Virus production method and method for introducing nucleic acid into cell

Abstract

The present invention addresses the problem of providing: a virus production method wherein the proportion of capsid containing a target gene GOI can be improved; and a method for introducing a nucleic acid into a cell, the method including a nucleic acid introduction step for adding a nucleic acid to a suspension containing cells, wherein the proportion of capsid containing the target gene GOI can be improved. The present invention provides a virus production method including a nucleic acid introduction step for adding a nucleic acid to a suspension containing cells, the suspension having a density of 10 × 106 cells / mL or more, and a culture step for culturing the cells into which the nucleic acid has been introduced, wherein a nucleic acid is added if the population cell doubling time of the suspension is 35.4 hours or less.

Description

Method for producing a virus and method for introducing nucleic acid into a cell

[0001] The present invention relates to a method for producing a virus, which includes a nucleic acid transfer step of adding nucleic acid to a suspension containing cells, and a culture step of culturing the cells into which the nucleic acid has been transferred.The present invention further relates to a method for transferring nucleic acid into cells, which includes a nucleic acid transfer step of adding nucleic acid to a suspension containing cells.

[0002] For the purpose of treating intractable diseases such as genetic disorders and cancer, gene therapy methods have been developed in which a recombinant adeno-associated virus (AAV) vector incorporating a therapeutic gene is administered to a patient. A known method for producing an AAV vector involves forming a complex between negatively charged plasmid DNA and the cationic polymer polyethyleneimine (PEI) to neutralize the charge of the plasmid DNA, introducing the plasmid DNA encoding a protein required for AAV production into a cell by endocytosis, and producing AAV within the cell.

[0003] Patent Document 1 describes a method for transfecting cells with at least one nucleic acid sequence, the method comprising the steps of: (a) contacting cells with at least one nucleic acid formulated in a solution containing polyethyleneimine (PEI); (b) incubating or culturing the cells with the nucleic acid and polyethyleneimine (PEI) solution; (c) adding an enhancer at or immediately after step (a), or within 3 hours of step (a), to produce a mixture; and (d) incubating the mixture of step (c), thereby transfecting the cells with the nucleic acid sequence.

[0004] Patent Document 2 describes a method for producing adeno-associated virus (AAV), comprising the steps of: (a) providing a stable AAV producer host cell line; and (b) culturing the cells in perfusion culture during AAV production, wherein the perfusion culture involves continuous replacement of spent medium with fresh medium, and the continuous replacement of spent medium with fresh medium continues after induction of AAV production.

[0005] Special table 2020-524498 publication Special table 2023-518919 publication

[0006] To achieve high production of viruses (e.g., AAV), it is important to use highly productive cells and increase cell density. However, it has been found that simply increasing cell density does not increase the number of capsids containing a gene of interest (GOI) (e.g., a therapeutic or prophylactic gene). An objective of the present invention is to provide a method for producing a virus that can increase the proportion of capsids containing a GOI. Another objective of the present invention is to provide a method for introducing nucleic acids into cells, which includes a nucleic acid introduction step of adding nucleic acid to a suspension containing cells, that can increase the proportion of capsids containing a GOI.

[0007] As a result of extensive research to solve the above problems, the present inventors focused on the process by which GOIs are produced within cells and hypothesized that in cells approaching saturation of proliferation, GOI-containing capsids cannot be produced due to reduced GOI replication. Based on this hypothesis, the present inventors found that high virus (AAV) production can be achieved by transfecting cells in a state where cell division is active. The present invention was completed based on these findings.

[0008] According to the present invention, the following inventions are provided: <1> 10 x 10 ６A method for producing a virus, comprising: a nucleic acid introduction step of adding nucleic acid to a suspension containing cells at a density of 10 x 10 cells / mL or more; and a culture step of culturing the cells into which the nucleic acid has been introduced, wherein the nucleic acid is added when the population cell doubling time of the suspension is 35.4 hours or less. <2> The method according to <1>, wherein the population cell doubling time of the suspension is 35.4 hours or less when cell density A at time point A and cell density B at time point B 24 hours before time point A satisfy cell density A / cell density B≧1.6. <3> The method according to <1> or <2>, comprising perfusion culturing the cells before the nucleic acid introduction step. <4> The method according to <3>, wherein the perfusion ratio 24 hours before the start of the nucleic acid introduction step is 1 or more. <5> The method according to <1>, wherein 10 x 10 cells are cultured at a density of 10 x 10 cells / mL or more before the nucleic acid introduction step. ６<6> The method for producing the virus according to any one of <1> to <4>, comprising a pre-culture step of culturing a suspension containing cells at a density of 10 ... <12> The method for producing a virus according to <10> or <11>, wherein the nucleic acid comprises at least one or more viral helper genes. <13> The method for producing a virus according to any one of <10> to <13>, wherein the nucleic acid comprises four or more of the group consisting of a therapeutic or prophylactic gene, a Rep gene, a Cap gene, an E2 gene, an E4 gene, and a VA-RNA1 gene. <14> The method for producing a virus according to any one of <1> to <13>, wherein the cell is an animal cell. <15> The method for producing a virus according to any one of <1> to <14>, wherein the cell is a HEK cell. <16> The method for producing a virus according to any one of <1> to <15>, wherein the nucleic acid is introduced into the cell using one or more plasmids. <17> Before the nucleic acid introduction step, 10 x 10 ６ <18> The method for producing a virus according to any one of <1> to <16>, comprising a pre-culture step of culturing a suspension containing cells at a density of 10 x 10 cells / mL or more, wherein in the culture step, perfusion culture is not performed for 4 to 24 hours immediately after the nucleic acid introduction step, and then perfusion culture is performed. ６<19> The method for producing a virus according to any one of <1> to <16>, comprising a pre-culture step of culturing a suspension containing cells at a density of 10 x 10 cells / mL or more, wherein when the population cell doubling time of the suspension is 35.4 hours or less, a portion of the pre-culture culture is removed, nucleic acid is added to the removed portion of the culture, and the cells into which the nucleic acid has been introduced are cultured to produce a virus, and the remaining portion of the pre-culture culture that was not removed is continued to be cultured, and thereafter, when the population cell doubling time of the suspension is 35.4 hours or less, a portion of the culture is removed, and virus production is carried out by nucleic acid introduction and cell culture. ６ A method for introducing nucleic acid into cells, comprising a nucleic acid introduction step of adding nucleic acid to a suspension containing cells at a density of 1000 cells / mL or more, wherein the nucleic acid is added when the population cell doubling time of the suspension is 35.4 hours or less.

[0009] According to the present invention, the proportion of capsids containing a GOI can be increased in a virus production method that includes a nucleic acid introduction step of adding nucleic acid to a suspension containing cells and a culture step of culturing the cells into which the nucleic acid has been introduced.

[0010] Figure 1 shows the results of measuring changes in cell density over the culture period. Figure 2 shows the results of measuring the genome titer of AAV5. Figure 3 shows the results of measuring the copy number of the target gene. Figure 4 shows the results of measuring the full rate. Figure 5 shows a top view of the electroporation device 100. Figure 6 shows a cross-sectional view of the electroporation device 100.

[0011] An example of an embodiment of the present disclosure will be described below. However, the present disclosure is not limited to the following embodiment in any way, and can be implemented with appropriate modifications within the scope of the object of the present disclosure. In this specification, a numerical range indicated using "to" means a range that includes the numerical values ​​written before and after "to" as the minimum and maximum values, respectively.

[0012] The present invention is 10 x 10 ６This method for producing a virus includes a nucleic acid introduction step of adding nucleic acid to a suspension containing cells at a density of 1000 cells / mL or more, and a culture step of culturing the nucleic acid-introduced cells, and the method includes adding nucleic acid when the population cell doubling time of the suspension is 35.4 hours or less. By satisfying this requirement, transfection occurs in a state of highly activated cell division, thereby achieving high virus production.

[0013] The population cell doubling time (T) can be calculated using the following formula: T = n × LN(2) / LN{(d Ａ ×V Ａ ) / (d Ｂ ×V Ｂ ) d Ａ V: Cell density at time point A (cells / mL) Ａ d: Amount of suspension containing cells at time point A (mL) Ｂ V: Cell density (cells / mL) at time point B (n hours before time point A) Ｂ : Amount of suspension containing cells at time point B (mL) n: Indicates the time from time point B to time point A.

[0014] When cell bleed (CB) is included between time point B and time point A, the population cell doubling time (T) can be calculated using the following formula:

[0015]

[0016] d Ａ V: Cell density at time point A (cells / mL) Ａ d: Amount of suspension containing cells at time point A (mL) Ｂ V: Cell density (cells / mL) at time point B (n hours before time point A) Ｂ d: Volume of suspension containing cells at time point B (mL) ＣＢ V: Cell density (cells / mL) of the cell-containing suspension at each time point of cell bleeding ＣＢ : Volume (mL) of suspension containing cells to be bled at each time point of cell bleeding. n: Indicates the time from time point B to time point A.

[0017] The population cell doubling time of the suspension may be 35.4 hours or less, preferably 31.5 hours or less, more preferably 28.0 hours or less, and particularly preferably 24.0 hours or less.

[0018] The cells used in the present invention may be isolated cells, cells contained in isolated tissues derived from living organisms, or cultured cells. When the cells are isolated cells or cultured cells, the cells may be either adherent cells or non-adherent cells.

[0019] The cells are preferably animal cells. While the animal cells are not particularly limited, mammalian cells or insect cells are preferred, and mammalian cells are more preferred. Examples of mammalian cells include, but are not particularly limited to, human cells, mouse cells, rat cells, monkey cells, and hamster cells. Preferably, human cells can be used. Examples of cells include mouse myeloma (NS0) cell lines, Chinese hamster ovary (CHO) cell lines, HT1080, H9, HepG2, MCF7, MDBK Jurkat, NIH3T3, PC12, BHK (baby hamster kidney cells), VERO, SP2 / 0, YB2 / 0, YO, C127, L cells, COS (e.g., COS1 and COS7), QC1-3, HEK (human embryonic kidney cells) cells (e.g., HEK293), and PER. Examples of suitable cell lines include C6, HeLa, EB1, EB2, EB3, oncolytic, or hybridoma cell lines. Preferably, the cells are HEK or CHO cells, more preferably HEK293 cells. The cells may be either adherent or suspension cells, but suspension cells are preferred for high-density, large-scale culture in a reactor.

[0020] As a cell line with high cell proliferation and high AAV production capacity per cell, for example, Thermo Fisher's suspension HEK293 cell line Viral Production Cells 2.0 (VPCs 2.0) can be used.

[0021] The method for producing a virus of the present invention may include pre-culturing cells before the nucleic acid introduction step. Preferably, in the present invention, 10 x 10 cells are pre-cultured before the nucleic acid introduction step. ６ The method may include a pre-culture step of culturing a suspension containing cells at a density of 1000 cells / mL or more.

[0022] The method of cell pre-culture is not particularly limited, and may be any of batch culture, fed-batch culture, perfusion culture, shake culture, agitation culture, static culture, and adherent culture. From the viewpoint of large-scale processing and high concentration, perfusion culture is preferred. In perfusion culture, waste components are removed using a filter and fresh medium is supplied, thereby maintaining the quality (concentration of components) of the suspension at a level suitable for cell growth, thereby enabling high-concentration growth.

[0023] The temperature for pre-cultivating the cells is preferably 30 to 40°C, more preferably 32 to 37°C, and particularly preferably 36 to 37°C. ２ The concentration is 2-25%. The cell density of the preculture is 10 x 10 ６ Cells / mL or more 200 x 10 ６ It is preferable to culture the cells so that the concentration is 15 x 10 cells / mL or less. ６ Cells / mL or more 100 x 10 ６ cells / mL or less, more preferably 20 x 10 ６ Cells / mL or more 80 x 10 ６ cells / mL.

[0024] The pre-culture time is preferably 12 hours or more.

[0025] When cells are perfusion cultured before the nucleic acid introduction step, the perfusion ratio 24 hours before the start of the nucleic acid introduction step is preferably 0.5 or more, more preferably 1 or more, from the viewpoint of enhancing cell proliferation. The perfusion ratio is more preferably 1 to 5. The perfusion ratio may be 2 to 5, or 3 to 5. The perfusion ratio is the volume ratio at which the cell culture medium is replaced in one day. A perfusion ratio of 1 means that the entire volume (1 volume) is replaced over one day. A perfusion ratio of 3 means that 3 times the culture volume is replaced over one day.

[0026] In the case of perfusion culture, either a dynamic or continuous system can be used. In the dynamic system, cells are seeded at a low concentration, followed by growth culture. Once a high concentration is reached, the entire cell solution is recovered and gene transfer is performed. In the continuous system, cells are seeded at a low concentration, followed by growth culture. Once a certain concentration is reached, a certain amount of cells are extracted (cell bleeding) and gene transfer is performed. The reactor is replenished with fresh medium in an amount equal to the amount extracted, maintaining a constant cell concentration within the reactor. Cell bleeding and medium supply can be continuous or intermittent (e.g., once a day, 10-50%). The cell concentration is restored by cell growth before the next cell bleeding. The above procedure can be repeated, for example, for one day to three months. The perfusion ratio is not particularly limited, but is generally 0.3 vvd to 5.0 vvd, preferably 0.5 vvd to 4.0 vvd. The vvd in the perfusion ratio refers to the volume of culture medium extracted / volume of culture medium in the culture vessel / day.

[0027] Perfusion culture devices and methods are known in the art and are described in WO 2018 / 159847, WO 2019 / 049843, WO 2019 / 181234, WO 2019 / 239780, WO 2020 / 003833, WO 2020 / 162125, WO 2021 / 187008, WO 2022 / 196710, and WO 2023 / 054556, which are incorporated herein by reference. Perfusion culture, as described below, can also be used in pre-culture. For example, the "membrane separation process in which a cell suspension extracted from a culture tank is passed through a separation membrane to separate it into a cell-containing liquid and a permeate" described below can be used in pre-culture.

[0028] The method for producing the virus of the present invention is to ６ The method includes a nucleic acid introduction step of adding nucleic acid to a suspension containing cells at a density of 10 x 10 cells / mL or more. ６ Any cell / mL or more is sufficient, but 12 x 10 ６ cells / mL or more is preferred, 15 x 10 ６ More preferably, 18 x 10 cells / mL or more ６ More preferably, 20 x 10 cells / mL or more ６The upper limit of the cell density is 100 x 10 cells / mL or more. ６ cells / mL. If the upper limit is exceeded, it becomes difficult to satisfy the population cell doubling time of the suspension of 35.4 hours or less, and replication of the therapeutic gene decreases.

[0029] Cell density can be determined using a Vi-cell™ XR (Beckman Coulter).

[0030] When the population cell doubling time of the suspension satisfies 35.4 hours or less, the cell density A at time point A and the cell density B at time point B 24 hours before time point A may satisfy cell density A / cell density B≧1.6.

[0031] The addition of nucleic acid may be carried out at any time during the cell proliferation phase as long as the rate of increase in cell density over 24 hours is 1.6 or more. The rate of increase in cell density over 24 hours is preferably 1.7 or more, more preferably 1.8 or more, and even more preferably 2 or more.

[0032] Cell growth has three phases: lag phase, logarithmic growth phase, stationary phase, and death phase. The present invention is intended to transfect during a specific period of the logarithmic growth phase. Note that the growth rate gradually decreases over time. When the inventors attempted transfection at the above-mentioned high density, transfection occurred during a period when the cell density growth rate was low, resulting in a low production amount of GOI-containing capsids. In the present invention, by performing transfection during a period when the cell growth rate was high even at the above-mentioned high cell density, the production amount of GOI-containing capsids can be improved.

[0033] In cell culture, the cell density is measured at a fixed time every day. For example, it is measured once a day at 9:00 AM. The cell density A is measured at 9:00 AM (time point A) after the start of the cell culture, and the cell density A is 10 × 10 ６Once it has been confirmed that the cell density has reached 1000 cells / mL or more and that the cell density B measured at 9:00 AM the previous day (time point B) and the cell density A satisfy the above formula, nucleic acid is added. If the above conditions are satisfied at 9:00 AM, it is preferable to add nucleic acid immediately thereafter. Although a slight delay is not a problem, it is preferable to add nucleic acid within 3 hours, more preferably within 2 hours, and even more preferably within 1 hour from time point A. Furthermore, if it is known from experience that the above conditions are satisfied after a predetermined time has elapsed since the start of culture, nucleic acid may be added after a predetermined time has elapsed since the start of culture without measuring the cell density.

[0034] In the nucleic acid introduction step, the nucleic acid is preferably introduced into the cells using a gene introduction reagent or by electroporation.

[0035] Nucleic acids are linear polynucleotides formed by polymerization of nucleotides, each of which consists of a purine or pyrimidine base, a sugar, and a phosphate, through the formation of diester bonds between the 3' and 5' carbon atoms of the sugar between nucleotides. Nucleic acids are broadly classified into deoxyribonucleic acid (DNA), in which the sugar moiety is deoxyribose, and ribonucleic acid (RNA), in which the sugar moiety is ribose, based on the sugar moiety. Nucleic acids may be any of genes, DNA (linear or circular), RNA, oligonucleotides, and polynucleotides. In this specification, the terms "nucleic acid" are used interchangeably with "gene," "DNA," "RNA," "oligonucleotide," and "polynucleotide." An example of a nucleic acid in the present invention is a plasmid.

[0036] The gene transfer reagent is preferably a cationic polymer. The cationic polymer is not particularly limited, but may be, for example, one or a combination selected from the group consisting of chitosan, poly-L-lysine (pLL), polyamine (PA), polyalkyleneimine (PAI), polyethyleneimine (PEI), poly[α-(-aminobutyl)-L-glycolic acid], polyamidoamine, poly(2-dimethylamino)ethyl methacrylate, polyhistidine, polyarginine, poly(4-vinylpyridine), poly(vinylamine), and poly(4-vinyl-N-alkylpyridinium halide). Polyamines are preferred as cationic polymers, with polyethyleneimine (hereinafter also referred to as PEI) being particularly preferred. A non-lipid cationic polymer is preferably used as the cationic polymer.

[0037] The PEI may be linear or branched, but linear PEI is preferred. Considering its transfection efficiency, the molecular weight of PEI is preferably 10,000 to 800,000 Da, more preferably 10,000 to 50,000 Da, even more preferably 10,000 to 27,000 Da, and particularly preferably about 25,000 Da. As an example, linear PEI with a molecular weight of about 25,000 Da can be used. PEI is commercially available and easily available. For example, PEI Pro manufactured by Polyplus can be preferably used.

[0038] In electroporation (EP), intracellular gene transfer is achieved by electrophoretically driving negatively charged plasmid DNA, which repels cells, into the cells (pores) formed by the application of an electric pulse. Unlike the PEI method, gene transfer with the EP method is completed upon pulse application, eliminating the need for prolonged stirring and culture control required with the PEI method. The cell concentration can be freely adjusted temporarily during the EP process, provided that uniform dispersion of the cells and plasmid DNA is maintained. Furthermore, because the transfer principle relies on electrophoresis, there is no need to individually optimize the added plasmid concentration depending on the cell concentration or medium condition; the same plasmid concentration conditions can be applied across a wide range of cell concentrations. Therefore, from the perspective of improving plasmid utilization efficiency and reducing throughput, it is preferable to set the cell concentration higher during EP.

[0039] The cell concentration may be increased from that of the pre-culture by cell concentration using centrifugation, continuous centrifugation, sonic aggregation, acoustophoresis, filtration (TFF, ATF), etc. Concentration is performed at a cell concentration of 80 x 10 ６ It is preferable to concentrate the cell concentration to 100 x 10 cells / mL or more. ６ cells / mL or more, 120 x 10 ６ In this step, the medium used for the culture may be replaced with a fresh medium, a buffer specifically for electroporation, or a medium optimized for subsequent culture.

[0040] The buffer conditions during EP can be those suitable for normal cell culture (pH, pH buffering capacity, nutrients, salt concentration, etc.). In the nucleic acid introduction step, the cells are in suspension, and the conductivity of the suspension is preferably 5 to 20 mS / cm. However, a suspension conductivity of 5 to 20 mS / cm is not essential because it can be used to reduce heat generation under electroporation conditions.

[0041] During electroporation, membrane repair agents or nutrients may be added. The functions and components of electroporation buffers and cell culture media are often similar, and using a dedicated medium optimized for each cell type may improve cell survival and gene transfer / expression efficiency after EP rather than using a general-purpose EP buffer. Balan-CD-HEK293 medium is preferred for HEK293 cell x EP plasmid transfection. Furthermore, if the preculture is performed using perfusion culture or other methods that maintain a consistent level of waste and nutrient concentration in the medium, buffer exchange can be omitted and the preculture suspension can be used directly for EP. Eliminating the concentration and medium exchange steps can simplify the process, reduce contamination risk, improve process stability and reproducibility, and reduce costs.

[0042] The type of power supply does not matter as long as the applied voltage (required electric field E x gap) and power capacity (pulse current, pulse time, pulse interval) meet the necessary requirements. A function generator is up to several tens of volts and several tens of microns, while a function generator + power amplifier is up to several hundred volts and up to a 2 mm gap. A dedicated pulse power supply (DC power supply + capacitor + power switch circuit) is up to several kV and up to a 1 cm gap.

[0043] The liquid delivery pump and the liquid delivery method may be any of a syringe pump, a tube pump, a magnet pump, a diaphragm pump, etc., or may be a pressurized air delivery method.

[0044] Electroporation may be performed using any of batch electroporation (single-use cuvettes (several tens of μL to approximately 1 mL, pipetting), continuous batch electroporation (several mL to several hundred mL), and continuous electroporation (several mL to several tens of L). When the processing volume (culture solution volume) is large, continuous electroporation is preferred. In the case of continuous electroporation, a liquid delivery method with less pulsation is preferred.

[0045] The apparatus for performing electroporation is not particularly limited, and is known in the art and described in WO2022 / 224803, WO2023 / 157673 and WO2023 / 223931, which are incorporated herein by reference.

[0046] As an example of an apparatus for performing continuous electroporation, the electroporation device shown in Figures 5 and 6 can be used. Figure 5 shows a top view of electroporation device 100, and Figure 6 shows a cross-sectional view of electroporation device 100.

[0047] In the electroporation device 100, an upper electrode 41a held by an upper electrode holding plate 10 and a lower electrode 41b held by a lower electrode holding plate 20 are arranged facing each other to form an electrode pair 41. A power supply (not shown) is connected to the upper electrode 41a and the lower electrode 41b. D indicates the distance (gap) between the electrodes. In FIG. 5, L indicates the electrode length, and W indicates the electrode width (channel width). In FIG. 6, a1 indicates the surface portion of the upper electrode, a2 indicates the back surface portion of the upper electrode, b1 indicates the surface portion of the lower electrode, and b2 indicates the back surface portion of the lower electrode. A channel plate 30 is provided between the upper electrode holding plate 10 and the lower electrode holding plate 20. Fluid introduced through an inlet 50 passes through an opening (channel) 32 and is discharged from an outlet 52.

[0048] The supply reservoir, liquid delivery tube, electroporation device, and recovery reservoir are preferably connected aseptically. That is, in the present invention, liquid delivery is preferably performed aseptically in the nucleic acid introduction step and the culture step. The pre-culture step (+concentration / medium exchange+mixing system) and the post-culture step (culture step for culturing cells into which nucleic acids have been introduced) may be connected continuously or separately.

[0049] The concentration of nucleic acid in the suspension to which nucleic acid has been added is preferably 3 μg / mL or more, more preferably 4 μg / mL or more, and even more preferably 5 μg / mL or more.

[0050] When a gene transfer reagent is used, the mass ratio of nucleic acid to gene transfer reagent is preferably 1:1 to 1:3, and more preferably 1:2.

[0051] The nucleic acid used may be a nucleic acid encoding a virus, preferably an exogenous recombinant nucleic acid encoding a virus. In the present invention, a virus is produced. The produced virus may be used, for example, as a pharmaceutical ingredient.

[0052] Virus refers to a virus that introduces nucleic acid into cells to produce it. Viruses include non-enveloped viruses. More specifically, they include adeno-associated viruses, adenoviruses, lentiviruses, baculoviruses, retroviruses, etc., and among them, adeno-associated viruses are preferred. Non-enveloped viruses are known in the art and are described in WO2015 / 005430, which are incorporated herein by reference.

[0053] Adeno-associated virus (AAV) refers to a small, replication-incompetent, non-enveloped virus of the Parvoviridae and Dependoparvovirus families, containing a single-stranded DNA consisting of approximately 4,700 bases. There are over 100 AAV serotypes, and it is known that the host range and viral characteristics differ depending on the serotype. Serotype 2 (AAV2) is one of the serotypes that has been widely studied for a long time and is known to have a very wide host range. Serotype 1 (AAV1), serotype 5 (AAV5), and serotype 6 (AAV6) are serotypes with higher tissue tropism. AAV1 is said to have high gene transfer efficiency in muscles, liver, respiratory tract, central nervous system, etc.; AAV5 is said to have high gene transfer efficiency in the central nervous system, liver, retina, etc.; and AAV6 is said to have high gene transfer efficiency in heart, muscles, liver, etc. In the present invention, serotype 2 or serotype 5 is preferably used. Serotype 5 is particularly preferred.

[0054] Adeno-associated virus genes refer to genes composed of one or more nucleic acid sequences derived from one or more adeno-associated virus serotypes, and are preferably genes involved in AAV replication and packaging, and genes encoding AAV structural proteins.

[0055] AAV is a non-enveloped virus that grows in the presence of helper viruses such as adenovirus and herpesvirus.When preparing AAV for gene therapy or nucleic acid transfer, traditionally, adenovirus is co-infected into host cells to allow AAV replication.In addition, the gene responsible for the helper function of adenovirus has been identified, and the plasmid carrying this gene is also used.For example, a plasmid containing Rep gene and Cap gene, an adenovirus helper plasmid, and a plasmid containing therapeutic or preventive gene can be simultaneously transfected into cells, and then packaged into recombinant AAV (rAAV).

[0056] The nucleic acid used in the present invention preferably contains one or more of an adeno-associated virus gene and a viral helper gene. The nucleic acid preferably contains at least one or more viral helper genes.

[0057] The Rep and Cap genes encode proteins involved in virion replication and packaging. In the wild type, the Rep gene is expressed from the P5 promoter and p19 promoter. The Cap region expresses VP1, VP2, and VP3. The promoter naturally retained by the Cap gene can be the p40 promoter.

[0058] The adeno-associated virus genes (such as the Rep gene and the Cap gene) may be wild-type genes, but genes that have been modified by base substitution, deletion, insertion, or addition, etc., may also be used, as long as they exhibit their original functions.

[0059] When introducing the Rep gene and the Cap gene into a cell, a vector containing the Rep gene and the Cap gene can be introduced into the cell. The Rep gene refers to a region of the AAV genome that encodes viral replication proteins collectively required for replication of the viral genome, or a functional homolog thereof, such as the human herpesvirus 6 (HHV-6) Rep gene (known to mediate AAV-2 DNA replication), as known to those skilled in the art. The Cap gene refers to a region in the AAV genome that encodes viral capsid proteins, as known to those skilled in the art.

[0060] As a vector containing the Rep gene and the Cap gene, for example, a plasmid, a nucleic acid sequence derived from a virus, an artificially designed nucleic acid, etc. can be used, and a plasmid is preferred.

[0061] When wild-type adeno-associated virus genes (such as the Rep gene and the Cap gene) are modified by base substitution, deletion, insertion, or addition, the number of modified bases is preferably 1 to 20, more preferably 1 to 10, and even more preferably 1 to 3. The base sequence of the modified adeno-associated virus gene preferably exhibits 85% or more sequence identity, more preferably 90% or more sequence identity, even more preferably 95% or more sequence identity, and even more preferably 98% or more sequence identity to the base sequence of the wild-type adeno-associated virus gene.

[0062] When introducing the Rep gene and the Cap gene into a cell, a vector containing the Rep gene and the Cap gene can be introduced into the cell. The arrangement of the Rep gene and the Cap gene in the vector is not particularly limited, and the Rep gene may be located upstream or downstream of the Cap gene, but preferably the Rep gene is located upstream of the Cap gene.

[0063] Rep genes refer to regions of the AAV genome that encode viral replication proteins collectively required for replication of the viral genome, as known to those skilled in the art, or functional homologs thereof, such as, for example, the human herpesvirus 6 (HHV-6) Rep genes, which are known to mediate AAV-2 DNA replication. Thus, the coding region of the Rep genes includes at least the genes encoding AAV REP78 and REP68 (long form REP proteins) and REP52 and REP40 (short form REP proteins), or functional homologs thereof.

[0064] The Cap gene refers to the region in the AAV genome that encodes the viral capsid protein known to those skilled in the art. Examples of these capsid proteins are AAV capsid proteins VP1, VP2 and VP3. The Cap gene used in the present invention may be derived from any AAV serotype, but is preferably derived from AAV2 or AAV5.

[0065] As a vector containing the Rep gene and the Cap gene, for example, a plasmid, a nucleic acid sequence derived from a virus, an artificially designed nucleic acid, etc. can be used, and a plasmid is preferred.

[0066] In the present invention, a therapeutic or preventive gene may be introduced into a cell. Examples of therapeutic or preventive genes that can be used include, but are not limited to, genes that are incomplete or missing in the genome of the target cell, or genes that encode non-natural proteins with a desired biological or therapeutic effect (e.g., antiviral function). Specific examples of therapeutic or preventive genes include genes used to treat or prevent infectious diseases, inflammatory diseases, autoimmune diseases, chronic and infectious diseases (including acquired immune deficiency syndrome (AIDS), cancer, neurological diseases, cardiovascular diseases, hypercholesterolemia, and other disorders), various blood diseases such as anemia and hemophilia, and genetic defects (e.g., cystic fibrosis, Gaucher disease, adenosine deaminase (ADA) deficiency, emphysema, and other conditions).

[0067] Therapeutic or preventive genes may also be some antisense oligonucleotides (e.g., short oligonucleotides complementary to sequences around the translation start site (AUG codon) of mRNA) that are useful in antisense therapy for cancer and viral diseases.

[0068] The therapeutic or prophylactic gene may be linked to a promoter for expressing the therapeutic or prophylactic gene. The promoter for expressing the therapeutic or prophylactic gene is not particularly limited, and examples include a cytomegalovirus-derived promoter (optionally containing an enhancer), SV40 early promoter, human elongation factor-1α (EF-1α) promoter, human ubiquitin C promoter, Rous sarcoma virus LTR promoter (a retrovirus), dihydrofolate reductase promoter, β-actin promoter, and phosphoglycerate kinase (PGK) promoter. The therapeutic or prophylactic gene and the promoter for expressing the gene are preferably flanked by ITR sequences.

[0069] As a vector containing a therapeutic or prophylactic gene, for example, a plasmid, a sequence derived from a virus, an artificially designed nucleic acid, etc. can be used, and a plasmid is preferred.

[0070] In the present invention, preferably, a viral helper gene derived from adenovirus may be introduced into a cell. The viral helper gene is a non-adeno-associated virus gene that enables replication and packaging of the adeno-associated virus. As the viral helper gene, a gene derived from a virus other than the adeno-associated virus is used. Specific examples of the viral helper gene include a viral helper gene derived from an adenovirus or a herpesvirus, and preferably, the viral helper gene is derived from an adenovirus.

[0071] Examples of viral helper genes derived from adenovirus include E1A, E1B, E2A, E4, and VA-RNA. In host cells having all or a part of the E1 region, the regions of the adenovirus genome necessary for the AAV genome to replicate and be packaged into capsids to form viral virions are the E2A region, E4 region, and VA1 RNA region. Regarding the function of the E4 region, the E4 34 kDa protein encoded by open reading frame 6 (E4 ORF6) of the E4 region is required for AAV replication. Preferably, the viral helper genes are the E2 gene, the E4 gene, and the VA-RNA gene. The VA-RNA gene is preferably the VA-RNAI gene.

[0072] The adenovirus-derived viral helper genes (E1A, E1B, E2A, E4, VA-RNA, etc.) may be wild-type genes, but genes that have been modified by base substitution, deletion, insertion, addition, or the like may also be used, as long as they exhibit their inherent functions.

[0073] When a wild-type viral helper gene is modified by base substitution, deletion, insertion, or addition, the number of modified bases is preferably 1 to 20, more preferably 1 to 10, and even more preferably 1 to 3. The base sequence of the modified viral helper gene preferably exhibits 85% or more sequence identity, more preferably 90% or more sequence identity, even more preferably 95% or more sequence identity, and even more preferably 98% or more sequence identity to the base sequence of the wild-type viral helper gene.

[0074] When a viral helper gene is introduced into a cell, a vector containing the viral helper gene can be introduced into the cell.

[0075] As a vector containing a viral helper gene, for example, a plasmid, a virus-derived sequence, an artificially designed nucleic acid, etc. can be used, and a plasmid is preferred.

[0076] The viral helper gene is preferably under the control of a promoter. Specific examples of promoters include, but are not limited to, the cytomegalovirus-derived promoter (CMV promoter) (optionally containing an enhancer), the SV40 early promoter, the human elongation factor-1α (EF-1α) promoter, the human ubiquitin C promoter, the retroviral Rous sarcoma virus (RSV) LTR promoter, the dihydrofolate reductase promoter, the β-actin promoter, and the phosphoglycerate kinase (PGK) promoter. The promoter may be under the control of a promoter whose expression can be regulated. The promoter whose expression can be regulated may be a Tet on / off system promoter, whose expression can be regulated by tetracycline, or a Tet on system.

[0077] The nucleic acid used in the present invention preferably contains four or more genes selected from the group consisting of a therapeutic or prophylactic gene, a Rep gene, a Cap gene, an E2 gene, an E4 gene, and a VA-RNA1 gene. In the present invention, the nucleic acid is preferably introduced into cells using one or more plasmids.

[0078] The nucleic acid preferably includes a plasmid containing a therapeutic or prophylactic gene, a plasmid containing the Rep gene and the Cap gene, and a plasmid containing the E2 gene, the E4 gene, and the VA-RNA1 gene. The nucleic acid may also include a plasmid containing the Rep gene, the E2 gene, the E4 gene, and the VA-RNA1 gene, and a plasmid containing the Cap gene and a therapeutic or prophylactic gene.

[0079] In the present invention, nucleic acids can be introduced into cells using multiple plasmids. However, there are no limitations on the form of the introduced nucleic acid, as long as the purpose of introducing nucleic acids encoding genes necessary for virus production into cells is achieved. For example, a large plasmid carrying the above genes on a single plasmid may be used. However, since the larger the plasmid size, the greater the tendency for cell damage during electroporation, so the plasmid size is preferably 15 kbp or less.

[0080] The virus may be produced by either the triple transfection (TT) method or the packaging cell method.

[0081] The TT method involves simultaneously transfecting a plasmid containing a Rep gene and a Cap gene, an adenovirus helper plasmid, and a plasmid containing a transgene (e.g., a desired therapeutic or prophylactic gene) into cells, thereby packaging the resulting plasmid into a recombinant AAV (rAAV).

[0082] The packaging cell method is a method for producing AAV by transfecting a cell into which some of the genes used in the TT method have already been integrated into the chromosome, and then introducing the remaining genes into the cell.

[0083] The method for producing a virus of the present invention includes a culturing step of culturing cells into which nucleic acid has been introduced. The cell culturing can be carried out under normal conditions for cell culturing. The cell culturing temperature is not particularly limited, and is carried out at a temperature at which the cells can survive. The culture temperature is generally 25°C to 45°C, preferably 30°C to 42°C, more preferably 35°C to 40°C, and an example is 37°C. ２ The concentration is generally 3 to 10% CO ２ and preferably 5 to 10% CO ２ As an example, 8% CO ２ is.

[0084] The culture conditions may be the same as those used in the pre-culture. However, when electroporation is performed, the culture conditions may be optimized to cause less damage than those used in the pre-culture (growth culture) because of the effects of electroporation-induced perforation damage, transgene expression, immune response due to intracellular viral accumulation, toxicity, etc.

[0085] The cell density is preferably equal to or less than that of the pre-culture. In the case of batch culture, the cell density is preferably 1 x 10 ６ ~10 x 10 ６ cells / mL, and in the case of fed-batch culture, preferably 1 x 10６ ~20 x 10 ６ cells / mL.

[0086] The cell concentration may be diluted during the post-culture step after gene transfer.

[0087] The period for virus production is preferably 24 hours to 90 days, more preferably 24 hours to 30 days, more preferably 24 hours to 20 days, even more preferably 24 hours to 10 days, even more preferably 24 hours to 7 days, and particularly preferably 24 hours to 72 hours. Unlike the PEI method, electroporation does not involve the processes of intracellular introduction, endosomal escape, or PEI sustained release, and therefore the rate at which the introduced gene reaches the nucleus and is expressed is faster than with the PEI method. While the PEI method typically requires 72 hours, the preferred period for EP is around 48 hours.

[0088] The culture can be batch culture, fed-batch culture, perfusion culture, or shake culture. From the viewpoint of large-scale processing and high density, it is preferable that at least a part of the virus production process be fed-batch culture (fed-batch culture) or perfusion culture.

[0089] The culturing step for culturing cells into which nucleic acids have been introduced is preferably fed-batch culture or perfusion culture. When perfusion culture is performed in the culturing step for culturing cells into which nucleic acids have been introduced, if nucleic acids are introduced into the cells using a gene transfer reagent, it is preferable to not start perfusion culture for 4 to 24 hours immediately after the nucleic acid transfer step, and then to perform perfusion culture thereafter. In this case, the perfusion ratio is preferably 0.5 or more, more preferably 1 or more. The perfusion ratio is more preferably 1 to 5. The perfusion ratio may be 2 to 5, or may be 3 to 5. By not performing perfusion culture for 4 to 24 hours immediately after the nucleic acid transfer step, the nucleic acid can be maintained in the medium and destruction of the complex between the nucleic acid and the gene transfer reagent can be suppressed. The period during which perfusion culture is not performed is more preferably 6 hours or more, more preferably 9 hours or more, and even more preferably 12 hours or more.

[0090] Perfusion culture is a culture method in which fresh medium is supplied to a cell culture solution and a portion of the medium in which the cells are cultured is removed. This perfusion culture method allows waste products excreted by the cells to be removed from the culture vessel. In perfusion culture, the medium is continuously supplied to the culture vessel, and the cells in the culture solution are continuously separated and the liquid is collected.

[0091] Perfusion culture generally allows for the achievement of high viable cell densities. A typical perfusion culture begins with a batch culture lasting one or two days, after which fresh feed medium is added to the culture continuously, stepwise, and / or intermittently, with simultaneous removal of spent medium. In perfusion culture, cells can also be separated using methods such as sedimentation, centrifugation, or filtration to remove spent medium while maintaining viable cell density. An advantage of perfusion culture is that the cell growth rate during cell density growth is maintained for a longer period than in batch or fed-batch culture.

[0092] Perfusion can be continuous, stepwise, intermittent, or a combination thereof, preferably continuous. The cells are retained in the culture, and the removed spent medium may be substantially cell-free or contain far fewer cells than the culture. Viruses expressed by the cell culture can be retained or recovered in the culture by selecting the membrane pore size.

[0093] In one example of the present invention, 10 x 10 ６A pre-culture step is performed in which a suspension containing cells at a density of 10 ...

[0094] The method for continuously separating the cell culture solution in perfusion culture is preferably a method using a membrane, preferably membrane filtration. The membrane filtration for separating the cells and the product in the culture solution is more preferably alternating tangential flow filtration (ATF method). Perfusion culture devices and culture methods are known in the art and are described in WO2018 / 159847, WO2019 / 049843, WO2019 / 181234, WO2019 / 239780, WO2020 / 003833, WO2020 / 162125, WO2021 / 187008, WO2022 / 196710 and WO2023 / 054556, which are incorporated herein by reference.

[0095] The virus can be extracted from the culture medium by a pump from the secondary side of the filtration membrane, but other available liquid-transporting means may also be used. The extracted culture medium is then subjected to treatments such as virus recovery and dead cell removal. After virus recovery and dead cell removal, the extracted culture medium may be partially discarded or returned to the culture vessel. If a loss of culture medium occurs due to the above treatments, it can be compensated for by, for example, supplying fresh medium to the culture vessel.

[0096] In perfusion culture, after the target cell density is reached, the cell density can be adjusted to within ±10% of the target cell density by removing the cell-containing culture medium at least once per day. Reducing the viable cell density during culture by removing a portion of the culture medium along with the cells to prevent excessive viable cell density is called cell bleeding, and the amount of culture medium can be maintained by adding an equal amount of fresh medium to the removed culture medium. "At least once per day" also includes continuous, automatic cell bleeding.

[0097] The culture vessel is not particularly limited and may be, for example, a flask or a bioreactor. The capacity of the culture vessel is preferably 1 L or more, more preferably 10 L or more, more preferably 50 L, more preferably 100 L or more, and more preferably 500 L. The upper limit is 200,000 L.

[0098] The culture scale is not particularly limited, and cells can be cultured in a medium of any volume. For example, cells can be cultured in a medium of 1 mL to 2500 L, preferably 1 L to 2300 L, more preferably 50 L to 2200 L, and particularly preferably 300 L to 2100 L.

[0099] In cell culture, an oxygen-containing gas can be introduced into the culture solution using a sparger. It is preferable to adjust the dissolved oxygen concentration of the culture solution by introducing an oxygen-containing gas into the culture solution. The dissolved oxygen concentration in the culture solution can be set appropriately and is not particularly limited. Generally, it is 10 to 150%, preferably 15 to 120%, and more preferably 20 to 100%, when the saturated dissolved oxygen concentration in air at 1 atmosphere at 37°C is taken as 100%. The pore size of the sparger is not particularly limited, but is preferably 5 μm to 100 μm, more preferably 10 μm to 50 μm. The aeration rate of the oxygen-containing gas is not particularly limited, but is generally 0.001 to 1.0 vvm, preferably 0.005 to 0.5 vvm. VVM stands for volume per volume per minute.

[0100] Cultivation may be performed with shaking agitation. The agitation speed when shaking agitation is generally 50 rpm to 200 rpm, preferably 80 to 150 rpm. Agitation culture may be rotation agitation culture using blades, propellers, paddles, or the like inside the reactor. For example, a three-blade propeller or two-blade paddle can be used. The size of the blades, propellers, or paddles is determined depending on the size of the culture tank. The agitation speed when rotating agitation is generally 50 rpm to 200 rpm, preferably 80 to 150 rpm. Agitation may also be performed by wave-type shaking agitation or by up-and-down movement of agitator blades, but is not particularly limited thereto.

[0101] The culture may be subjected to a membrane separation process in which the cell suspension withdrawn from the culture vessel is passed through a separation membrane to separate the cell suspension into a cell-containing liquid and a permeate. In this process, the cell suspension withdrawn from the culture vessel is separated into a cell-containing liquid having a higher cell concentration than the cell suspension and a permeate having a lower cell concentration than the cell suspension.

[0102] The membrane separation process is preferably tangential filtration, more preferably alternating tangential flow (ATF) or tangential flow, and most preferably ATF. Filters that can be used for ATF include SuATF10-S02PES and F2 RF02PES manufactured by Repligen.

[0103] Examples of the material of the membrane used in the membrane separation treatment step include polyethersulfone, modified polyethersulfone, mixed cellulose ester, etc. The pore size of the membrane used in the membrane separation treatment step is preferably 0.1 μm to 0.4 μm, more preferably 0.15 μm to 0.3 μm.

[0104] In the present invention, the cells are preferably in a suspension in the nucleic acid transfer step and the culture step, and the suspension is a medium.

[0105] In the culture of the present invention, including pre-culture, cell bleeding, in which a portion of the culture medium is withdrawn, may be performed. Cell bleeding allows the cell density to be maintained at a predetermined value. Cell bleeding can be performed, for example, by the following method. After measuring the cell concentration, the culture medium is withdrawn by operating a pump at a speed of 0.3 vvd to 3 vvd. The cell-bleed cell solution may be transferred to a culture tank separate from the pre-culture. Cell bleeding is performed at least once a day. The last cell bleed of the day is preferably performed within 5 hours, and more preferably within 3 hours, of the first cell bleed. After the completion of cell bleeding for one day, a volume of cell culture medium equal to the volume of cell suspension lost due to cell bleed is added, returning the total volume of the pre-culture to the state before cell bleed, and culturing is continued. Cell bleed can also be performed under automatic control. When cell bleeding is performed under automatic control, for example, a FUTURA sensor manufactured by ABER can be used to automatically perform continuous cell bleeding while monitoring the capacitance of the culture solution. One example of this can be performed using the following method: (1) Set a target capacitance. (2) Set a weight control value for the culture tank. (3) Measure the capacitance of the culture solution at a cycle of 0.1 s or less. (4) When the capacitance of the culture solution exceeds the target, operate the pump that extracts the culture solution at a speed of 0.3 vvd to 3 vvd. (5) Automatically supply medium into the culture tank while measuring the weight of the culture tank so that the volume of the culture solution remains roughly constant. (6) When the capacitance of the culture solution falls below the target by 0.01% or more, stop the pump that extracts the culture solution.

[0106] The cell bleeding rate is preferably 10 to 50% / day, more preferably 20 to 50% / day, and is the proportion of the culture medium withdrawn per day relative to the total volume of the culture medium.

[0107] Examples of media include, but are not limited to, BalanCD® Medium, Expi293 Expression Medium (Thermo Fisher Scientific, A1435101), Dulbecco's Modified Eagle's Medium (DMEM) containing 10% (vol / vol) fetal bovine serum (FBS), Gibco™ Viral Production Medium (Thermo Fisher Scientific, A4817901), serum-free UltraCULTURE™ Medium (Lonza), HuMEC Basal Serum-Free Medium, KNOCKOUT™ CTS™ XenoFREE ESC / iPSC Medium, and STEMPRO™-34 SFM Medium, STEMPRO™ NSC Medium, ESSENTIAL™-8 Medium, Medium 254, Medium 106, Medium 131, Medium 154, Medium 171, Medium 200, Medium 231, HeptoZYME-SFM, Human Endothelial-SFM, GIBCO® FREESTYLE™ 293 Expression Medium, Medium 154CF / PRF, Medium 154C, Medium 154 CF, Medium 106, Medium 200PRF, Medium 131, Essential™-6 Medium, STEMPRO™-34 Medium, Gibco® Astrocyte Medium, AIMV® Medium CTS™, AMINOMAX™ C-100 Basal Medium, AMINOMAX™-II Complete Medium, CD Examples of suitable medium include FORTICHO™ Medium, CD CHOAGT Medium, CHO-S-SFM Medium, GIBCO® FREESTYLE™ CHO Expression Medium, CD OPTICHO™ Medium, CD CHO Medium, CD DG44 Medium, SF-900™ Medium, EXPI293™ Expression Medium, LHC Basal Medium, LHC-8 Medium, 293SFM Medium, CD293 Medium, AEM Growth Medium, PER.C6® Cell Medium, AIMV® Medium, EXPILIFE® Medium, Keratinocyte SFM Medium, LHC Medium, LHC-8 Medium, LHC-9 Medium, and any derivatives or variations thereof.In certain non-limiting embodiments, the high-density culture medium may be CD FORTICHO™ Medium, CD CHOAGT Medium, CHO-S-SFM Medium, GIBCO® FREESTYLE™ CHO Expression Medium, CD OPTICHO™ Medium, CD CHO Medium, CD DG44 Medium, GIBCO® FREESTYLE™ 293 Expression Medium, EXPI293™ Expression Medium, LV-MAX™ Production Medium, FREESTYLE™ F17 Expression Medium, DYNAMIS™ Medium, or a similar medium, or a variant thereof. Alternatively, a self-made medium may be used. The medium may be supplemented with additional components as needed. Examples of additional components include, but are not limited to, amino acids, salts, sugars (e.g., glucose), vitamins, hormones, growth factors, lipids, trace elements, etc. The pH of the medium is 6 to 8, preferably 6.8 to 7.6, and more preferably 7.2 to 7.6. If desired, the medium may be supplemented with 1x GlutaMAX™ (ThermoFisher Scientific) or the like. Among these, BalanCD® medium, Expi29 Expression Medium (Thermo Fisher Scientific, A1435101), Dulbecco's Modified Eagle's Medium (DMEM) containing 10% (vol / vol) fetal bovine serum (FBS), Gibco™ Viral Production Medium (Thermo Fisher Scientific, A4817901), and FREESTYLE™ F17 Expression Medium are particularly preferred. These media contain glucose and amino acids necessary for HEK cell growth. By performing perfusion culture using these media, nutrients necessary for HEK cell growth are constantly supplied while growth-inhibiting components such as ammonia and lactic acid secreted into the medium are washed away, maintaining a cellular environment with low concentrations of these components, which is important for virus production from high-density cells from the perspective of increasing cell growth.

[0108] An antifoaming agent may be further added to the culture medium. As the antifoaming agent, a silicone-based agent is preferred, and dimethicone is particularly preferred. As the antifoaming agent, one containing polydimethylsiloxane is preferred, and one containing finely powdered silica in polydimethylsiloxane (simethicone) is more preferred. The addition rate of simethicone relative to the amount of culture solution is not particularly limited, but is preferably 5 mg / hr / L or less, more preferably 2 mg / hr / L or less.

[0109] A block copolymer of polyoxypropylene and polyoxyethylene may be added to the medium. As the copolymer of polyoxypropylene and polyoxyethylene, poloxamer is preferred, and poloxamer-188 is more preferred. The content of the block copolymer of polyoxypropylene and polyoxyethylene in the medium is not particularly limited, but is preferably 0.1% by mass or more and 2% by mass or less, more preferably 0.25% by mass or more and 2% by mass or less, and even more preferably 0.5% by mass or more and 2% by mass or less.

[0110] In the present invention, preferably, the produced virus can be recovered. The virus particles produced in the cells are present in the culture medium or within the cells (intranuclear). Extraction from the cells (destruction and dissolution of the cell membrane and nuclear membrane) may be performed by the freeze-thaw method, or by adding a surfactant (such as Triton X) and stirring. Separation of the virus from the cell debris can be performed by centrifugation or depth filtration.

[0111] If necessary, the virus may be purified by TFF (concentration / buffer exchange), affinity chromatography, or AEX (anion exchange chromatography). This allows for the removal of cell debris, cell-derived nucleic acids, and cell-derived proteins. Alternatively, a commercially available virus purification kit (such as an AAV purification kit) may be used. For example, Takara Bio's AAVpro (registered trademark) Purification Kit Maxi / Midi may be used.

[0112] The titer of the virus produced in the present invention can be measured by a conventional method known to those skilled in the art. For example, the cell culture medium after cultivation is collected, the cells are disrupted by freezing and thawing, and the supernatant is collected by centrifugation. The collected supernatant is added with MgCl ２ The target virus-containing sample obtained as described above can be used as a ddPCR (Droplet Digital PCR) sample, and the titer of the target virus can be measured by ddPCR.

[0113] Furthermore, the capsid particle titer (Vp / mL) can be measured using an ELISA kit, and the percentage of capsids containing the GOI (full percentage) can be calculated from the ratio of this titer to the genome titer (vg / mL) calculated by ddPCR. Alternatively, the sample solution after virus extraction and purification can be analyzed by HPLC, isoelectric focusing capillary electrophoresis, or the like, to determine the percentage of capsids containing the GOI (full percentage) in the same analysis system.

[0114] In the present invention, the percentage of capsids containing GOI (full rate) in the produced virus is preferably 5% or more, more preferably 7% or more, even more preferably 10% or more, even more preferably 20% or more, even more preferably 30% or more, and particularly preferably 50% or more.

[0115] According to the present invention, 10 x 10 ６ The present invention further provides a method for introducing nucleic acids into cells, which includes a nucleic acid introduction step of adding nucleic acids to a suspension containing cells at a density of 10 x 10 cells / mL or more, wherein the nucleic acids are added when the population cell doubling time of the suspension is 35.4 hours or less. ６ The present invention provides a method for introducing nucleic acids into cells, the method comprising a nucleic acid introduction step of adding nucleic acids to a suspension containing cells at a density of 1000 cells / mL or more, wherein the nucleic acids are added when the population cell doubling time of the suspension is 35.4 hours or less. Preferred embodiments of the method for introducing nucleic acids into cells according to the present invention are as described above in this specification.

[0116] The present invention will be explained in more detail with reference to the following examples, but the present invention is not limited to these examples.

[0117] Example 1 Cell Culture HEK293 cells (Expi293, A14527, ThermoFisher Scientific) were cultured in Balan CD medium (Fujifilm Irvine Scientific Inc.) supplemented with 1x GlutaMAX™ (ThermoFisher Scientific). The cells were cultured in shake flasks (Corning) or bioreactors. Shake flasks were cultured in an incubator at 37°C with 120 rpm agitation and 8% CO. ２ Cells were cultured in a humidified atmosphere at 77°C.

[0118] [Batch Culture] The HEK293 cells were cultured by batch culture. Balan CD medium (Fujifilm Irvine Scientific, Inc.) was used as the culture medium, and the cell seeding density was 5 × 10 ５ The culture environment was pH 6.4 to 7.6, culture temperature 36°C to 38°C, CO ２ After the start of the culture, the cell density was maintained at 2 × 10 ６ On the second day, when the cell density reached 100 cells / mL, plasmid DNA was introduced using the PEI reagent described below. The cell density was measured at 9:00 a.m., and nucleic acid was added within 1 hour after the measurement.

[0119] [Fed-batch culture] The HEK293 cells were cultured by the fed-batch method. Balan CD medium (Fujifilm Irvine Scientific, Inc.) was used as the culture medium, and the cell seeding density was 5 × 10 ５ The culture environment was pH 6.4 to 7.6, culture temperature 36°C to 38°C, CO ２ After the start of the culture, the cell density was maintained at 2 × 10 ６From the second day onwards, when the cell density reached 20 × 10 cells / mL, BalanCD Feed Medium (Fujifilm Irvine Scientific, Inc.) was added once a day to maintain the glucose concentration in the medium at 4 g / L, and the culture was continued. ６ On the seventh day, when the cell density reached 100 cells / mL, plasmid DNA was introduced using the PEI reagent described below. The cell density was measured at 9:00 a.m., and nucleic acid was added within one hour after the measurement.

[0120] [Perfusion Culture] The HEK293 cells were cultured by perfusion culture. The perfusion ratio was 3. Balan CD medium (Fujifilm Irvine Scientific, Inc.) was used as the medium, and the cell seeding density was 5 × 10 ５ The culture environment was pH 6.4 to 7.6, culture temperature 36°C to 38°C, CO ２ The concentration was maintained below 25%.

[0121] The culture volume was 1 L, and a glass culture vessel with a diameter of 114 mm was used. A paddle-shaped stirring blade with a diameter of 85 mm was installed, and a predetermined amount of culture medium was placed in the vessel for culture. Filtration was performed using an RF02PES membrane in an ATF2 system manufactured by Repligen.

[0122] After the second day from the start of the culture, perfusion culture was started, which included supplying fresh medium and removing the filtered culture solution from the culture vessel. After the start of the culture, when the cell density reached 20 × 10 ６ On the fifth day, when the cell density reached 100 cells / mL, plasmid DNA was introduced using the PEI reagent described below. The cell density was measured at 9:00 AM, and nucleic acid was added within one hour of the measurement. Perfusion culture was not performed for 4 to 24 hours immediately after the plasmid DNA introduction step (nucleic acid introduction step), and then perfusion culture was resumed at a perfusion ratio of 3.

[0123] [Gene transfer (nucleic acid transfer)] The following three plasmid DNAs were used to prepare adeno-associated virus vectors (rAAV) as nucleic acids: (1) a plasmid containing the target gene described below, flanked by ITRs; (2) a packaging plasmid containing the Rep gene and cap gene; and (3) an adenovirus helper plasmid containing the adenovirus E2, E4, and VA RNA genes. All plasmids used were AAVpro Packaging Plasmid (AAV5,6650, Takara Bio). For (1) above, EGFP (Enhanced Green Fluorescent Protein) was inserted downstream of a cytomegalovirus (CMV)-derived promoter as the target gene.

[0124] As a cationic polymer, linear polyethyleneimine (PEI) "PEI pro" molecular weight 25 KDa (manufactured by Polyplus) was used as a gene transfer reagent.

[0125] PEI / DNA complexes were prepared at a mass ratio of 2:1 between PEI and plasmid DNA, incubated at room temperature for 15 minutes, and then added to the cell culture medium. The total amount of plasmid DNA used for transfection was 0.5 μg per million cells. The plasmid DNA concentrations in the suspension were 1.0 μg / mL for batch culture, 5.8 μg / mL for fed-batch culture, and 5.6 μg / mL for perfusion culture.

[0126] [Measurement of cell density and viability] Cell density and viability were determined using a Vi-cell™ XR cell viability analyzer (Beckman Coulter).

[0127] The changes in cell density during the culture period were measured for fed-batch culture and perfusion culture, and the results are shown in Figure 1. In the case of fed-batch culture, the cell density on day 7 was 20.4 × 10 ６ cells / mL, and the cell density on day 6 was 15.9 x 10 ６The cell density was 20.0 × 10 cells / mL. That is, the ratio of cell density A at time point A to cell density B at time point B, 24 hours before time point A, (cell density A / cell density B) was 1.28. That is, the population cell doubling time was 66.8 hours. In the case of perfusion culture, the cell density on day 5 was 20.0 × 10 ６ cells / mL, and the cell density on day 4 was 11.0 x 10 ６ The cell density A / cell density B, which is the ratio of cell density A at time point A to cell density B at time point B 24 hours before time point A, was 1.81. The population cell doubling time was 30.5 hours.

[0128] [AAV titer measurement] 72 hours after gene transfer (nucleic acid transfer), the cells were incubated at 37°C, 8% CO ２ The HEK cell culture medium was collected after culturing under the conditions described above. Then, Tween 20 (Fujifilm Wako Pure Chemical Industries, Ltd.) was added to a final concentration of 0.1%, and MgCl 2 (Future concentration: 2 mmol / L) was added to a final concentration of 2 mmol / L. ２, and 25 U / mL Benzonase (Merck) were added, and the reaction was carried out at 37°C for 2 hours to digest gDNA (genomic DNA) and remaining plasmid. After the reaction, the sample was incubated at 95°C for 15 minutes, 70°C for 3 minutes, 40°C for 3 minutes, and 20°C for 3 minutes in that order to inactivate the Benzonase, and this was used as a ddPCR (Droplet Digital PCR) sample. The ddPCR sample was diluted 50-fold with TE buffer (pH 8.0, containing 0.05% Pluronic F-68 and 10 μg / mL calf thymus DNA). 10 μL of ddPCRtm Supermix for Probes (no dUTP) (BIORAD) was placed in a tube on ice, 2 μL of diluted ddPCR sample, primers (seq1, seq2, final concentration 900 nmol / L) targeting the ITR, and a probe (seq3, final concentration 250 nmol / L, with FAM (fluorescein amidite) added as a fluorescent probe), and nuclease-free water (Thermo Fisher Scientific, 10977015) were mixed, and the total volume was adjusted to 22 μL, and ddPCR was performed. seq1 GGAACCCCTAGTGATGGAGTT (SEQ ID NO: 1) seq2 CGGCCTCAGTGAGCGA (SEQ ID NO: 2) seq3 CACTCCCTCTCTGCGCGCTCG (SEQ ID NO: 3)

[0129] In ddPCR, droplets were formed from the preparation solution using a droplet formation device, followed by incubation at 95°C for 10 minutes, 40 cycles of 94°C for 30 seconds and 55°C for 60 seconds, and then 98°C for 10 minutes. Measurement was performed using a droplet reader, and the AAV genome titer (vg / mL) was calculated. The results of the AAV genome titer measurement are shown in Table 1 and Figure 2. It was confirmed that the AAV genome titer was improved when the population cell doubling time of the suspension was 35.4 hours or less.

[0130] [Measurement of Fullness Rate] 72 hours after gene transfer (nucleic acid transfer), ２The HEK cell culture medium cultured under these conditions was collected, and AAV was extracted and purified using a Takara Bio AAVpro® Purification Kit. The purified preparation was analyzed using high-performance liquid chromatography to measure the fullness (proportion of capsids containing GOI). An anion exchange column was used as the separation column, and a fluorescence detector (excitation: 280 nm, detection: 348 nm) was used for detection. The fullness was calculated from the area values ​​of the empty and full AAV peaks. The measurement results of the fullness are shown in Table 1 and Figure 4. It was confirmed that when nucleic acid was added to a suspension with a population cell doubling time of 35.4 hours or less (in the case of perfusion culture), the fullness (proportion of capsids containing GOI) was improved compared to when this time was not met (in the case of fed-batch culture).

[0131]

[0132] [Measurement of Gene Copy Number per Cell] The gene copy number per cell was also measured by ddPCR, targeting the ITR sequence associated with the gene of interest, as in the above [AAV Titer Measurement]. In order to measure not only the gene of interest encapsulated in AAV but also the gene of interest that had replicated but not been encapsulated in AAV, the following sample pretreatment was performed. Cells were collected 72 hours after gene transfer (nucleic acid transfer), and Proteinase K (Thermo Fisher Scientific, 25530-049) was added to a TE buffer containing a final concentration of 0.5% SDS to a final concentration of 0.5 mg / mL, and the collected cell suspension was adjusted to a 15-fold dilution density. This adjusted solution was incubated at 55°C for 60 minutes and then at 95°C for 10 minutes. The results of measuring the copy number of the gene of interest are shown in Table 1 and Figure 3. It was confirmed that the copy number of the target gene was improved when the population cell doubling time of the suspension was 35.4 hours or less (in the case of perfusion culture).

[0133] Example 2 Cell Culture HEK293 cells (Viral Production Cells 2.0, A497840, manufactured by ThermoFisher Scientific) were cultured in the same manner as in Example 1.

[0134] [Batch Culture] Batch culture was carried out in the same manner as described in Example 1 using the above-mentioned HEK293 cells.

[0135] [Fed-batch Culture] Fed-batch culture was carried out in the same manner as described in Example 1 using the above-mentioned HEK293 cells.

[0136] [Perfusion Culture] Perfusion culture was carried out in the same manner as described in Example 1 using the above-mentioned HEK293 cells.

[0137] [Gene transfer (nucleic acid transfer)] The procedure was carried out in the same manner as in Example 1.

[0138] [Measurement of cell density and viability] The cell density and viability were determined in the same manner as described in Example 1. The cell density on the day of transfection in fed-batch culture (day 7 of culture) was 20.4 × 10 ６ cells / mL, and the cell density on the previous day (day 6 of culture) was 14.4 × 10 ６ The cell density A / cell density B, which is the ratio of cell density A at time point A to cell density B at time point B 24 hours before time point A, was 1.41. The population cell doubling time was 47.8 hours.

[0139] The cell density on the day of transfection in perfusion culture (day 5 of culture) was 21.5 × 10 ６ cells / mL, and the cell density on the previous day (day 4 of culture) was 12.0 × 10 ６ The cell density A / cell density B, which is the ratio of cell density A at time point A to cell density B at time point B 24 hours before time point A, was 1.79. The population cell doubling time was 28.5 hours.

[0140] [AAV titer measurement] The AAV genome titer (vg / mL) was calculated in the same manner as in Example 1. The measurement results of the AAV genome titer are shown in Table 2 as relative values, with the genome titer in batch culture being set at 1.0. It was confirmed that the AAV genome titer was improved when nucleic acid was added when the population cell doubling time of the suspension was 35.4 hours or less (in the case of perfusion culture).

[0141] [Measurement of Full Rate] The full rate was calculated in the same manner as in Example 1. The measurement results of the full rate are shown in Table 2. It was confirmed that when nucleic acid was added and the population cell doubling time of the suspension was 35.4 hours or less (in the case of perfusion culture), the full rate (the proportion of capsids containing GOI) was improved compared to when this requirement was not met. In the case of perfusion culture, a high full rate was also obtained when fed-batch culture was performed after gene transfer (nucleic acid transfer).

[0142]

[0143] Example 3 Cell Culture The same method as in Example 2 was used.

[0144] [Batch culture] The method was carried out in the same manner as in Example 2.

[0145] [Continuous Culture] Using the HEK293 cells described in [Cell Culture] above, cell culture was performed using culture step 1 (pre-culture), in which perfusion culture was performed to increase the cell density before the nucleic acid introduction step, and culture step 2 (post-culture), in which the gene-introduced cells were cultured after the nucleic acid introduction step. Separate bioreactors were prepared for each step. The culture volume was 1 L, and the culture vessel was made of a glass vessel with a diameter of 114 mm. An 85 mm diameter paddle-shaped stirring blade was installed, and a predetermined amount of culture medium was placed inside the vessel for culture.

[0146] [Continuous culture step 1: pre-culture step before nucleic acid introduction step] Cell culture was performed by perfusion culture using the above-mentioned HEK293 cells. The cell culture medium was filtered using an RF02PES membrane in an ATF2 system manufactured by Repligen. The medium used was Balan CD medium (manufactured by Fujifilm Irvine Scientific, Inc.), and the perfusion ratio was 3. The cell seeding density was 5 x 10 ５ The culture environment was pH 6.4 to 7.6, culture temperature 36°C to 38°C, CO ２ The concentration was maintained below 25%.

[0147] In the culture step 1, after the start of perfusion culture, the cell density was 20 x 10 ６ When the cell concentration reached 100 cells / mL, cell bleeding was performed by withdrawing the cell culture medium. For cell bleeding, 40 to 50% of the total culture volume of culture step 1 was withdrawn and aseptically transferred to a bioreactor separate from culture step 1 for culture step 2. When bleeding the cell culture medium, the pump was operated at a speed of 0.3 vvd to 3 vvd.

[0148] After cell bleeding, the bioreactor in culture step 1 was replenished with Balan CD medium (manufactured by Fujifilm Irvine Scientific Inc.) in an amount equal to the amount of cell culture medium extracted within 1 hour after cell bleeding. As a result, the cell density in the bioreactor in culture step 1 decreased to approximately 50 to 60% of the density before cell bleeding.

[0149] In the bioreactor of the culture step 1, the perfusion culture was continued, and 24 hours after the cell density decreased by cell bleeding, the cell density reached 20 x 10 ６ cells / mL was reached again.

[0150] In the culture step 1, the cell density first reached 20 x 10 ６ After the cell density reached 100 cells / mL, cell bleeding, supplementation with the cell culture medium, and the above-mentioned perfusion culture were repeated once a day, and continuous culture was carried out for a total of 22 days.

[0151] [Continuous culture step 2: a step of culturing the cells into which nucleic acids have been introduced after the nucleic acid introduction step] The 20 x 10 cells aseptically transferred to a separate bioreactor by cell bleeding from the culture step 1 were cultured in a continuous culture step. ６ Plasmid DNA was introduced into the cell culture medium at 1000 cells / mL using a PEI reagent. Cell density measurement was performed at 9:00 AM during culture step 1, and cell bleed and nucleic acid addition were performed within 1 hour after the measurement.

[0152] The plasmid DNA introduction step (nucleic acid introduction step) and the culture step 2 were carried out after the cell density in the culture step 1 first reached 20 × 10 ６ The time when the cell culture medium concentration reached 100 cells / mL was defined as continuous production Day 1, and continuous production was performed on Days 1, 8, 15, and 22. On the other continuous production days, the nucleic acid introduction step and culture step 2 were not performed, and only culture step 1 (cell bleeding, replenishment with cell culture medium, and the above-mentioned perfusion culture) was continued.

[0153] The culture in the culture step 2 after the nucleic acid introduction step was carried out at 37°C and 8% CO for up to 72 hours after gene introduction. ２ Fed-batch culture was performed under the following conditions: 24 and 48 hours after nucleic acid introduction, BalanCD Feed Medium (Fujifilm Irvine Scientific Inc.) was added to the measured glucose concentration to a final concentration of 6 g / L, and glutamine solution (Fujifilm Wako Pure Chemical Industries, Ltd.) was added to the measured glutamine concentration to a final concentration of 4 mM.

[0154] [Gene transfer (nucleic acid transfer)] The procedure was carried out in the same manner as in Example 1.

[0155] [Measurement of cell density and viability] The cell density and viability were determined in the same manner as in Example 1. As shown in Table 3, the cell densities on the days when the plasmid DNA introduction step was performed (Days 1, 8, 15, and 22) were 20.5 to 24.5 x 10 ６ The population cell doubling time T at the time of nucleic acid addition, calculated from the cell density at the time point after cell bleeding on the previous day (Day 0, 7, 14, and 21), was 22.8 to 25.2 hours, as shown in Table 3.

[0156] [AAV titer measurement] The AAV genome titer (vg / mL) was calculated in the same manner as in Example 1. The measurement results of the AAV genome titer are shown in Table 3. When nucleic acid was added when the population cell doubling time of the suspension was 35.4 hours or less (in the case of continuous production days 1, 8, 15, and 22), it was confirmed that the AAV genome titer was high in the gene transfer batches derived from all continuous production days.

[0157] [Measurement of Full Rate] The full rate was calculated in the same manner as in Example 1. The measurement results of the full rate are shown in Table 3. When the population cell doubling time of the suspension was 35.4 hours or less (in the case of continuous production days 1, 8, 15, and 22), it was confirmed that the full rate (the proportion of capsids containing GOI) was high in the gene transfer batches derived from all continuous production days.

[0158]

[0159] Example 4 Cell Culture The same method as in Example 2 was used.

[0160] [Perfusion culture] Cell culture was performed using the HEK293 cells described in [Cell culture] above. The perfusion ratio, medium, cell seeding density, culture environment, culture volume, culture vessel, and filtration were the same as those described in Example 1.

[0161] After the second day from the start of the culture, perfusion culture was started, which included supplying fresh medium and removing the filtered culture solution from the culture vessel. After the start of the culture, when the cell density reached 40 × 10 ６ On the 7th day, when the cell density reached 16 x 10 cells / mL, plasmid DNA was introduced using electroporation as described below. The cell density was measured at 9:00 AM, and the addition of nucleic acid and electroporation were carried out within 1 hour after the measurement. After electroporation, the cell density was increased to 16 x 10 cells / mL within 1 hour. ６ Diluted to cells / mL.

[0162] After the nucleic acid transfection step, the cells were cultured at 37°C and 8% CO for up to 48 hours after the nucleic acid transfection. ２Fed-batch culture was performed under the following conditions: 24 hours after nucleic acid introduction, BalanCD Feed Medium (Fujifilm Irvine Scientific Inc.) was added to the measured glucose concentration to give a final glucose concentration of 6 g / L, and glutamine solution (Fujifilm Wako Pure Chemical Industries, Ltd.) was added to the measured glutamine concentration to give a final concentration of 4 mM.

[0163] [Gene transfer (nucleic acid transfer)] Nucleic acid transfer was performed by electroporation. ６ Cells were concentrated to 1000 cells / mL, and then nucleic acid was added to prepare a nucleic acid-added suspension. Cell concentration was achieved within 1 hour, and a highly activated state of cell division was maintained. The nucleic acid concentration in the suspension was 60 μg / mL. The same plasmid DNA as in Example 1 was used as the nucleic acid. The nucleic acid-added suspension was filled into a 50 mL syringe. 20 mL of the suspension was delivered at 86 mL / min to an electroporation device with an inter-electrode gap of 3 mm, a channel width of 20 mm, and an electrode length of 20 mm, as shown in Figures 5 and 6.

[0164] A pulse voltage of 412.5 V (electric field 1375 V / cm), pulse width 3.5 ms, and pulse period 450 ms was applied to the EP electrode. Cells flowing between the electrodes were electroporated continuously so that each cell received an average of one pulse.

[0165] [Measurement of cell density and viability] The cell density and viability were determined in the same manner as in Example 1. The cell density on the day of nucleic acid transfer (day 7 of culture) was 42.3 × 10 ６ The population cell doubling time T calculated from the cell densities on the day of nucleic acid transfer (day 7 of culture) and the day before (day 6 of culture) was 28.5 hours, as shown in Table 4.

[0166] [AAV titer measurement] The AAV genome titer (vg / mL) was calculated in the same manner as in Example 1. The measurement results of the AAV genome titer are shown in Table 4. It was confirmed that the AAV genome titer was high when nucleic acid was added when the population cell doubling time was 34.5 or less.

[0167] [Measurement of Full Rate] The full rate was calculated in the same manner as in Example 1. The measurement results of the full rate are shown in Table 4. When nucleic acid was added when the population cell doubling time was 34.5 or less, a high full rate (proportion of capsids containing GOI) was confirmed. The reason why the full rate is particularly high in nucleic acid transfer by electroporation is unclear, but it is presumed to be because the rate of nuclear arrival and expression of the introduced gene is faster than with the PEI method.

[0168]

[0169] 10 Upper electrode holding plate 20 Lower electrode holding plate 30 Flow path plate 32 Opening (flow path) 41 Electrode pair 41a Upper electrode 41b Lower electrode 50 Inlet 52 Outlet 100 Electroporation device a1 Surface portion of upper electrode a2 Back surface portion of upper electrode b1 Surface portion of lower electrode b2 Back surface portion of lower electrode L Electrode length W Electrode width (flow path width) D Distance between electrodes (gap)

Claims

1. 10 x 10 ６ A method for producing a virus, comprising: a nucleic acid introduction step of adding nucleic acid to a suspension containing cells at a density of 1000000000 cells / mL or more; and a culture step of culturing the cells into which the nucleic acid has been introduced, wherein the nucleic acid is added when the population cell doubling time of the suspension is 35.4 hours or less.

2. The method according to claim 1, wherein the population cell doubling time of the suspension is 35.4 hours or less when cell density A at time point A and cell density B at time point B 24 hours prior to time point A satisfy cell density A / cell density B ≧ 1.

6.

3. A method for producing the virus described in claim 1, which comprises perfusion culturing the cells prior to the nucleic acid introduction step.

4. A method for producing a virus as described in claim 3, wherein the perfusion ratio 24 hours before the start of the nucleic acid introduction process is 1 or more.

5. Before the nucleic acid transfer process, ６ The method for producing the virus according to claim 1 , further comprising a pre-culture step of culturing a suspension containing cells at a density of at least 10000000 cells / mL.

6. A method for producing a virus described in any one of claims 1 to 5, wherein in the nucleic acid introduction step, the nucleic acid is introduced into the cell using a gene introduction reagent or by electroporation.

7. A method for producing a virus described in any one of claims 1 to 5, wherein the concentration of nucleic acid in the suspension is 3 μg / mL or more.

8. The method for producing a virus according to claim 6, wherein the gene introduction reagent is a cationic polymer.

9. The method for producing a virus described in claim 6, wherein the mass ratio of the nucleic acid to the gene introduction reagent is 1:1 to 1:

3.

10. A method for producing a virus according to any one of claims 1 to 5, wherein the virus is an adeno-associated virus.

11. The method of producing a virus according to claim 10, wherein the nucleic acid comprises one or more of an adeno-associated virus gene and a viral helper gene.

12. The method of producing a virus according to claim 10, wherein the nucleic acid comprises at least one viral helper gene.

13. The method of producing a virus according to claim 10, wherein the nucleic acid comprises four or more of the group consisting of a therapeutic or prophylactic gene, a Rep gene, a Cap gene, an E2 gene, an E4 gene and a VA-RNA1 gene.

14. A method for producing a virus according to any one of claims 1 to 5, wherein the cells are animal cells.

15. A method for producing a virus according to any one of claims 1 to 5, wherein the cells are HEK cells.

16. A method for producing a virus according to any one of claims 1 to 5, wherein the nucleic acid is introduced into the cell using one or more plasmids.

17. Before the nucleic acid introduction step, 10 x 10 ６ 6. The method for producing a virus according to claim 1, further comprising a pre-culture step of culturing a suspension containing cells at a density of 1000 ng / mL or more, wherein in the culture step, perfusion culture is not performed for 4 to 24 hours immediately after the nucleic acid introduction step, and then perfusion culture is performed.

18. 10 x 10 ６ 2. The method for producing a virus according to claim 1, comprising: a pre-culture step of culturing a suspension containing cells at a density of 1000 ng / mL or more; when a population cell doubling time of the suspension reaches 35.4 hours or less, a portion of the pre-culture culture is removed, nucleic acid is added to the removed portion of the culture, and the cells into which the nucleic acid has been introduced are cultured to produce the virus; and continuing to culture the remainder of the pre-culture culture that was not removed, and thereafter, when a population cell doubling time of the suspension reaches 35.4 hours or less, a portion of the culture is removed and virus is produced by nucleic acid introduction and cell culture.

19. 10 x 10 ６ A method for introducing nucleic acid into cells, comprising a nucleic acid introduction step of adding nucleic acid to a suspension containing cells at a density of 10000000000000 cells / mL or more, wherein the nucleic acid is added when the population cell doubling time of the suspension is 35.4 hours or less.

Images