Metallic cation-mediated entrapment of nucleic acids (MENA) on mesoporous silica surface for delivery of nucleic acids in biological environments

Abstract

Compositions comprising a mesoporous silica nanoparticle (MSN) loaded with metal cations and oligonucleotides and methods of use.

Description

[0001] METALLIC CATION-MEDIATED ENTRAPMENT OF NUCLEIC ACIDS (MENA) ON MESOPOROUS SILICA SURFACE FOR DELIVERY OF NUCLEIC ACIDS

[0002] IN BIOLOGICAL ENVIRONMENTS

[0003] PRIORITY

[0004] This application claims the benefit of priority of U.S. Provisional Patent Application No. 63 / 592,409, filed on October 23, 2023 and U.S. Provisional Patent Application No. 63 / 570,110, filed on March 26, 2024, the benefit of priority of which are claimed hereby, and which are incorporated by reference herein in their entirety.

[0005] GOVERNMENT FUNDING

[0006] This invention was made with government support under grant no. RO1CA22653701 awarded by the National Institute of Health, and grant no. 1939267 awarded by the National Science Foundation. The government has certain rights in the invention.

[0007] SUMMARY

[0008] The use of exogenous nucleic acid technologies to modulate aberrant protein expression resulting from genetic mutations is a promising therapeutic approach for treatment of diseases, such as advanced prostate cancer (PC). The promise of nucleic-based therapeutics is dependent on the development of platforms that effectively protect nucleic acids from nuclease degradation and deliver the nucleic acids to the cytosol of target cells. Provided herein is the development of a divalent metal-mediated nucleic acid entrapment strategy within a porous silica matrix. This strategy results in efficient loading percentages of nucleic acids, such as siRNA (>60%) and mRNA (>80%), as well their release within relevant biological environments (80%). Additionally, the data supports that the current method reduces endosomal entrapment and supports the lipid coating of mesoporous silica nanoparticles (LC-MSNs). The metal-enhanced nanosystem has been assessed for biocompatibility, stability, and circulation within in vitro, ex ovo and in vivo models of PC.

[0009] BRIEF DESCRIPTION OF THE DRAWINGS

[0010] FIGS 1A-1G. MSN pore size and morphology modulation, (a) DLS measurement results for as synthesized MSNs, (b) DLS measurement results for zeta potentials of as synthesized MSNs (c) Representative TEM images of as synthesized MSNs left: 2 nm hexagonal middle: 5nm worm like right: 8 nm dendritic MSNs, insets are zoomed in images to demonstrate morphology, (d) Profile topography of hexagonal (left), worm like (middle) or dendritic (right) MSNs (e) Nitrogen adsorption isotherms for hexagonal (left), worm like (middle) or dendritic (right) (f) Corresponding calculate pore size distributions for hexagonal (left), worm like (middle) or dendritic (right). FIGS. 2A-2G. Metal based cation loading of siRNA or mRNA. (a) Schematic showing cation loading and entrapment of RNA (b) Initial siRNA loading as a function of pore size and morphology. pH=4.5 (c) DLS characterization of resulting cation loaded MSNs (d) DLS characterization of zeta potential for resulting cation loaded MSNs (e) STEM images of siRNA loaded MSNs (f) Cation siRNA loading efficiencies, blue star indicates cation loading solutions not applicable to pH adjustments (g) Cation mRNA loading efficiencies.

[0011] FIGS. 3A-3E. Lipid encapsulation of CaMSN loaded with RNA. (a) Schematic of lipid coating of calcium MSN and RNA release mechanism, (b) DLS characterization LC-CaMSN construct and components, (c) DLS characterization of zeta potential of LC-CaMSN construct and components, (d) Release kinetics for RNA loaded CaMSN or LC-CaMSN incubated in lx PBS. (e) Release kinetics for RNA loaded CaMSN or LC-CaMSN incubated in MES.

[0012] FIGS 4A-4F. Analysis results LC-CaMSN and LNCaP or human RBC interactions.

[0013] (a) Calculated percent hemolysis as a function of MSN or LC-CaMSN concentration, (b) Flow cytometry analysis of cells following incubation with targeted LC-CaMSN (c) Cytotoxicity analysis of 72-hour incubation with MSN and LC-MSN (d) Quantitative RT-PCR analysis results for luciferase mRNA delivery via LC-CaMSN. (e) Plate reader results of cell bioluminescence following 24h LC-CaMSN incubation, (f) Deconvoluted confocal images of LNCaP cells following 24h incubation with LC-CaMSNs having various lipid coating with or without calcium using a 63x oil immersion objective. Scale bars indicate 5 pm.

[0014] FIG. 5. Timelapse images of LC-MSN circulation within CAM vasculature taken at 40x. Red arrows indicate MSN aggregation.

[0015] FIG. 6A-6B. Imaging of NSG mouse LNCaP xenografts obtained from IVIS imaging system after right flank subcutaneous Dylight 633 mRNA loaded LC-CaMSN injections, (a) Whole body live images of dorsal side of mice. Dashed yellow lines indicate tumor site, (b) Quantification of fluorescent signal in mouse organs dissected 48 hours after injections.

[0016] FIG. 7. Picture of FeCh solutions and corresponding Fe loaded MSNs (small tube).

[0017] FIGS. 8A and 8B. EDS elemental analysis of siRNA loaded MSNs using calcium cation, (a) Elemental mapping results (b) Resulting spectra from EDS analysis of calcium loaded siRNA MSN with arrow indicating phosphorous peak too small to be auto labeled.

[0018] FIG. 9. DLS hydrodynamic size characterization of bare or lipid encapsulated CaMSN incubated in various physiological solutions at 37 °C.

[0019] FIG. 10. Cryo- electron microscopy micrographs of 8 nm dendritic LC-CaMSNs or liposomes alone. FIG 11. Centrifuged hemolysis analysis sample tubes showing presence of hemoglobin in supernatant. + indicates positive hemolysis control for RBCs incubated in DI H2O. - indicates negative hemolysis control for RBCs incubated in physiological lx PBS.

[0020] FIGS. 12A-12C. Flow cytometry gating parameters and results for LNCaP uptake experiments, (a) Flow cytometry analysis of LNCaP cells following incubation with nontargeted LCCaMSN, (b) Gating parameters for negative control, (c) Gating parameters for positive control.

[0021] FIG. 13. Deconvoluted confocal images of LNCaP cells following incubation with LC- MSNs having various lipid coating using a 63x oil immersion objective. Scale bars indicate 5 pm.

[0022] FIG. 14. Deconvoluted confocal images of LNCaP cells following incubation with LC- CaMSNs having various lipid coating using a 63x oil immersion objective. Scale bars indicate 5 pm.

[0023] FIG. 15. 3D rendered deconvoluted confocal Z stacks of LNCaP cells following incubation with LC-MSNs having various lipid coatings using a 63x oil immersion objective. Scale bars indicate 20 pm.

[0024] FIG. 16. 3D rendered deconvoluted confocal Z stacks of LNCaP cells following incubation with LC-CaMSNs having various lipid coatings using a 63x oil immersion objective. Scale bars indicate 20 pm.

[0025] FIG. 17. Pearson correlation coefficients obtained from deconvoluted confocal imaging following LC-MSN or LC-CaMSN having various lipid coatings incubation with LNCaP cells.

[0026] FIG. 18. Deconvoluted confocal images of LNCaP cells preincubated with free GRP78 before incubation with targeted LC-CaMSNs obtained using a 63x oil immersion lense.

[0027] FIG. 19. Cytotoxicity analysis of LNCaP cells following incubation with high and low amounts of Lipofectamine® or LC-CaMSN.

[0028] FIGS. 20A-20B. CAM injection of LC-MSNS setup (a) Embryo at EDD 16 showing injection site, dashed circles indicate field of view areas used for imaging (b) CAM imaging apparatus setup.

[0029] FIG. 21. IVIS spectrum imaging of dissected mouse organs following 48-hour incubation with Dylight 633 labeled non-targeted and GRP78 targeted LC-CaMSNs.

[0030] DETAILED DESCRIPTION

[0031] The use of nucleic acids (NA), such as RNAs, to treat diseases resulting from genetic abnormalities, offers a promising therapeutic approach. Naked RNA molecules suffer from nuclease degradation and therefore require delivery agents for effective modulation and treatment of disease. Various constructs have been developed in which silica surface modifications and cationic polymers or cationic lipid coatings are employed. Native bare silica matrix exhibits a net negative charge in aqueous environments due to the presence of silanolate groups at their surface which presents an unfavorable electrostatic repulsive interaction between silica mesopores and negative charged nucleic acid molecules. While cationic modifications of the silica surface have had success in loading of nucleic acids, they face shortcomings in 1) the blood circulation as positively charged molecules tend to stick to negatively charged membrane of vasculature epithelial cells 2) the ability to release cargos in biological conditions and 3) issues with cationic mediated toxicity.

[0032] The MENA invention described herein offers a method for a NA entrapment at the silica nanoparticle surface for delivery within biological microenvironments. This invention reduces the need of positively charged organic moieties, polymers, or complicated silica surface functionalization steps to a single metallic cation that efficiently intermediates the interaction between the silica surface and nucleotide’s phosphate groups locking-in the nucleic acid. RNAs are loaded into the LC-CaMSN system via a metallic cation (examples are Ca++, Mg++, Al+++, Fe+++) mediated entrapment method in which multivalent metal cations link silanolate (Si-O-) groups on the silica surface and negatively charged nucleotides by overcoming electrostatic repulsive forces. Within this facile entrapment method, silica nanoparticles are incubated for one hour at room temperature with a pH-adjusted (~ 9) concentrated salt (4M) solution (such as CaC12) containing the multivalent cation and RNAs before being washed twice with water. The addition of this metal cation entrapment technique also serves to provide quick release within biologically relevant environments as well as provides a mechanism of endosomal escape (which is one of the main nanoparticle delivery barriers) for cytosolic delivery of nucleic acids upon internalization within cellular sub compartments. Finally, this strategy allows and supports the addition of lipid coating on the silica surface hence combining physiologically relevant liposomes with colloidally stable silica nanoparticles for delivery of nucleic acids that can be tailored to a specific biological microenvironment.

[0033] Definitions

[0034] The following definitions are included to provide a clear and consistent understanding of the specification and claims. As used herein, the recited terms have the following meanings. All other terms and phrases used in this specification have their ordinary meanings as one of skill in the art would understand. Such ordinary meanings may be obtained by reference to technical dictionaries, such as Hawley's Condensed Chemical Dictionary 14th Edition, by R. J. Lewis, John Wiley & Sons, New York, N.Y., 2001.

[0035] References in the specification to "one embodiment," "an embodiment," etc., indicate that the embodiment described may include a particular aspect, feature, structure, moiety, or characteristic, but not every embodiment necessarily includes that aspect, feature, structure, moiety, or characteristic. Moreover, such phrases may, but do not necessarily, refer to the same embodiment referred to in other portions of the specification. Further, when a particular aspect, feature, structure, moiety, or characteristic is described in connection with an embodiment, it is within the knowledge of one skilled in the art to affect or connect such aspect, feature, structure, moiety, or characteristic with other embodiments, whether or not explicitly described.

[0036] The singular forms "a," "an," and "the" include plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to "a compound" includes a plurality of such compounds, so that a compound X includes a plurality of compounds X. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for the use of exclusive terminology, such as "solely," "only," and the like, in connection with any element described herein, and / or the recitation of claim elements or use of "negative" limitations.

[0037] The term "and / or" means any one of the items, any combination of the items, or all of the items with which this term is associated. The phrase "one or more" is readily understood by one of skill in the art, particularly when read in context of its usage. For example, one or more substituents on a phenyl ring refers to one to five, or one to four, for example if the phenyl ring is di -substituted.

[0038] As used herein, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when separating a listing of items, “and / or” or “or” shall be interpreted as being inclusive, e.g., the inclusion of at least one, but also including more than one of a number of items, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of’ or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e., “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.”

[0039] As used herein, the terms “including,” “includes,” “having,” “has,” “with,” or variants thereof, are intended to be inclusive similar to the term “comprising.” The term "about" can refer to a variation of ± 5%, ± 10%, ± 20%, or ± 25% of the value specified. For example, "about 50" percent can in some embodiments carry a variation from 45 to 55 percent. For integer ranges, the term "about" can include one or two integers greater than and / or less than a recited integer at each end of the range. Unless indicated otherwise herein, the term "about" is intended to include values, e.g., weight percentages, proximate to the recited range that are equivalent in terms of the functionality of the individual ingredient, the composition, or the embodiment. The term about can also modify the endpoints of a recited range as discuss above in this paragraph.

[0040] As will be understood by the skilled artisan, all numbers, including those expressing quantities of ingredients, properties such as molecular weight, reaction conditions, and so forth, are approximations and are understood as being optionally modified in all instances by the term "about." These values can vary depending upon the desired properties sought to be obtained by those skilled in the art utilizing the teachings of the descriptions herein. It is also understood that such values inherently contain variability necessarily resulting from the standard deviations found in their respective testing measurements.

[0041] As will be understood by one skilled in the art, for any and all purposes, particularly in terms of providing a written description, all ranges recited herein also encompass any and all possible sub-ranges and combinations of sub-ranges thereof, as well as the individual values making up the range, particularly integer values. A recited range (e.g., weight percentages or carbon groups) includes each specific value, integer, decimal, or identity within the range. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, or tenths. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art, all language such as "up to," "at least," "greater than," "less than," "more than," "or more," and the like, include the number recited and such terms refer to ranges that can be subsequently broken down into sub-ranges as discussed above. In the same manner, all ratios recited herein also include all sub-ratios falling within the broader ratio. Accordingly, specific values recited for radicals, substituents, and ranges, are for illustration only; they do not exclude other defined values or other values within defined ranges for radicals and substituents.

[0042] One skilled in the art will also readily recognize that where members are grouped together in a common manner, such as in a Markush group, the invention encompasses not only the entire group listed as a whole, but each member of the group individually and all possible subgroups of the main group. Additionally, for all purposes, the invention encompasses not only the main group, but also the main group absent one or more of the group members. The invention therefore envisages the explicit exclusion of any one or more of members of a recited group. Accordingly, provisos may apply to any of the disclosed categories or embodiments whereby any one or more of the recited elements, species, or embodiments, may be excluded from such categories or embodiments, for example, for use in an explicit negative limitation.

[0043] The term "patient" or "subject" is used throughout the specification within context to describe an animal, generally a mammal, especially including a domesticated animal or a human, to whom treatment, including prophylactic treatment (prophylaxis), with the compounds or compositions according to the present disclosure is provided. For treatment of those infections, conditions or disease states which are specific for a specific animal such as a human patient, the term patient refers to that specific animal. In most instances, the patient or subject of the present disclosure is a human patient of either or both genders. Patient or subject can also refer to mice, apes, humans, farm animals, sports animals, and pets. Tissues, cells, and progeny thereof of the biological entity obtained in vivo or cultured in vitro are also included.

[0044] The term "effective" is used herein, unless otherwise indicated, to describe an amount of a compound or component which, when used within the context of its use, produces or effects an intended result, whether that result relates to the prophylaxis and / or therapy of an infection and / or disease state or as otherwise described herein. The term effective subsumes all other effective amount or effective concentration terms (including the term "therapeutically effective") which are otherwise described or used in the present application.

[0045] The terms "treat", "treating", and "treatment", are used synonymously to refer to any action providing a benefit to a patient at risk for or afflicted with a disease, including improvement in the condition through lessening, inhibition, suppression or elimination of at least one symptom, delay in progression of the disease, delay in or inhibition of the likelihood of the onset of the disease, etc. Treatment can also be used to provide prevention (prophylaxis / reducing the likelihood) of a disease state occurring, but the present disclosure contemplates a distinction between the treatment of a disease state and / or condition and the prevention (prophylaxis / reducing the likelihood) that a disease state or condition will occur, within the context of such treatment / prevention.

[0046] By switching out the targeting ligand and the oligonucleotide cargo, any disorder resulting from a known genetic mutation can be treated with the composition of the invention. Some diseases of interest include, but are not limited to, cancer, autoimmune diseases and autoinflammatory diseases. The oligonucleotide sequences can be of any length depending on the gene of interest / the gene expression to be corrected. The nanoparticle system and metal cation loading procedure here can accommodate a wide variety of oligonucleotide lengths for this reason. Lengths can include, for example, oligonucleotide sequences of about 20-2000 nucleotides in length.

[0047] As used herein, the term “cancer” includes solid animal tumors as well as hematological malignancies. The terms “tumor cell(s)” and “cancer cell(s)” are used interchangeably herein.

[0048] "Solid animal tumors" include cancers of the head and neck, lung, mesothelioma, mediastinum, lung, esophagus, stomach, pancreas, hepatobiliary system, small intestine, colon, colorectal, rectum, anus, kidney, urethra, bladder, prostate, urethra, penis, testis, gynecological organs, ovaries, breast, endocrine system, skin central nervous system; sarcomas of the soft tissue and bone; and melanoma of cutaneous and intraocular origin. In addition, a metastatic cancer at any stage of progression can be treated, such as micrometastatic tumors, megametastatic tumors, and recurrent cancers.

[0049] In some cases, a hematological cancer or hematological malignancy can be treated. The term "hematological malignancies" includes adult or childhood leukemia and lymphomas, Hodgkin's disease, lymphomas of lymphocytic and cutaneous origin, acute and chronic leukemia, plasma cell neoplasm, and cancers associated with AIDS.

[0050] The inventive methods and compositions can also be used to treat leukemias, lymph nodes, thymus tissues, tonsils, spleen, cancer of the breast, cancer of the lung, cancer of the adrenal cortex, cancer of the cervix, cancer of the endometrium, cancer of the esophagus, cancer of the head and neck, cancer of the liver, cancer of the pancreas, cancer of the prostate, cancer of the thymus, carcinoid tumors, chronic lymphocytic leukemia, Ewing's sarcoma, gestational trophoblastic tumors, hepatoblastoma, multiple myeloma, non-small cell lung cancer, retinoblastoma, or tumors in the ovaries. A cancer at any stage of progression can be treated or detected, such as primary, metastatic, and recurrent cancers. In some cases, metastatic cancers are treated but primary cancers are not treated. Information regarding numerous types of cancer can be found, e.g., from the American Cancer Society (cancer.org), or from, e.g., Wilson et al. (1991) Harrison's Principles of Internal Medicine, 12th Edition, McGraw-Hill, Inc.

[0051] In some embodiments, the cancer and / or tumors to be treated are hematological malignancies, or those of lymphoid origin such as cancers or tumors of lymph nodes, thymus tissues, tonsils, spleen, and cells related thereto. In some embodiments, the cancer and / or tumors to be treated are those that have been resistant to T cell therapies.

[0052] “Gene therapy vectors” are vehicles designed to deliver therapeutic genetic material, such as a working gene, directly into a cell. Gene transfer can be obtained using direct transfer of genetic material, in but not limited to, plasmids, viral vectors, viral nucleic acids, phage nucleic acids, phages, cosmids, and artificial chromosomes, or via transfer of genetic material in cells or carriers such as cationic liposomes. The gene transfer vector can comprise DNA, RNA (e.g., antisense nucleic acid molecule, a small interfering RNA (siRNA), microRNA (miRNA) a short hairpin RNA (shRNA), synthetic mRNA and / or coding sequence), peptide, protein, and / or viral associated vectors, including but not limited to, adenovirus, adeno-associated virus (AAV), lentivirus, retrovirus, bocavirus, oncolytic vectors and / or virus like particles (VLPs).

[0053] Treatment of, or treating, metastatic cancer can include the reduction in cancer cell migration or the reduction in establishment of at least one metastatic tumor. The treatment also includes alleviation or diminishment of more than one symptom of metastatic cancer such as coughing, shortness of breath, hemoptysis, lymphadenopathy, enlarged liver, nausea, jaundice, bone pain, bone fractures, headaches, seizures, systemic pain and combinations thereof. The treatment may cure the cancer, e.g., it may prevent metastatic cancer, it may substantially eliminate metastatic tumor formation and growth, and / or it may arrest or inhibit the migration of metastatic cancer cells.

[0054] Anti-cancer activity can reduce the progression of a variety of cancers (e.g., breast, lung, pancreatic, or prostate cancer) using methods available to one of skill in the art. Anti-cancer activity, for example, can determined by identifying the lethal dose (LD100) or the 50% effective dose (ED50) or the dose that inhibits growth at 50% (GI50) of an agent of the present invention that prevents the migration of cancer cells. In one aspect, anti-cancer activity is the amount of the agent that reduces 50%, 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99% or 100% of cancer cell migration, for example, when measured by detecting expression of a cancer cell marker at sites proximal or distal from a primary tumor site, or when assessed using available methods for detecting metastases.

[0055] In another example, agents that increase or decrease regulator / modulator expression or function can be administered to sensitize tumor cells to immune therapies. Hence, by administering an agent that increase or decrease regulator / modulator expression or function, tumor cells can become more sensitive to the immune system and to various immune therapies.

[0056] MSNs pursuant to the present disclosure may be used to deliver nucleic acid, such as DNA, including double stranded linear DNA or a plasmid DNA, RNA (e.g., mRNA), including small interfering RNA, small hairpin RNA, microRNA, siRNA, a drug, an imaging agent, or a mixture thereof. The compounds / bioactive agents may also be included in MSNs for formulating compositions adapted for intravenous, intramuscular, intraperitoneal, retro-orbital and subcutaneous injection routes.

[0057] The term "pharmaceutically acceptable" as used herein means that the compound or composition is suitable for administration to a subject, including a human patient, to achieve the treatments described herein, without unduly deleterious side effects in light of the severity of the disease and necessity of the treatment.

[0058] The term "compound" is used herein to describe any specific compound or bioactive agent disclosed herein, including any and all stereoisomers (including diastereomers), individual optical isomers (enantiomers) or racemic mixtures, pharmaceutically acceptable salts (including alternative pharmaceutically acceptable salts when a pharmaceutically acceptable salt is disclosed) and prodrug forms. The term compound herein refers to stable compounds. Within its use in context, the term compound may refer to a single compound or a mixture of compounds as otherwise described herein. One or more bioactive agents (any agent which produces an intended biological, including pharmacological effect) may be included in MSNs according to the present disclosure to provide pharmaceutical compositions hereunder.

[0059] The term "mesoporous silica nanoparticles" (MSNs) is used to describe nanoparticles according to the present disclosure which can be used in vivo for diagnostic and / or therapeutic purposes.

[0060] A nanoparticle may have a variety of shapes and cross-sectional geometries that may depend, in part, upon the process used to produce the particles. In one embodiment, a nanoparticle may have a shape that is a sphere, a rod, a tube, a flake, a fiber, a plate, a wire, a cube, or a whisker. A nanoparticle may include particles having two or more of the aforementioned shapes. In one embodiment, a cross-sectional geometry of the particle may be one or more of circular, ellipsoidal, triangular, rectangular, or polygonal. In one embodiment, a nanoparticle may consist essentially of non-spherical particles. For example, such particles may have the form of ellipsoids, which may have all three principal axes of differing lengths or may be oblate or prelate ellipsoids of revolution. Non-spherical nanoparticles alternatively may be laminar in form, wherein laminar refers to particles in which the maximum dimension along one axis is substantially less than the maximum dimension along each of the other two axes. Non-spherical nanoparticles may also have the shape of frusta of pyramids or cones, or of elongated rods. In one embodiment, the nanoparticles may be irregular in shape. In one embodiment, a plurality of nanoparticles may consist essentially of spherical nanoparticles. The phrase "effective average particle size" as used herein to describe a multi-particulate (e.g., a porous nanoparticulate) means that at least 50% of the particles therein are of a specified size. Accordingly, "effective average particle size of less than about 2,000 nm in diameter" means that at least 50% of the particles therein are less than about 2000 nm in diameter. In certain embodiments, nanoparticles have an effective average particle size of less than about 2,000 nm (i.e., 2 microns), less than about 1,900 nm, less than about 1,800 nm, less than about 1,700 nm, less than about 1,600 nm, less than about 1,500 nm, less than about 1,400 nm, less than about 1,300 nm, less than about 1,200 nm, less than about 1,100 nm, less than about 1,000 nm, less than about 900 nm, less than about 800 nm, less than about 700 nm, less than about 600 nm, less than about 500 nm, less than about 400 nm, less than about 300 nm, less than about 250 nm, less than about 200 nm, less than about 150 nm, less than about 100 nm, less than about 75 nm, or less than about 50 nm, as measured by light-scattering methods, microscopy, or other appropriate methods. In certain aspects of the present disclosure, where administration via intravenous, intramuscular, intraperitoneal, retro-orbital and subcutaneous injection routes produces long residence times (on the order of at least 12 hours to 2 weeks or more) and greater biodistribution and / or bioavailability, the MSNs are monodisperse and generally no greater than about 50 nm in average diameter, often less than about 30 nm in average diameter, as otherwise described herein. The term "Dso" refers to the particle size below which 50% of the particles in a multi -particulate fall. Similarly, the term "D90" refers to the particle size below which 90% of the particles in a multi -particulate fall.

[0061] The MSN size distribution depends on the application, but is principally monodisperse (e.g., a uniform sized population varying no more than about 5-20% in diameter, as otherwise described herein). The term "monodisperse" is used as a standard definition established by the National Institute of Standards and Technology (NIST) (Particle Size Characterization, Special Publication 960-1, January 2001) to describe a distribution of particle size within a population of particles, in this case nanoparticles, which particle distribution may be considered monodisperse if at least 90% of the distribution lies within 5% of the median size. See Takeuchi, et al., Advanced Materials, 2005, 17, No. 8, 1067-1072.

[0062] In certain embodiments, mesoporous silica nanoparticles can range, e.g., from around 1 nm to around 500 nm in size, including all integers and ranges there between. The size is measured as the longest axis of the particle. In various embodiments, the particles are from around 5 nm to around 500 nm and from around 10 nm to around 100 nm in size. The mesoporous silica nanoparticles have a porous structure. The pores can be from around 0.5 nm to about 25 nm in diameter, often about 1 to around 20 nm in diameter, including all integers and ranges there between. In one embodiment, the pores are from around 1 to around 10 nm in diameter. In one embodiment, around 90% of the pores are from around 1 to around 20 nm in diameter. In another embodiment, around 95% of the pores are around 1 to around 20 nm in diameter.

[0063] In certain alternative embodiments, the MSNs are monodisperse and range in size from about 25 nm to about 300 nm. The sizes used may include 50 nm (+ / -10 nm) and 150 nm (+ / -15 nm), within a narrow monodisperse range, but may be narrower in range. A broad range of particles is not used because such a population is difficult to control and to target specifically.

[0064] The term "lipid" is used to describe the components which are used to form lipid bi- or multilayers on the surface of the nanoparticles which are used in the present disclosure. Various embodiments provide nanostructures which are constructed from nanoparticles which support a lipid bilayer(s). In embodiments according to the present disclosure, the nanostructures may include, for example, a core-shell structure including a porous particle core surrounded by a shell of lipid bilayer(s). The nanostructure, e.g., a porous alum nanostructure as described above, supports the lipid bilayer membrane structure.

[0065] The lipid bi- or multilayer supported on the porous particle according to one embodiment of the present disclosure has a lower melting transition temperature, i.e., is more fluid than a lipid bi- or multilayer supported on a non-porous support or the lipid bi- or multilayer in a liposome. This is sometimes important in achieving high affinity binding of immunogenic peptides or targeting ligands at low peptide densities, as it is the bilayer fluidity that allows lateral diffusion and recruitment of peptides by target cell surface receptors. One embodiment provides for peptides to cluster, which facilitates binding to a complementary target.

[0066] In the present disclosure, the lipid bi- or multilayer may vary significantly in composition. Ordinarily, any lipid or polymer which may be used in liposomes may also be used in MSNs according to the present disclosure. Lipids are as otherwise described herein. Lipids for use in the present disclosure include, for example, l,2-dioleoyl-sn-glycero-3 -phosphocholine (DOPC), l,2-dipalmitoyl-sn-glycero-3 -phosphocholine (DPPC), l,2-distearoyl-sn-glycero-3- phosphocholine (DSPC), l,2-dioleoyl-sn-glycero-3-[phosphor-L-serine] (DOPS), 1,2-dioleoyl- 3-trimethylammonium-propane (18: 1 DOTAP), l,2-dioleoyl-sn-glycero-3-phospho-(l'-rac- glycerol) (DOPG), l,2-dioleoyl-sn-glycero-3 -phosphoethanolamine (DOPE), 1,2-dipalmitoyl- sn-glycero-3-phosphoethanolamine (DPPE), l,2-dioleoyl-sn-glycero-3-phosphoethanolamine- N-[methoxy(polyethylene glycol)-2000] (18: 1 PEG-2000 PE), l,2-dipalmitoyl-sn-glycero-3- phosphoethanolamine-N-[methoxy(poly ethylene glycol)-2000] (16:0 PEG-2000 PE), 1-Oleoyl- 2-[12-[(7-nitro-2-l,3-benzoxadiazol-4-yl)amino]lauroyl]-sn-Glyce- ro-3 -Phosphocholine (18: 1- 12:0 NBD PC), l-palmitoyl-2-(12-[(7-nitro-2-l,3-benzoxadiazol-4-yl)amino]lauroyl)-sn-gl- ycero-3 -phosphocholine (16:0-12:0 NBD PC), cholesterol and mixtures / combinations thereof. Cholesterol, not technically a lipid, but presented as a lipid for purposes of an embodiment of the present disclosure given the fact that cholesterol may be an important component of the lipid bilayer according to an embodiment of the disclosure. Often cholesterol is incorporated into lipid bilayers in order to enhance structural integrity and fluidity of the bilayer. These lipids are all readily available commercially from Avanti Polar Lipids, Inc. (Alabaster, Ala., USA). DOPE and DPPE are particularly useful for conjugating (through an appropriate crosslinker) peptides, polypeptides, including immunogenic peptides, proteins and antibodies, RNA and DNA through the amine group on the lipid.

[0067] The term "reporter" is used to describe an imaging agent or moiety which is incorporated into the phospholipid bilayer or cargo of MSNs according to an embodiment of the present disclosure and provides a signal which can be measured. The moiety may provide a fluorescent signal or may be a radioisotope which allows radiation detection, among others. Exemplary fluorescent labels for use in MSNs(e.g., via conjugation or adsorption to the lipid bi- or multilayer or silica core, although these labels may also be incorporated into cargo elements such as DNA, RNA, polypeptides and small molecules which are delivered to cells by the metallic MSNs) include Hoechst 33342 (350 / 461), 4',6-diamidino-2-phenylindole (DAPI, 356 / 451), Alexa Fluor® 405 carboxylic acid, succinimidyl ester (401 / 421), CellTracker™. Violet BMQC (415 / 516), CellTracker™ Green CMFDA (492 / 517), calcein (495 / 515), Alexa Fluor® 488 conjugate of annexin V (495 / 519), Alexa Fluor® 488 goat anti-mouse IgG (H+L) (495 / 519), Click-iT® AHA Alexa Fluor® 488 Protein Synthesis HCS Assay (495 / 519), LIVE / DEAD® Fixable Green Dead Cell Stain Kit (495 / 519), SYTOX®. Green nucleic acid stain (504 / 523), MitoSOX™ Red mitochondrial superoxide indicator (510 / 580). Alexa Fluor® 532 carboxylic acid, succinimidyl ester (532 / 554), pHrodo™ succinimidyl ester (558 / 576), CellTracker™ Red CMTPX (577 / 602), Texas Red® l,2-dihexadecanoyl-sn-glycero-3 -phosphoethanolamine (Texas Red® DHPE, 583 / 608), Alexa Fluor® 647 hydrazide (649 / 666), Alexa Fluor® 647 carboxylic acid, succinimidyl ester (650 / 668), Ulysis™ Alexa Fluor® 647 Nucleic Acid Labeling Kit (650 / 670) and Alexa Fluor® 647 conjugate of annexin V (650 / 665). Moities which enhance the fluorescent signal or slow the fluorescent fading may also be incorporated and include SlowFade®. Gold antifade reagent (with and without DAPI) and Image-iT® FX signal enhancer. All of these are well known in the art.

[0068] Additional reporters include polypeptide reporters which may be expressed by plasmids (such as histone-packaged supercoiled DNA plasmids) and include polypeptide reporters such as fluorescent green protein and fluorescent red protein. Reporters pursuant to the present disclosure are utilized principally in diagnostic applications or the progress of therapy in a patient or subject.

[0069] Pharmaceutical compositions according to the present disclosure comprise an effective population of MSNs as otherwise described herein formulated to affect an intended result (e.g., immunogenic result, therapeutic result and / or diagnostic analysis, including the monitoring of therapy) formulated in combination with a pharmaceutically acceptable carrier, additive or excipient. The MSNs within the population of the composition may be the same or different depending upon the desired result to be obtained. Pharmaceutical compositions according to the present disclosure may also comprise an addition bioactive agent or drug.

[0070] Generally, dosages and routes of administration of the compound are determined according to the size and condition of the subject, according to standard pharmaceutical practices. Dose levels employed can vary widely and can readily be determined by those of skill in the art. Typically, amounts in the milligram up to gram quantities are employed. The composition may be administered to a subject by various routes, e.g., orally, transdermally, perineurally or parenterally, that is, by intravenous, subcutaneous, intraperitoneal, intrathecal or intramuscular injection, among others, including buccal, rectal and transdermal administration. Subjects contemplated for treatment according to the method of the disclosure include humans, companion animals, laboratory animals, and the like. The disclosure contemplates immediate and / or sustained / controlled release compositions, including compositions which comprise both immediate and sustained release formulations.

[0071] Certain formulation embodiments of the disclosure include LC-MSNs comprised of mesoporous silica nanoparticles (MSNs) that (a) are loaded with one or more pharmaceutically- active agents and (b) that are encapsulated by and that support a lipid bilayer, and wherein the LC-MSN has an average diameter of between about 1 nm to about 50 nm, e.g., between about 1 nm to about 30 nm, about 5 nm to about 25 nm, often 10 nm to about 25 nm, about 10 to about 20 nm. It has unexpectedly been discovered that the administration of LC-MSNs comprising therapeutic and / or diagnostic agents via intravenous, intramuscular, intraperitoneal, retro-orbital and especially subcutaneous routes of administration at the average diameters indicated above provide enhanced biodistribution, enhanced bioavailability and increased residence time (often at least 12-24 hours to several days up to a week or in certain cases, two weeks to a month or even longer), of these LC-MSNs compared to LC-MSNs with average diameters which are in excess of 50 nm, often greater than about 100 nm or more (e.g., 200-300 nm). Compositions according to the present disclosure may be used to administer cargo as otherwise described herein to a patient or subject through intravenous, intramuscular, intraperitoneal, retro-orbital and subcutaneous routes of administration, with unexpected biodistribution, bioavailability and residence times far exceeding compositions utilizing nanoparticles with average diameters in excess of 50-100 nm or greater (200-250 nm).

[0072] Formulations containing the compounds according to the present disclosure may take the form of liquid, solid, semi-solid or lyophilized powder forms, such as, for example, solutions, suspensions, emulsions, sustained-release formulations, tablets, capsules, powders, suppositories, creams, ointments, lotions, aerosols, patches or the like, e.g., in unit dosage forms suitable for simple administration of precise dosages.

[0073] Pharmaceutical compositions according to the present disclosure typically include a conventional pharmaceutical carrier or excipient and may additionally include other medicinal agents, carriers, adjuvants, additives and the like. In some embodiments, the composition is about 0.1% to about 85%, about 0.5% to about 75% by weight of a compound or compounds of the disclosure, with the remainder consisting essentially of suitable pharmaceutical excipients.

[0074] An injectable composition for parenteral administration (e.g., intravenous, intramuscular or intrathecal) will typically contain the compound in a suitable i.v. solution, such as sterile physiological salt solution. The composition may also be formulated as a suspension in an aqueous emulsion. Liquid compositions can be prepared by dissolving or dispersing the population of MSNs and / or LC-MSNs (about 0.5% to about 20% by weight or more), and optional pharmaceutical adjuvants, in a carrier, such as, for example, aqueous saline, aqueous dextrose, glycerol, or ethanol, to form a solution or suspension. For use in an oral liquid preparation, the composition may be prepared as a solution, suspension, emulsion, or syrup, being supplied either in liquid form or a dried form suitable for hydration in water or normal saline.

[0075] For oral administration, such excipients include pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, talcum, cellulose, glucose, gelatin, sucrose, magnesium carbonate, and the like. If desired, the composition may also contain minor amounts of non-toxic auxiliary substances such as wetting agents, emulsifying agents, or buffers.

[0076] When the composition is employed in the form of solid preparations for oral administration, the preparations may be tablets, granules, powders, capsules or the like. In a tablet formulation, the composition is typically formulated with additives, e.g., an excipient such as a saccharide or cellulose preparation, a binder such as starch paste or methyl cellulose, a filler, a disintegrator, and other additives typically used in the manufacture of medical preparations.

[0077] Methods for preparing such dosage forms are known or is apparent to those skilled in the art; for example, see Remington's Pharmaceutical Sciences (17th Ed., Mack Pub. Co., 1985). The composition to be administered will contain a quantity of the selected compound in a pharmaceutically effective amount for therapeutic use in a biological system, including a patient or subject according to the present disclosure.

[0078] Methods of treating patients or subjects in need for a particular disease state or infection comprise administration an effective amount of a pharmaceutical composition comprising therapeutic MSNs and optionally at least one additional bioactive (e.g., antiviral) agent according to the present disclosure.

[0079] In accordance with the present disclosure there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook et al, 2001, "Molecular Cloning: A Laboratory Manual"; Ausubel, ed., 1994, "Current Protocols in Molecular Biology" Volumes I-III; Celis, ed., 1994, "Cell Biology: A Laboratory Handbook" Volumes I-III; Coligan, ed., 1994, "Current Protocols in Immunology" Volumes I-III; Gait ed., 1984, "Oligonucleotide Synthesis"; Hames & Higgins eds., 1985, "Nucleic Acid Hybridization"; Hames & Higgins, eds., 1984, "Transcription And Translation"; Freshney, ed., 1986, "Animal Cell Culture"; IRL.

[0080] The invention is described further in the following non-limiting example.

[0081] EXAMPLE

[0082] Introduction

[0083] Treatment of advanced prostate cancer (PC) has moved to FDA approved androgen signaling inhibitors (enzalutamide and abiraterone) with some increase in overall survival. Unfortunately, advanced PC diseases become castration resistant after relapse and metastasis to sites such as bone, liver, lymph nodes and brain are observed. (1) To reduce the burden of these diseases and improve patient outcomes, new therapeutic approaches need to be developed that address hard to treat cancers, such as advanced prostate cancer. The limitations and issues associated with traditional prostate cancer therapeutics, as well as enhanced understanding of the molecular mechanisms leading to disease progression, have driven the emergence of nucleic acid-based gene therapies. (2-7) More specifically, the utilization of synthetic siRNAs or mRNAs for modulation of gene expression are attractive for use in therapeutics due to their high specificity and the ability to tailor their design for a broad range of genetic targets. (8,9)

[0084] In the last ten years, numerous scientific studies have been reported in the literature focused on gene therapy for cancers, however very few gene therapies have achieved FDA approval for use in clinical settings. The reason for this is related to issues associated with the delivery of naked DNA / RNA molecules in biological systems such as degradation by nucleases, rapid clearance by the kidneys, poor cellular uptake and non-specific biodistribution. (10) These physiological barriers for nucleic acid delivery necessitate the development of carriers that provide safe and efficient delivery of nucleic acids to target tissues. The application of nanotechnology for nucleic acid delivery has enabled the development of nonviral systems that provide effective gene modulation. Material properties of nanoparticle systems must enable stable blood circulation after intravenous injection, evasion of the mononuclear phagocytic and reticuloendothelial systems, facilitate uptake by target cells and subsequent endosomal escape for cytosol delivery upon cellular internalization. Lipid-based nanocarriers systems (namely liposomes and solid lipid nanoparticles) have emerged as promising delivery agents for nucleic acids due to their biocompatibility, ability to protect naked DNA / RNA from degradation and clinical translatability. (11-14) While promising, liposomal based nanoparticles have some limitations in their stability, loading capacity and multi-cargo accommodation and reliance on specific lipid components for effective nucleic acid encapsulation. (15,16) Mesoporous silica nanoparticles (MSNs) resulting from surfactant templated sol gel processes have garnered significant attention within biomedical research due to their colloidally stability, controllable size and morphology, chemical versatility, excellent biocompatibility and tunability to a variety of nucleic acid cargos. (17-21) Additionally, MSNs have been shown to improve liposome stability, enhance blood circulation and stability as well as offer controlled release characteristics. (17,22,23) Native bare silica matrix exhibit a net negative charge in aqueous environments due to the presence of silanolate groups at their surface which presents an unfavorable electrostatic repulsive interaction between silica mesopores and negative charged nucleic acid molecules. To overcome these interactions, various so called “core-shell” constructs have been developed in which silica surface modifications (24,25) and cationic polymers (26- 30) or cationic lipid coatings (13,31) are employed. While these cationic modifications of the silica surface have had success in loading of nucleic acids, they face shortcomings in 1) the blood circulation as positively charged molecules tend to stick to negatively charged membrane of vasculature epithelial cells 2) the ability to release cargos in biological conditions and 3) issues with cationic mediated toxicity.

[0085] Provided herein is the development of a novel nucleic acid entrapment strategy that reduces the need of positively charged organic moieties, polymers, or complicated silica surface functionalization steps to a single metallic cation that efficiently intermediates the interaction between the silica surface and nucleotide’s phosphate locking-in the nucleic acid. This method results in efficient loading via a straightforward incubation, but also quick release within biologically relevant environments. This strategy also allows and supports the addition of a lipid coating on the silica surface hence combining physiologically relevant liposomes with colloidally stable silica nanoparticles for delivery of nucleic acids in the advanced PC landscape. The addition of this metal cation entrapment technique also serves to provide a mechanism of endosomal escape for cytosolic delivery of siRNA or mRNA. Finally, the LC-MSN’s nucleic acid delivery ability, circulation and biocompatibility were evaluated within relevant in vitro, ex ovo and in vivo models of PC.

[0086] Materials and Methods

[0087] Chemicals. Tetraethylorthosilicate (TEOS), cetyltrimethylammonium chloride (CTAC), cetyltrimethyl ammonium bromide (CTAB), triethanolamine (TEA), calcium chloride (CaC12), sodium chloride (NaCl), magnesium sulfate (MgSCh), iron III chloride (FeCh), aluminum III chloride (AlCh), ammonium nitrate (NH4NO3), hydrochloric acid (HC1), cyclohexane, (3- Aminopropyl)triethoxysilane (APTES) and dimethylformamide (DMF) were purchased from Sigma Aldrich. Cyanine 3-NHS (Cy3) was purchased from Luminoprobe and DyLight 633- NHS was purchased from ThermoFisher. Potassium chloride (KC1) and ammonium hydroxide (NH40H) were purchased from Macron Chemicals. Anhydrous ethanol was purchased from Thomas Scientific. Magnesium chloride (MgC12) was purchased from Mallinckrodt Chemicals. l,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), cholesterol, 1,2-distearoyl-sn-glycero- 3-phosphoethanolamine-N-[methoxy-(polyethylene glycol)-2000] (ammonium salt) (DSPE- PEG2000), l,2-dioleoyl-3 -trimethylammonium -propane (chloride salt) (DOTAP), 1,2-dioleoyl- sn-glycero-3-phosphoethanolamine (DOPE), l,2-distearoyl-sn-glycero-3- phosphoethanolamine-N-[carboxy(polyethylene glycol)-2000, NHS ester] (sodium salt) (DSPE- PEG2000-NHS) were purchased from Avanti Polar Lipids.

[0088] Synthesis of monodisperse 2nm pore size hexagonal silica nanoparticles. In a 150 mL beaker, 0.29g of CTAB was combined with 150g of a 0.32M NH4OH in water solution. The beaker was then covered with parafilm before being placed in an oil bath at 40 °C. The reaction mixture was stirred at 600 rpm for one hour. The parafilm was then removed and a solution of 0.6 mL TEOS in 2.4 mL ethanol was added to the beaker and reacted for 30 minutes before stirring was stopped. The reaction was allowed to age at 40 °C overnight before being placed in an oven at 70 °C for a 24-hour hydrothermal treatment. Finally, the resulting suspension of MSNs was centrifuged at 50,000 g. Surfactant removal was achieved via successive washing steps with NH4NO3 (6 g / L) and HC1 (1% in ethanol, twice). All centrifugation steps were conducted at 50,000 g for 15 minutes. Finally, the resulting MSNs were stored in pure ethanol.

[0089] Synthesis of monodisperse 8 and 5nm pore size spherical silica nanoparticles. In a 100 mL round bottom flask, 0.181g of TEA, 24 mL of CTAC and 36 mL of DI H2O were mixed in an oil bath at 55°C for one hour with a stirring speed of 400 rpm. The stirring speed was then reduced to 200 rpm before adding dropwise a solution of TEOS in cyclohexane (2 mL TEOS, 18 mL cyclohexane). The mixture was then allowed to react for 18 hours before being removed from heat and stirring. The upper organic phase was removed from the flask and the resulting aqueous phase was centrifuged at 50,000 g. Surfactant removal was conducted in the same manner as described for hexagonal MSNs. The resulting MSNs are stored in pure ethanol.

[0090] For in vitro and in vivo studies, MSNs were dyed with either Cy3 or Dylight 633. For Cy3 labeled MSNs, a solution of Cy3 and APTES in ethanol (2 mg Cy3, 2 pL APTES, 1 mL ethanol) was added to the aqueous phase 10 minutes before TEOS addition. For Dylight 633 labeled MSNs, APTES (110 pL APTES in 200 pL ethanol) was added to the aqueous phase during the MSN synthesis (18 hours after TEOS addition) and allowed to react for three hours before surfactant removal. The resulting amine functionalized MSNs were readily reacted with AF 633 NHS for 2 hours. The MSN suspension was spun down, and the supernatant was replaced by a solution of succinic anhydride (100 mg in 4 mL DMF) and the mixture was sonicated for 2 min and kept at RT for at least 24 h. The labeled MSNs were then spun down and washed once by DMF and twice by ethanol.

[0091] Nanoparticle Characterization. TEM / STEM and SEM images were obtained on a JEOL NEO ARM 200 kV aberration corrected instrument equipped with a Gatan Orius digital camera system. Energy dispersive spectroscopy (EDS) mapping was also conducted on the JEOL NEO ARM STEM instrument equipped with JEOL SDD 100 mm2 EDS detectors. MSN hydrodynamic size, zeta potential and poly dispersity were assessed using dynamic light scattering (DLS) on a Malvern Zetasizer Nano-ZS equipped with a He-Ne laser (633 nm) and non-invasive backscatter optics. All samples for DLS measurements were suspended in distilled water or ethanol at a 1 mg mL -1 concentration. Samples were washed three times through centrifugation prior to measurements. All measurements were acquired at 25 °C. DLS measurements for each sample were obtained in triplicate and the Z-average diameter was used for all reported hydrodynamic size values. The zeta potential for all the samples was measured in distilled water in triplicate according to the Smoluchowski method. All reported values correspond to the average of three independent measurements. Nitrogen adsorption-desorption isotherms of MSNs were obtained on a Micromeritics ASAP 2020 at 77 K. Samples were degassed at 60 °C for 12 h before measurements. The surface area was calculated following the Brunauer-Emmet-Teller (BET) equation and the pore size was obtained using the standard Barrett-Joyner-Halenda (BJH) method applied to both the adsorption and desorption branches. For visualization of LC-CaMSNs, samples (1 mg / mL in lx PBS) were plunge frozen into liquid ethane using a Thermo Fisher Scientific Vitrobot, then Cryo-TEM imaging was performed on a Talos L120C operating at 120 kV using a Gatan 626 holder.

[0092] Metal Based Cation siRNA Loading. The metal-based cation loading procedure described here was adapted and developed from a previously described method for porous silicon. (32) Stock solutions of cation solutions were prepared by adding corresponding mass of cation salt to 10 mL of DI H2O to achieve final concentrations of 0.4M, IM or 4M and used immediately for loading experiments. 1 mg of MSNs were washed twice in DI H2O (1 mg / 100 pL) before being incubated with a 5% weight ratio of Cy3 siRNA (ThermoFisher AM4621) or Cy5 firefly luciferase mRNA (APExBio RIO 10) for 10 minutes. 750 pL of the cation solution was then added to the MSN-nucleic acid suspension and allowed to incubate at room temperature for 1 hour. The resulting nucleic acid loaded MSNs were then spun down at 20,000 g and washed twice with DI H2O (Sigma Aldrich W4502 pH=8.8). Loading efficiencies were quantified using a Biotek microplate reader. Loading efficiencies were calculated as the ratio of fluorescence signal in supernatant over fluorescence signal of the overall suspension.

[0093] Liposome Preparation and Fusion to MSN. Lipid formulations were prepared from pure lipid stock solutions at 25 mg / mL in chloroform kept in an argon glove box. Lipid components in chloroform were mixed and chloroform was evaporated using a rotary evaporator. The obtained lipid films were then rehydrated to a concentration of 5 mg / mL in lx PBS. The resulting liposomes were then characterized by DLS to determine hydrodynamic size and polydispersity index. Fusion of lipids to the MSN surface was done at a weight ratio of 1 :5 MSN to lipids. MSN were suspended in DI H2O at a concentration of 1 mg / mL. Liposomes were added to MSNs under sonication while pipetting up and down ~25 times. The resulting LC-MSNs were then spun down and washed once with lx PBS.

[0094] GRP78 Ligand Conjugation Strategies. For NHS-NH2 conjugation of GRP78, the NHS lipid film was rehydrated with a 1 mg / mL stock solution of GRP78 in lx PBS (CPC Scientific 937657) to a final concentration of 5 mg / mL liposomes and sonicated for 30 minutes. The resulting liposomes were then fused to the surface of MSNs pre-suspended in DI H2O at a 1 :5 MSN to lipid weight ratio and incubated at room temperature for 30 minutes. The resulting LC- MSNs were then spun down at 20,000 g (10 min) and resuspended in lx PBS to a final concentration of 1 mg / mL.

[0095] LNCaP Cell Culture and Cytotoxicity Analysis. The androgen sensitive human prostate adenocarcinoma metastatic cell line (LNCaP) was cultured in RPMI 1640 media with L- glutamine (Coming 10-040-CV) supplemented with penicillin / streptomycin (ThermoFisher 15140122) and 10% fetal bovine serum (EMD Millipore 12306C). Cell cultures were maintained at 37°C and 5% CO2. For cytotoxicity studies, LNCaP cells were seeded in 96 well plates at 10,000 cells per well and incubated with LC-MSN system components for 24 or 48 hours. Analysis of LC-MSN cytotoxicity with the LNCaP cell line was assessed on a Biotek microplate reader using the commercially available Cell Titer Gio assay (Promega G7571) according to the manufacturer's protocol.

[0096] Confocal Microscopy Imaging. For visualization of LC-MSN cellular interactions, LNCaP cells were grown on No. 1.5 coverslips in 6 well plates at a density of 250,000 cells per well overnight. Lysotracker (Invitrogen L7528) was incubated with live cells at 50 nM according to the manufacturer’s protocol. The next day, Cy3 labeled LC-MSNs were added for the indicated times to their respective wells and incubated at 37 °C. Cells were then washed twice with pre-warmed lx PBS, fixed with 4% paraformaldehyde for 15 minutes at room temperature. Following fixation, cells were permeabilized using 0.1% Triton-X in PBS for 15 minutes. Cells were then incubated in a 1% BSA blocking buffer for 20 minutes. All cell staining solutions were prepared by diluting fluorescently conjugated antibodies in 1% BSA in PBS. Rab5a-Alexa Fluor 488 (Santa Cruz Biotechnology sc-46692) was diluted at 1 : 100 and incubated with cells at 4 °C overnight. Clathrin heavy chain-Alexa Fluor 475 (Invitrogen MAI-065) was diluted to 5 pg / mL and incubated with cells at 4 °C overnight. Cell samples were then rinsed twice with lx PBS before being mounted to microscopy slides in Prolong Gold with DAPI (Thermo Fisher P36935). All microscopy images were obtained using a Leica DMi8 TCS SP8 confocal microscope. Confocal images were deconvoluted using Huygens Deconvolution software package.

[0097] Flow Cytometry Analysis of LC-MSN Uptake Kinetics. LNCaP cells were seeded in 6 well plates at 250,000 cells per well and incubated overnight at 37 °C. The next day, cells were incubated at the indicated times with 50 pg / mL Cy3 LC-MSNs. Cell samples were then washed twice with lx PBS and collected using 0.05% Trypsin-EDTA (Thermo Fisher 25300054) before being fixed with 4% PFA in lx PBS. Cell samples were analyzed on a Thermo Fisher Attune NxT flow cytometer.

[0098] Human Blood Hemolysis Analysis. Whole human blood was obtained from (Innovative Research, IWB1K2E10ML). Red blood cells (RBCs) were then isolated using Ficoll-Paque PLUS (Cytiva #17144002) and density gradient centrifugation at 800 xg for 8 minutes. RBCs were then purified with successive lx PBS washing and centrifugation steps (800 xg, 8 minutes) before being suspended in lx PBS (~ 4 x 106cells / mL). Isolated RBCs were then incubated with relevant MSNs, CaMSNs or LC-CaMSNs at 37 °C for three hours. Samples were then centrifuged and resulting supernatant hemoglobin amounts were assessed via plate reader endpoint absorbance measurements (570 nm). The percentage of hemolysis for each sample was calculated using Equation 1 below. Negative control samples corresponded to RBCs suspended in lx PBS at physiological pH while positive control samples corresponded to RBCs suspended in DI H2O. 100 [1]

[0099] LNCaP mRNA Proof of Concept Experiments. LNCaP cells were seeded in 96 well plates at 10,000 cells per well and incubated overnight at 37 °C. The next day media was removed and replaced with media containing Lipofectamine / mRNA complexes or mRNA loaded LC-MSNs and incubated at 37 °C for 24 hours. Lipofectamine MessengerMax (Invitrogen LMRNA003) complexes were prepared and added to cells according to manufacturer protocol based on recommended high and low amounts of reagents.

[0100] Real-time qPCR Analysis. LNCaP cells were seeded in 6 well plates at 250,000 cells per well and incubated overnight at 37 °C. Relevant LC-CaMSNs loaded with luc-mRNA were incubated with cells (50 pg / mL) for 24 or 48 hours. RNA was then extracted using an IBI reagent Kit (IB47602, IBI Scientific, Dubuque, IA). qPCR was performed on a LightCycler 480 instrument (Roche Diagnostics, Indianapolis, IN). The mRNA level was measured by qPCR. The gene levels were normalized by 18S. Expression level changes were calculated by comparing to a non-treated control.

[0101] Luciferase F: TGCACATATCGAGGTGGACATC (SEQ ID NO: 1) Luciferase R: TGCCAACCGAACGGACAT (SEQ ID NO: 2)

[0102] Ex ovo chick chorioallantoic membrane model (CAM) Maintenance and Analysis. Fertilized white leghorn chicken eggs were purchased from a local farmer on embryonic developmental day zero (EDD). Eggs were placed in a GOF 1500 cabinet incubator with 60% humidity at 38 °C and allowed to rock until EDD 3. On EDD day 3, a Dremel tool equipped with a No. 5 blade was used to score the eggs along the shortest circumference. The eggs are then cracked into a sterile weigh boat. Viability of chick embryos out of the shell in the weigh boats was confirmed by observing an intact yolk and a visible heartbeat. Embryos were then covered with a square plastic petri dish cover and placed in a VWR Symphony incubator at 37 °C and 0% CO2 until EDD 16. On EDD 16, embryonic vasculature was labelled by microinjecting LCA fluorescein (1 :100, 250 pL) and allowed to circulate for 15 minutes before microinjecting Cy3 labeled LC-MSNs. Embryos were then imaged using a Zeiss Axio Examiner Z1 microscope. All experiments were conducted in accordance with the regulations and guidelines of the Institutional Animal Care and Use Committee at the University of New Mexico (IACUC Protocol # 21- 201149-T-MC).

[0103] Mouse Models and in vivo Experimentation. Adult male NOD scid gamma (NSG) mice at the University of New Mexico were maintained on a 12-hour light-dark cycle with ad libitum access to food and water. Animals were group housed and all experiments were conducted in accordance with the regulations and guidelines of the Institutional Animal Care and Use Committee at the University of New Mexico (IACUC Protocol # 22-201155). LC-MSNs were administered to adult male NOD scid gamma (NSG) mice via retro-orbital injections under isoflurane anesthesia (1 mg / mL, lOOpL). For xenograft establishment in NSG mice, LNCaP cells were suspended to a final concentration of 5xl07cells / mL in serum free, phenol red free RPMI media. Cell suspensions were then mixed at 50% volume with phenol red free Matrigel (Coming 356237) before subcutaneous injection in the right flank (200 pL final injection volume). Tumor growth was monitored serially over time. Fluorescent LC-MSN and bioluminescence signal was tracked in mice using a Perkin Elmer IVIS Spectrum in vivo imaging system.

[0104] Results / Discussion

[0105] MSN Morphology and Pore Size Modulation. MSNs in this study were synthesized via a sol gel surfactant template approach in which a silica precursor (TEOS) is condensed over an aqueous surfactant self-assembly (Figure la). This approach is attractive for engineering nanocarriers due to its ease of synthesis as well as the high level of control over reaction products. (33) The interchanging of surfactants, conditions of the reaction scheme and varying additions of the silica precursor enabled the creation of a library of MSNs having varying morphologies and pore sizes for subsequent tailoring to nucleic acid cargos. First, hexagonal MSNs having a 2nm pore size structure were synthesized via CTAB templating base catalyzed by NFUOH according to previous work. (34) Secondly, spherical MSNs having either dendritic or worm-like pores were synthesized using a biphasic reaction setup adapted from our previous work. (35) All synthesis approaches resulted in highly monodisperse nanoparticle populations based on the low polydispersity indices (PDI < 0.2) obtained from DLS measurements of resulting reaction batches (Figure lb). The DLS zeta potential measurements of the synthesized nanoparticles (-28.9 ±2.4 mV) were indicative of a pure silica matrix in water (Figure 1c). TEM indicated highly ordered resulting mesoporous structures for the hexagonal (Figure Id, left), 5nm wormlike (Figure Id, middle) and 8nm dendritic nanoparticles (Figure Id, right).

[0106] Metallic Entrapment for MSN Loading of Nucleic Acids. siRNA Loading and Pore Entrapment. Engineering of chemical and physical characteristics for improved siRNA or mRNA loading into silica mesopores must also consider the need for efficient release kinetics and biocompatibility within biological systems. Additionally, reducing the complexity of such systems boosts their reproducibility as well as streamlines future use in clinical settings. To avoid the reliance on cationic polymers, cationic lipids or additional surface functionalization, it is shown herein shown that the utilization of metal cations can link silanolate (Si-O-) groups and negatively charged nucleotides by overcoming electrostatic repulsive forces. It was hypothesized that complexation between nucleic acid molecules, metal cations and silanolate groups on the surface of the silica nanoparticles and within the pores would enhance siRNA or mRNA loading into negatively charged MSN mesopores and that the resulting complexation would serve to trap nucleic acids within the pores (Figure 2a).

[0107] Impact of MSN morphology / pore size. In order to evaluate surface morphology impact on nucleic acid loading using metallic cations, a previously reported procedure was adapted that uses high concentration of calcium chloride to load siRNA into porous silicon by forming insoluble calcium silicate species. (32) As expected, bare MSNs loaded negligible siRNA amount, due to natural electrostatic repulsion while the use of the 4M CaCh solution drastically increased the loading efficiency with a ratio 1 / 0.75 / 0.5 as a function of pore size. (Figure 2b). These results suggest a dependence on MSN pore size and morphology for calcium mediated loading of siRNA.

[0108] Evaluation of siRNA loading in function of cation radius and solution pH. It was then hypothesized that the loading extent of siRNA could be further modulated as a function of ionic radii of the cations. To test this hypothesis, Mg2+(ionic radius=72 pm), Ca2+(Ca2+= 100 pm), Na+(ionic radius=102 pm), and K+(ionic radius=138 pm) were used in 4 M cation chloride solutions to load fluorescent siRNA. Loading efficiency (<10%) results along with zeta potential measurements ( — 20 mV, with no difference compared to bare MSN) indicated ineffective loading with monovalent cations (Na+, K+) in both acidic and basic pH conditions, in contrast to an effective loading (>80%, pH 9.5) with divalent cations (Mg2+, Ca2+) ruling out the effect of the ionic radius effect in favor of the cation valency. Additionally, it is noteworthy that acidic pH reduced to 30% the loading efficiency using divalent cations (Figure 2d, 2f) implying that pH and hence, the degree of ionization of both silanols and phosphate (nucleotide), plays a key role in the metallic entrapment process. Considering the Hendersson Hasselbach relationship (pH= pKa +log[A-] / [AH]), the ratio of both base / acid couples SiO- / SiOH and PO4- / PCLH groups will drastically evolve from ~ 20 at pH=3.5 to -107 at pH=9.5 suggesting that an electrostatic link plays a key role in the metallic entrapment process. The results from STEM imaging do not show any morphological or contrast difference of MSN incubated with and without concentrated CaCh (Figure 2e), as previously shown with the silicon surface in a reported study. (32) These results suggest a nucleic acid entrapment strategy via an electrostatic metallic link without formation of observable silicate precipitate.

[0109] The loading procedure was then extended to other cations having higher valences. Prepared 4 M solutions of FeCh and AlCh resulted in pH <1. Adjusting the pH to >3 resulted in important precipitation on a wide range of concentrations (0.04 M-0.4 M) (Figure 7). The obtained loading efficiency results (at unadjusted pH<l) for trivalent cations (Fe3+, A13+) also indicated relatively good loading (-80%).

[0110] It was then sought to understand the interaction between the silica surface and siRNA / cation complexes with a hypothesis that the state of silanol groups would play a key role in the ability of calcium loading to occur. To test this hypothesis, fluorescent tracking of siRNA loading was conducted utilizing CaCh solutions at a higher pH (pH~9.5). In respect to the hypothesis, at higher pH the siRNA loading efficiency was increased to approximately 80% (Figure 2f). This is likely due to the fact that at lower pHs, the silanol groups on the surface are protonated (SiOH), inhibiting optimal interaction with cation / siRNA complexes. At pHs well above the pKa of silanol groups we expect the surface to be significantly deprotonated, facilitating effective interactions between Si-O- groups and cation / siRNA complexes.

[0111] Metallic entrapment efficiently loads messenger RNA. After confirming the capability of divalent metallic cations to entrap siRNA (-50 nucleotides, double stranded), the efficacy of this strategy was evaluated with mRNA, a significantly larger molecule (1921 nucleotides, single stranded) with comparable chemistry. The loading data shows 85-100% loading efficiency, suggesting that divalent cations can exert the same effect on the mRNA nucleotides and assist by folding mRNA within the pores. The ability of divalent cation loading was also applicable to mRNAs as indicated by results from tracking of a fluorescent Firefly Luciferase mRNA (Figure 2g). DLS measurement results for cation loaded MSNs indicated optimal hydrodynamic size (<200 nm) and PDI (<0.2) of the CaMSN and was therefore chosen for subsequent experimentation (Figure 2c). STEM imaging results after Ca2+loading indicated that nucleic acids are loaded into pores and that MSN morphology is retained (Figure 2e). Finally, EDS elemental analysis of nucleic acid loaded CaMSNs confirmed the presence of calcium and phosphorous attributed to the phosphate backbone of the siRNA (Figure 8). Considering these results, we decided to move forward with the calcium rich MSN (CaMSN) as divalent cations showed optimal loading conditions compared to mono and trivalent metallic ions, and Ca-MSN exhibited optimal stability as compared to Mg-MSN.

[0112] Fusion of Liposomes to MSN for LC-MSN Formation. The addition of liposomes to coat the CaMSN was hypothesized to enhance nanoparticle biocompatibility, improve nanoparticle stability within biologically relevant medias as well as provide a modifiable surface for subsequent functionalization for targeting within the aggressive LNCaP cell model of PC (Figure 3 A). Table 1 lists the liposomal formulations developed in this study.

[0113] Table 1. Compositions of liposomal formulations for MSN encapsulation

[0114] The colloidal stability of neutral and GRP78 encapsulated CaMSNs was confirmed by DLS measurements where the full LC-CaMSN construct, and its individual components remained in the 150-200 nm range with a low polydispersity indices (PDI<0.2) indicating homogeneous nanoparticles (Figure 3b). DLS zeta potential measurement results further indicated successful encapsulation of CaMSNs (Figure 3c). The addition of liposomes to coat the metallic enhanced MSN was also hypothesized to enhance the resistance of SiO-M-PO4(nucleotide) to other ionic species that can overlap with the nucleotide’s phosphate. For instance, incubating siRNA-CaMSN in PBS resulted in a brutal release of the nucleic acid (100% within 30 min) due to the replacement of siRNA’s phosphate groups by the free and labile phosphate from PBS or sulfates in the case of the endosomal mimicking solution, MES (Figure 3d). The lipid coating does not affect the loading of the nucleic acid meaning that lipid protection of the metallic entrapments occurs faster than their destabilization resulting from PBS. To confirm this, we tracked the release of fluorescently labeled siRNA or mRNA in PBS and an endosomal mimicking solution (MES) for 4 days. Significant release of siRNA was observed (up to 80%) within MES while release within PBS having a physiological pH was minimal (< 15%) (Figure 3e). DLS hydrodynamic size measurement results indicated that lipid encapsulation conferred superior stability properties of neutral LC-CaMSNs over bare CaMSNs for up to 4 days in PBS and complete cell media (Figure 9). LC-CaMSNs incubated in pure serum degraded over time agreeing with our previous work. (17) LC-CaMSNs incubated in MES exhibited instability, further supporting a pH triggered disruption and subsequent release of nucleic acids (Figure 9). Further confirmation of successful lipid coating of RNA loaded CaMSNs was enabled via cryogenic electron microscopy. The lipid coating appears as a distinct halo ring surrounding the dendritic MSN (Figure 10).

[0115] LC-CaMSN Interactions with LNCaP PC cell line and Human Red Blood Cells. The LC- CaMSNs were then introduced to the LNCaP cell line for in vitro analysis. The biocompatibility of the LC-MSN system was analyzed using the Cell Titer Gio® assay in which cell viability is characterized based on the presence of ATP, signaling metabolically active cells. After 48 hours of incubation with a LC-CaMSN having a neutral lipid coating, no significant reduction in cell viability was observed, indicating encapsulation with neutrally charged lipids may reduce cytotoxic effects of the bare MSNs (Figure 4c). To further assess the biocompatibility of the LC- CaMSN system within the bloodstream, the hemolytic activity of particles incubated with human red blood cells for 3 hours at 37 °C was tested. Bare MSNs caused significant hemolysis regardless of the concentration compared to bare CaMSNs which exhibited slightly less hemolysis likely due to incomplete covering of silanol groups with calcium (Figure 4a). CaMSNs coated with either neutral lipids or GRP78 lipids exhibited significantly less hemolytic activity (Figure 4a), further supporting the use of lipid coatings for enhancement of biocompatibility. Cellular uptake kinetics for non-targeted (Figure 12a) or targeted (Figure 4b) were evaluated by flow cytometry. Representative gating parameters used to determine the percentage uptake for flow cytometry experiments are given in Figure 12. In the case of non-targeted LC-CaMSNs, rapid uptake was observed for positively charged particles as compared to neutrally charged particles, most likely due to nonspecific electrostatic interactions with cellular membranes. GRP78 minibody targeted particles exhibited superior uptake kinetics, indicating the need for active targeting strategies in the LNCaP cell line to achieve rapid uptake in cancerous cells.

[0116] The majority of nanoparticle systems are internalized within cells via endocytotic pathways in which nanoparticles are trapped in vesicles (endosomes) which are trafficked to lysosomes for hydrolytic enzyme degradation. (36,37) The neutral lipid LC-CaMSN uptake by flow cytometry and confocal microscopy was investigated. Flow cytometry (Figure 4b) and confocal microscopy (Figure 4f) results showed full association and internalization within cells at 48h. In line with studies that confirmed the capacity of cells to readily uptake positively charged nanoparticles, the LC-CaMSN having positive liposomal encapsulations, namely POSITIVE and DOTAP47 with which internalization via endocytosis was previously demonstrated in HeLa and A549 cells, were evaluated. (17) Confocal microscopy data showed a significant amount of nanoparticles associated with LNCaP cells at 2 hours (Figure 13 and Figure 14). Deconvoluted 3D rendered images obtained from z-stack confocal imaging further demonstrated internalization of the POSTIVE or DOTAP47 LC-MSNs with or without calcium by 6 hours (Figure 15 and Figure 16). Additionally, POSITIVE or DOTAP47 LC-MSNs colocalized (yellow areas, Pearson correlation coefficient PCC = 0.5236) with the early endosomal marker Rab5 at 6 hours, supporting an internalization mechanism via endocytosis (Figure 4f). It was hypothesized that the addition of calcium to LC-MSNs would not only load RNAs but could also provide an endosomal escape release mechanism. Endosomal escape was assessed by tracking colocalization between Rab5 (early endosomes) and LC-MSNs or LC-CaMSNs via confocal microscopy. At 24 hours, deconvoluted confocal microscopy images revealed that LC-CaMSNs colocalized less with Rab5 as compared to LC-MSNs lacking calcium, supporting calcium’s role in endosomal escape (Figure 4f). To further support qualitative confocal imaging, colocalization was quantified by tracking Pearson correlation coefficients (PCC) between Rab5 and LC-MSNs or LC-CaMSNS as a function of incubation time with LNCaP cells. Results demonstrated LC-CaMSNs internalized via endocytosis escaped endosomes more quickly or completely as compared to LC-MSNs lacking calcium (Figure 17). Glucose Receptor Protein 78 KDa (GRP78) has been previously established as an overexpressed receptor on LNCaP cells and has been previously validated as a functional molecular moiety for targeted delivery systems in PC therapeutic applications. (38,39) It was hypothesized that LC-MSNs with or without calcium that are functionalized with a GRP78 minibody would enable quick association with LNCaP cells. Flow cytometry results confirmed almost complete uptake of GRP78 LC-CaMSNs within 30 minutes of incubation at 37 °C (Figure 4b). Additionally, GRP78 functionalized LC-MSN or LC-CaMSN systems lacked colocalization with Rab5 (Figure 4f, Figure 13 and Figure 14) suggesting an alternative internalization pathway. 3D rendered confocal images of LC-MSN or LC-CaMSNs following incubation with LNCaP cells confirmed internalization by 2 hours (Figure 15 and Figure 16). To confirm that GRP78 functionalization results in LC-MSN or LC-CaMSN binding to surface expressed GRP78 exclusively, LNCaP cell were pre-incubated with free GRP78 for 4 hours before incubating cells with LC-CaMSNs. Deconvoluted confocal microscopy results demonstrated a lack of LC- CaMSN association or internalization supporting that GRP78 functionalized LC-CaMSNs bind exclusively to surface expressed GRP78 (Figure 18).

[0117] Successful delivery of mRNA within the LNCaP cell line was first assessed via quantitative RT-PCR after cells were incubated with various LC-CaMSNs. The commercially available in vitro transfection agent Lipofectamine MessengerMax® was used as a positive control. Results indicated that as compared to the non-treated control, GRP78 targeted LC- CaMSNs significantly delivered more mRNA to cells and that the relative gene expression could be increased with increasing amount of NHS within the lipid formulation (Figure 4d). Subsequent protein expression was then assessed after mRNA delivery in LNCaP cells via expression of luciferase and subsequent bioluminescence as measured by plate reader. Similarly, to RT-PCR results, better bioluminescence expression was observed in cells incubated with targeted LC-CaMSN systems (Figure 4d). While Lipofectamine® outperformed the LC- CaMSNs as far as bioluminescence signal, cytotoxicity analysis in which volumes of LC- CaMSN and Lipofectamine® were matched revealed that Lipofectamine® was significantly more toxic than the LC-CaMSN carrier. (Figure 19). This indicates that Lipofectamine® would not be appropriate as a therapeutic delivery agent and should only serve as a control for experiments.

[0118] LC-MSN system vascular margination, circulation and stability within ex ovo chick chorioallantoic membrane model (CAM). The CAM can be classified as a bridge between in vitro and in vivo systems making it an ideal biological barrier platform for evaluating vascular margination, binding, circulation time and stability of the LC-MSN system. (40) Bare CaMSNs and LC-CaMSNs having varied liposomal coatings were injected into CAM vasculature and imaged after allowing 20 minutes of circulation (Figure 13). Bare MSNs were observed to aggregate and bind to vasculature walls (Figure 5) and remaining non-aggregated MSNs were observed to quickly be removed from circulation most likely via innate immune system opsonization. (41) LC-CaMSNs having a positive charge (POSITIVE) exhibited relatively longer circulation within CAM vasculature but were quickly bound to vasculature walls and red blood cells most likely due to electrostatic interactions between negatively charged membranes and the positively charged LC-CaMSN (Figure 5). Additionally, positively charged LC-CaMSNs ultimately exhibited aggregation. Finally, neutrally charged LC-CaMSNs with or without the GRP78 targeting ligand exhibited stable circulation, no vasculature binding, and no apparent reduction in circulation due to opsonization (Figure 5).

[0119] LC-CaMSN in vivo Tumor Retention. The retention of DyLight 633 labeled LC-CaMSNs was tested after subcutaneous (SC) injections within NSG mice engrafted with LNCaP tumors for up to 48 hours. Whole live animal IVIS imaging results for SC injected LC-CaMSNs indicated superior retention at the tumor site in the case of GRP78 LC-CaMSNs as compared to nontargeted N LC-CaMSNs (Figure 6a). After live animal imaging, mice were euthanized and necropsied to assess LC-CaMSN presence in organs and tumors. Enhanced tumor retention in the case of GRP78 targeted LC-CaMSNs as compared to non-targeted neutral LC-CaMSNs was confirmed via quantification of Dylight 633 LC-CaMSN signal in dissected organs and tumors (Figure 6b). IVIS images of necropsied organs upon which this quantification were carried out over are given in Figure 21.

[0120] Conclusions

[0121] In summary we have presented the development and characterization of a lipid coated mesoporous silica nanoparticle that is capable of loading either siRNA or mRNA via metal cation complexation. This is the first report of successful mRNA loading using metallic cation mediated entrapment. Colloidally stable constructs that exhibit pH triggered release for endosomal escape within LNCaP cells was demonstrated. Ex ovo results supported the biocompatibility of the system along with promising stability and circulation characteristics. The inclusion of calcium cations to the LC-MSN system provided an enhanced endosomal escape mechanism as seen by confocal microscopy. The tailorable and biocompatible nature of the LC-CaMSN along with high loading efficiencies for siRNA and mRNA allowed for the addition of tumor retention ligands as shown in the intratumoral retention of the GRP78 LC-CaMSN.

[0122] Bibliography

[0123] (1) Gandhi, J.; Afridi, A. The Molecular Biology of Prostate Cancer: Current Understanding and Clinical Implications. Prostate Cancer and Prostatic Dis. 2018, 21 (1), 22.

[0124] (2) Viswanathan, S. R. et al. Structural Alterations Driving Castration-Resistant Prostate Cancer Revealed by Linked-Read Genome Sequencing. Cell 2018, 174 (2), 433-447.

[0125] (3) Varambally, S. et al. Integrative Genomic and Proteomic Analysis of Prostate Cancer Reveals Signatures of Metastatic Progression. Cancer Cell 2005, 8 (5), 393-406.

[0126] (4) Monteith, G. R. Prostate Cancer Cells Alter the Nature of Their Calcium Influx to Promote Growth and Acquire Apoptotic Resistance. Cancer Cell 2014, 26 (1), 1-2.

[0127] (5) Knudsen, K. E.; Penning, T. M. Partners in Crime: Deregulation of AR Activity and Androgen Synthesis in Prostate Cancer. Trends Endocrinol. Metab. 2010, 21 (5), 315-324.

[0128] (6) Takeda, D. Y. et al. A Somatically Acquired Enhancer of the Androgen Receptor Is a Noncoding Driver in Advanced Prostate Cancer. Cell 2018, 174 (2), 422-432.

[0129] (7) Klezovitch, O et al. Hepsin Promotes Prostate Cancer Progression and Metastasis. Cancer Cell 2004, 6 (2), 185-195.

[0130] (8) Kara, G.; Calin, G. A.; Ozpolat, B. RNAi-Based Therapeutics and Tumor Targeted Delivery in Cancer. Adv. Drug Deliv. Rev. 2022, 182,114113.

[0131] (9) Shugang Qin et al. mRNA-Based Therapeutics: Powerful and Versatile Tools to Combat Diseases. Signal Transduct. Target Ther. 2022, 7 (1), 1-35.

[0132] (10) Zhou, Z et al. Nonviral Cancer Gene Therapy: Delivery Cascade and Vector Nanoproperty Integration. Adv. Drug Deliv. Rev. 2017, 115, 115-154.

[0133] (11) Samaridou, E.; Heyes, J.; Lutwyche, P. Lipid Nanoparticles for Nucleic Acid Delivery: Current Perspectives. Adv. Drug Deliv. Rev. 2020, 154-155, 37-63.

[0134] (12) Akinc, A. et al. The Onpattro Story and the Clinical Translation of Nanomedicines Containing Nucleic Acid-Based Drugs. Nat. Nanotechnol. 2019, 14 (12), 1084-1087.

[0135] (13) Hou, X.; Zaks, T.; Langer, R.; Dong, Y. Lipid Nanoparticles for mRNA Delivery. Nat. Rev. Mater. 2021, 6, 1078-1094.

[0136] (14) Tenchov, R.; Bird, R.; Curtze, A. E.; Zhou, Q. Lipid Nanoparticles-From Liposomes to mRNA Vaccine Delivery, a Landscape of Research Diversity and Advancement. ACS Nano 2021, 15 (11), 16982-17015.

[0137] (15) Kulkarni, J. A. et al. Lipid Nanoparticle Technology for Clinical Translation of siRNA Therapeutics. Acc. Chem. Res. 2019, 52 (9), 2435-2444.

[0138] (16) Allen, T. M.; Cullis, P. R. Liposomal Drug Delivery Systems: From Concept to Clinical Applications. Adv. Drug Deliv. Rev. 2013, 65 (1), 36-48.

[0139] (17) Noureddine, A. et al. Engineering of Monosized Lipid-Coated Mesoporous Silica Nanoparticles for CRISPR Delivery. Acta Biomater. 2020, 114, 358-368.

[0140] (18) Croissant, J. G.; Fatieiev, Y.; Almalik, A.; Khashab, N. M. Mesoporous Silica and Organosilica Nanoparticles: Physical Chemistry, Biosafety, Delivery Strategies, and Biomedical Applications. Adv. Healthc. Mater. 2018, 7 (4), 1700831.

[0141] (19) Yang, Y.; Zhang, M.; Song, H.; Yu, C. Silica-Based Nanoparticles for Biomedical Applications: From Nanocarriers to Biomodulators. Acc. Chem. Res. 2020, 53 (8), 1545— 1556.

[0142] (20) Lei, Q. et al. Sol-Gel-Based Advanced Porous Silica Materials for Biomedical Applications. Adv. Funct. Mater. 2020, 30 (41), 1909539.

[0143] (21) Noureddine, A et al. Future of Mesoporous Silica Nanoparticles in Nanomedicine: Protocol for Reproducible Synthesis, Characterization, Lipid Coating, and Loading of Therapeutics (Chemotherapeutic, Proteins, siRNA and mRNA). ACS Nano 2023, 17 (17), 16308-16325.

[0144] (22) LaBauve, A. E. et al. Lipid-Coated Mesoporous Silica Nanoparticles for Anti-Viral Applications via Delivery of CRISPR-Cas9 Ribonucleoproteins. Sci. Rep. 2023, 13 (1), 1-13.

[0145] (23) Butler, K. S. et al. Protocells: Modular Mesoporous Silica Nanoparticle-Supported Lipid Bilayers for Drug Delivery. Small. 2016, 12, 2173-2185.

[0146] (24) Natarajan, S.; Selvaraj, S. Mesoporous Silica Nanoparticles: Importance of Surface Modifications and Its Role in Drug Delivery. RSC Adv. 2014, 4, 14328-14334.

[0147] (25) Na, H. K et al. Efficient Functional Delivery of siRNA Using Mesoporous Silica Nanoparticles with Ultralarge Pores. Small. 2012, 8, 1752-1761.

[0148] (26) Xia, T et al. Polyethyleneimine Coating Enhances the Cellular Uptake of Mesoporous Silica Nanoparticles and Allows Safe Delivery of siRNA and DNA Constructs. ACS Nano 2009, 3 (10), 3273-3286.

[0149] (27) Li, X et al. A Mesoporous Silica Nanoparticle - PEI - Fusogenic Peptide System for siRNA Delivery in Cancer Therapy. Biomaterials 2013, 34 (4), 1391-1401.

[0150] (28) Tsai, P.-H et al. Dual Delivery of HNF4a and Cisplatin by Mesoporous Silica Nanoparticles Inhibits Cancer Pluripotency and Turn origeni city in Hepatoma-Derived CD 133- Expressing Stem Cells. ACS Appl. Mater. Interfaces 2019, 11 (22), 19808-19818.

[0151] (29) Wu, M et al. Photoresponsive Nanovehicle for Two Independent Wavelength Light- Triggered Sequential Release of P-Gp shRNA and Doxorubicin to Optimize and Enhance Synergistic Therapy of Multi drug-Resistant Cancer. ACS Appl. Mater. Interfaces 2018, 10 (23), 19416-19427.

[0152] (30) Yin, P. T et al. Overcoming Chemoresistance in Cancer via Combined MicroRNA Therapeutics with Anticancer Drugs Using Multifunctional Magnetic Core-Shell Nanoparticles. ACS Appl. Mater. Interfaces 2018, 10 (32), 26954-26963.

[0153] (31) Zhang, Y.; Sun, C.; Wang, C.; Jankovic, K. E.; Dong, Y. Lipids and Lipid Derivatives for RNA Delivery. Chem. Rev. 2021, 121 (20), 12181-12277.

[0154] (32) Kang, J et al. Self-Sealing Porous Silicon-Calcium Silicate Core-Shell Nanoparticles for Targeted siRNA Delivery to the Injured Brain. Adv. Mater. 2016, 36, 7962.

[0155] (33) Faustini, M et al. “Integrative Sol-Gel Chemistry”: A Nanofoundry for Materials Science. J. Solgel Sci. Technol. 2014, 70, 216-226.

[0156] (34) Durfee, P. N et al. Mesoporous Silica Nanoparticle-Supported Lipid Bilayers (Protocells) for Active Targeting and Delivery to Individual Leukemia Cells. ACS Nano 2016, 10 (9), 8325-8345.

[0157] (35) Noureddine, A et al. Engineering of Large-Pore Lipid-Coated Mesoporous Silica Nanoparticles for Dual Cargo Delivery to Cancer Cells. Journal of Sol-Gel Science and Technology 2019, 1, 78.

[0158] (36) Mosquera, J.; Garcia, I.; Liz-Marzan, L. M. Cellular Uptake of Nanoparticles versus Small Molecules: A Matter of Size. Acc. Chem. Res. 2018, 51 (9), 2305-2313.

[0159] (37) Mindell, J. A. Lysosomal Acidification Mechanisms. Annu. Rev. Physiol. 2012, 74, 69- 86.

[0160] (38) Mintz, P. J et al. Fingerprinting the Circulating Repertoire of Antibodies from Cancer Patients. Nat. Biotechnol. 2003, 21 (1), 57.

[0161] (39) Arap, M. A et al. Cell Surface Expression of the Stress Response Chaperone GRP78 Enables Tumor Targeting by Circulating Ligands. Cancer Cell 2004, 6 (3), 275-284.

[0162] (40) Butler, K. S et al. Bridging the In Vitro to In Vivo Gap: Using the Chick Embryo Model to Accelerate Nanoparticle Validation and Qualification for In Vivo Studies. ACS Nano 2022, 16 (12), 19626-19650.

[0163] (41) Paul Garcia et al. The Chicken Embryo Model: A Novel and Relevant Model for Immune-Based Studies. Front. Immunol. 2021, 12, 791081.

[0164] All publications, patents and patent applications are incorporated herein by reference. While in the foregoing specification, this invention has been described in relation to certain preferred embodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details herein may be varied considerably without departing from the basic principles of the invention.

Claims

WHAT IS CLAIMED IS:

1. A composition comprising a mesoporous silica nanoparticle (MSN) loaded with metal cations and at least one oligonucleotide sequence.

2. The composition of claim 1, wherein the at least one oligonucleotide sequence is DNA, RNA or a combination thereof.

3. The composition of claim 2, wherein the RNA is mRNA, siRNA, small hairpin mRNA, guide RNA, or microRNA.

4. The composition of claim 1, wherein the at least one oligonucleotide sequence releases from the MSN in a biological environment.

5. The composition of claim 1, wherein the metal cation is a monovalent cation, divalent cation, trivalent metal cation or a combination thereof.

6. The composition of claim 1, wherein the metal cation is Mg2+, Ca2+, Fe3+, Al3+or combination thereof.

7. The composition of claim 1, wherein the metal cation is a divalent metal cation.

8. The composition of claim 1, wherein the metal cation is Ca2+.

9. The composition of claim 1, wherein the MSN has pores ranging from 2 to 12 nm.

10. The composition of claim 1, wherein the mesoporous silica nanoparticle (MSN) loaded with metal cations and oligonucleotides is coated with lipid (LC-MSN).

11. The composition of claim 10, wherein the lipid is a lipid bilayer.

12. The composition of claim 11, wherein the LC-MSN has an average diameter of between about 1 nm to about 50 nm, between about 1 nm to about 30 nm, between about 5 nm to about 25 nm, between about 10 nm to about 25 nm, or between about 10 to about 20 nm.

13. The composition of claim 10, wherein the lipid includes a targeting peptide.

14. The composition of claim 13, wherein the targeting peptide is GRP78, NKG2D ligands (such as NKG2d and NKG2D-L), folic acid, RGD, transferring (Tf), an anti-HER2 antibody or a combination thereof.

15. The composition of claim 1, wherein the at least one oligonucleotide sequence is a gene and / or codes for at least one protein.

16. The composition of claim 1, wherein the at least one oligonucleotide sequence is part of a plasmid, expression vector or other gene therapy vector.

17. A pharmaceutical composition comprising a composition of any one of claims 1 to 16 in combination with a pharmaceutically acceptable carrier, additive and / or excipient.

18. A method comprising administering the composition of claim 17 to subject.

19. The method of claim 18, wherein the subject is human.

20. The method of claim 18, wherein the subject has a known genetic mutation.

Images