional evaluation of the delivered MT

[0102] C28 / I2 cells were seeded at 1.5 x 10 per well in a 6-well plate. 5Cells were seeded at a density of 100 μg / mL and cultured overnight at 37°C / 5% CO2. Cells were then treated with 1.5 μg / mL LPS (L3491, Sigma-Aldrich) for 24 h, and then co-cultured with 4 μg of nMT and FMCs in serum-free medium for 1 h, after which the medium was replaced. Four hours after MT delivery, the extent of recovery was analyzed at the mRNA and protein levels. Eight days after MT transplantation, the same analysis was performed using 3D cell cultures for evaluation. To analyze mRNA levels, total RNA was extracted from the cells using Trizol reagent (15596026, Invitrogen), and cDNA was synthesized. Real-time PCR was performed under appropriate conditions using SYBR Green master mix (Takara, Japan) and the specific primers listed in Table 1. To assess protein levels, cells were lysed in radioimmunoprecipitation (RIPA) buffer, and protein lysates (30 μg) were separated on a 10% SDS-PAGE gel and transferred to PVDF membranes. The membranes were then probed with primary antibodies specific for the target proteins, followed by the appropriate HRP-conjugated secondary antibodies (Bio-Rad, Hercules, CA, USA). Protein signals were detected using a gel documentation imaging system (BR170-8265; Bio-Rad Laboratories, Korea).For Western blotting, the following primary antibodies were used: COL II (collagen type 2, MAB8887, Millipore), MMP-13 (matrix metallopeptidase 13, ab51072, abcam), NF-κB (Nuclear factor kappa B, #8242S, Cell Signaling Technology), and Phospho-NF-κB (phospho-nuclear factor kappa B, #3033S, Cell Signaling Technology). To measure cytokine levels, ELISA kits specific for human IL-6 (Interleukin 6, 430507, BioLegend) and human IFN-γ (Interferon gamma, 430107, BioLegend) were used according to the manufacturers' instructions.

[0103] Three-dimensionally cultured cell spheroids were fixed with 4% paraformaldehyde, dehydrated in 20% sucrose solution, and cryosectioned (Leica, Wetzlar, Germany). The sections were then subjected to immunofluorescence (IF) staining. Briefly, the sections were permeabilized with 0.1% Triton X-100 and incubated with 1% BSA for 1 h. Primary antibodies against SOX9 (SRY-box transcription factor 9, ab76997, abcam) and COL II (collagen type 2, MAB8887, Millipore) were added, and the samples were incubated overnight. After washing, secondary antibodies conjugated to Alexa Fluor 488 and Alexa Fluor 647 were added for 30 min, followed by DAPI staining for 5 min. The sections were mounted in Canada balsam (C0249, SAMCHUN chemical) and visualized by CLSM.

[0104] (9) Evaluation of cell proliferation after MT delivery

[0105] C28 / I2 cells were seeded at 1.5 x 10 per well in a 6-well plate. 5 Cells were seeded at a density of 100 cells / plate and cultured overnight at 37°C / 5% CO2. Next, cells were treated with 1.5 μg / mL LPS (L3491, Sigma-Aldrich) for 24 h. Afterwards, cells were co-cultured in serum-free medium containing 4 μg of nMT and FMCs for 1 h, and then the medium was replaced. MT-transduced C28 / I2 cells (1.0 × 10 per plate) 6 (Canine cells) were seeded on 35 mm patterned dishes coated with human cartilage glycoprotein (HCG) (101896, SPL). Cells were cultured for 10 days, and images were captured using an optical microscope (ECLIPSE Ts2, Nikon) on days 1 and 10. The spheroid sizes of the captured images (n=20) were measured using Photoshop CS6 software (Adobe, San Jose, CA, USA).

[0106] (10) In vivo experiments and histological analysis

[0107] Animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of CHA University (Approval No. IACUC220173). Eight-week-old Balb / c nude mice were purchased from Orient Bio (Seongnam, Korea).

[0108] To visualize cartilage infiltration by injected MT, nMT and FMC2 (10 μg (low dose) and 30 μg (high dose)) stained with MitoTracker Deep Red FM (L12492, Invitrogen) were injected into the knee joint cartilage. After 1 day, the mice were sacrificed, and the knee joints were obtained.

[0109] To evaluate the recovery of osteoarthritic cartilage after mitochondrial transfer, a mouse model of osteoarthritic cartilage was generated by injection of monosodium iodoacetate (MIA; I9148, Sigma-Aldrich). Briefly, 20 μL of MIA (3 mg / mL, diluted in saline) was injected into the knee joint cartilage of mice. One week after MIA injection, mice were infected with nMT and FMC2 (twice and five times every 5 days, respectively). Six weeks after MIA injection, mice were sacrificed, and knee joints were obtained for further histological analysis. Serum was also collected for measurement of IFN-γ (Mouse IFN-γ ELISA kit, 430807, BioLegend).

[0110] Whole knee joints were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin. Sections were deparaffinized in xylene and dehydrated in graded ethanol and water. After DAPI staining, cartilage sections were observed using CLSM. To investigate the repair of osteoarthritic cartilage, all samples were stained with Safranin-O and Alcian blue to examine cartilage morphology. Based on the Safranin-O staining results, Mankin scores were calculated across four categories: structure, cellularity, proteoglycan depletion, and tidemark integrity. Details are provided in Table 2.

[0111]

[0112] (11) Statistical analysis

[0113] Statistical analysis was performed using Student's t-test and SigmaPlot software. Statistical significance levels were set at *P<0.05, **P<0.01, and ***P<0.001.

[0114] 2 Results and Discussion

[0115] (1) Characterization of FC and FMCs and evaluation of MT encapsulation

[0116] After stem cell lysis, we isolated naked mitochondria (nMT) from the nuclear / MT / cytoplasmic fractions. We then examined the expression of the MT marker protein Lamin B1 (nuclear-specific) and the mitochondrial import receptor TOMM20 (Fig. 8). Fractionation efficiency was assessed by measuring the expression of the cytoplasmic marker α-tubulin. To confirm the function of the isolated MTs, we measured the amount of ATP in the lysate and the expression of cytochrome C oxidase (CCO); both increased with increasing MT number (Fig. 9). This suggests that the MTs isolated from stem cells function normally.

[0117] To stably encapsulate anionic MTs, fusogenic capsules (FCs) were generated by increasing the amount of cationic lipid DOTAP. Figure 1A provides a brief description of this method. The liposomes consisted of PE, Liss Rhode PE, and DOTAP. We varied the ratio of cationic lipid DOTAP to 0, 1, and 2. Liss Rhode PE emitted red fluorescence, allowing for detailed imaging of the liposomes.

[0118] Encapsulation of MTs into FCs was indirectly confirmed by measuring changes in liposome size using dynamic light scattering (DLS). FCs without MTs (MT non-encapsulated, liposome only) were smaller than FMCs containing mitochondria (MT encapsulated) (Fig. 1B). The size change of approximately 25–80 nm indicates that liposomes become larger as MTs are encapsulated.

[0119] Next, we investigated how the amount of DOTAP affected the zeta potential (ZP) of liposomes after MT encapsulation (Fig. 1C). MT itself has a negative charge of approximately -38 mV. However, the positively charged lipids within the liposomes have a high charge of over +40 mV. As the proportion of positively charged DOTAP increased, the ZP increased. The use of cationic liposomes (FC1 and 2) containing DOTAP is advantageous for MT encapsulation because cationic liposomes (FC1 and 2) interact more readily with the anionic membrane structure of MT through electrostatic interactions than anionic liposomes (FC0). Furthermore, the positively charged membrane-fusion-inducing MT capsules (FMC1 and FMC2) can fuse better with negatively charged cell membranes.

[0120] FCs and FMCs were imaged using transmission electron microscopy (TEM) (Fig. 1D). Morphologically, there was no difference in the appearance of FCs and FMCs, suggesting that the FMCs encapsulating mitochondria maintained a stable structure. Furthermore, confocal laser scanning microscopy (CLSM) analysis revealed stable encapsulation of MTs depending on the ratio of DOTAP (Fig. 1E). MTs labeled with MitoTracker Green were encapsulated within liposomes, and the green fluorescence overlapped with the red fluorescence of rhodamine (liposomes). This overlapping (yellow) signal indicates that many MTs were encapsulated within the liposomes. Furthermore, spatial imaging within the capsules confirmed the stability of the MTs encapsulated within the liposomes. However, the MT encapsulation efficiency increased with increasing DOTAP amounts.

[0121] The efficiency of MT encapsulation was measured by fluorescence resonance energy transfer (FRET) analysis according to the distance between the MitoTracker Green-labeled MT signal (λex=490 / λem=516) and the rhodamine signal (λex=560 / λem=583) contained within the liposomes (Fig. 1F). FRET efficiency was calculated using a graph obtained by exciting with a 488 nm laser and measuring the emission wavelength range from 520 to 650 nm. FMC2, which contained the highest amount of DOTAP, showed the highest MT encapsulation efficiency, and this efficiency increased as the DOTAP ratio increased.

[0122] To determine the optimal MT:FC ratio for encapsulation, we performed a screening experiment and found that a ratio of 1:2 was most effective (Fig. 10). This result was validated by heterogeneity analysis (Fig. 11), indicating that rat mtDNA expression in cells was highest in FMCs prepared using this ratio of MT:liposomes. Therefore, this ratio was used in all subsequent experiments, and the encapsulated mitochondrial capsule is referred to as FMC2.

[0123] The physical properties of FCs with varying DOTAP ratios were investigated using atomic force microscopy (AFM) (Fig. 1G). The FCs had similar diameters (ranging from 600 to 700 nm), but varied in height. FC0 was measured to be 130 nm, FC1 50 nm, and FC2 18 nm. The corresponding Rq values ​​were 49.85, 17.31, and 7.56, respectively. These results confirm that the flexibility of FCs was directly proportional to the amount of DOTAP, while the rigidity was inversely proportional to the amount of DOTAP. These results suggest that both DOTAP content and flexibility are important for optimizing the MT-encapsulation efficiency of liposomes. Taken together, these results suggest that FMC2 is optimal.

[0124] (2) Stability of FMCs and internal mitochondria (compared to nMT)

[0125] The stability of FCs and FMCs over time was investigated and compared with that of nMT (Fig. 2). The manufactured FCs and FMCs were stored in buffer solution for 12 weeks and 5 days, respectively, and the extent to which capsule formation was maintained was measured by DLS (Fig. 2A). As a result, FCs were confirmed to maintain their original size for up to 12 weeks, regardless of the DOTAP ratio. Similarly, all three types of FMCs remained stable for up to 5 days with no measurable size change. However, the size of nMT increased significantly from day 3. This suggests that the stability of liposomes after MT encapsulation did not change significantly, as the cationic nature of liposomes prevents fusion through electrostatic repulsion.

[0126] To visually confirm these results, the morphology of nMT and FMCs was observed on days 0 and 3 using CLSM (Fig. 2B). On day 0, both nMT and FMC were evenly distributed. Notably, voxel imaging confirmed that MTs were well encapsulated within FMCs. On day 3, the size of nMTs in solution increased due to aggregation between MTs. In contrast, the distribution of FMCs remained stable, and the encapsulated morphology was well maintained. The results of daily observations (up to 4 days) are shown in Fig. 12. TEM was performed to further clarify the changes observed on day 3 (Fig. 2C). Similar to the previous results, FMCs maintained their morphology and distribution, whereas nMTs formed aggregates and some were destroyed.

[0127] The above data demonstrate that FMCs enhance the physical stability of isolated MTs. However, it remains to be determined whether MTs within FMCs are viable and functional. Normal mitochondria contain cytochrome c (CytoC), and cell death occurs when CytoC leaks out. Therefore, the expression of MT CytoC was assessed as an indicator of MT survival using Western blot analysis (Fig. 2D). The amount of CytoC was normalized to the amount of TOMM20, a protein present in the MT outer membrane. On day 1, MT CytoC expression was significantly higher in FMC2 than in nMT. This suggests that nMTs leaked CytoC, indicating nonviability.

[0128] These results indicate that encapsulation of isolated MTs stabilizes their function. They also suggest that FMCs administered to cells or tissues will maintain stability and function.

[0129] (3) Delivery to LPS-treated C28 / I2 cells by FMCs

[0130] The cytotoxicity of the liposomal delivery system was investigated (Fig. 3A). Three types of FCs were evaluated by treating cells with up to 75 μg of FC. At this dose, FC1 exhibited minimal cytotoxicity. The viability of cells exposed to FC0 and FC2 at 30 μg was >80%. Cells were exposed to 7.5, 15, and 30 μg of FC2, and viability was assessed for up to 4 hours, with no noticeable cytotoxicity. Furthermore, cells were exposed to FCs (4 and 8 μg) for 0.5 and 1 hour to observe fusion efficiency (Fig. 13). Fusion after 1 hour was higher than after 0.5 hours, and 8 μg of FCs exhibited a higher fusion efficiency than 4 μg of FCs. Based on this, an 8 μg FC dose was used in further experiments.

[0131] CLSM was performed to confirm the transfer of membrane fusion-induced MTs (Fig. 3B). MTs from recipient C28 / I2 cells were stained blue, MTs from donor MSCs were stained green, and FMCs were labeled red. The fluorescence intensities of recipient MTs (blue) were similar, but the signals from donor MTs (green) from FMC1 and FMC2 were significantly stronger than those from nMT and FMC0. Red fluorescence intensity (indicating fusion efficiency) was also measured, and the results confirmed that FMC2 exhibited the most efficient membrane fusion-induced MT transfer.

[0132] To quantitatively verify this phenomenon, we analyzed mtDNA copy numbers after heterologous MT delivery (Fig. 3C). Since the recipient cells (C28 / I2) were human-derived, the donor (heterogeneous) MTs were isolated from the rat myoblast L6 cell line. After 1 h, more rat MTs were delivered to the cells by FMC1 and FMC2 than by nMT. After 4 h, FMC2 delivered the most MTs. In contrast, nMT and FMC0 delivered significantly less, although at similar levels at 1 and 4 h. Therefore, FMC2 is the platform that delivers the most MTs in the shortest time. Taken together, these results indicate that nMT and FMC0 are delivered via the endocytic pathway, whereas FMC1 and FMC2 are delivered via the membrane fusion pathway, suggesting that the latter is a more advantageous strategy.

[0133] Membrane fusion with LPS-treated C28 / I2 cells was monitored, confirming that FMC2 was the most efficient MT delivery platform (Fig. 3D). In Fig. 3D, the green signal represents the plasma membrane (PM), the cyan signal represents transferred MT, and the red signal represents FMC2. Unlike untreated (NT) cells, the cytoplasm of cells exposed to nMT and FMC2 contained MT. Furthermore, the green and red signals in cells exposed to FMC2 overlapped, indicating membrane fusion (yellow). Similarly, membrane fusion occurred when cells were exposed to empty (MT-free) FC2 capsules (Fig. 14).

[0134] (4) Differences in endocytosis and membrane fusion pathways for MT transport

[0135] As mentioned above, there are two pathways by which MTs can be transported into cells, via nMT and FMC2 (Figure 4A). Endocytosis is a common mechanism for transporting foreign substances into cells. However, when foreign substances are transported via endocytosis, they must escape from the endosome, as they are removed and degraded by lysosomes. Therefore, MTs transported into the cytoplasm via endocytosis are at risk of degradation. In contrast, MTs transported by FMCs bypass this process. Instead, FMCs fuse with the cell membrane, creating a channel that allows encapsulated MTs to be transported directly into the cytoplasm.

[0136] The fate of mitochondria delivered into cells using these two methods was observed by CLSM (Fig. 4B). Mitochondria were stained blue by Mitotracker, early endosomes (EE) were stained green, and FMC2 was stained red. No liposome signal was observed for nMT, only EE and MT signals. The cropped image in Fig. 4B shows overlap of the EE and MT signals (cyan; indicated by the red arrow). Furthermore, line profiling revealed overlap of the green and blue peaks (red highlight). In contrast, FMC2 liposome signals were observed throughout the cell membrane, confirming fusion and the separation of EE and MT signals (yellow arrow). Similarly, the line profiles did not overlap (yellow highlight). These results confirm that nMT enters cells via endocytosis, whereas FMC2 transports MT via membrane fusion.

[0137] A key difference between nMT and FMC2 is that nMT enters cells by forming endosomes, whereas FMC2 transports MTs through membrane fusion. Therefore, the effect of endosomal pH was investigated (Figure 15). JC-1 staining, an indicator of MT membrane potential (MMP), showed a decrease in MMP at pH 5.5 (the pH of late endosomes) compared to pH 7.4. This suggests that MTs may be functionally impaired when exposed to acidic conditions. Therefore, endocytosis is not suitable for MT transport.

[0138] Typically, if foreign material inside the endosome cannot escape, it is removed by lysosomes. Therefore, to determine whether the delivered MTs are digested in the cytoplasm, lysosomes were stained green and cells were observed using CLSM (Fig. 4C). In the case of nMTs, a significant number of MTs overlapped with lysosomes, resulting in a cyan signal (red arrows). This overlap was confirmed by line profiling (red highlight), indicating that the delivered MTs were digested by lysosomes. Conversely, imaging and line profiling results indicate that the FMC2 signal was clearly separated from the MT and lysosome signals (yellow highlight).

[0139] We examined the expression of parkin and LC3B, markers of mitophagy (Fig. 4D). Mitophagy is a process that causes the digestion of MTs. The expression of both parkin and LC3B was significantly lower after delivery via FMC2 than after delivery via nMT. Similar to the lysosomal results, these data suggest that MTs delivered via FMC2 are more viable because they are delivered directly to the cytosol, whereas a significant portion of MTs delivered via nMT are digested via lysosomes and mitophagy. Therefore, the net amount of MTs delivered via FMC2 may be higher because MT digestion by lysosomes and mitophagy is minimal.

[0140] By inhibiting cell membrane activity at low temperature (4°C), we compared the MT delivery efficiency by nMT and FMC2 (Fig. 4E). The data showed that nMT was half as efficient at 4°C compared to 37°C. However, FMC2 was equally efficient at both temperatures. Therefore, FMC2 can deliver MT even when cell membrane activity is reduced. We also tested the effects of various drugs that inhibit endocytosis (Fig. 16). Inhibition of endocytosis reduced nMT delivery into C28 / I2 cells. However, delivery by FMC2 was unaffected. This suggests that FMC2 can deliver substances even into cells with low cell membrane activity. In other words, these data suggest that fusion with the cell membrane is a more advantageous strategy than endocytosis.

[0141] (5) Recovery of cellular function after mitochondrial transfer in a two-dimensional osteoarthritis model (LPS-treated C28 / I2 cells)

[0142] A two-dimensional osteoarthritis model was created to determine whether C28 / I2 cells were damaged by LPS exposure (Fig. 17). As a result, we confirmed that LPS-responsive COL II (type II collagen) expression decreased and MMP-13, IL-6, and TNF-α expression increased. Furthermore, we confirmed that mitochondrial dysfunction was induced by decreased ATP content. Therefore, LPS-treated C28 / I2 cells can be used as a two-dimensional model of osteoarthritis.

[0143] Because LPS induces pathological responses such as NF-κB phosphorylation and intracellular inflammatory cytokine production, we investigated the extent of cell recovery after MT delivery into a two-dimensional arthritis model (Fig. 5A). LPS-treated cells were exposed to nMT and FMC2, and NF-κB phosphorylation and the expression of COL II and MMP-13 were examined (Fig. 5B). After exposure of cells to nMT and FMC2, COL II expression increased. However, FMC2 decreased MMP-13 expression. This effect was promoted by the inhibition of NF-κB phosphorylation by the delivered MT.

[0144] After MT delivery, changes in the expression of mRNA encoding IL-6 and TNF-α, known inflammatory factors associated with osteoarthritis, were measured by qRT-PCR (Fig. 5C). Results revealed a decrease in the expression of these inflammatory factors in MT-transduced C28 / I2 cells, indicating that MT restores optimal cellular function. This effect was more pronounced in FMC2, confirming that FMC2 is more effective in delivering MT and reducing inflammation.

[0145] Additionally, the expression of secreted inflammatory factors was measured using ELISA (Fig. 5D). The secretion of inflammatory factors by LPS-treated C28 / I2 cells was reduced after MT delivery. Consistent with these results, FMC2 was more effective than nMT in restoring normal function of damaged chondrocytes. Taken together, these data suggest that MT delivery is a promising approach for the treatment of osteoarthritis. Furthermore, MT delivery via FMC2 resulted in better cell recovery than nMT, indicating that FMC2 is a more effective strategy for restoring the function of damaged chondrocytes.

[0146] (6) Functional recovery of LPS-treated chondrocytes after MT delivery in 3D culture

[0147] LPS-treated C28 / I2 cells were cultured in 3D to investigate their aggregation and differentiation potential. As shown in Figure 6A, LPS-treated C28 / I2 cells had difficulty forming aggregates in 3D culture dishes. In contrast, similar to the NT group (untreated, control), nMT- and FMC2-treated cells were able to form aggregates and be cultured in 3D. This trend persisted for more than 10 days after seeding, indicating that MT not only prevents dedifferentiation or inflammation but also promotes cell growth. Quantitative analysis of aggregate formation revealed that the number of cell aggregates was significantly affected by the presence of MT, suggesting that MT repairs LPS-induced damage.

[0148] After 8 days of 3D culture, the expression of mRNA encoding AGG, SOX9, COLX, MMP-3 and MMP-13, and TNF-α was examined (Fig. 6B). AGG expression was highest in FMC2-treated cells, and SOX9 expression was expressed at a level similar to that in NT. In addition, the LPS and nMT groups expressed high levels of COLX, MMP-3, MMP-13, and TNF-α, all of which were significantly reduced after FMC2 treatment.

[0149] Immunofluorescence staining revealed increased expression of SOX9 (pink) and COL II (green, ECM) in FMC2-treated cells, indicating that LPS-induced damage was repaired by delivered MT (Fig. 6C). Furthermore, FMC2-induced repair was more pronounced than that induced by nMT. In contrast, LPS suppressed the expression of SOX9 and COL II. These results demonstrate that damaged chondrocytes can recover normal function after delivery of MT by FMC2.

[0150] Ultimately, these data demonstrate that functional restoration of damaged chondrocytes can be achieved by MT, which not only alleviates inflammation and enhances tissue formation, but also promotes cell growth and differentiation. These findings have significant implications for the development of novel therapies for cartilage regeneration.

[0151] (7) FMC injection into an animal model of osteoarthritis

[0152] A mouse model of osteoarthritis was generated by intra-articular (IA) injection of monoiodoacetic acid (MIA), and tissue repair after IA injection of nMT and FMC2 was investigated. FMC2 was injected twice (injection #2) at low dose (LD) every 5 days, and nMT was injected twice (injection #2) at low or high dose (HD) and five times (injection #5) at low dose (Fig. 7A).

[0153] On day 1 after IA injection, the localization of nMT and FMC2 was observed using CLSM to determine whether they were delivered to the cartilage tissue (Fig. 7B). MT delivered to the cartilage was labeled with Mitotracker Deep Red and tested at two doses. In the nMT group, MT signals (green) were barely observed at the low dose and were delivered only to a narrow area at the high dose. In contrast, in the FMC2 group, FMC (red) and MT signals (green) were observed even at the low dose and were distributed more evenly over a wider area at the high dose. The same pattern was observed for the intermediate dose (Fig. 18). These data suggest that MT delivery in vivo via FMC2 is superior.

[0154] The anti-inflammatory effect of injected MT was confirmed by measuring inflammatory factors in the blood. The amount of IFN-γ in the blood of mice with MIA-induced inflammation was higher than that of wild-type (WT) mice (Fig. 7C). However, when MT was administered via FMC2, the amount of IFN-γ decreased to levels similar to those in WT mice. These results suggest that mitochondria restore normal function to damaged inflamed tissues, thereby reducing inflammation.

[0155] Cartilage tissue staining with safranin-O and alcian blue showed restoration of damaged cartilage tissue, as indicated by increased expression of sulfated GAGs (orange) and acidic polysaccharides (blue) (Fig. 7D). Histological analysis of the saline-injected group (saline) did not show restoration of inflamed cartilage tissue. However, MT delivered via FMC2 promoted cartilage tissue restoration. This restoration was better than that of #2 nMT LD at the same dose with the same number of injections, and was significantly more effective than the group delivering a higher dose of MT (#2 nMT HD). A restored morphology was also observed in the group receiving more frequent nMT injections at the same dose as FMC2 (#5 nMT LD), but the polysaccharide (blue) and GAG (orange) areas were narrower and less stained than those with FMC2. These results are presented in a quantitative graph.

[0156] The severity of cartilage tissue damage in the MIA-induced osteoarthritis model was assessed using the Mankin score (Fig. 7E). The Mankin scoring system is a reliable and effective method for assessing the severity of osteoarthritis because it considers cartilage structure and proteoglycan content. The scores of FMC2-treated animals were similar to those of WT animals (approximately 2 points). However, the scores of the #2 nMT LD and #2 nMT HD groups were 11–13 points (similar to the saline control group). The #5 nMT LD had a score of approximately 6 points, indicating moderate damage. These results were confirmed by PET-CT (Fig. 19). Taken together, these data demonstrate that MT delivered via FMC2 effectively promotes cartilage tissue regeneration at low doses and low treatment frequencies.

[0157] 3. Conclusion

[0158] We describe a membrane fusion method as a strategy for delivering MT to target cells via membrane-fusion-inducing liposomes containing cationic lipid (DOTAP). The morphology and properties of FMC were analyzed based on the DOTAP ratio to evaluate encapsulation efficiency, stability, and membrane fusion efficiency. The data showed that FMC2 with a PE:DOTAP ratio of 1:2 was the most optimal. Furthermore, through in vitro and in vivo experiments, we demonstrated that membrane fusion delivers higher amounts of MT more safely and more rapidly than endocytosis. Furthermore, two-dimensional and three-dimensional culture systems demonstrated increased chondrogenic expression of ECM components and decreased inflammatory cytokine expression after MT delivery. A MIA-induced OA model confirmed that FMC2 was more effective than nMT under low-dose and low-frequency treatment conditions. Therefore, a stable membrane fusion delivery system for MT has great potential to restore the function of cells or tissues damaged by various diseases.

Claims

1. A pharmaceutical composition for treating osteoarthritis, comprising, as an active ingredient, a cell membrane fusion-inducing liposome formed by encapsulating mitochondria inside a liposome composed of a lipid including a cationic lipid.

2. A pharmaceutical composition according to claim 1, characterized in that the lipid containing the cationic lipid contains a neutral lipid and a cationic lipid.

3. A pharmaceutical composition according to claim 2, characterized in that the neutral lipid is at least one selected from the group consisting of 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE), 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE), and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE).

4. A pharmaceutical composition according to claim 3, characterized in that the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE).

5. A pharmaceutical composition according to claim 1, characterized in that the cationic lipid is at least one selected from the group consisting of 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), dioctadecylamidoglycylspermine (DOGS), N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), 2,3-dioleyloxy-N-[2-(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate (DOSPA), and 3β-[N-(N',N'-dimethylaminoethyl)-carbamoyl]cholesterol (DC-Chol).

6. A pharmaceutical composition according to claim 5, characterized in that the cationic lipid is 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP).

7. A pharmaceutical composition according to claim 2, characterized in that the molar ratio of the neutral lipid and the cationic lipid is 1:1 to 5.

8. A pharmaceutical composition according to claim 7, characterized in that the molar ratio of the neutral lipid and the cationic lipid is 1:1 to 3.

9. A pharmaceutical composition according to claim 1, characterized in that the mitochondria are mitochondria derived from human mesenchymal stem cells.

10. A pharmaceutical composition according to claim 1, characterized in that the cell membrane fusion-inducing liposome is obtained by a method comprising the steps of (a) preparing an aqueous dispersion comprising liposomes made of lipids including cationic lipids; and (b) mixing an aqueous dispersion comprising mitochondria with the aqueous dispersion of step (a) to form a cell membrane fusion-inducing liposome.

11. A pharmaceutical composition according to claim 10, characterized in that the mass ratio of the mitochondria and the liposome composed of lipids including the cationic lipid is 1:1 to 10.

12. A pharmaceutical composition according to claim 11, characterized in that the mass ratio of the mitochondria and the liposome composed of lipids including the cationic lipid is 1:1 to 5.

13. A pharmaceutical composition according to claim 1, characterized in that the average diameter of the cell membrane fusion-inducing liposome is 550 to 650 nm.

14. A pharmaceutical composition according to claim 1, characterized in that the zeta potential of the cell membrane fusion-inducing liposome is 25 to 60 mV.

Images