PCR method

Abstract

This PCR method comprises: a step (S10) in which blood is added to a PCR reagent to prepare a sample; a step (14) in which the sample is repeatedly reciprocated in a flow path in a microfluidic chip to apply a thermal cycle to the sample; and a step (S16) in which fluorescence is detected from the sample in the flow path in order to monitor the progress of PCR on the sample.

Description

PCR method

[0001] The present invention relates to a method for polymerase chain reaction (PCR).

[0002] Genetic testing is widely used in various medical fields, for identifying agricultural crops and pathogenic microorganisms, for evaluating food safety, and for testing for pathogenic viruses and various infectious diseases. To detect minute amounts of DNA with high sensitivity, methods are known that involve amplifying a portion of the DNA and analyzing the resulting DNA. Among these, PCR is a notable technology that selectively amplifies a portion of extremely small amounts of DNA collected from living organisms.

[0003] PCR involves subjecting a biological sample containing DNA to a mixture of PCR reagents, such as primers and enzymes, to a predetermined thermal cycle, repeatedly causing denaturation, annealing, and extension reactions, thereby selectively amplifying a specific portion of the DNA. Real-time PCR analysis can be performed by measuring the fluorescent signal produced while the DNA is being amplified and performing quantitative analysis.

[0004] In PCR, a predetermined amount of the target sample is placed in a chip such as a PCR tube or a microplate (microwell) with multiple holes, and the sample is subjected to a temperature change using a device called a thermal cycler (see, for example, Patent Document 1).

[0005] International Publication No. 2020 / 065917

[0006] However, in conventional PCR methods using PCR tubes or microplates as described above, when PCR is performed on a sample in which blood has been directly added to a PCR reagent, heat denaturation at the beginning of PCR accelerates browning of blood components, reducing the fluorescent transmittance of the sample, making it difficult to accurately measure the fluorescent signal associated with PCR amplification and potentially preventing proper real-time PCR analysis. While real-time PCR is possible with conventional PCR methods by, for example, extracting and purifying nucleic acids from blood to remove dyes that inhibit the measurement of fluorescent signals before adding the blood to the PCR reagent, or by diluting the blood, for example, by 10 times or more, and then adding only a trace amount of blood to the PCR reagent, these operations are extremely cumbersome and time-consuming.

[0007] The present invention has been made in view of the above circumstances, and an object of the present invention is to provide a PCR method that can suitably measure the fluorescent signal accompanying PCR amplification, even when blood is used as a sample, without requiring complicated nucleic acid purification procedures or the like.

[0008] In order to solve the above problems, one aspect of the PCR method of the present invention comprises the steps of preparing a sample by adding blood to a PCR reagent, subjecting the sample to thermal cycling by repeatedly moving the sample back and forth within a channel of a microfluidic chip, and detecting fluorescence from the sample within the channel to monitor the progress of PCR of the sample.

[0009] According to the present invention, a PCR method can be provided that can suitably measure the fluorescent signal accompanying PCR amplification, even when blood is used as a sample, without requiring complicated nucleic acid purification procedures or the like.

[0010] 1 is a perspective view showing a first surface side of a microfluidic chip applicable to a PCR method according to an embodiment of the present invention; FIG. 2 is a perspective view showing a second surface side of the microfluidic chip; FIG. 3 is a plan view of a first surface of a substrate provided in the microfluidic chip; FIG. 4 is a plan view of a second surface of a substrate provided in the microfluidic chip; FIG. 5 is a conceptual diagram for explaining the cross-sectional structure of the microfluidic chip; FIG. 6 is a schematic diagram for explaining a PCR device for performing a thermal cycle and PCR that can use the microfluidic chip; FIG. 7 is a flowchart for explaining a PCR method according to an embodiment of the present invention; FIG. 8 is a diagram for explaining how a sample changes when moved within a channel of the microfluidic chip; FIG. 9 is a diagram for explaining how a sample changes when moved within a channel of the microfluidic chip; FIG. 10 is a diagram for explaining how a sample changes when moved within a channel of the microfluidic chip; FIG. 11 is a diagram for explaining how a sample changes when moved within a channel of the microfluidic chip; FIG. 12 is a diagram for explaining how a sample changes when moved within a channel of the microfluidic chip; FIG. 13 is a diagram for explaining how a sample changes when moved within a channel of the microfluidic chip; FIG. 14 is a diagram for explaining how a sample changes when moved within a channel of the microfluidic chip; FIG. 15 is a diagram for explaining how a sample changes when moved within a channel of the microfluidic chip; 15(a) and 15(b) are diagrams showing amplification curves when a reciprocal flow real-time PCR device is used. 15(a) and 15(b) are diagrams showing amplification curves when a general real-time PCR device is used. 17(a) and 17(b) are diagrams showing amplification curves when a reciprocal flow real-time PCR device is used. 17(b) are diagrams showing amplification curves when a general real-time PCR device is used.

[0011] Hereinafter, embodiments of the present invention will be described. The same or equivalent components, parts, and processes shown in each drawing will be given the same reference numerals, and redundant explanations will be omitted where appropriate. Furthermore, the embodiments are illustrative and do not limit the invention, and all features and combinations thereof described in the embodiments are not necessarily essential to the invention.

[0012] Fig. 1 is a perspective view showing the first surface side of a microfluidic chip 10 applicable to a PCR method according to an embodiment of the present invention. Fig. 2 is a perspective view showing the second surface side of the microfluidic chip 10. Fig. 3 is a plan view of the first surface 14a of a substrate 14 included in the microfluidic chip 10. Fig. 4 is a plan view of the second surface 14b of the substrate 14 included in the microfluidic chip 10. Fig. 5 is a conceptual diagram illustrating the cross-sectional structure of the microfluidic chip 10. Note that Fig. 5 is a diagram illustrating the positional relationship between the channel, film, and filter and the substrate, and differs from the cross-sectional view of an actual microfluidic chip.

[0013] A microfluidic chip 10 (also referred to as a "fluid chip," "(micro)channel chip," "reaction processing chip," "reaction processing container," "nucleic acid amplification chip," "DNA chip," or "measurement chip") includes a channel 12 through which a sample to be subjected to a thermal cycle or a reaction moves. The microfluidic chip 10 includes a resin substrate 14 having a first surface 14a on which a groove-like channel 12 through which the sample moves is primarily formed, a first sealing film 16 and a second sealing film 18 attached to the first surface 14a of the substrate 14, and a third sealing film 20 attached to the second surface 14b of the substrate. The microfluidic chip 10 may also include a first filter 28 and a second filter 30 near both ends of the channel 12 on the substrate 14 in order to suppress contamination of the channel 12.

[0014] 3, the first surface 14a of the substrate 14 of the microfluidic chip 10 is provided with at least a groove-shaped flow channel 12, air communication ports 24, 26 disposed at both ends of the flow channel 12 and communicating with the flow channel 12 to connect outputs from pumps that pressurize or blow air into the flow channel, chamber-shaped chambers 32, 34 provided above the flow channel 12, and filter spaces 36, 38 in which filters 28, 30 are placed to prevent contamination of the flow channel 12. The groove-shaped flow channel 12 is intended to carry a sample to be subjected to PCR or thermal cycling.

[0015] 4, groove-shaped air ducts 40, 42 for connecting the air communication ports 24, 26 with the filter spaces 36, 38, and a sample introduction port (sample introduction hole) 44 for introducing a sample into the flow channel 12 are provided on the second surface 14b of the substrate 14. The groove-shaped air ducts 40, 42 may be intended as flow channels mainly for air to flow or pressurize from a pump or the like connected to the air communication ports 24, 26. Providing the flow channel 12 and the air ducts 40, 42 on the two opposing main surfaces (first surface 14a and second surface 14b) of the substrate 14 in this manner helps to make effective use of the main surfaces of the substrate 14.

[0016] The substrate 14 of the microfluidic chip 10 is preferably formed from a material that is stable against temperature changes and is resistant to the sample solution used. Furthermore, the substrate 14 is preferably formed from a material that has good moldability, good barrier properties, and low autofluorescence. Examples of such materials include resins such as acrylic, polypropylene, and silicone, with cyclic polyolefin resin being particularly preferred. When the substrate is made of resin, it can be produced in large quantities and with high quality by injection molding using a mold.

[0017] The size of the substrate 14 of the microfluidic chip 10 is not particularly limited, and any size is acceptable as long as it satisfies the chemical and physical functions within the flow channels formed within the substrate. On the other hand, if there is a demand for a smaller device in which the microfluidic chip is mounted, the microfluidic chip and the substrate that constitutes it can also be made smaller or thinner. The substrate 14 of the microfluidic chip 10 may be a parallel plate, which is easy to mold, portable, and handle.

[0018] The size of the substrate 14 of the microfluidic chip 10 is, for example, a thickness of 1 mm to 10 mm, preferably 2 mm to 6 mm, and a rectangular shape of W x L in plan view, where W is 10 mm to 60 mm, preferably 20 mm to 35 mm, and H is 45 mm to 100 mm, preferably 60 mm to 85 mm.

[0019] The microfluidic chip 10 may also be made of a transparent resin. The microfluidic chip 10 is intended to be used for amplifying nucleic acids contained in a sample by real-time PCR. As a sample containing nucleic acids undergoes a reaction in the flow channel of the microfluidic chip 10, the progress and completion of the reaction can be determined by detecting and monitoring the fluorescence emitted from the sample in real time. As a part used for optical measurements such as detecting fluorescence from the sample in the flow channel and irradiating excitation light to induce fluorescence, the microfluidic chip 10 is preferably made of a transparent material.

[0020] A groove-shaped flow channel 12 is formed on the first surface 14a of the substrate 14. In the microfluidic chip 10, most of the flow channel 12 is formed as a groove exposed on the first surface 14a of the substrate. The groove-shaped air ducts 40, 42 are also formed as grooves exposed on the second surface 14b of the substrate 14. This configuration allows a substrate 14 having the flow channel 12 and other components on two opposing main surfaces to be easily formed by injection molding using a mold. To seal the grooves formed in the substrate 14 and utilize them as the flow channel 12, a flow channel sealing film is attached to each surface of the substrate 14. The dimensions of the flow channel 12 are, for example, approximately 0.2 mm to 1.5 mm in width and 0.2 mm to 2 mm in depth, and the dimensions of the flow channel 12 may be 0.7 mm in width and 0.7 mm in depth. Furthermore, to more efficiently produce the substrate 14 industrially using injection molding, the structure of the flow channel 12 may include a side surface that is angled relative to the first surface 14a and second surface 14b of the substrate 14, known as a "draft taper." The angle of the taper may be between 1° and 30°, or may be between 3° and 15°.

[0021] The sealing films 16, 18, and 20 used to seal the flow channel 12, sample inlet 44, air vent 24, 26, chambers 32, 34, and filters 28, 30 may have one main surface that is adhesive, or may have a functional layer formed on one main surface that exhibits adhesiveness or bonding properties when pressed, exposed to energy such as ultraviolet light, or heated, thereby providing a function that allows for easy adhesion and integration with the first surface 14a and second surface 14b of the substrate 14. The sealing films 16, 18, and 20 are preferably made of a material that, including the adhesive, has low, preferably almost zero, autofluorescence. In this regard, transparent films made of resins such as cycloolefin polymer, polyester, polypropylene, polyethylene, or acrylic are suitable, but are not limited to these. The sealing films 16, 18, and 20 may also be made of plate-shaped glass or resin. In this case, their rigidity is expected to help prevent warping and deformation of the microfluidic chip 10.

[0022] A first filter 28 is provided near one end of the flow channel 12. A second filter 30 may be provided near the other end of the flow channel 12. The pair of first filter 28 and second filter 30 provided near both ends of the flow channel 12 are intended to prevent contamination of the flow channel and the sample so as not to interfere with the amplification and detection of the target DNA by PCR or to prevent deterioration of the quality of the target DNA. The dimensions of the first filter 28 and the second filter 30 are formed so that they fit snugly into filter spaces 36, 38 formed on the first surface 14a of the substrate 14.

[0023] The substrate 14 is formed with a first air communication port 24 that communicates with one end of the flow path 12 via a first air duct 40 and a first filter 28. Similarly, the substrate 14 is formed with a second air communication port 26 that communicates with the other end of the flow path 12 via a second air duct 42 and a second filter 30. The pair of first air communication port 24 and second air communication port 26 are formed so as to be exposed on the first surface 14a of the substrate 14.

[0024] A portion of the flow channel 12 includes a thermal cycle region between the pair of first filter 28 and second filter 30, which can be controlled at multiple temperatures by a PCR device (described later). By placing the microfluidic chip 10 in a PCR device having a temperature control system including a heater, a portion of the flow channel 12 of the microfluidic chip 10 is heated by the temperature control system and maintained at a desired temperature. The temperature is controlled to maintain multiple temperatures required for applying thermal cycles to cause reactions such as PCR. Reactions include reactions in which nucleic acids contained in the sample are thermally denatured, annealing reactions, and extension reactions. The temperature controlled in the portion of the flow channel 12 may be a temperature that causes these reactions. By continuously moving the sample back and forth through such reaction regions where multiple temperatures are maintained, the sample can be subjected to thermal cycles.

[0025] In this embodiment, the thermal cycle region includes a first temperature region 46 and a second temperature region 48. When the microfluidic chip 10 is mounted in a PCR device (described later), the first temperature region 46 is maintained at a relatively high temperature (e.g., approximately 95°C), and the second temperature region 48 is maintained at a lower temperature (e.g., approximately 60°C) than the first temperature region 46. Nucleic acids contained in the sample may undergo a thermal denaturation reaction in the flow path included in the first temperature region 46, and may undergo an annealing reaction and an extension reaction in the flow path included in the second temperature region 48. Note that the first temperature region 46 and the second temperature region 48 may be referred to as a "high temperature region" and a "medium temperature region," respectively, in terms of their temperature. Furthermore, the first temperature region 46 and the second temperature region 48 may be referred to as a "denaturation region" and an "annealing / extension region," respectively, in terms of the attributes of the reactions.

[0026] One end of the first temperature region 46 is connected to the first chamber 32. Furthermore, the first chamber 32 is connected to the first air communication port 24 via the first filter 28 and the first air duct 40. The other end of the first temperature region 46 is connected to one end of the second temperature region 48 via a connecting flow path 50. The other end of the second temperature region 48 is connected to one end of a third serpentine flow path 52 through a connecting flow path 41. The other end of the third serpentine flow path 52 is connected to the second chamber 34. Furthermore, the second chamber 34 is connected to the second air communication port 26 via the second filter 30 and the second air duct 42.

[0027] In this embodiment, the third serpentine channel 52 is a channel that is not directly related to thermal cycling or PCR, and includes a straight channel and a curved channel. By configuring the sample inlet 44 for introducing a sample into the channel to be connected to the third serpentine channel 52, the third serpentine channel 52 may be used as a buffer channel for storing samples to be subjected to PCR.

[0028] The first temperature zone 46 and the second temperature zone 48 each include a first serpentine channel 54 and a second serpentine channel 56, which are continuously folded back and forth, combining a curved channel and a linear channel. This can also be considered as connecting multiple curved channels via a linear channel. Such a serpentine channel effectively utilizes the limited effective area of ​​the heaters and other components of the temperature control system described below, contributing to reduced temperature variation within each temperature zone. It also has the advantage of reducing the physical size of the microfluidic chip 10, contributing to the miniaturization of PCR devices. Furthermore, combining curved and linear channels can promote the stirring and mixing of samples flowing through the channels compared to, for example, temperature zones configured solely with linear channels. This allows for effective separation of the sample into solid components and clear solution components, as described below. The radius of curvature R2 of the curved channel may be 0.3 mm to 10 mm, preferably 0.5 mm to 6 mm.

[0029] Meanwhile, the first temperature region 46 and the second temperature region 48 are connected by a linear connecting flow path 50. The connecting flow path 50 may be provided with a region (referred to as a "fluorescence detection region" or simply as a "detection region") 58 that is irradiated with excitation light in order to detect fluorescence from a sample flowing through the flow path when the microfluidic chip 10 is mounted on a PCR device described below. The flow path included in this fluorescence detection region 58 is referred to as a detection flow path 59.

[0030] The connecting flow path 50 corresponds to the portion where a part of a fluorescence detection device for detecting fluorescence from a sample is disposed. Therefore, the distance between the first temperature region 46 and the second temperature region 48 may be relatively long. For example, the distance between the first temperature region 46 and the second temperature region 48 may be longer than the linear flow path included in the first temperature region 46 and / or the second temperature region 48. Because the part of the fluorescence detection device disposed in the connecting flow path 50 has a predetermined volume, it is advantageous to set the distance to a certain distance or more in order to accommodate the part of the fluorescence detection device. Furthermore, the longer the distance between the first temperature region 46 and the second temperature region 48, the smaller the thermal interference between the two temperature regions. Minimizing thermal interference between the temperature regions allows for more efficient use of heat provided by the device through a temperature control means such as a heater, contributing to power savings for the device.

[0031] On the other hand, since there are advantages (portability, weight, etc.) in reducing the size of the PCR device and microfluidic chip 10, the distance between the first temperature region 46 and the second temperature region 48 may be shorter than, for example, half the length L of the long side in a plan view of the microfluidic chip 10. In this case, the degree of freedom in designing the microfluidic chip, such as the mounting of other elements and the arrangement of margins and blank spaces, can be improved, and it is easier to ensure the size and portability required for the PCR device.

[0032] The first chamber 32 is disposed between the thermal cycling region and the first air communication port 24. More specifically, the first chamber 32 is disposed between the first temperature region 46 of the thermal cycling region and the first filter 28. The sample in the flow path moves toward the first temperature region 46, for example, by applying pressure or blowing air through the second air communication port 26. The first chamber 32 serves to prevent the sample from being excessively pushed or from overrunning the first temperature region 46 and reaching the first filter 28. By providing the first chamber 32, which has a fixed volume, in the flow path, the sample can remain and be stopped within the first chamber 32 even if it passes a predetermined stop position in the thermal cycling region, thereby preventing the sample from flowing toward the first air communication port 24.

[0033] 3, the first chamber 32 includes a first connection portion 32a, which is a connection portion (or opening) with the end of the flow path extending from the first temperature region 46 of the thermal cycle region, and a second connection portion 32b, which is a connection portion with the end of the flow path leading to the first filter 28. The first chamber 32 has a first structure 32c near the first connection portion 32a. This first structure 32c prevents the liquid sample that has entered the first chamber 32 from the first connection portion 32a from moving directly toward the second connection portion 32b, thereby contributing to preventing the sample from entering in the direction of the first filter 28.

[0034] The second chamber 34 is disposed between the thermal cycle region and the second air communication port 26. More specifically, the second chamber 34 is disposed between the third serpentine flow path 52 and the second filter 30. The sample in the flow path is moved toward the second temperature region 48, for example, by pressurizing or blowing air through the first air communication port 24. The second chamber 34 serves to prevent the sample from being excessively pushed or from overrunning the second temperature region 48 or the third serpentine flow path 52 and reaching the second filter 30.

[0035] 3 , the second chamber 34 includes a third connection portion 34a that is a connection portion with the flow path end of the flow path extending from the third serpentine flow path 52, and a fourth connection portion 34b that is a connection portion with the flow path end of the flow path leading to the second filter 30. The second chamber 34 has a second structure 34c near the third connection portion 34a. This second structure 34c prevents the liquid sample that has entered the second chamber 34 from the third connection portion 34a from heading directly toward the fourth connection portion 34b, thereby contributing to preventing the sample from entering in the direction of the second filter 30.

[0036] The first chamber 32 and the second chamber 34 may have a function other than preventing sample overrun. For example, the first chamber 32 and the second chamber 34 may be used as reaction chambers. Specifically, a PCR reagent may be held in the first chamber 32 and the second chamber 34 in advance, and a sample may be added to the PCR reagent in the first chamber 32 and the second chamber 34, and then PCR may be performed.

[0037] 3 , a first widening flow channel 60 may be provided between the first serpentine flow channel 54 and the first chamber 32. The first widening flow channel 60 is adjacent to the flow channel belonging to the first temperature region 46 and is provided further back than the first serpentine flow channel 54 when viewed from the connecting flow channel 50. Furthermore, a second widening flow channel 62 may be provided between the second serpentine flow channel 56 and the third serpentine flow channel 52. The second widening flow channel 62 is formed adjacent to the flow channel belonging to the second temperature region 48 and is provided further back than the flow channel belonging to the second temperature region 48 when viewed from the connecting flow channel 50.

[0038] The first widening channel 60 is configured so that its cross-sectional area is larger than that of the first serpentine channel 54. Similarly, the second widening channel 62 is configured so that its cross-sectional area is larger than that of the second serpentine channel 56. The first widening channel 60 and the second widening channel 62 act as a brake on the sample flowing through the first serpentine channel 54 and the second serpentine channel 56, respectively. This is based on Bernoulli's law, which states that the speed of a fluid passing through a flow tube is inversely proportional to the cross-sectional area of ​​the flow tube. When the sample flows through the first temperature region 46 and the second temperature region 48, a brake is applied to the sample, thereby adding the function of stopping the sample within the first temperature region 46 and the second temperature region 48. Furthermore, by providing a region where the cross-sectional area changes in part of the channel 12, stirring and mixing of the sample in that region can be promoted. This allows the sample to be effectively separated into a solid component and a clear solution component, as described below.

[0039] The microfluidic chip 10 may have at least one sample inlet for introducing a sample into a channel. The sample inlet is, for example, an inlet for introducing a sample containing a nucleic acid to be amplified into the channel. The sample inlet may have any shape, size, or location, as long as it has a perforated structure that connects from the main surface of the substrate 14 to one of the channels. In FIGS. 3 and 4 , for example, a sample inlet 44 is provided to connect to the third serpentine channel 52. In FIGS. 3 and 4 , the channel 12 is provided on surface 14 a and the sample inlet 44 is provided on surface 14 b, and they are formed on opposing surfaces of the substrate 14, but they may also be provided on the same surface of the substrate 14. A microfluidic chip according to another embodiment may have two sample inlets (a first sample inlet and a second sample inlet).

[0040] As shown in FIG. 1 , a first sealing film 16 for sealing at least the flow paths is attached to the first surface 14a of the substrate 14. The first sealing film 16 may be large enough to cover substantially the entire first surface 14a of the substrate 14. The first sealing film 16 may have holes pre-drilled at positions corresponding to the air communication ports 24, 26 so that the air communication ports 24, 26 are not sealed, in order to connect a nozzle communicating with the discharge port of a pump in a liquid delivery system. The first sealing film 16 may also be in a form in which the air communication ports 24, 26 are sealed. In this case, when the microfluidic chip 10 is used, a nozzle communicating with the discharge port of a pump used in a liquid delivery system for pressurizing or blowing air into the flow paths is attached to the air communication ports 24, 26. Therefore, if the nozzle end is provided with a hollow needle or the like, the film can be pierced with the tip of the needle, thereby connecting the output port of the pump to the air communication ports 24, 26.

[0041] A first sealing film 16 is used to seal the flow path 12, the filter spaces 36, 38, and the chambers 32, 34, excluding the air communication ports 24, 26, and an adhesive second sealing film 18 may be attached to the first surface 14a of the substrate 14, for example, to seal only the second air communication port 26. In this case, a sealing film for sealing the first air communication port 24 does not need to be attached. When a sample is introduced into the microfluidic chip 10 through the sample inlet 44, the first air communication port 24 functions as an exhaust port for air corresponding to the volume of the sample introduced into the flow path. The output end of a pump of a liquid delivery system may be connected to the air communication ports 24, 26 of the microfluidic chip 10 after the sample has been introduced into the flow path. At this time, the second sealing film may be peeled off. During distribution, the first air communication port 24 is open, but the second air communication port 26 and other ports are sealed with a sealing film, so that dust, dirt, and the like are less likely to enter through the first air communication port 24, making it possible to suppress contamination.

[0042] As shown in FIG. 2 , groove-shaped air ducts 40, 42 that connect the air communication ports 24, 26 and the filter spaces 36, 38, and a sample inlet 44 for introducing a sample into the flow path are provided on the second surface 14b of the substrate 14. A third sealing film 20 for sealing the groove-shaped air ducts 40, 42 may be attached to the second surface 14b of the substrate 14. Furthermore, a fourth sealing film for sealing the sample inlet 44 may be attached to the second surface 14b of the substrate 14. If the air ducts 40, 42 and the sample inlet 44 are located close to each other, the third sealing film 20 may simultaneously seal the air ducts 40, 42 and the sample inlet 44. In this case, the fourth sealing film is not necessary.

[0043] 1 and 2 show an example in which the substrate 14 is integrated by being attached to the respective sealing films 16, 18, and 20. Fig. 2 shows an example of the third sealing film 20 that simultaneously seals the air ducts 40 and 42 and the sample inlet 44.

[0044] An example will be described in which a sample is introduced into a flow channel via the sample inlet 44. First, an operator peels off the third sealing film 20 to open the sample inlet 44. At this time, the third sealing film 20 is peeled off only enough to open the sample inlet 44, while the groove-shaped air ducts 40 and 42 remain sealed.

[0045] Next, a measured amount of sample is introduced into the flow channel 12 through the sample introduction port 44 using a pipette, dropper, syringe, or the like. The pipette, dropper, syringe, or the like may then be operated to push the sample until it reaches the first temperature region 46 or the second temperature region 48 of the thermal cycling region. In this case, the position reached by the sample can be used as the initial position of the sample during PCR or thermal cycling. The introduced sample pushes air of approximately the same volume as the sample within the flow channel, which is then released through the open first air communication port 24. At this time, the first air communication port 24 serves as an exhaust port during sample introduction.

[0046] Next, the third sealing film 20 is reattached to its original position. The third sealing film 20 preferably has properties that allow it to withstand multiple cycles of attachment and detachment. This is advantageous from the viewpoints of maintaining the cleanliness of the microfluidic chip 10 during distribution and facilitating the introduction of samples.

[0047] Furthermore, the second sealing film 18 and the third sealing film 20 may be provided with tabs 18a, 20a with non-adhesive front and back at the ends of the film so that they can be easily peeled off (and possibly reattached) during use from the state in which they are initially attached to the main surface of the substrate 14. This helps to improve the convenience of the operator in opening the sample introduction port 44 and the air communication ports 24, 26 of the microfluidic chip 10.

[0048] 2, the third sealing film 20 may have a corner portion 20b between the sample inlet 44 and the air duct 42. This corner portion 20b serves as a guide for the limit of peeling off the third sealing film 20 when an operator opens only the sample inlet 44. Alternatively, a substantially circular notch may be provided in the corner portion to emphasize the guide, or the film may be peeled off partway to make it less likely to tear.

[0049] FIG. 6 is a schematic diagram illustrating a PCR device (also called a "thermal cycle device," "thermal cycler," or "reaction processing device") 100 for performing thermal cycling and PCR that can utilize the microfluidic chip 10.

[0050] The PCR device 100 includes a mounting section 101 on which the microfluidic chip 10 is mounted, a first heater 102 for heating the first temperature region 46 of the flow channel 12, which is controlled to a relatively high temperature, a second heater 104 for heating the second temperature region 48 of the flow channel, and a temperature control system including temperature sensors (not shown), such as thermocouples, for measuring the actual temperatures of each reaction region. Each heater may be, for example, a resistive heating element or a Peltier element. These heaters, an appropriate heater driver, and a control device 110, which is comprised of a microcomputer, microprocessor, electronic circuits, etc., maintain the first temperature region 46 of the flow channel 12 of the microfluidic chip 10 at approximately 95°C and the second temperature region 48 at approximately 60°C, thereby setting the temperatures of each reaction region in the thermal cycle zone required for PCR. Furthermore, the PCR device 100 includes a built-in battery and a power supply unit (neither of which are shown) for receiving external power to operate these components properly. Drivers for driving each component are not described here.

[0051] The PCR device 100 further includes a fluorescence detection device 106. A predetermined fluorescent probe is added to the sample S. As the amplification of DNA progresses, the intensity of the fluorescent signal emitted from the sample S increases, and the intensity value of the fluorescent signal can be used as an index for determining the progress and termination of PCR.

[0052] The fluorescence detection device 106 can be an optical fiber fluorescence detector FLE-510 manufactured by Nippon Sheet Glass Co., Ltd., which has a very compact optical system, can perform rapid measurements, and can detect fluorescence regardless of whether it is in a bright or dark location. This optical fiber fluorescence detector can be tuned so that the wavelength characteristics of its excitation light / fluorescence are suitable for the fluorescence characteristics emitted by the sample S, making it possible to provide an optimal optical and detection system for samples with various characteristics. Furthermore, the small diameter of the light beam produced by the optical fiber fluorescence detector makes it suitable for detecting fluorescence from samples present in small or narrow regions such as flow channels, and it also has excellent response speed.

[0053] The optical fiber fluorescence detection device 106 includes an optical head 108, a fluorescence detection device main body (including a driver) 112, and an optical fiber 114 connecting the optical head 108 and the fluorescence detection device main body 112. The fluorescence detection device main body 112 includes an excitation light source (an LED, laser, or other light source tuned to emit a specific wavelength), an optical fiber multiplexer / demultiplexer, and a photoelectric conversion element (a photodetector such as a PD, APD, or photomultiplier) (all not shown), as well as a driver and a microcomputer for controlling these elements. The optical head 108 is composed of an optical system including lenses and is responsible for the directional irradiation of the excitation light onto the sample and the collection of fluorescence emitted from the sample. The collected fluorescence is separated from the excitation light via the optical fiber 114 by the optical fiber multiplexer / demultiplexer in the fluorescence detector driver and converted into an electrical signal by the photoelectric conversion element. The optical fiber fluorescence detector described in JP 2010-271060 A can be used. The optical fiber fluorescence detector 106 can be further modified to enable coaxial detection of multiple wavelengths using a single or multiple optical heads. The invention described in International Publication No. 2014 / 003714 can be utilized for detecting multiple wavelengths and processing their signals.

[0054] In the PCR device 100, an optical head 108 is disposed so as to be able to detect fluorescence from the sample S in the detection flow channel 59. The sample S is repeatedly moved back and forth within the thermal cycle region within the flow channel, causing the reaction to proceed, and a specific DNA contained in the sample S is amplified. Therefore, by monitoring the fluctuations in the amount of detected fluorescence, the progress of DNA amplification can be known in real time (real-time PCR). Furthermore, in the PCR device 100, the output value from the fluorescence detection device 106 is utilized to control the movement of the sample S. For example, the output value from the fluorescence detection device 106 may be transmitted to the control device 110 and used as a parameter for controlling the liquid delivery system 120, which will be described later. The fluorescence detection device 106 is not limited to an optical fiber type fluorescence detection device, as long as it is capable of detecting fluorescence from the sample.

[0055] Furthermore, the fluorescence detection device 106 can be provided with multiple sets of excitation light / fluorescence. For example, a first fluorescence detection device may be set to irradiate a sample with blue excitation light and detect green fluorescence emitted from the sample, and a second fluorescence detection device may be set to irradiate a sample with green excitation light and detect red fluorescence. Alternatively, fluorescence detection devices may be arranged that are preset with combinations of excitation light / fluorescence wavelength characteristics according to combinations of nucleic acids, fluorescent probes, etc. to be detected.

[0056] In the PCR device 100, the optical head 108 of the fluorescence detection device 106 is positioned to detect fluorescence from a sample in a connecting flow path 50 in the thermal cycling region. The connecting flow path 50 is a flow path that connects the first temperature region 46 and the second temperature region 48. As described above, the region where fluorescence from the sample is expected to be detected is referred to as the fluorescence detection region 58. Furthermore, a flow path belonging to the fluorescence detection region 58 is referred to as a detection flow path 59. The detection flow path 59 is provided on the first surface 14a of the substrate 14 on which the flow paths are formed.

[0057] The PCR device 100 further includes a liquid delivery system 120 for moving and stopping the sample S within the flow channel of the microfluidic chip 10. The liquid delivery system 120 can move the sample S in one direction within the flow channel by, but is not limited to, sending air (blowing) through either the first air communication port 24 or the second air communication port 26. Furthermore, the liquid delivery system 120 can stop the sample S at a predetermined position by stopping the blowing of air into the flow channel or by equalizing the pressure on both sides of the sample S within the flow channel.

[0058] 6, the liquid delivery system 120 in this embodiment includes a liquid delivery pump 128, a first three-way valve 122, a second three-way valve 124, and a pressurized chamber 126. Furthermore, the liquid delivery system 120 may include a tube and a nozzle that connect the discharge port of the liquid delivery pump 128 to the air communication port.

[0059] The pressurized chamber 126 forms a space with a constant volume within it. The pressurized chamber 126 is configured to be able to change the pressure within its internal space. The pressure within the pressurized chamber 126 is maintained at a pressure (e.g., 1.05 to 1.3 atmospheres) that is at least higher than the atmospheric pressure of the ambient environment of the PCR device 100 during PCR. To increase the pressure within the pressurized chamber 126, the PCR device 100 may include, but is not limited to, a pressure pump, an air pump, a blower, a micropump, a syringe pump, or the like (not shown) whose output port is connected to the pressurized chamber 126. The atmospheric pressure of the ambient environment of the PCR device 100 refers to the pressure (or atmospheric pressure) at the location where the PCR device 100 is installed, the location where PCR is performed by the PCR device 100, or, if the PCR device 100 is installed in a location partitioned from the surroundings, the pressure in that partitioned location. The pressure inside the pressurized chamber 126 should be set to a level that can prevent significant sample evaporation and the generation of bubbles, etc., that could affect the PCR reaction process, even if the sample is repeatedly exposed to high temperatures (approximately 95°C). The higher the pressure inside the pressurized chamber 126, the more effectively it can suppress the effects of sample evaporation, etc. However, on the other hand, the liquid delivery system 120, including its handling, becomes more complex and larger. Therefore, a person skilled in the art can comprehensively consider the use, purpose, cost, effectiveness, etc. of the device when designing the entire system.

[0060] The pressurized chamber 126 is provided with an atmospheric pressure release valve (leak valve) 127. The atmospheric pressure release valve 127 is controlled so that the pressure in the liquid delivery system 120 and the flow channel 12 of the microfluidic chip 10 becomes equal to atmospheric pressure when the microfluidic chip 10 is attached or detached. This makes it possible to prevent the sample S from suddenly moving or jumping out.

[0061] The liquid supply pump 128 is disposed within the pressure chamber 126. The liquid supply pump 128 may be a blower or a micro-blower that equalizes the pressure on the primary side (air intake side) and secondary side (air discharge side) when stopped. It should be noted that the liquid supply pump 128 has the role of sending air into the flow path, and the liquid sample moves in response to the air supply and increased pressure, but it is not a pump that actually sends the liquid itself.

[0062] A first port A of the first three-way valve 122 is connected to an output port (discharge port) 128a of the liquid-feed pump 128. A second port B of the first three-way valve 122 is connected to the internal space of the pressurized chamber 126. A third port C of the first three-way valve 122 is connected to one end of a first tube 130, the other end of which is connected to the first air communication port 24 of the microfluidic chip 10 as a first output port 131 of the liquid-feeding system 120. The first three-way valve 122 is switchable between a state in which the first air communication port 24 of the microfluidic chip 10 is connected to the output port 128a of the liquid-feed pump 128 and a state in which the first air communication port 24 of the microfluidic chip 10 is open to the internal space of the pressurized chamber 126. When the first air communication port 24 of the microfluidic chip 10 and the output port 128a of the liquid-feeding pump 128 are communicated with each other, the first three-way valve 122 is controlled to a state in which port A and port C are communicated with each other. On the other hand, when the first air communication port 24 of the microfluidic chip 10 is opened to the internal space of the pressurized chamber 126, the first three-way valve 122 is controlled to a state in which port B and port C are communicated with each other.

[0063] A first port A of the second three-way valve 124 is connected to an output port 128a of the liquid-feed pump 128. A second port B of the second three-way valve 124 is connected to the internal space of the pressurized chamber 126. A third port C of the second three-way valve 124 is connected to the second air communication port 26 of the microfluidic chip 10. The third port C of the second three-way valve 124 is connected to one end of a second tube 132, the other end of which is connected to the second air communication port 26 of the microfluidic chip 10 as a second output port 133 of the liquid-feeding system 120. The second three-way valve 124 is switchable between a state in which the second air communication port 26 of the microfluidic chip 10 is connected to the output port 128a of the liquid-feed pump 128 and a state in which the second air communication port 26 of the microfluidic chip 10 is open to the internal space of the pressurized chamber 126. When the second air communication port 26 of the microfluidic chip 10 and the output port 128a of the liquid-feeding pump 128 are connected to each other, the second three-way valve 124 is controlled to connect the ports A and C. On the other hand, when the second air communication port 26 of the microfluidic chip 10 is opened to the internal space of the pressurized chamber 126, the second three-way valve 124 is controlled to connect the ports B and C.

[0064] The liquid delivery pump 128, the first three-way valve 122, and the second three-way valve 124 can be operated by the control device 110 through appropriate drivers. In particular, the optical head 108 arranged as described above transmits an output value based on the obtained fluorescent signal to the control device 110, and the control device 110 recognizes the position of the sample S in the flow path and its passage, thereby controlling the liquid delivery system 120.

[0065] A case will be described in which the liquid delivery system 120 is used to move the sample S from the first temperature region 46 to the second temperature region 48. The liquid delivery pump 128 is controlled to an operating state (ON). The first three-way valve 122 is controlled to a state in which the first port A and the third port C are in communication, and the second three-way valve 124 is controlled to a state in which the second port B and the third port C are in communication. As a result, the first air communication port 24 of the microfluidic chip 10 is in communication with the output port 128a of the liquid delivery pump 128, and the second air communication port 26 of the microfluidic chip 10 is in a state in which it is open to the internal space of the pressurized chamber 126. In this embodiment, since the liquid delivery pump 128 is disposed within the pressurized chamber 126, when air is discharged from the liquid delivery pump 128, the pressure at the first air communication port 24 of the microfluidic chip 10 becomes higher than that at the second air communication port 26, and the sample S moves from the first temperature region 46 toward the second temperature region 48. When the sample S reaches the second temperature region 48, the first three-way valve 122 is controlled to a state in which the second port B and the third port C are in communication, and the second three-way valve 124 is controlled to a state in which the second port B and the third port C are in communication. As a result, the first air communication port 24 and the second air communication port 26 are both in a state in which they are open to the internal space of the pressurized chamber 126, and the sample S stops in the second temperature region 48. Conversely, to move the sample S from the second temperature region 48 to the first temperature region 46, the first three-way valve 122 and the second three-way valve 124 can be operated in the reverse order to that described above.

[0066] In this way, by sequentially and continuously operating the first three-way valve 122 and the second three-way valve 124 connected to both sides of the flow path 12, the sample S can be continuously moved back and forth within the flow path between the first temperature region 46 and the second temperature region 48, thereby providing the sample S with an appropriate thermal cycle.

[0067] The PCR device 100 includes a liquid delivery pump 128 disposed in the internal space of a pressurized chamber 126, which is set at a pressure higher than the atmospheric pressure of the surrounding environment (e.g., 1.3 atmospheres), and the second port B of the first three-way valve 122 and the second three-way valve 124 is configured to open to the internal space of the pressurized chamber 126. Therefore, during the reaction process, the entire flow channel 12 of the microfluidic chip 10 is maintained at a pressure higher than the atmospheric pressure of the surrounding environment. This is particularly advantageous when using the PCR device 100 at high altitudes, such as Mexico City, or inside an aircraft during flight. The first temperature of the first temperature region 46 is at or near 95°C. Because the pressure at high altitudes and inside an aircraft is lower than 1 atmosphere, there is a possibility that a portion of the sample S will boil even at 95°C. However, by employing a liquid delivery system 120 including the pressurized chamber 126 of the PCR device 100, it is possible to suppress undesired boiling of the sample in such a low-atmospheric-pressure environment. Furthermore, the PCR device 100 can be used without problems even in environments other than low-atmospheric-pressure environments.

[0068] The liquid delivery system may be configured in a manner other than that shown in Figure 6. Pumps such as syringe pumps, diaphragm pumps, micro-blowers, and air blowers can be used. Because two pumps are used, it may be necessary to adjust for individual differences between the pumps in order to accurately stop the pumps at the desired temperature range. In this case, air-delivery pumps consisting of air blowers or micro-blowers can be used, which equalize the pressure on the primary side (air intake side) and secondary side (air discharge side) when the two pumps are stopped. To move the sample, only the pump corresponding to that direction is operated. To stop the sample, both pumps are stopped. This balances the pressure on both sides of the sample, allowing the sample to stop.

[0069] The PCR device 100 to which the microfluidic chip 10 having the flow channel 12 can be applied is also called a reciprocal flow real-time PCR device.

[0070] As described above, conventional PCR methods using PCR tubes or microplates require the extraction and purification of nucleic acids from blood samples to remove dyes that inhibit fluorescent signal measurement before adding the sample to the PCR reagent, or the blood sample must be diluted, for example, 10-fold or more before adding only a trace amount of blood to the PCR reagent. This is because, with conventional PCR methods, when PCR is performed on a sample in which blood has been directly added to the PCR reagent, heat denaturation at the beginning of PCR causes the blood components to brown, reducing the sample's fluorescent transmittance, making it impossible to accurately measure the intensity of the fluorescent signal associated with PCR amplification. In other words, with conventional PCR methods, the color of the blood components in the sample interferes with fluorescent detection.

[0071] While conducting real-time PCR experiments on various samples, the inventors discovered that by using a microfluidic chip 10 equipped with a fine flow path 12 through which the above-described sample flows and a PCR device 100 that provides thermal recycling to the microfluidic chip 10, it is possible to suitably measure the fluorescent signal accompanying PCR amplification even for samples in which blood has been directly added to the PCR reagent.

[0072] 7 is a flowchart illustrating the PCR method according to this embodiment. The PCR method according to this embodiment is a real-time PCR method using blood as a sample.

[0073] In the PCR method according to this embodiment, first, blood is added to a PCR reagent to prepare a sample (S10). Here, "blood" refers to "whole blood." In this specification, "adding blood to a PCR reagent" refers to adding whole blood directly to a PCR reagent; adding nucleic acids purified from blood to a PCR reagent or adding crude blood that has been simply purified to a PCR reagent is not referred to as "adding blood to a PCR reagent." It should be noted that in prior art literature, adding blood to a PCR reagent in this manner is sometimes referred to as "adding blood to a PCR reagent."

[0074] The PCR reagents include primers and a probe, which may be a TaqMan probe (TaqMan is a registered trademark of Roche Diagnostics Gesellschaft mit Beschlenkter Haftung).

[0075] A sample is prepared by adding a predetermined amount of blood to a predetermined amount of PCR reagent. The blood content in the sample may be 0.01% to 20%, preferably 0.1% to 10%, and more preferably 1% to 5%. For example, a 20 μL sample with a 5% blood content can be prepared by adding 1 μL of whole blood to 19 μL of PCR reagent.

[0076] Next, the microfluidic chip 10 is prepared, and the prepared sample is introduced into the flow channel 12 in the microfluidic chip 10 (S12). The sample is introduced into the flow channel 12 through the sample introduction port 44 of the microfluidic chip 10 using a pipette, a dropper, a syringe, or the like.

[0077] In S10 and S12, the sample is prepared and then introduced into the microfluidic chip 10, but the sample may also be prepared within the microfluidic chip 10. For example, as described above, PCR reagents may be held in the first chamber 32 and the second chamber 34 in advance, and blood may be added to the PCR reagents within the first chamber 32 and the second chamber 34.

[0078] Next, the sample is subjected to thermal cycling by repeatedly moving it back and forth between the first temperature region 46 and the second temperature region 48 of the microfluidic chip 10 (S14). By subjecting the sample to several tens of thermal cycles, the target nucleic acid is amplified.

[0079] During the thermal cycles in S14, fluorescent signals emitted from the sample in the flow channel 12 are detected to monitor the progress of PCR of the sample (S16). Real-time PCR analysis is then performed based on the detected fluorescent signals (S18). In real-time PCR analysis, an amplification curve is created with the cycle number (C) on the horizontal axis and the fluorescent signal intensity on the vertical axis. When the sample is subjected to thermal cycles and the target nucleic acid in the sample is amplified, the fluorescent signal intensity increases. The cycle number at which the fluorescent signal intensity rises exponentially is called the Ct value (threshold cycle number), and the Ct value decreases as the initial sample concentration increases. In real-time PCR analysis, it is extremely important to accurately measure the fluorescent signal intensity in order to determine the Ct value.

[0080] 8 to 13 are diagrams for explaining how the sample S changes when it is moved within the channel 12 of the microfluidic chip 10. 8 to 13 schematically show the channel 12 formed on the first surface 14a of the microfluidic chip 10. The sample S is obtained by directly adding blood to a PCR reagent.

[0081] 8 shows the state immediately after the sample S is introduced into the flow channel 12 from the sample introduction port 44. The sample S immediately after introduction is located in the third serpentine flow channel 52 as shown in FIG. 8. The sample S immediately after introduction is red and transparent.

[0082] 9 shows the state in which the sample S has been moved from the third serpentine flow channel 52 through the second temperature region 48 and the connecting flow channel 50 to the first temperature region 46. As described above, the sample can be moved within the flow channel 12 by pressurizing or blowing air through the air communication ports 24, 26. In the first temperature region 46, the sample is heated to approximately 95°C for 15 seconds. This changes the sample S from a transparent red to an opaque light brown.

[0083] 10 shows the state in which the sample S is transferred from the first temperature region 46 to the second temperature region 48 through the connecting flow path 50. In the second temperature region 48, the sample S is heated to approximately 60°C for 15 seconds. As a result, the sample S gradually begins to separate into a solid component (precipitate) and a clear solution component. The solid component of the sample S is light brown and opaque, while the clear solution component is light brown and transparent.

[0084] 11 shows the state in which the sample S has been transferred from the second temperature region 48 to the first temperature region 46 through the connecting flow path 50. In the first temperature region 46, the sample S is heated to approximately 95° C. for 15 seconds. This promotes aggregation of the solid components of the sample S, further promoting separation of the colored solid component from the clear solution component.

[0085] 12 shows the state in which the sample S has been transferred from the first temperature region 46 to the second temperature region 48 through the connecting flow path 50. In the second temperature region 48, it is heated to approximately 60°C for 15 seconds. This further promotes aggregation of the solid components of the sample S, and as shown in FIG. 12, the separation of the colored solid component and the clear solution component becomes clear. The solid component of the sample S changes from an opaque light brown to an opaque dark brown. The clear solution component is a transparent light brown.

[0086] 13 shows the state in which the sample S has been moved from the second temperature region 48 to the first temperature region 46 through the connecting flow path 50. In the first temperature region 46, the sample S is heated to approximately 95° C. for 15 seconds. This further promotes aggregation of the solid components of the sample S, and further promotes separation of the colored solid component (dark brown) from the clear solution component (light brown, clear).

[0087] Thereafter, PCR progresses and the target nucleic acid is amplified by repeatedly (several dozen cycles) moving the sample S back and forth between the first temperature region 46 and the second temperature region 48. During this time, the sample S remains separated into a colored solid component (dark brown) and a clear solution component (light brown, transparent).

[0088] The inventors have found that, as described above, sample S, which is a blood specimen, is separated into an opaque, colored solid component and a clear solution component by several reciprocal movements between first temperature region 46 and second temperature region 48 at the beginning of PCR. In general PCR, in which reagents do not move, separation of blood components does not occur after heat denaturation of the blood, making it difficult to accurately measure the intensity of the fluorescent signal due to PCR amplification. However, in the present invention, sample S is separated into a colored solid component and a clear solution component, making it possible to accurately measure the intensity of the fluorescent signal emitted from the clear solution component, thereby making it possible to perform real-time PCR analysis favorably.

[0089] In the PCR method according to this embodiment, the phenomenon in which the sample separates into a solid component and a clear solution component within the channel 12 is presumably due to the sample being agitated and mixed as it moves through the channel 12. In the microfluidic chip 10, the first temperature region 46 and the second temperature region 48 include a first serpentine channel 54 and a second serpentine channel 56, which combine a straight channel and a curved channel. By flowing the sample through the curved channel, the sample is agitated and mixed more than when the sample is simply flowed through a straight channel, thereby facilitating the separation of the fixed component and the clear solution component of the sample.

[0090] The microfluidic chip may be configured so that the cross-sectional area of ​​one portion of the channel 12 is different from that of the other portion. In this case, the unevenness of the portion where the cross-sectional area changes will further agitate and mix the sample, facilitating the separation of the fixed component of the sample from the clear solution component. An example of this is shown below.

[0091] 14 is a plan view of the first surface 14a of another microfluidic chip 70 applicable to a PCR method according to an embodiment of the present invention. As shown in FIG. 14, in the microfluidic chip 70, the cross-sectional area of ​​the detection channel 59 in the connection channel 50 is larger than the cross-sectional areas of the first serpentine channel 54 and the second serpentine channel 56. The unevenness at the portion where the cross-sectional area of ​​the channel changes allows the sample to be more thoroughly stirred and mixed, thereby facilitating the separation of the immobilized component of the sample from the clear solution component.

[0092] The PCR reagent may contain a surfactant. When a surfactant is added to the PCR reagent, the sample can be mixed appropriately while flowing through the flow path 12. The surfactant may be a cationic surfactant, an anionic surfactant, a zwitterionic surfactant, or a nonionic surfactant, and both high molecular weight and low molecular weight surfactants may be used. Examples of surfactants include pure soap, alpha sulfo fatty acid ester salts, linear alkylbenzene sulfonates, alkyl sulfate ester salts, alkyl ether sulfate ester salts, alpha olefin sulfonates, alkyl sulfonates, sucrose fatty acid esters, sorbitan fatty acid esters, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene fatty acid esters, fatty acid alkanolamides, alkyl glucosides, polyoxyethylene alkyl ethers, polyoxyethylene alkylphenyl ethers, alkylamino fatty acid salts, alkyl betaines, alkyl amine oxides, alkyl trimethyl ammonium salts, and dialkyl dimethyl ammonium salts. Specific examples of surfactants include N,N-Bis(3-D-gluconamidopropyl)cholamide [BIGCHAP], N,N-Bis(3-D-gluconamidopropyl)deoxycholamide[Deoxy-BIGCHAP]、NIKKOL BL-9EX [Polyoxyethylene(9)Lauryl Ether]、Octanoyl-N-methylglucamide [MEGA-8]、Nonanoyl-N-methylglucamide [MEGA-9]、Decanoyl-N-methylglucamide [MEGA-10]、Polyoxyethylene(8)Octylphenyl Ether [Triton X-114]、Polyoxyethylene(9)Octylphenyl Ether [NP-40]、Polyoxyethylene(10)Octylphenyl Ether [Triton X-100]、Polyoxyethylene(20)Sorbitan Monolaurate [Tween 20]、Polyoxyethylene(20)Sorbitan Monopalmitate [Tween 40]、Polyoxyethylene(20)Sorbitan Monostearate [Tween 60]、Polyoxyethylene(20)Sorbitan Monooleate [Tween 80]、Polyoxyethylene(20)Sorbitan Trioleate、Polyoxyethylene(23)Lauryl Ether [Brij35]、Polyoxyethylene(20)Cethyl Ether [Brij58]、n-Dodecyl-β-D-maltopyranoside、n-Heptyl-β-D-thioglucopyranoside、n-Octyl-β-D-glucopyranoside、n-Octyl-β-D-thioglucopyranoside、n-Nonyl-β-D-thiomaltoside、IGEPAL CA-630、Digitonin、Saponin,from Soybeans, 3-[(3-Cholamidopropyl)dimethylammonio]-2-hydroxy-1-propanesulfonate [CHAPSO], 3-[(3-Cholamidopropyl)dimethylammonio]-1-propanesulfonate [CHAPS], Sodium Dodecylsulfate [SDS], Lithium Dodecyl Sulfate [LDS], Lithium 3,5-Diiodosalicylate, Tris(hydroxymethyl)aminomethane Dodecyl Sulfate [Tris DS], Sodium Cholate, N-Lauroylsarcosine, Sodium N-Dodecanoylsalcosinate, Cetyldimethylethylammonium Bromide, Cetyltrimethylammonium Bromide [CTAB], Cetyltrimethylammonium Chloride, Guanidine Thiocyanate, etc. are used.,

[0093] The PCR reagent may contain an additive. Adding an additive to the PCR reagent allows the sample to be mixed appropriately while flowing through the flow path 12. This is because blood proteins are denatured and do not interfere with PCR. To enhance the efficiency and specificity of the amplification reaction of the present invention, it is effective to add an appropriate amount of additives such as ammonium sulfate, bovine serum albumin, dimethyl sulfoxide (DMSO), dimethylformamide (DMF), betaine, formamide, gelatin, glycerol, PEG 6000, SDS, spermidine, Triton, Triton X-100, or urea. In addition to adding the above substances, mixing an alkaline solution with the sample can also enhance the efficiency of the amplification reaction. Examples of alkaline solutions include, but are not limited to, solutions of alkali metal hydroxides, such as sodium hydroxide and potassium hydroxide. The alkaline concentration (OH-1 concentration) can be 0.1 mM or higher, or 1 mM or higher, preferably 10 mM or higher, and more preferably 30 mM or higher. Alternatively, the pH can be set to not less than pH 7, preferably not less than pH 8, and more preferably not less than pH 9. The alkaline concentration and pH can be set to any concentration and pH (e.g., 10 M or less) as long as they do not inhibit the subsequent detection or amplification step.

[0094] Examples will be described below.

[0095] (First Example) In the first example, a reciprocal flow real-time PCR device and a general real-time PCR device using a PCR tube were used to prepare samples by adding blood directly to a PCR reagent, and real-time PCR measurements were performed.

[0096] A sample was prepared under the following conditions: Primers (0.9 μM each) shown in SEQ ID NO: 1 and 2 for amplifying the horse mackerel gene, a probe (0.4 μM) shown in SEQ ID NO: 3, and template DNA 10 shown in SEQ ID NO: 4 were mixed in a 2× PCR reagent of GoTaq (registered trademark) Enviro qPCR Systems (manufactured by Promega) to give a two-fold dilution. ５ 19 μL of PCR reagent containing 1 copy of the PCR product was prepared. 1 μL of whole blood or ddH ２O was added to prepare 20 μL of sample, which was used as the sample per reaction in each device. The sequences are shown below. Primer: 5'-CAGATATCGCAACCGCCTTT-3' (SEQ ID NO: 1) Primer: 5'-CCGATGTGAAGGTAAATGCAAA-3' (SEQ ID NO: 2) Probe: 5'-[FAM]-TATGCACGCCAACGGCGCCT-[BHQ1]-3' (SEQ ID NO: 3) Template DNA: 5'CAGATATCGCAACCGCCTTTACATCCGTAGCACACATCTGCCGGGACGTAAACTACGGCTGACTTATTCGCAATATGCACGCCAACGGCGCCTCCTTCTTTTTCATTTGCATTTACCTTCACATCGG-3' (SEQ ID NO: 4)

[0097] The real-time PCR device and PCR conditions are shown below: The reciprocal flow type measurement chip and real-time PCR device correspond to the microfluidic chip 10 and PCR device 100 described above. (Reciprocal flow real-time PCR device and PCR conditions) Measurement device: PicoGene PCR1100 (GoPhoton) Measurement chip: MCP2000 (GoPhoton) Measurement conditions: Set values ​​for PCR1100 Hot Start 95℃, 15 seconds. Denature 95℃, 3.5 seconds. Annealing & Extension 60℃, 15 seconds. Cycle 50 (General real-time PCR device and PCR conditions) Measurement device: CFX96 Touch Deep Well (Bio-Rad) Measurement tubes: 8-tube array Measurement conditions: Actual measured values ​​for CFX96 Touch Deep Well (same as PCR1100) Hot Start 95℃, 15 seconds. Denature 95℃, 3.5 seconds. Annealing & Extension 60℃, 15 seconds. Cycle 50

[0098] When using a reciprocal flow real-time PCR device, a sample containing PCR reagents and blood is alternately sent through the flow path 12 to a first temperature region 46 of 95°C and a second temperature region 48 of 60°C, whereby the sample is stirred and mixed while the blood coagulates, separating the solid component from the clear solution component, making it possible to measure the fluorescent signal of the clear solution component.

[0099] Figures 15(a) and 15(b) show amplification curves obtained using a reciprocal flow real-time PCR device. Figure 15(a) is the real-time amplification curve for a sample with added blood, and Figure 15(b) is the real-time amplification curve for a sample without added blood. As shown in Figures 15(a) and 15(b), similar amplification curves can be obtained for samples with and without added blood, making it very easy to determine the PCR amplification.

[0100] Measurements were performed using a PCR tube in a typical real-time PCR device. In a typical real-time PCR device, the PCR reaction proceeds while the sample remains stationary in the PCR tube. For samples without added blood, the sample was transparent both before and during PCR, allowing for adequate measurement of the fluorescent signal associated with PCR amplification. On the other hand, for samples with added blood, the sample was red and transparent before PCR, but during PCR, the blood components browned due to heat denaturation at the beginning of PCR, reducing the fluorescent transmittance of the sample. As a result, it became impossible to adequately measure the fluorescent signal associated with PCR amplification.

[0101] Figure 16 shows the amplification curves obtained using a typical real-time PCR device. As shown in Figure 16, the amplification curve for the sample without added blood has a clear rise in the curve, making it easy to determine whether PCR amplification has occurred. On the other hand, the amplification curve for the sample with added blood has an unclear rise in the curve, making it very difficult to determine whether PCR amplification has occurred.

[0102] (Second Example) In the second example, a reciprocal flow real-time PCR device and a general real-time PCR device using PCR tubes were used to prepare samples by adding blood directly to an RT-PCR reagent, and real-time RT-PCR measurements were performed.

[0103] A sample was prepared under the following conditions: A predetermined amount of reverse transcriptase included in GoTaq® Enviro RT-qPCR Systems (manufactured by Promega) was added, and the 2x PCR reagent was diluted two-fold to amplify the SFTS gene. The primers (0.9 μM each) shown in SEQ ID NO: 5 and 6, the probe (0.3 μM) shown in SEQ ID NO: 7, and the template RNA 10 shown in SEQ ID NO: 8 were used. ５ 19 μL of RT-PCR reagent containing 1 copy of the antibody was prepared. 1 μL of whole blood or ddH ２ O was added to prepare 20 μL of sample, which was used as the sample per reaction in each device. The sequences are shown below. Primer: 5'-ACCTGTCTCCTTCAGCTTCT-3' (SEQ ID NO: 5) Primer: 5'-TGTCAGAGTGGTCCAGGATT-3' (SEQ ID NO: 6) Probe: 5'-FAM-TGGAGTTTGGTGAGCAGCAGC-BHQ1-3' (SEQ ID NO: 7) Template RNA: 5'ACCTGTCTCCTTCAGCTTCTTGATGATCAATGCAGGATCAAGGCCTTCATAGGCCAGCTCTCTCGCAAAATCTTCAAGCTCAGTCAAATTGAGCTGCTGCTCACCAAACTCCACTGCAATCCTGGACCACTCTGACA-3' (SEQ ID NO: 8)

[0104] The real-time PCR device and PCR conditions are shown below: The reciprocal flow type measurement chip and real-time PCR device correspond to the microfluidic chip 10 and PCR device 100 described above. (Reciprocal flow real-time PCR device and PCR conditions) Measurement device: PicoGene PCR1100 (GoPhoton) Measurement chip: MCP2000 (GoPhoton) Measurement conditions: Set values ​​for PCR1100 RT 50℃, 5 min. Hot Start 95℃, 15 sec. Denature 95℃, 3.5 sec. Annealing & Extension 60℃, 20 sec. Cycle 45 (General real-time PCR device and PCR conditions) Measurement device: CFX96 Touch Deep Well (Bio-Rad) Measurement tubes: 8-tube strip Measurement conditions: Actual measured values ​​for CFX96 Touch Deep Well (same as PCR1100) RT 50℃, 5 min. Hot Start 95℃, 15 sec. Denature 95℃, 3.5 sec. Annealing & Extension 60℃, 20 sec. Cycle 45

[0105] When using a reciprocal flow real-time PCR device, just as when the template is DNA, even when the template is RNA, a sample made by adding blood to an RT-PCR reagent is subjected to a reverse transcription reaction at 50°C for 5 minutes in a flow path 12, and then the sample is alternately sent to a first temperature region 46 of 95°C and a second temperature region 48 of 60°C. As the sample is stirred and mixed, blood coagulation progresses, and the solid component and the clear solution component are separated, making it possible to measure the fluorescent signal of the clear solution component.

[0106] Figures 17(a) and 17(b) show amplification curves obtained using a reciprocal flow real-time PCR device. Figure 17(a) is the real-time amplification curve for a sample with added blood, and Figure 17(b) is the real-time amplification curve for a sample without added blood. As shown in Figures 17(a) and 17(b), similar amplification curves can be obtained for samples with and without added blood, making it very easy to determine the PCR amplification.

[0107] On the other hand, in a typical real-time PCR device, the RT-PCR reaction proceeds while the sample remains stationary within the PCR probe. For samples without added blood, the sample was transparent both before and during PCR, allowing for adequate measurement of the fluorescent signal associated with PCR amplification. For samples with added blood, the sample was red and transparent before PCR, but during PCR, the blood components browned due to heat denaturation at the beginning of PCR, reducing the sample's fluorescent transmittance. This made it impossible to adequately measure the fluorescent signal associated with RT-PCR amplification.

[0108] Figure 18 shows the amplification curves obtained using a typical real-time PCR device. As shown in Figure 18, the amplification curve for the sample without added blood has a clear rise in the curve, making it easy to determine whether PCR amplification has occurred. On the other hand, the amplification curve for the sample with added blood has an unclear rise in the curve, making it very difficult to determine whether PCR amplification has occurred.

[0109] From the PCR results of the first and second examples, it can be seen that the PCR method according to this embodiment can suitably measure the fluorescent signal accompanying PCR amplification for samples in which blood has been directly added to the PCR reagent, and can appropriately perform real-time PCR analysis. Because the PCR method according to this embodiment uses samples in which blood has been directly added to the PCR reagent, complicated nucleic acid purification procedures are not required. Therefore, rapid real-time PCR is possible without any hassle.

[0110] The present invention has been described above based on the embodiments. These embodiments are merely examples, and it will be understood by those skilled in the art that various modifications are possible in the combination of the components and treatment processes, and that such modifications are also within the scope of the present invention.

[0111] The present invention can be used in PCR.

[0112] 10, 70 Microfluidic chip, 12 Channel, 14 Substrate, 16 First sealing film, 18 Second sealing film, 20 Third sealing film, 24 First air communication port, 26 Second air communication port, 28 First filter, 30 Second filter, 32 First chamber, 34 Second chamber, 40 First air duct, 42 Second air duct, 46 First temperature region, 48 Second temperature region, 54 First serpentine channel, 56 Second serpentine channel, 58 Fluorescence detection region, 59 Detection channel, 60 First widening channel, 62 Second widening channel, 100 PCR device, 101 Installation unit, 102 First heater, 104 Second heater, 106 Fluorescence detection device, 108 Optical head, 110 Control device, 120 Liquid delivery system, 122 first three-way valve, 124 second three-way valve, 126 pressure chamber, 128 liquid delivery pump.

[0113] SEQ ID NO: 1: Primer SEQ ID NO: 2: Primer SEQ ID NO: 3: Probe SEQ ID NO: 4: Template DNA SEQ ID NO: 5: Primer SEQ ID NO: 6: Primer SEQ ID NO: 7: Probe SEQ ID NO: 8: Template RNA

Claims

1. A PCR method comprising the steps of: preparing a sample by adding blood to a PCR reagent; thermally cycling the sample by repeatedly moving the sample back and forth within a flow channel of a microfluidic chip; and detecting fluorescence from the sample within the flow channel to monitor the progress of PCR of the sample.

2. The PCR method according to claim 1, characterized in that in the step of applying a thermal cycle, the sample is repeatedly moved back and forth within the flow path, thereby separating the sample into a colored solid component and a clear solution component within the flow path, and in the step of detecting fluorescence, fluorescence emitted from the clear solution component is detected.

3. The PCR method according to claim 1 or 2, characterized in that the blood content in the sample is 0.01% to 20%, preferably 0.1% to 10%, and more preferably 1% to 5%.

4. The PCR method according to any one of claims 1 to 3, characterized in that the PCR reagent contains a surfactant.

5. A PCR method according to any one of claims 1 to 4, characterized in that the PCR reagent contains an additive.

6. A PCR method according to any one of claims 1 to 5, characterized in that the flow path includes a serpentine flow path that combines a straight flow path and a curved flow path.

7. A PCR method according to any one of claims 1 to 6, characterized in that the flow path includes a first temperature region maintained at a first temperature, a second temperature region maintained at a second temperature different from the first temperature, and a connecting flow path connecting the first temperature region and the second temperature region, and the cross-sectional area of ​​the connecting flow path is larger than the cross-sectional areas of the flow paths included in the first temperature region and the second temperature region.

Images